understanding the molecular basis of cotton leaf curl...
TRANSCRIPT
Rahim Ullah
2015
Department of Biotechnology Pakistan Institute of Engineering and Applied Sciences
Nilore, Islamabad, Pakistan
Understanding the Molecular Basis of Cotton Leaf Curl Disease Resistance in
Cotton Germplasm
Abstract
The production and processing of cotton is a major source of foreign exchange for the
economy of Pakistan. The majority of cotton fiber produced in the region comes from
the tetraploid Gossypium hirsutum, although some is still produced from the cotton
species native to the region, the diploid G. arboreum. Since the early 1990s, cotton
production in Pakistan and northwestern India has been adversely affected by cotton
leaf curl disease (CLCuD). The disease is caused by single-stranded DNA viruses of
the genus Begomovirus (family Geminiviridae) in association with a specific satellite,
Cotton leaf curl Multan betasatellite (CLCuMuB). At this time only a single virus,
Cotton leaf curl Burewala virus (CLCuBuV), is associated with CLCuD across most
of Pakistan. This virus is resistance breaking, overcoming resistance to the previous
begomoviruses/satellite complex that was introduced into cotton by conventional
breeding.
At this time there are no commercially available G. hirsutum lines that are
resistant to CLCuBuV/CLCuMuB. However, all lines of G. arboreum are “immune”
to CLCuD and plant breeders have long been trying to introduce the “resistance” from
this species into the more desirable G. hirsutum lines. In addition, recently two lines
of G. hirsutum originating from France (cvs. Dominique and Haiti) have shown
promise in field screening for resistance against CLCuD.
The study described here was designed to investigate the nature of the
resistance of G. arboreum cv. Ravi and the French G. hirsutum cultivars, Dominique
and Haiti, using whitefly-mediated and graft inoculation of the CLCuD virus
complex. Additionally the possibility of using biolistic inoculation of viral DNA was
investigated as a possible means of experimentally introducing the virus complex
causing CLCuD into cotton.
In large scale field screening of G. arboreum cv. Ravi over a period of two
years, no symptoms of virus infection were detected under inoculation pressure
conditions where 79-89% of the susceptible control (G. hirsutum cv. CIM 496) plants
were symptomatic. Rolling circle amplification/polymerase chain reaction
xiii
(RCA/PCR) diagnostics, the most sensitive diagnostic method available to detect
geminiviruses in plants, did not detect either CLCuBuV or CLCuMuB in field grown
G. arboreum cv. Ravi plants; consistent with the idea that G. arboreum is immune to
the virus complex. However, graft inoculation with scions from CLCuD affected G.
hirsutum showed firstly that the virus complex can move systemically in the plant and
that G. arboreum can respond to virus infections by the production of symptoms.
Surprisingly, in a few cases, the disappearance of established symptoms was seen
following removal of the graft. In all graft inoculated Ravi plants, after removal of the
graft, newly emerging tissues were non-symptomatic and no virus could be detected.
These results show that, rather than being immune, G. arboreum is highly resistant to
the CLCuD complex and has a high virus/satellite threshold for the induction of
symptoms, which whitefly inoculation likely is not able to achieve. The low virus
levels detected in G. arboreum suggest that possibly the resistance targets
virus/satellite replication and, without a continual source (such as from a graft), the
virus/satellite complex is rapidly lost.
In small-scale, glasshouse-based insect transmission studies, plants of G.
hirsutum cvs. Dominique and Haiti remained symptomless under conditions where all
G. hirsutum cv. CIM 496 plants became infected. Graft inoculation showed the
Dominique and Haiti plants to be susceptible but showing only mild symptoms,
slightly higher than in grafted G. arboreum cv. Ravi plants. The virus/satellite levels
in such plants were lower than in the susceptible control but higher than detected in G.
arboreum cv. Ravi. Upon removal of the graft, newly developing leaves did not show
symptoms and no virus/satellite could be detected. The response to infection seen in
G. hirsutum cvs. Dominique and Haiti very much mirrors what was seen for G.
arboreum cv. Ravi. Recovery from infection has, for other viruses, been shown to be
an RNA interference phenomenon and the results are discussed in light of this
possibility.
G. hirsutum cvs. Dominique, Haiti, Coker and S-12, as well as G. arboreum
cv. Ravi plants were biolistically inoculated with cloned CLCuBuV/CLCuMuB,
Cotton leaf curl Kokhran virus (CLCuKoV; a begomovirus prevalent in cotton in
Pakistan in the 1990s)/CLCuMuB and with RCA products from field- infected G.
hirsutum cv. CIM 496 plants shown to be infected with CLCuBuV/CLCuMuB. Only
a small number of Coker and S-12 plants, inoculated with cloned
xiv
CLCuKoV/CLCuMuB, became infected and showed the typical symptoms of
CLCuD.
Overall the findings indicate that G. hirsutum cvs. Dominique and Haiti harbor
a useful resistance to the virus(es) causing CLCuD which should be used for
introgression into elite cotton varieties. The results obtained with G. arboreum cv.
Ravi indicate that, rather than being a non-host, this harbors extreme resistance to the
viruses causing CLCuD and further efforts should be made to characterize the
molecular basis for the resistance. Finally the biolistic studies indicate that this can
potentially be a useful method for experimentally introducing
begomoviruses/satellites into which should be investigated further.
xv
CHAPTER 1 Introduction and Review of
Literature
1 Introduction and Review of Literature
Archaeologists for the first time, 7,000 years ago, searched out cotton in the caves of
Mexico very similar to the present day cotton. Some 5,000 years ago at Moenjodaro
people in Pakistan and the Egyptian were making and wearing cotton clothes. About
800 AD traders from Arab introduced cotton cloth to Europe. With the discovery of
America in 1492, Columbus found cotton growing in Bahamas. The first machine
spinning of cotton was made in England in 1730 with the invention of cotton gin by
Eli Whitney.
Gossypium hirsutum, the highly domesticated Upland cotton, was introduced
to India in two phases in 1818 and 1840, respectively through the East Indian
Company. With the inception of the Agriculture Department in 1905, Mr. Milne,
started working on cotton improvement, released the first improved and approved
variety of G. hirsutum, 4F, for cultivation in Punjab in 1914. The Punjab Government
in 1925 conjointly with Indian Central Cotton Committee started the Punjab Botanical
Research Scheme. Cotton varieties with improved produce, such as 24F, 289F, 199F,
238F, 289/43F and LSS were successfully introduced for cultivation.
The genus Gossypium is classified into 50 species including 45 diploids and 5
tetraploids [1, 2]. However, agronomically important species in the genus Gossypium
is represented by four vital species entitled G. hirsutum, G. barbadense, G. arboreum
and G. herbaceum [3] with a common origin of approximately 5-15 million years old.
1.1 Viruses Virus, word with Latin origin, meaning poison, slimy liquid or stench, is defined as an
intracellular obligate parasite with RNA or DNA genome enclosed in the virus
encoded protective protein coat. The geneticist, Hermann Muller in 1922, proposed a
hypothesis declaring viruses as potential genes. The idea was later recommenced in
1923 by Joanne Karrer Armstrong and Benjamin Duggar, who reflected Tobacco
mosaic virus (TMV) as a biocolloidal reproducible protein just like the genes seemed
to be. The idea, even if rejected by the virologists, was predicted by some decades as
1
1 Introduction and Review of Literature
the functional nature of viruses and signified the first conceptual reply to the virus
paradox. According to Luria et al. [4] viruses are small entities with genomes
comprising of elements of nucleic acid that require the synthetic cellular machinery of
the host for their replication resulting in the synthesis of particular elements
obligatory for the transmission of viral genome to new cells. Every single cellular
form of life studied so far is either having the viruses on its own or, if not, at least,
genetic elements with a close resemblance to viruses [5]. Viruses, particularly
bacteriophages, based on the recent environmental studies, are the most abundant
biological units on this planet [6]. Because of their lively and vigorous movement
between biomes, viruses are believed to be crucial agents of evolution due to their
capability to function as a mean of horizontal gene transfer [7]. Human beings are
under the threat of more than a 1000 different viruses [8].
1.2 Plant Viruses Plant viruses, similar to other viruses, are obligate intracellular parasites using the
host cellular machinery for their replication. Plant viruses, amongst the most
dangerous and taxing, are causing alarming threats to the crops of high economic
value in the form of different types of diseases [9, 10]. Martinus Beijerinck, in 1898,
squeezed out sap from the leaves of tobacco infected with mosaic disease and
determined that the sap remains infectious even after passing through porcelain filter
[11] in contrast to bacteria which were retained on the porcelain filter. This
contagious filtrate was named as a "contagium vivum fluidum", from which the
current term "virus" was coined. This work resulted in the discovery of the first ever
plant virus, TMV, attributed to Martinus Beijerinck. The first rational system of plant
virus classification was presented by James Johnson [12], who also revealed that
plants can be infected by a number of distinct viruses. Smith [13] published the first
ever textbook of plant virology in 1937. Wendell Stanley [14], the “Nobel Prize”
winner for his contribution in the field of virology, was the first one to carry out the
crystallization (purification) of TMV in 1935, though he was unable to find out that
RNA is an encapsidated nucleic acid. Based on the present classification viruses are
placed into 6 orders, 94 families, 22 subfamilies, 395 genera, and ~2500 species of
which the plant viruses are represented by 20 families, 90 genera and ~800 species
[15]. More than 90% of the plant viruses are RNA viruses with single-stranded (ss)
RNA genomes while less than 10% of the plant viruses are DNA viruses. DNA
2
1 Introduction and Review of Literature
viruses with circular double-stranded DNA (dsDNA) or circular ssDNA genomes are
further grouped into two Caulimoviridae, comprised of caulimoviruses and
badnaviruses with dsDNA genome which replicate through RNA intermediates by
reverse transcription, represents the first group whereas the families Nanoviridae
(nanoviruses) and Geminiviridae (geminiviruses), comprised of ssDNA viruses using
dsDNA intermediates for replication through the rolling circle mechanism, represent
the second group [16, 17].
1.3 Geminiviruses Description of disease caused by geminiviruses might have been recognised anciently
in the classical anthology of Japanese poetry, Man’syoshu, as yellow vein disease of
Eupatorium plants, as early as 752 AD [18]. With the passage of time, almost 23
years later, it was confirmed that yellow vein disease in Eupatorium was caused by
geminivirus/betasatellite [19]. The name ‘‘geminivirus’’, from Gemini, symbol of
zodiac signified for twins [20], was assigned to these viruses possessing the
distinctive geminate (twinned) morphology (Figure 1.1), with genomes represented by
one or two circular ssDNA components of 2.5–3.1 Kb [21]. The availability of vector
free inoculation techniques, easy tackling through molecular procedures and
manageable small sizes of their genomes present them to be the best studied plant
viruses so far [22]. Geminiviruses were upgraded to the family Geminivirdae in1995
[23] including the widely distributed plant viruses infecting both monocots, such as
wheat and maize, and dicots, such as tomato and cotton [24]. Geminiviruses evolves
continuously extending their circle of infection and have been recently reported in
some new weeds [25-29]. The economically important crops not only in most of the
tropical and subtropical regions but very recently in some of the temperate regions
also, are severely hampered by these viruses owing to the changes in the
environmental conditions and most importantly due to human trade, spreading the
infectious materials and insect vectors [30, 31].
3
1 Introduction and Review of Literature
Figure 1-1 Three-dimensional cryoelectron microscopy image reconstruction of a geminate particle (reproduced from [32]).
1.4 Classification of Geminiviruses Based on genome organization, host range and the insect vectors, the family
Geminiviridae has been categorised into four genera, named Curtovirus, Mastrevirus,
Begomovirus and Topocuvirus [33]. However recently three more genera, namely
Becurtovirus, Turncurtovirus and Eragrovirus, have been proposed [15, 34,
35].About 300 species of geminiviruses are officially recognized of which ~ 200
belongs to largest genus Begomovirus and more than 800 completely sequenced
genomes have been submitted to the database [35], showing how much diverse and
economically important this family is.
1.4.1 Mastrevirus
The leafhopper-transmitted monopartite mastreviruses, exclusively confined to the
Old World (OW), infect monocotyledonous or dicotyledonous plants [36-39]. Wheat
dwarf virus (WDV) and Maize streak virus (MSV) are the two thoroughly
investigated members of monocot- infecting while Tobacco yellow dwarf virus
(TbYDV) is an important dicot- infecting mastrevirus. The unique features of ~ 2.6-
2.8Kb viruses from this genus is the presence of non-coding large and short intergenic
regions (LIR; large intergenic region and SIR; small intergenic region) separating the
virion-sense (V-sense) and complementary-sense (C-sense) open reading frames
4
1 Introduction and Review of Literature
(ORF), comprehend the regulatory components (Figure 1.2), and two ‘‘replication
associated proteins’’ (Rep). Mastreviruses encode four conserved proteins [40]. The
two proteins associated with the replication of these viruses, Rep and Rep A, needed
early in the establishment of a successful viral infections are encoded from the C-
sense transcripts. The spliced mRNA of Rep and Rep A genes produces the full length
Rep while Rep A protein is encoded from Rep A gene. The other two proteins,
required for the encapsidation and movement of these viruses within and between the
host cells (coat protein [CP] and movement protein [MP]), are deciphered from the V-
sense transcripts.
Figure 1-2 Genome organizations of mastreviruses and leafhopper vector of Maize streak virus (MSV), Cicadulina mbila. The position and orientation of genes are
indicated by specific arrows. The genes encoded in the V-sense are coat protein (CP) and the movement protein (MP) genes. The C-sense encodes the replication-
associated protein (Rep) which is translated from a spliced mRNA product of the Rep and Rep A genes. The position of the intron is indicated. The unspliced messenger RNA translates to Rep A protein. The intergenic regions (non-coding region), the
large intergenic region (LIR), including a predicted hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of the loop, and small
intergenic region (SIR), are indicated.
The bidirectional expression of C-sense and V-sense genes is controlled by the
promoter elements present in the LIR which in addition have plant nuclear factors
binding sites mandatory for expression and DNA replication. The LIR in addition also
5
1 Introduction and Review of Literature
possesses the Rep binding sites (iterons) and an expected stem loop structure acting as
the origin of virion-strand DNA replication [41].
1.4.2 Curtovirus
The dicot- infecting curtoviruses, monopartite with circular ssDNA genomes of ~ 3.0
kb, uses leafhoppers for their transmissions to host plants [42]. A recently included
species Spinach severe curly top virus (SSCTV), in addition to the first described and
most important member Beet curly top virus (BCTV), is one of the key members of
genus Curtovirus. The transcription of the seven open reading frames (ORFs) of these
viruses is under the control of a single bidirectional promoter positioned in the IR
region (~ 450nt) which also possesses the origin of (V)-strand DNA replication
(Figure 1.3; [43-47]). V1, V2 and V3 genes are transcribed from the V-sense strand
encoding coat protein (CP), ss/dsDNA regulators (V2) and the putative movement
protein (V3; [21, 46]) while the most divergent C1, C2, C3 and C4 genes are
transcribed from the C-sense strand encoding replication associated protein (Rep),
protein involved in the recovery of phenotype, homolog of begomovirus-encoded
transcriptional-activator protein (C2), replication enhancer protein (REn) and a
protein involved in the development of symptom (C4), respectively [48-51]. The IR is
highly divergent among different species of curtoviruses possessing species-specific
cis-acting elements (iterons) playing a major role in replication and control of gene
expression, however, inadequate to regulate the expression of its own Rep protein
[42].
1.4.3 Topocuvirus
Topocovirus, the most recently documented genus of Geminiviridae family, is
represented by the only dicot- infecting specie of Tomato pseudo-curly top virus
(TPCTV) isolated from Florida [52]. This monopartite virus uses Micrutalis
malleiffera (treehopper) for transmission to the host plants and is prevalent, as much
is known till now, to the New World (NW). Encoding a total of six, four (Rep, C2, C3
and C4) are encoded from the C-sense and two from the V-sense (Figure 1.4). TPCTV
genes, although not investigated, are considered to have similar functions based on
their homology to other dicot- infecting viruses. Based on the genomic analysis
TPCTV is considered as a natural recombinant of mastreviruses and begomoviruses
[52] that can trans-complement the DNA-A components of
6
1 Introduction and Review of Literature
Figure 1-3 Leafhopper vector, Circulifer tenellus, and typical genome arrangements of curtoviruses. Position and orientation of genes are indicated by specific arrows.The
genes, encoding the coat protein (CP), a ss/dsDNA regulator (V2) and putative movement protein (V3), are present in the V-sense strand. The replication-associated
protein (Rep), a homolog of the begomovirus-encoded transcriptional-activator protein (C2), a replication enhancer protein (REn) and a protein involved in symptom expansion (C4) are encoded in the C-sense. The intergenic region contains a putative hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of
the loop.
African cassava mosaic virus (ACMV) and Tomato golden mosaic virus (TGMV)
regarding their movement when their cognate DNA-B components are absent [53].
1.4.4 Becurtovirus, Turncurtovirus and Eragrovirus
Becurtovirus, a very recently added genus to the family of Geminiviridae is
transmitted by leafhopper [54, 55]. The symptoms induced in plants by Beet curly top
Iran virus (BCTIV), first ascribed becurtovirus from Iran, and by BCTV, a curtovirus,
are very similar [56-58]. Spinach curly top Arizona virus (SCTAV), a recently added
second species to the genus Becurtovirus, has been ascribed from United States [59].
Transmission of BCTIV from plants-to-plants is vectored by Circulifer hematoceps
[56, 60]. Circulifer tenellus, found in the NW, vectoring curtoviruses, is thought to be
the possible vector of SCTAV. Regarding the genome organization both members are
found to encode three genes in the V-sense, V1 (CP), V2 (MP) and V3, and two in the
C-sense, C1 (Rep) and C2 (Figure 1.5; on the right), owning a unique nonanucleotide
sequence (TAAGATTCC; [59]). Genes products encoded in the V-sense are similar to
7
1 Introduction and Review of Literature
Figure 1-4 Treehopper, Micrutalis malleifera, and genome organization of Tomato pseudo-curly top virus encoding four genes (Rep, C2, C3 and C4) on C-sense strand and two genes (CP, V2) on V-sense strand. The position and orientation of genes are
indicated by specific arrows. The intergenic region contains the putative hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of the loop.
the corresponding genes products of curtoviruses while the genes products encoded in
C-sense are comparable to the corresponding genes products of mastreviruses. Two
intergenic regions, in common with mastreviruses, have been found in the genome of
becurtoviruses; named LIR and SIR. The unique nonanucleotide sequence
(TAAGATTCC) is found in the hairpin- loop structure of LIR. Splicing, apparently an
expected feature with a possible involvement in the expression of the C-sense genes
of becurtoviruses, has not yet being evident [59].
The leafhopper transmitted (Circulifer haematoceps) genus, Turncurtovirus, is
another recent addition to the family of Geminiviridae [34]. Turncurtovirus is
represented by the sole species of Turnip curly top virus (TCTV) first ascribed in
Fars, a province in Iran [61]. The virus is hosted by a number of weeds, sugarbeet,
cowpea and turnip [62]. Genome of TCTV is represented by four overlapping genes
in the C-sense, comparable to curtoviruses encoding Rep, C2, REn and C4 proteins,
and two genes in the V-sense strand encoding CP and V2 proteins (Figure 1.5; on the
left), dissimilar to the ones in curtoviruses. The V2 protein of TCTV, except the CP
protein slightly identical to the CPs of curtoviruses, does not share a slight bit of
sequence identity to any such V2s in the databases [61].
8
1 Introduction and Review of Literature
The genus Eragrovirus, represented by the sole species of Eragrostis curvula
streak virus (ECSV) is another new entry to the family of Geminiviridae [34]. The
insect vector for the plant-to-plant transmission of ECSV, quarantined for the first
time in South Africa from a monocotyledonous weed [63], has not yet been known.
Four genes, CP, V2, Rep and C2, have been identified in the genome of ECSV
arranged in a similar way to that of mastreviruses (Figure 1.5; down). The V-sense
genes of ECSV, CP and V2, are closely related to similar genes in mastreviruses.
However the products of genes encoded in the C-sense are closely related to the Rep
and C2 proteins of curto-, topocu- and begomoviruses [61]. Two IRs, with the smaller
one having becurtoviruses like nonanucleotide-containing stem-loop structure [63],
unlike mastreviruses, named IR-1 (smaller one) and IR-2 (larger one), have also been
identified in the genome of ECSV.
1.4.5 Begomovirus
Begomovirus is the largest dicot-infecting genus of family Geminiviridae in both OW
and NW with more than 230 documented species so far [35]. Begomoviruses are
spreading continuously, expanding their host range and causing threats to the
production of crops. They were held responsible for the massive economic
impairment to the economically important crops such as bean, cassava, squash,
tomatoes and cotton [64-66].
Begomoviruses, highly recalcitrant to mechanical transmission, are
transmitted exclusively by the whitefly (Bemisia tabaci), with single or two circular
ssDNA genomes. Based on phylogenetic studies begomoviruses are grouped in OW,
instigated from Asia, Australia, Africa and Europe, and NW viruses, originated from
South America [67-69]. Bipartite begomoviruses require both DNA-A and DNA-B
components to induce a symptomatic infection in the host plants [31, 70]. The single
genomic component of a monopartite begomovirus is homologous to the DNA-A
component of the bipartite begomovirus. Most of the monopartite begomoviruses are
often linked with symptoms modulating and trans-replicating circular ssDNA
satellites recognized as betasatellites and self- replicating satellites- like particles
identified as alphasatellites [71-73]. The OW is heavily dominated by the satellite-
associated begomoviruses overtaking both the bipartite and truly monopartite
begomoviruses. The symptoms associated with begomovirus infected plants are
9
1 Introduction and Review of Literature
Figure 1-5 Genome organizations of Becurtovirus (on the right), Turncurtovirus (on the top left) and Eragrovirus (bottom). The position and orientation of genes in each
of the virus are indicated by specific arrows. Becurtovirus encode three genes; V1 (CP), V2 (MP) and V3, in the V-sense and two genes; C1 (Rep) and C2, on the C-
sense. The intergenic regions (non-coding region), the large intergenic region (LIR), including a predicted hairpin structure with a unique nonanucleotide sequence
(TAAGATTCC) forming part of the loop, and small intergenic region (SIR), are also indicated. Turncurtovirus encodes four genes; Rep, C2, REn and C4, on the C-sense and two genes; CP and V2, on the V-sense strand. Eragrovirus encodes two genes; CP and V2, in the V-sense strand and two; Rep and C2, in the C-sense strand. The intergenic regions (non-coding region), the small intergenic region (IR-1), with a
unique nonanucleotide sequence (TAAGATTCC) forming part of the loop and large intergenic region (IR-2) are also indicated.
10
1 Introduction and Review of Literature
characterised by upward and downward leaf rolling, enations on the underside of the
leaves, stunting of plants following sever infestations and a significantly low yield
[71-74].
Bipartite Begomoviruses
The Bipartite begomoviruses, native to the NW, are represented by two genomic
components (DNA-A and DNA-B) of ~ 2.6-3.1Kb each. Almost all of the bipartite
begomoviruses are confined to the NW except Corchorus yellow vein virus (CoYVV)
and Corchorus golden mosaic virus (CoGMV), originated from the OW (Vietnam),
possessing attributes of the NW begomoviruses with a suggestion that they might be
the preceding leftovers of diverse descents of OW begomoviruses introduced to the
NW [75, 76]. There is not significant sequence similarity between the DNA-A and
DNA-B components except for a sequence of ~ 200nt, called the common region
(CR), almost identical in both of the components [61]. CR is the most significant
portion comprising the origin of V-strand DNA replication, iterons (sequences needed
for replication) and bidirectional promoter needed for the transcription of genes in
both components of begomovirus-complex [77, 78].
The DNA-A component of bipartite virus like the monopartite genome
encodes six genes. Two of these genes are transcribed from the V-sense strand
encoding the CP and AV2 protein, and four from the C-sense strand; encoding Rep,
transcriptional-activator protein (TrAP), replication enhancer protein (REn) and the
AC4 protein (Fig 1.6, on the right). The movement of virus within and between the
host plants is mediated by CP [79, 80], while the AV2 protein, in addition to be
involved in the movement of virus in plants, also play a key role to overcome host
plant defences activated by dsRNA (a phenomenon called post-transcriptional gene
silencing [PTGS]) in some of the species [81, 82]. Unlike all of the monopartite
begomoviruses from the OW, the DNA-A components in most of the NW bipartite
begomoviruses lack the AV2 gene suggesting their probable evolution from a single
parent [76].
The genes on the C-sense strand, called the early genes, encodes Rep, the only
virus encoded gene essential for the replication of virus, hamper host cell cycle and
initiate rolling-circle replication, TrAP, holds the key to up-regulate the V-sense (in
some cases), so called late genes, alongside host encoded genes and overpowers
11
1 Introduction and Review of Literature
PTGS [83-85]. The REn protein, in combination with Rep, plays a key role in the
replication of virus and correlation with host plants components [86]. The AC4
protein may have a role in the movement of virus, severity of the disease symptoms,
determination of host range and as a probable suppressor of PTGS [87-90]. The DNA-
A components of some of the begomoviruses encodes a non conserved AC5 gene, as
has been the case in Mungbean yellow mosaic Indian virus (MYMIV), with a
probable role in the replication of virus [91]. The DNA-B components of all the
bipartite begomoviruses encode BV1, a nuclear shuttle protein (NSP), and BC1, a
movement protein (MP), from the V-sense and C-sense strands respectively (Figure
1.6; on the left [22]).
Monopartite Begomoviruses
The monopartite begomoviruses, with identity to the DNA-A component of bipartite
begomoviruses, are represented by a single circular genomic component of ~ 2.6-
2.8Kb. At present majority of the monopartite begomoviruses, except Tomato leaf
curl virus (ToLCV), a true monopartite begomovirus that can induce symptoms of
disease in the field without being augmented by satellites, are associated with
satellites called betasatellites (as DNA β previously; [53, 92]) and satellite- like
molecules, alphasatellites (as DNA 1 earlier; [93-95]). The betasatellites are
indispensable for some of the monopartite begomoviruses to infect the host plants.
The monopartite begomovirus isolated for the first time ever from the NW was found
not to be associated with satellites [96].
Monopartite Begomovirus Associated Satellites
Satellites are the subviral agents or nucleic acids acting as pathogenicity determinant
or dampeners dependent (betasatellites) or independent (alphasatellites) on helper
viruses (HV) for their replication without significant nucleic acid identities to the
helper virus [97].
Betasatellites
These are small circular ssDNA component of ~ half of the size of the HV which are
associated with monopartite begomoviruses in the OW. Betasatellites, symptoms
modulating nucleic acids totally dependent on the helper virus for insect transmission,
encapsidation and most importantly replication, augment the level of HV and take
over host plants defences [98-100]. With an exception of the invariant nonanucleotide
12
1 Introduction and Review of Literature
sequence (TAATATTAC), the most important part of the origin of replication,
begomoviruses and betasatellites do not share any considerable sequence similarity
with each other [97]. Betasatellites, almost half the size of their HVs (~1351nt in
length; Figure 1.6; on the top), are characterised by an adenine rich region (A-rich), a
C-sense strand encoded solitary βC1 gene and a highly conserved region of ~ 200nt
among all the betasatellites (named satellite conserved region [SCR]; [97]). The βC1
encoded protein, being a major symptom determinant [71, 99] and as a suppressor of
PTGS [98, 101, 102], may also have a role in the movement of HV in host plants
[103].
The satellite molecule discovered for the first time ever associated with a
monopartite begomovirus, was Tomato leaf curl virus-satellite (ToLCV-sat), isolated
from ToLCV (a monopartite virus) infected tomatoes in Australia [104]. Sequence
analysis later confirmed it to be a vestigial betasatellite of ~ 682nt, encoding no
proteins and with very little sequence identity to its HV except for the TAATATTAC
motif of geminivirus and Rep binding motif of ToLCV within the two stem-loop
structures [105]. The infectivity analysis showed that ToLCV-sat, dependent on HV
for replication and encapsidation (hallmark of betasatellites), does not play any role in
the induction of symptoms. The betasatellite associated with Tobacco curly shoot
virus (TbCSV) may have a role in the augmentation of the severity of HV infection
but is not an obligation representing an evolutionary changeover between betasatellite
demanding and true monopartite begomoviruses [106]. Following the identification of
betasatellite in the last decade till now more than 400 full length versions of
betasatellites have been submitted and this number is increasing day by day [35],
suggesting how much prevalent they are, particularly in the OW [94].
Alphasatellites
Some of the monopartite begomovirus-betasatellite complexes were found linked with
small circular alpahsatellites with ssDNA genomes, previously known as DNA 1 [93-
95]. In common with betasatellites, they also require HV for the encapsidation and
movement within the host plants. Ageratum yellow vein disease (AYVD) in
Ageratum conyzoides, weed species from south-eastern parts in Asia, was found
associated with a unique begomovirus-complex comprising DNA-A from Ageratum
yellow vein virus (AYVV), betasatellite and DNA 1 [92]. TGMV, a bipartite virus,
13
1 Introduction and Review of Literature
and BCTV, a curtovirus, were found associated with the movement of alphasatellites
in planta. The leafhopper in association with BCTV was also found responsible for
the movement of alphasatellite within plants [107]. They encode a single Rep protein
identical to the one encoded by nanoviruses (Figure 1.6; on the bottom;[93, 94, 108])
and are capable of autonomous replication in host plants with no apparent role in the
induction of disease symptoms [94]. Being capable of autonomous replication, they
are precisely described as ‘‘satellites- like’’ molecules as satellites by definition are
dependent on HV for replication.
The hypothesis put forward, suggesting a close link of begomoviruses-
associated alphasatellites with Rep encoding sequence of nanoviruses, might have
been apprehended following a mixed infection with a nanovirus [109], was reasoned
observing the high levels of sequence similarity between them [110]. The
alphasatellites are not required for the begomoviruses to develop an infection in the
host plants [94] and it remains a mystery about the exact role of alphasatellites in
begomovirus-betasatellite complexes. However, the work done recently showing the
involvement of Rep proteins encoded by two different alphasatellites in PTGS
activity, suggests its probable role in overpowering host plant defences [111]. The
first ever cloned alphasatellite, Cotton leaf curl Multan alphasatellite [93], when
analysed, was shown to encode a Rep protein with no RNA suppression activity (Q.
Abbas; unpublished results), suggested two different classes of alphasatellites not
very significant in suppressing host plant defences at least in some cases of the
begomovirus-betasatellite complexes. However, work done recently have shown that
Rep proteins encoded by two different alphasatellites exhibit PTGS activity,
suggested its probable role in overpowering host plant defences [111]. Another
recently conducted study has shown a reduction in the accumulation of betasatellites
and ultimately virus- induced symptoms to guarantee the endurance of the host plant
[112].
1.5 Transmission of Begomoviruses Bemisia tabaci (Gennadius), the whitefly vector of begomoviruses, was described for
the first time in Aleyrodes (Homoptera) in 1889 [113] and as a pest for the first time
in India in 1919 [114]. Viruses of the families Potyviridae and Comoviridae and
genera Begomovirus, Carlavirus and Closterovirus are transmitted by Bemisia tabaci.
14
1 Introduction and Review of Literature
Figure 1-6 The photograph (centre) shows the vector of all begomoviruses (mono- and bipartite viruses), Bemisia tabaci. Genomes of bipartite begomoviruses are
represented by two modules known as DNA-A and DNA-B (right and left). Products involved in the replication (Rep), enhancement of replication (REn), activation of
transcription (TrAP), pathogenesis and suppression of RNA silencing (AC4), encapsidation (CP), and movement/pathogenicity (AV2) of begomoviruses are
encoded by their respective genes on DNA-A. However genes needed for the local and systemic movement (movement protein [MP] and nuclear shuttle protein [NSP]) are encrypted on DNA-B. Genome of monopartite begomoviruses, homologous to the
DNA-A of the bipartite begomoviruses, are usually associated with satellites molecules designated as betasatellites and alphasatellites. Betasatellites (top),
depending on their helper virus for encapsidation, movement and replication, encode a single pathogenicity determinant protein known as βC1. Alphasatellites (bottom) on
the other hand, encoding their own Rep, are capable of autonomous replication.
15
1 Introduction and Review of Literature
Herbaceous plants are most predominantly targeted by the whitefly- transmitted viral
diseases but very rarely testified on trees and shrubs. Cotton, tomato, bean, pepper,
beet, tobacco, squash and cassava are the main targets of whitefly-transmitted
geminiviruses [115].
To get transmitted begomoviruses, gulped through the stylets of whiteflies,
find their way to salivary glands, moving through oesophagus and digestive tract
breaching gut membranes into the haemolymph, from where they are delivered to the
host plants with the saliva during feeding. When Tomato yellow leaf curl virus
(TYLCV) specific antiserum was processed through immunosorbent electron
microscopy, immunogold label was found in the stylets of whitefly associated
predominantly with lumen of the food canal. The same label was also found in the
proximal and descending parts of midgut and in microvilli- rich gut wall epithelial
cells [116]. Immunolocalization of TYLCV was also reported in the filter chamber
and distal parts of midgut [117] suggesting microvilli to be the locations rich in
receptors for begomovirus acting as the main sites of virus internalization. Insect
vectors dose not facilitate the replication of geminiviruses [118]. CP is the only
begomovirus encoded protein that establishes a close link with factors of whitefly for
their circulative transmission to the host plants. However, the specific transmission of
a geminivirus from the insect to the specific host plants is governed by the CP as
replacing ACMV specific CP with that of BCTV modifies its insect specificity [79].
A mutant Abutilon mosaic virus (AbMV) capable of being transmitted by whitefly
was obtained by mutating two amino acids of the CP of a non-whitefly-transmissible
AbMV at positions 124 and 149 [119]. Whitefly insets its stylet and nourishes on the
sap in the phloem by tracing the conducting tissue [120]. Acquisition access period
(AAP) of 15 to 30 minutes, to a minimum, was signposted following whitefly
mediated TYLCV transmission and disease symptoms observation in tomato plants.
Following 24 h AAP a single insect (whitefly) can successfully transfer TYLCV to
tomato plant. However, as early as 5-10 minute after the commencement of the AAP,
TYLCV DNA can be detected through polymerase chain reaction (PCR) in a single
insect [121-123]. After a 5 minute inoculation access period (IAP) viral DNA can be
detected at the site of inoculation in tomato [121]. Transmission efficiency reaches
100% using 5 to 15 insects per plant [124-126]. The gender and age of whitefly plays
a role in the acquisition and conduction of TYLCV to the host plant. Following a 48h
16
1 Introduction and Review of Literature
IAP nearly all of the 7-14 days old female whiteflies were capable of causing an
infection in tomato compared to only about 20% of the males of the same age to
produce an infection. The efficiency of inoculation decreases with the age of insect as
observed with TYLCV-transmitting whiteflies; 60% of three and only 20% of the six
weeks old females retain the capacity to infect tomato plants. Even though the
frequency of translocation of TYLCV is analogous in both males and females,
indicating the possibility that the amount of virus translocated in both the genders is
different [122], and there is a difference in the presumed receptors of begomoviruses
in both of the male and female whiteflies. However this situation is completely
contrasting, with the reasons very much unclear, in case of Squash leaf curl virus
(SqLCV) transmitted by both male and female whiteflies with the same efficiency
[127].
1.6 Proteins Encoded by Geminiviruses
1.6.1 Replication-Associated Protein (Rep)
Rep is encoded by ORF C1 (also named AC1 or AL1) in the C-sense by all of the
geminiviruses. Owing to the similarity of this protein, almost 41kDa, to some of the
prokaryotic plasmids encoded replication initiator proteins obligatory for rolling circle
DNA replication [128], called “replication associated protein” [129]. Rep is known to
possess modular functions [130, 131]. Both the N- and C-termini of Rep are
characterised by DNA-binding, nicking- ligation and oligomerization domains and
ATP-binding domain along with ATPase activity, respectively [91, 132, 133]. Rep is
a sequence specific DNA binding protein vital for the replication of viral genome that
starts replication of virus in the (V)-strand [134-136] and is self- regulatory [137, 138].
Rep binds to iterons (repeated elements) during the course of rolling circle replication
(RCR) and creates a site-specific nick at the nonanucleotide motif TAATATT↓AC in
the stem loop region of the V-sense strand to start replication and then via a tyrosine
residue binds to the 5′ end of the nicked DNA. Acting as a replicative helicase Rep
forms a large oligomeric complex as the helicase activity is dependent on the
oligomeric conformation (~ 24 mer) of Rep [139]. The leafhopper-transmitted
mastreviruses encode two Rep proteins (Rep A and Rep) translated from the spliced
messenger RNA of C1 and C2 genes. Begomovirus encoded Rep is functionally
homologous to the Rep protein of mastreviruses [140].
17
1 Introduction and Review of Literature
The three dimensional structure of the catalytic domain of Rep protein of
TYLCV elucidated by nuclear magnetic resonance (NMR; [131]) predicted a well-
conserved architecture of this domain in Rep proteins of eukaryotes and prokaryotes,
and also in a number of proteins with different functions. Through the induction of the
replication machinery Rep proteins enable the replication of virus in differentiated
cells of host plants [141, 142]. The binding of Rep protein of TGMV using the linker
sequence of 80 amino acids (aa) with two predicted α-helices to the retinoblastoma
related proteins (RBR), is involved in cell-cycle regulation and by sequestering the
transcription factors can prevent the entry of cells to the S-phase [143, 144]. The
activity of Rep to bind pRBR and TGMV infection, capable of overpowering E2F-
mediated repression of the proliferating cell nuclear antigen (PCNA; [145]) promoter,
is very much in support of pRBR/E2F pathway controlled host gene expression by the
Rep protein of geminiviruses. According on this model, E2F binds to the PCNA
promoter in mature plant cells and recruits RBR, which in response recruits chromatin
remodeling factors to create a repressor complex [146], activating host gene
expression that leads to the production of required host DNA replication machinery.
1.6.2 Transcriptional Activator Protein (TrAP)
Transcriptional activator protein (TrAP) of ~ 134aa, encoded by curto-, begomo- and
topocuviruses, is a multifunctional protein localizes in the nuclei of host cells [147].
TrAP bear resemblance to a typical transcription factor in several esteems represented
by three main domains; a nuclear localization signal (NLS), a zinc finger- like domain
comprise of cysteine and histidine residues and an acid activation domain [147-150].
The begomoviruses encoded TrAP is a silencing suppressor, transcriptional activator,
and a suppressor of a basal defence. Being a nuclear protein [151] TrAP, at the level
of transcription, transactivates the expression of V-sense genes [83, 152, 153]. TrAP
is functionally interchangeable among begomoviruses [152]. TrAP as a transcriptional
activator is proved to be associated with the conserved structure of TrAP domains in
bipartite begomoviruses as mutations in any of these three domains can result in the
loss of this function [154]. Similarly TrAP as silencing suppressor loses this activity
in case of mutation in any of the three TrAP domains [82, 147, 154]. C2 protein in
curtoviruses and some of the monopartite begomoviruses (BCTV and Cotton leaf curl
Multan virus [CLCuMuV]) does not up-regulate the expression of V-sense genes
[155, 156], however, with respect to all other functions C2 protein is similar to TrAP.
18
1 Introduction and Review of Literature
In most cases TrAP/C2 has been reported to be lethal to plants when over
expressed [82, 153]. Suppression of PTGS has been shown to be associated with both
TrAP and C2 [82, 147, 157]. TrAP of TYLCV was studied for its in vitro binding
activity and was found to prefer the binding of ssDNA in comparison to dsDNA in a
sequence independent manner [158]. Adding to its foremost role in viral transcription,
TrAP/C2 also acts as a pathogenicity factor suppressing more than one of the host
defence pathways [159]. A universal metabolic regulator, SNF1 kinase, responding to
cellular energy balance, was found to be interacted and inactivated by TrAP/C2
proteins [160]. TrAP of begomovirus and C2 of BCTV are suppressors of an antiviral
defence, RNA silencing [161-164]. TrAP expressed from an RNA virus vector such
as Potato virus X (PVX) can reverse silencing and can also impede silencing when
expressed from plasmids by agroinfiltration or particle bombardment into plants [154,
157, 165, 166].
TrAP interacts with and inactivates adenosine kinase (ADK), a cellular
enzyme producing methyltransferase cofactor S-adenosylmethionine, needed for the
salvation of adenosine and conservation of methyl cycle [157]. TrAP/C2 is involved
in transcriptional gene silencing (TGS) by reducing transmethylation activity [85,
167], upsurges the expression of genes mandatory for cytokinin response [168] and to
up-regulate genes involved in cell-cycle [169]. TrAP/C2 was reported as a counter of
NSP induced hypersensitivity response (HR) leading to cell death and mutagenesis
analysis have shown the necessity of zinc finger domain and NLS, central region of
TrAP/C2, in the inhibition of HR and ultimately cell death [170, 171]. Most of the
developmental micro (mi) RNAs (non-coding small endogenous RNAs) are up-
regulated by TrAP/C2 [172], modulating the expression of host genes [154]. Self-
interaction of TrAP needs zinc finger- like motif (CCHC) but is not enough for this
interaction. Bimolecular fluorescence complementation have shown the accumulation
of TrAP: TrAP complexes in nucleus and TrAP: ADK complexes in cytoplasm
suggesting a correlation of TrAP: TrAP with nuclear localization and activation of
transcription, and that of TrAP: ADK with suppression of local silencing [173].
1.6.3 Replication Enhancer Protein (REn)
A small protein of ~ 132aa, the replication enhancer protein (REn), with no
significant role in replication, is a key to augment viral DNA as much as 50 folds
19
1 Introduction and Review of Literature
[174, 175], possibly due to the amendment in the activity of Rep protein or
recruitment of enzymes used by the host plant replication machinery [145, 176]. With
an exception of mastreviruses, the highly conserved REn protein is encoded by curto-,
begomo-, and topocuviruses [57, 145]. Nanoviruses, following rolling circle strategy
for their replication, do not encode REn protein [16, 110], nullifying the role of REn
not only in the binding of DNA by Rep but also in cleavage/ligation, topoisomerase
activities and Rep-facilitated deliverance of monomeric viral DNAs [177].
REn protein, at levels very much similar to Rep protein, is localized to the
nuclei of diseased plant cells [178] suggests its role as an initiator of viral DNA
replication by increasing the Rep binding affinity to the origin [179] unlike
mastreviruses, with no REn protein, where the role of REn protein is complemented
by their distinctive Rep A protein [129, 132]. The domains of REn protein mediate its
homo-oligomerization and interaction with host-encoded PCNA and pRBR overlap
[86, 176]. The polar residues of REn at both C- and N- termini were implicated in
REn-RBR interaction, whereas the central hydrophobic residues were playing a key
role in its interaction with itself as well as Rep and PCNA, indicating the importance
of REn-Rep, REn-REn, and REn-PCNA interactions for the replication of
geminiviruses. Whereas the REn-RBR complex, not needed for the replication of
viruses, plays a key role during the infection of host plants in their differentiated cells
[86].
1.6.4 (A)C4
A small gene symbolised as the AC4 (AL4 or C4), encoded by all the dicot- infecting
geminiviruses except mastreviruses, shows a sizeable variation in sequence and size.
The gene, completely embedded within Rep gene, is encoded in a different reading
frame [77]. The exact function of bipartite encoded AC4 protein still remains unclear.
The introduction of a stop codon at two different locations in C4 gene without
disturbing the amino acid sequence of Rep protein resulted in a mutant producing
yellowing of leaves, downward leaf curling and stunting when inoculated into
Nicotiana benthamiana [180]. C4 functioning as a pathogenicity determinant was
shown by the mutational analysis of C4 gene [87, 159, 181]. The C4 protein
expressing transgenics produced phenotypes similar to the ones produced by these
viruses further confirmed its role in the development of symptoms [51, 90], though
20
1 Introduction and Review of Literature
AC4 as a determinant of symptoms in bipartite geminiviruses still remains enigmatic
[182, 183]. In common with the MP of bipartite begomoviruses, the C4 of BCTV and
TYLCV were found confined to the cell periphery [80]. The AC4 protein of ACMV
and Sri Lankan cassava mosaic virus (SLCMV), capable of binding with non-coding
small (s)RNAs, might be acting as suppressors of PTGS to control gene expression
[166, 184]. This suppressor activity was also shown by the C4 protein of monopartite
begomoviruses with a high affinity for sRNAs [82].
1.6.5 Pre-Coat Protein (A)V2
The unique V-sense encoded (A)V2 gene, absent in begomoviruses from the NW, is
found in begomoviruses from the OW. However, CoYVV and CoGMV, two of the
bipartite begomoviruses recently discovered from the OW, lack this gene [75, 76].
Studies conducted to find out the function of about 118aa long pre-coat protein have
shown its involvement in movement and systemic infection of begomoviruses in host
plants [159, 185, 186]. Following a pattern somewhat similar to the localization of
MP [80], this begomoviruses encoded protein localizes in cell periphery and around
the nucleus and co- localizes with endoplasmic reticulum (ER; [187, 188]). The AV2
mutants induced either no or very mild symptoms with a very low level of the
accumulation of viral DNA on inoculation [185, 189], showing the importance of this
protein in the induction of symptoms and movement of virus in plants [185].
Acting as a suppressor of PTGS the V2 protein of CLCuMuV was found to
suppress PTGS by interacting with long RNAs preferring the ds forms while the short
RNAs were found showing no interaction with this protein [82]. However, the V2
protein encoded by TYLCV was found to bind siRNAs [190] and interact with
SISGS3, tomato homolog of SGS3 protein from Arabidopsis thaliana (AtSGS3),
involved in RNA silencing pathway [81]. The V2 protein, actively involved in the
movement of virus in host plant without binding the viral DNAs, is known as MP in
mastreviruses [191]. The identification of MP-CP complexes in MSV infected
extracts suggested an interaction between CP and MP directing CP-DNA complexes
from nucleus to cell periphery needed for the cell- to-cell movement of virus in host
plant [191]. Mutated AV2 had a very mild effect on the intensity of symptoms
implying that it did not played a significant role in the infection of cassava by East
African cassava mosaic Zanzibar virus (EACMZV). The mutations in AV1 and AV2
21
1 Introduction and Review of Literature
resulted in the loss/or alteration of CP production proposing a close functional and/or
structural association between these proteins [189].
1.6.6 Coat Protein (CP)
A multifunctional protein encoded by coat protein (CP) gene on the V-sense strand
by all of the geminiviruses is involved in a series of events associated with the
accumulation and encapsidation of ss viral DNAs, insect transmission and movement
of virus both inside the cell and between the adjacent cells. The CP is absolutely
indispensable for the long distance movement and systemic infection of monopartite
begomoviruses [159, 186], but in case of bipartite begomoviruses, augmenting the
efficiency of their long distance movement, the role of CP is highly redundant. The
CP, confined to the nucleolus and nucleus, facilitates the transport of DNA between
cytoplasm and nucleus [80]. The titre of viral DNA condenses when the host plant is
inoculated with a mutated CP. The spread of virus was impaired in the host plant
when inoculated with a CP mutated ToLCV [192]. CP confined to the secondary
plasmodesmata is associated with the appearance of lesions which shows how much
significant this protein is for monopartite geminiviruses to move systemically in the
host plant [193]. GUS assay showing the transport of CP to the nuclei of insect and
plant cells was another confirmatory report of the localization of CP to the nucleus
[194]. While studying the role of CP in the transport of viral genomes to the nuclei of
the host cells two nuclear localization signals (NLS) identified at the N-terminus,
described in the CPs of MSV [195], ACMV [196] and in TYLCV [80, 194], were
thought to be involved in transporting geminiviruses to the nuclei. Mungbean yellow
mosaic virus (MYMV) CP interacting with importin α (a nuclear import factor)
suggested the involvement of importin α-dependent pathway in the transport of CP to
the nuclei of host cells [197]. However, recent findings mapped NLS and nuclear
export signal (NES) for the CP of Tomato leaf curl Java virus (TLCJV; [198]).
The transmission of geminiviruses by specific insect vectors is associated with
the CP. CP determines the vector specificity of geminiviruses; when CP of ACMV
was replaced with that of BCTV it resulted in the change of whitefly to leafhopper as
a transmission vector [79]. The interaction of virion with a protein homologous to
GroEL within the insect/vector not only protects them from degradation but also
ensure their safe transmission to the host plants [199].
22
1 Introduction and Review of Literature
1.6.7 Nuclear Shuttle Protein (NSP)
Following the replication of geminiviruses in the nucleus there is a need to translocate
these viruses to cytoplasm and also to the neighboring cells. Nuclear shuttle protein
(NSP) encoded on the V-sense strand of the DNA-B component is involved in the
intracellular and intercellular movement of bipartite begomoviruses. NSP in
association with MP has been implicated in the determination of host range, systemic
spread and development of symptoms in the infected plants. Mutation in MP or NSP
does not have any influence on the replication or encapsidation but obliterates the
infectivity of virus [200, 201]. NSP as a target of the host defence response was
shown by the expression of this protein in plants causing curling and HR [170, 202].
Strong evidences were provided regarding the highly efficient binding of NSP with
ssDNA [203] with a limited sequence independent affinity towards the dsDNA as
well [204] localized in the nuclei. Co-expression of NSP with MP resulted in the
localization of this protein to the periphery of cells [146]. NSP is a basic protein
possessing two possible NLSs and a mutation in any one of them can severely hamper
the infectivity of virus. The C-terminus of NSP is required for interaction with MP
[205].
Cell-to-cell movements of bipartite begomoviruses follow a two model theory,
“relay-race model” and “couple-skating model”. According to “relay-race model”
intracellular movement of viruses from the nucleus to the cytoplasm is mediated by
NSP, where it is switched by MP which through plasmodesmata transports the viruses
to adjacent cells [206, 207]. According to “couple-skating model” intracellular export
of viruses from the nucleus to cytoplasm is mediated by NSP and later through
endoplasmic reticulum (ER) derived tubules the NSP coupled DNA is transported to
the adjacent cells [151, 204, 205, 208].
The movement of viral DNA can be regulated either by phosphorylating NSP
using kinase or inactivating the virus induced defence response of the host by
blocking the synthesis of protein [209]. TrAP has been reported to regulate NSP at the
level of transcription [83].
1.6.8 Movement Protein (MP)
The movement protein (MP), encoded by the DNA-B component of bipartite
begomoviruses on the C-sense strand, plays a key role in the intercellular movement
23
1 Introduction and Review of Literature
of bipartite geminiviruses. Being a mediator of the viral movement in the form of
dsDNA through plasmodesmata [206, 210], MP in a size- and form-specific manner
binds cooperatively with both ss- and ds-DNA [206, 207]. According to the “relay
race model theory” the cytoplasmic trafficking of viral dsDNA from nucleus is
mediated by NSP which then through plasmodesmata is carried out by MP. However,
according to the “couple-skating model theory” the ssDNA of virus is shuttled from
nucleus to cytoplasm and then intracellularly by MP. The intracellular movement of
NSP-containing ss- and ds-DNA of virus is mediated by MP [151, 204, 205, 208].
While studying the role of NSP and MP in the intracellular movement of Bean dwarf
mosaic virus (BDMV) by mutagenesis, the mutated NSP and MP were found to
hamper the movement of viral DNA [210]. At the C-terminus of MP three
phosphorylated sites, found vital for the development of symptoms and accumulation
of viral DNAs, were documented [211]. Two of the MP’s domains implicated in the
intracellular movement are from amino acids 117-160 and amino acids 1-49. The
domain (amino acids 117-180) implicated in the efficient targeting of reporter protein
to cell’s periphery, is known as an anchor domain [212].
1.7 Replication of Geminiviruses Replication of geminiviruses follow two mechanisms, the rolling circle replication
mechanism (RCR; [213-215]) and recombination dependent replication mechanism
(RDR; [17, 216]), in the nuclei of the infected cells from a ds-DNA intermediate
exploiting host plant machinery to utilize host cell polymerases for their replication
[16, 217, 218]. The role of both iterons/cis elements, positioned in the IR/CR of the
origin of replication [130, 217] and well-preserved nonanucleotide sequence (5′-
TAATATTAC-3′) in the loop of the hairpin structure [134], is unavoidable by the Rep
to recognize the origin of replication [136, 219].
1.7.1 Rolling Circle Replication (RCR)
The mechanism of RCR in geminiviruses is analogous to the mechanism found in ss-
DNA replicons; some of the bacteriophages and also in prokaryotic plasmids [213,
214, 220, 221]. RCR succeeds in three phases [16]. The first phase is initiated by the
conversion of the V-sense strand (known as genomic ss-DNA) into a ds-DNA
intermediate, primed by a short RNA, to produce the C-sense strand [222, 223]. The
host DNA primases, in most of the cases, synthesize this short primer on the V-sense
24
1 Introduction and Review of Literature
strand, however, this short RNA primer of ~ 80nt is already hybridized inside the SIR
on the encapsidated viral ss-DNA for mastreviruses [224]. The second phase begins
with the binding of iterons in the origin of replication by Rep [136] nicking the well-
preserved nonanucleotide sequence (TAATATT/AC) on the V-sense strand [214].
Tyrosine-103, a physical link between Rep and the origin of replication, is responsible
for this cleavage [88]. Rep, via a tyrosine residue, remains covalently attached to the
exposed 5′-terminus of the sliced strand [129] and the 3′ end, using the host encoded
polymerases, is stretched using the C-sense strand as a template. In the final phase the
unit length virion strand is produced by nicking and ligation to shape a circular V-
sense ss-DNA. After RCR the newly formed close circular ss-DNA genome can either
serve as template for further replication or can be encapsidated into virions for
transportation between plants or other parts of the same plant.
1.7.2 Recombination-Dependent Replication (RDR)
Based on analysing the replication intermediates of TGMV, ToLCV, BCTV, ACMV,
AbMV and a betasatellite, using electron microscopy and two dimensional gel
electrophoresis, an additional method of replication, RDR, was proposed [216, 225].
This model, leading to the repair of damages or breaks produced during RCR [226], is
not well studied. RDR model, more companionable with the RDR of a bacteriophage,
is based on the presence of certain replication intermediates [17, 225]. The
observation of both types of DNA intermediates in the naturally virus infected leaves
were showing the compatibility of virus with both RCR and RDR [17] unlike the
agroinoculated leaf discs, producing only the RDR compatible virus intermediates
[17]. The RDR model, named ‘join-copy’ pathway [17], ‘bubble-migration synthesis’
[227] and ‘break- induced replication’ [228], also proceeds in three phases [17, 226].
RDR begins with the processing of fragmented ds-DNA generating 3′-end ssDNA
needed for the invasion of the DNA followed by the formation of displacement loop
(D-loop) structure by the invasion of a homologous duplex using the 3′-end of ssDNA
serving as a potential primer for replication. The RDR finishes with the extension of
the heteroduplexed DNA (branch migration). The protein directed branch migration
proceeds at the back end of the D-loop due to the extension of the leading strand by
DNA polymerases in the front end of D-loop.
25
1 Introduction and Review of Literature
1.8 Cotton Leaf Curl Disease, Introduction of Resistant Cotton Varieties and Current Status of the Disease
Cotton leaf curl disease (CLCuD) is the most momentous biotic constraint to the
production of cotton in north-western parts of India and throughout Pakistan [72]. The
monopartite begomoviruses, augmented by a single symptom modulating
betasatellite, are the main players responsible for the induction of the disease [229,
230]. Symptoms of CLCuD in cotton starts within 2-3 weeks post- inoculation by B.
tabaci with initial downward cupping of the newly emerging leaves followed by
upward or downward curling, vein thickening and darkening and budding out of
enations (leaf like small outgrowths) from the underside of the leaf [74]. In 1967
CLCuD was observed for the first time ever in Pakistan [231]. However CLCuD as
first epidemic appeared in 1989 over a limited area and was ignored until 1992 when
the disease seriously hampered the production of cotton in Punjab. The CLCuD
epidemic, in Pakistani Punjab, was much more severe in the first three years regarding
the yield losses. The disease at that time, as compound infection, was shown to be
triggered by seven distinct monopartite begomoviruses [109] associated with a single
Cotton leaf curl Multan betasatellite (CLCuMuB) to augment the severity of disease
[72, 229].
Owing to the losses of 5 billion dollars (US), Pakistan has suffered since 1992
to 1997 regarding the production of cotton [53], plant breeders started to search for
the sources of resistance in the available germplasm of G. hirsutum on urgent basis.
The promising varieties were exposed to field trials in search for resistance against
CLCuD, if there is any, but except from the different ratings of tolerance exhibited by
some of these varieties, none was found to be completely resistant to the disease. CIM
70, S-12 and Rehmani (a variety from Sindh), severely hampered by CLCuD, were
found to be most highly susceptible in comparison to the varieties CIM 109, BH-36,
FH-87, MNH-93, SLH-41, CIM-240 and MNH-147 which were least affected by
CLCuD. The exotic germplasm were also carefully studied for the existence of
resistance and the varieties CP-15/2 and LRA-5166 (imported from India) were
discovered to resist CLCuD. The cross 492/87 × CP-15/2 produced progenies 1098
and 1100 as the first product of resistant lines against CLCuD in the cropping season
of 1992-93. Crosses conducted between the exotic cultivars resistant to the virus and
local susceptible cultivars in Multan at CCRI were successful in releasing two virus
26
1 Introduction and Review of Literature
resistant cultivars (CIM-448 and CIM-1100) which were approved for general
cultivation in Punjab by Punjab Seed Council in 1996. Later on in 1998 the crosses
CIM-109 × LRA-5166 and LRA-5166 × S-12 resulted in the release of two new
resistant cultivars named CIM-443 and CIM-446 (Anonymous).
The introduction of these CLCuD tolerant/resistant cotton varieties by
conventional breeding/selection methods were showing promise to manage the
disease. However, the resistance offered by these varieties was not long lasting and
was breached by the reappearance of CLCuD, second epidemic, on these varieties in
the year 2001 in district Vehari, (Burewala city), Pakistan in the form of a resistance
breaking species, the “Burewala species” [232]. The species named Cotton leaf curl
Burewala virus (CLCuBuV) after the city where the disease reappeared was found,
when analysed, to lack an intact TrAP gene [156]. Further analysis showed CLCuBuV
to be a recombinant of CLCuKoV and CLCuMuV triggering pre-resistance breaking
CLCuD. Origin of replication along with most of the sequences in the V-sense was
donated by CLCuKoV, first parent, while the C-sense sequences were donated by
CLCuMuV, the second parent [156].
Isolates of CLCuBuV dominating most areas in Pakistan with a recent
annexation to some parts of India [233, 234], sequenced mostly from different
accessions of G. hirsutum, clearly depict the prevailing nature of CLCuBuV playing
havoc with cotton production in these regions since 2001 till now. The emergence and
re-emergence of CLCuD, each time when the threat was slightly relieved using
resistant sources of cotton germplasm, has drawn us to search for durable sources of
resistance against the disease. These sources of resistance, before being utilized in
breeding for resistance, need to be analysed to understand the nature of their
resistance. An infectivity system to introduce cloned viruses into cotton would allow
us to investigate directly the exact mechanism of resistance breaking, the most
important question yet to be answered. Unfortunately an efficient infectivity system in
cotton is still lacking. The work described here is an attempt to get an insight into the
resistance mechanism of CLCuD resistance in cotton, specifically in the resistant
germplasm of cotton.
27
1 Introduction and Review of Literature
1.9 Aims of the Study
Graft-Inoculation to Investigate
• The mechanism of resistance in G. arboreum cv. Ravi.
• Two of the French imported G. hirsutum cvs. Dominique [AS0039] and Haiti
[AS0099].
Biolistic-Inoculation to Investigate
• The use of bioballistic/biolistic as a means of studying the mechanism of
resistance in cotton germplasm.
28
CHAPTER 2 General Methods
2 General Methods
2.1 Preparation of Gold Particles For 240 bombardments (using 250µg of gold per bombardment), gold (INBIO Gold,
Victoria), with a diameter of 1μm, was prepared by weighing 30mg of gold powder in
1.5ml microfuge tube and suspended in 1ml of 70% ethanol. Gold particles were
vigorously vortexed for 2-3 minutes and then allowed to settle for 5-10 minutes.
Microparticles were pelleted by spinning in microfuge for 5-10 seconds and the
supernatant was discarded, washed thrice with 1ml of sterile water. After the final
wash gold particles were resuspended in 500µl of 40% glycerol to bring the final
concentration to 60mg/ml. Following the final resuspension in sterile glycerol, 50μl
aliquots were transferred to 1.5ml microfuge tubes and stored at 40C.
2.2 Precipitation of Viral DNAs onto Gold and Biolistic Inoculation
To precipitate viral DNA onto the gold particles 1μg of the corresponding viral DNA
(0.5μg each of DNA-A [CLCuBuV and CLCuKoV] and their cognate betasatellites as
well as RCA products of CLCuBuV/CLCuMuBBur) was added to a 50μl aliquot and
vortexed for 30 seconds. During vortexing 50μl of 2.5M CaCl2 was added and the
mixture in the tube was vortexed for 30 seconds. 20μl of 0.1M spermidine was added
to the tube during vortexing and the mixture was vortexed for 3 minutes. The particles
(with coated DNAs) were pelleted by centrifugation at 10,000rpm for 10 seconds. The
pellet, after discarding the supernatant, was resuspended first in 250μl of 70% and
then in 250μl of 100% ethanol and again pelleted by centrifugation at 10,000rpm for
10 seconds and the supernatant was discarded. As a final step the pellet was
resuspended in 72μl of 100% ethanol and 6μl of the particle suspension was loaded
onto the centre of the macrocarrier for bombardment (protocol for 12 shots). Particles
(DNA/gold mixture) were delivered into cotton seedlings placed directly under the
outlet, at ~ 3-4cm beneath it, using a helium pressure based apparatus (Figure 2.1,
Helios Biolistic PDS-1000; Bio-Rad, Hercules, CA) with 28mm Hg of vacuum. The
rupture discs used were in the pressure range of 450psi.
29
2 General Methods
Figure 2-1 The image, front view of the components of Biolistic® PDS-1000/He system, is reproduced from Biolistic® PDS-1000/He Particle Delivery System Bio-
Rad Laboratories Hercules, California (USA), Catalog Numbers165-2257.
2.3 Plant Growth Conditions All the cotton plants used for grafting and biolistic inoculation were grown in
controlled aseptic growth rooms with 16 hours light period, 8 hours dark period and
optimum temperature, at the early stage during sowing and development of seedlings
the daytime temperature between 220C and 280C and night-time temperature between
180C and 200C was set but when the plants gets adopted following inoculation
(grafting and biolistic) temperature in the range of 380C and 450C (380C at most) at
daytime and 250C and 300C at night-time was maintained. Plants (for grafting) were
grown in big clay pots containing a combination of compost, silt and sand. All plants
were properly watered and given Hoagland solution (0.75mM MgSO4.7H2O, 1.5mM
Ca(NO3)2.4H2O, 0.5mM KH2PO4, 1.25mM KNO3, micro nutrients [50μM H3BO3,
15μM MnCl2.4H2O, 2.0μM ZnSO4.7H2O, 0.5μM Na2MoO4.2H2O, 1.5μM
CuSO4.5H2O] and Fe-EDTA [30μM FeSO4.7H2O, 1mM KOH, 30μM EDTA.2Na]
once a week.
30
2 General Methods
2.4 Collection of Samples The grafted as well as bombarded plants were photographed and samples were
collected on ice, leaves from the rootstocks and scions of grafted as well as
bombarded plants, respectively, from Nuclear Institute for Agriculture and Biology
(NIAB) 31025 North 7305 East Faisalabad. Samples collected both from the
symptomatic and non-symptomatic plants were marked with permanent markers and
stored at -710C.
2.5 Extraction of Plant Genomic DNA The method described by Doyle and Doyle [235], Cetyl trimethylammonium bromide
(CTAB) method, was used to extract DNA from the leaf samples. Plant leaves, ~
1gram, were frozen in liquid nitrogen and ground into fine powder with the help of
chilled, sterile mortars and pestles in the presence of liquid nitrogen. With the aid of
sterile and chilled spatula the powder was equally divided into three microfuge tubes.
An equal volume of hot (650C) 2% (w/v) CTAB buffer (2% [w/v] cetyl
trimethylammonium bromide,100mM Tris, [pH 8.0], 20mM EDTA [pH 8.0], 1.4M
NaCl and 1% [w/v] polyvinylpyrrolidone [PVP; MW 40,000]) was added, incubated
at 650C for ~ 45 minutes and thoroughly mixed by inverting the tubes. An equal
volume of chloroform: isoamyl alcohol (24:1) was added, mixed well by inversion of
tube forming an emulsion and centrifuged at 13,000rpm for 10 minutes. The upper
(aqueous) phase was carefully transferred to a new microfuge tube without touching
the lower phase, using an autoclaved wide bore white tip. DNA was precipitated by
adding 0.8 volume ice cold isopropanol, mixed well, put at -700C for 30 minutes and
centrifuged at 13,000rpm for 10 minutes at 40C. The supernatant was discarded
without disturbing the pellet. The pellet was washed with 70% cold ethanol for 5
minutes. The supernatant was discarded; pellet was dried at 370C in the incubator and
dissolved in 150µl of sterilized distilled water (SDW).
2.6 DNA Quantification Concentration of DNA, extracted from leaves of plants, and purified plasmids was
measured using spectrophotometer (Smartspec Plus, Bio-Rad). The samples to be
quantified were diluted 50 folds in SDW and at 260nm (OD260 of 1= 50 µg/mL) the
absorbance was measured after zeroing the machine against SDW. The quality of the
31
2 General Methods
extracted DNA was tested by running on 1% agarose gel and then checking under UV
light in gel documentation instrument.
2.7 DNA Amplification
2.7.1 Rolling Circle Amplification (RCA)
To amplify the circular DNA molecules rolling circle amplification (RCA; [236-239])
was used. A total of 20μl reaction mixture was prepared containing 100 to 200ng of
genomic DNA from cotton acting as a template, 2μl of 10X ɸ 29 DNA polymerase
reaction buffer (330mM Tris-acetate [pH 7.9 at 370C], 100mM magnesium acetate,
660mM potassium acetate, 1% [v/v] Tween 20, 10mM DTT), 1mM dNTPs and 50μM
random hexamer primer (RHP). To denature the double stranded DNA the reaction
mixture was placed at 940C in a thermal cycler/PCR machine for 5 minutes, cooled at
room temperature and mixed well with an enzyme mix, 5-7 units of ɸ 29 DNA
polymerase and 0.02 units of pyrophosphatase (to exclude pyrophosphate). After
mixing the reaction mixture was incubated at 280C for 17-19 hours. The next day the
reaction mixture was incubated at 650C in PCR machine for 10 minutes to inactivate ɸ
29 DNA polymerase. Running 2μl of the RCA product along with the control samples
on 1% agarose gel the amplification was confirmed.
2.7.2 Polymerase Chain Reaction
Depending on the purpose of PCR 25μl and 50µl, for diagnosis and cloning
respectively, of the reaction mixture was prepared. The reaction mixture containing ~
10pg-150ng of template DNA, 2.5-5μl of 10X Taq polymerase buffer (Fermentas,
USA), 2.5-5μl of 2mM dNTPs, 1.5mM of MgCl2, 0.25 to 0.50μM of each of the
primer and 0.50-1.25 units of Taq DNA polymerase (Fermentas) was prepared in a
0.25ml thin walled PCR tube. The DNA was amplified in the PCR machine
(Eppendorf, Germany). Machine was programmed for preheat treatment at 940C for 5
minutes followed by 38-40 cycles of 940C for 1 minute, primer annealing at 500C-
550C for 1 minute and extension of primer at 720C for varying times (depending upon
the length of the template to be amplified) and final extension at 720C for ~ 10
minutes. To amplify the begomovirus-complex from either genomic DNA of the
cotton plant or RCA amplified DNA primers pairs CLCV1/CLCV2
32
2 General Methods
(Begomodiagnostic primer pair; [240]), Beta01/Beta02 [241] and Begom-F/Begomo-
R [242] were used.
2.8 Purification of DNA
2.8.1 Gel Extraction and PCR Product Purification
The PCR amplified or endonuclease digested DNA was resolved on 1% ethidium
bromide containing agarose gel (Discussed in section 2.16) and the desired fragments
were cut out with sterile surgical blades under UV light, using Wizard SV Gel and
PCR Clean-Up System (Promega, USA), following manufacturer’s instructions.
Membrane binding solution, at the rate of 10μl per 10mg of gel slice and equal in
volume to the PCR product, was added, mixed well and incubated at 60-650C until the
gel slice is completely dissolved. The dissolved gel mixture was transferred into a
minicolumn assembly, incubated at room temperature for 1-2 minutes and centrifuged
in the microfuge for 1 minute at 13,000rpm. After discarding the flowthrough the
minicolumn was washed with 700μl of membrane wash solution (MWS). The
flowthrough was discarded and the column received another wash but this time with
500μl of MWS. Following the removal of MWS the empty column was centrifuged
for an additional 2 minutes with lid kept open to allow evaporation of any residual
ethanol left. The column was placed in a clean microfuge tube and 40-50μl of SDW
was added. Following an incubation period of 2 minutes at room temperature the
column was centrifuged for 1 minute to collect the purified DNA product, quantified
and stored at -200C.
2.8.2 Phenol-Chloroform Purification of DNA
Phenol: chloroform purification was carried out to exclude protein and other
impurities from DNA. By adding SDW the DNA solution was diluted to 200μl,
phenol: chloroform (1:1) was added to it in equal volume, well mixed till the solution
turned creamy and then centrifuged in a microfuge for ~ 5 minutes at 13,000rpm.
Without disturbing the interface between the two phases the upper aqueous phase was
moved to a new clean microfuge tube. Sodium acetate (3M, pH 5.4) and chilled
absolute ethanol at the rate of 1/10 and 2.5 volumes, respectively, was thoroughly
mixed with the supernatant and placed at -200C for 30 minutes. By centrifugation at
13,000rpm for ~ 4-5 minutes in the microfuge tube the precipitated DNA was
33
2 General Methods
pelleted. Following a wash with 70% ethanol the pellet was air dried to remove the
residual ethanol and stored at -200C after being dissolved in SDW.
2.9 Cloning of PCR Products The PCR amplified DNA was cloned in TA cloning vector using InsTAclone PCR
Cloning Kit (Fermentas, USA) according to the manufacturer’s instructions. Briefly,
the reaction mixture of 20μl in total contained 90 to 540ng of PCR product
(depending upon the length of DNA fragment), 1.5μl (120ng) of vector (pTZ57R/T),
4μl of 5X ligation buffer and 1μl (5 units) of T4 DNA Ligase. The reaction mixture
was prepared in 1.5ml microfuge tube and incubated at 160C overnight. Following
day the ligation mixture was transformed to competent Escherichia coli (E. coli) cells
(DH5α) by heat-shock method, incubated at 370C in a shaking incubator for an hour
and spread on solid Lauria bertani (LB) media plates (0.5% yeast extract, 1% tryptone
and 1% NaCl) and incubated at 370C overnight. The plates contain ampicillin
(100μg/ml) as a selection, X-Gal (20μl, 50mg/ml) and IPTG (100μl, 24mg/ml). The
recombinant white colonies, picked out from those plates with the help of sterile tooth
picks, were inoculated in sterilized culture tubes having 3-5ml of the liquid LB media
and grown overnight at 370C on vigorous shaking. Following day plasmid DNAs,
extracted from selected E. coli cells, were screen out for the presence of desired DNA
fragments by restriction analysis.
2.10 Extraction of Plasmid DNA (Miniprep) Single bacterial colony was picked from solid LB plate using sanitized tooth pick,
inoculated into a 5-6ml LB medium containing culture tube with an appropriate
antibiotic selection and placed at 370C on vigorous shaking overnight. Next day 1ml
from the culture tube was transferred to a microfuge tube and spanned at 13,000rpm
for 2-3 minutes to pellet down the cells. The bacterial pellet, through vortexing, was
resuspended in 100μl of Re-suspension solution (10mM EDTA, 50mM Tris-HCl [pH
8.0] and 100μg/ml RNase A). Following the addition and mixing of 150μl of Lysis
solution (1% [w/v] SDS, 0.2M NaOH) 200μl of Neutralization solution (3.0M
potassium acetate [pH 5.5]) was added, mixed and spanned at 13,000rpm for 12
minutes. The supernatant was carefully transferred to fresh microfuge tube without
touching the cell debris and DNA was pelleted with ~ 900μl of chilled absolute
ethanol. Pelleted DNA was washed twice, once each with 70 and 100% ethanol, air
34
2 General Methods
dried and dissolved in 100-150μl of SDW depending on concentration and amount of
the pellet.
Extraction of the plasmid DNA for sequencing was done by using Pure
YieldTM Plasmid Miniprep System (Promega, USA). The overnight cultures of E. coli
were shifted to microfuge tubes (~ 1.5ml) and centrifuged for ~ 1 minute. Added to it
was 100μl of Cell Lysis Buffer, mixed by inverting, and 350μl of cold (4-80C)
Neutralization Solution. Following centrifugation for 3 minutes at 13,000rpm, the
supernatant from the microfuge tube was transferred into PureYield™ Minicolumn
placed in PureYield™ Collection Tube (provided with the kit). After being
centrifuged for 15 seconds at 13,000rpm the flowthrough was discarded and
minicolumn was placed again in the same collection tube. 200μl of Endotoxin
Removal Wash buffer was added to the minicolumn and centrifuged again for the
same period at 13,000rpm. Finally the minicolumn was washed for 30 seconds with
400μl of Column Wash Solution. The minicolumn was inserted into a fresh
autoclaved microfuge tube and plasmid DNA, eluted in 30-50μl of elution
buffer/SDW by centrifugation at 13,000rpm for ~ 15-30 seconds, was stored at -200C.
2.11 Restriction Analysis Restriction digestion of RCA products and plasmids was done using specific
restriction endonucleases and their corresponding buffers in accord with provider’s
(Fermentas) recommendations. To screen out for the expected insert size, a reaction
mixture of 10μl (containing 0.5-1µg DNA, 3 units of restriction endonucleases,
corresponding buffer and SDW) was prepared. However, for the purpose of cloning, a
reaction mixture of 20μl for digestion was prepared and incubated at 370C (optimum
temperature) for 1-2 hours. Ethidium bromide stained agarose gel combined with a
suitably co-electrophoresed DNA marker was used to determine size of expected
DNA fragment(s) from the digestion mixture.
2.12 DNA Sequencing and Sequence Analysis Plasmids with the desired constructs were extracted using Pure YieldTM Plasmid
Miniprep System (Promega, USA) and sequenced commercially by Macrogen (Seoul,
South Korea) using the M13 Forward (-20) and M13 Reverse (-20) primers. The
complete begomoviruses of ~ 2.752 kb were sub-sequenced by designing specific
35
2 General Methods
internal primers based on the M13 Forward and M13 Reverse sequenced data. The
sequenced data was assembled and analysed using the Lasergene package of sequence
analysis software (DNAStar Inc., Madison, WI, USA). BLAST, a sequence similarity
search, was performed to compare the sequenced data to the already available
begomovirus sequences in the database (http://www.ncbi.nlm.nih.gov/BLAST/) and
using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), open reading frames
were located. The final sequences of viruses and their cognate betasatellites were
submitted to European Molecular Biology Laboratory (EMBL) sequence database.
Using ClustalX [243] and MegAlign program of the Lasergene package multiple
sequence alignments were performed. Based on the matrices of the aligned sequences
phylogenetic analysis were conducted using the Neighbor Joining and bootstrap
options.
2.13 Microbiological Techniques
2.13.1 Preparation of Heat-Shock Competent Escherichia coli Cells
The method described by Cohen et al. [244] was followed for the preparation of heat-
shock competent E. coli cells. A single colony from a freshly grown plate of E. coli
(Top 10) was picked with a sterile tooth pick, inoculated into 20 ml LB medium in a
50ml sterile flask and incubated overnight with vigorous shaking at 370C. The
following day 2ml of the overnight culture was taken and diluted up to 250ml in LB
media in 1 litre autoclaved flask and shaken vigorously at 370C until attaining an
OD600 of 0.5-1. After being ice-cold for 30 minutes, the culture was transferred
aseptically to sterile disposable 50ml propylene tubes and centrifuged at 4000rpm for
6-8 minutes at 40C to pellet down the cells. The pellet, after discarding the
supernatant, was re-suspended in 20ml of 0.1 M MgCl2and centrifuged again. The
Pellet was re-suspended but this time in 20ml of 0.1M CaCl2, incubated on ice for 30
minutes and centrifuged at 4000rpm. The pellet was re-suspended in an appropriate
amount of 0.1M CaCl2and filter-sterilized cold 30% (v/v) glycerol (200μl per 1ml of
CaCl2). The cells were stored in small aliquots of 100-150μl in 1.5 ml microfuge
tubes at -710C.
36
2 General Methods
2.13.2 Transformation of Heat-Shock Competent E. coli Cells
The method described by Sambrook et al. [245] was followed for the transformation
of competent E. coli cells. The ligation mixture (2-4µl) was added to ~ 100µl of the
thawed competent E. coli cells in 1.5ml microfuge tube, gently mixed and incubated
on ice for 30 minutes. After ice incubation the cells were heat-shocked at 420C on dry
bath/water bath for 2 minutes and then incubated again on ice for 2 minutes. Each of
the microfuge tube was added with 1ml of LB liquid medium and grown at 370C for 1
hour. The transformed cells were spread on solid LB media plates with an appropriate
antibiotic selection and put upside down at 370C in incubator overnight for ~ 16
hours.
2.14 Storage of Bacterial Cultures Glycerol stocks were prepared for the long term preservation of bacterial cultures. For
this purpose 300μl of filter sterilized glycerol was mixed with 700μl of bacterial cell
culture in an autoclaved microfuge tube and stored at -700C. To recover bacterial
culture from glycerol stocks small amount of culture was streaked on solid LB culture
plate, containing suitable antibiotic, with the help of a sterile wire loop and incubated
at suitable temperature for a proper period of time.
2.15 Agarose-Gel Electrophoresis DNA, mixed with loading dye (Fermentas), was analysed by electrophoresis in 1%
(w/v) agarose gels using 0.5X TAE buffer (40mM Tris-acetate and 1mM EDTA [pH
8.4]). Agarose was dissolved in TAE buffer by heating in microwave oven for ~ 2
minutes; ethidium bromide (0.5μg/mL) was added, cooled to ~ 550C and decanted
into casting tray with suitable combs. After getting solidified at room temperature, the
gel was transferred to gel tank with TAE buffer and the combs were removed
carefully. DNA, properly loaded into the wells, was resolved on the gel by applying ~
90-110 volts for a short period of 30-50 minutes. Ethidium bromide stained DNA
fragments were viewed and compared when co-electrophoresed with 1kbp of DNA
marker (Fermentas) under ultraviolet (UV) transilluminator (Eagle Eye-Stratagene).
37
2 General Methods
2.16 Southern Hybridization
2.16.1 Preparation of Probe
Digoxigenin labelled probes for DNA fragments were synthesized using the
instructions provided by DIG DNA labelling kit (Roche, Germany). A reaction
mixture of 25μl for each of the DIG and normal PCR was prepared. DIG PCR mixture
was comprised of 2.5μl (10-100pg in case of plasmid and 5-50ng in case of genomic
DNA) of the template DNA, 2.5μl of 10X Taq polymerase buffer with MgCl2
(Fermentas), 2.5μl of 2mM DIG dNTPs, 1μl (0.5μM) of each primer, 0.5-1μl of Taq
DNA polymerase provided with the kit and SDW to make up the volume. However,
the composition of normal PCR was the same (briefly discussed in section 2.8.2). The
reagents (for both DIG and normal PCR) were mixed and incubated in PCR machine
with an initial denaturation of 940C for 5 minutes followed by 32-35 cycles each with
a second denaturation at 940C for 30 seconds, primer annealing at 520C
(CLCV1/CLCV2) and 550C (Beta01/Beta02) for 30 seconds, extension of primer at
720C for 30 seconds (CLCV1/CLCV2) and 45 seconds (Beta01/Beta02), and a final
extension at 720C for ~ 10 minutes. Introduction of DIG dNTPs was confirmed by
loading both the DIG and normal PCR products on 1% ethidium bromide stained
agarose gel and comparing its size with 1kbp DNA marker under UV light
transilluminator. The DIG PCR product was transferred to a 1.5ml and stored at -200C
after adding 500µl of DIG Easy Hyb (Roche Applied Science, Germany) to it. When
needed the probe was denatured at 950C for five minutes and immediately cooled on
ice for two minutes and then added to the blot in the hybridization bottle having 10-
15ml of the fresh prehybridization solution depending on the concentration of the
probe.
2.16.2 Electrophoresis and Gel Treatment
Agarose gel (1.2% [w/v]) stained with ethidium bromide (discussed in detail in
section 2.16) was cast and DNA samples were loaded on to it. The samples were
electrophoresed at 50 volts in a 0.5X TAE buffer in the gel tank up for a period of ~
3-4 hours. The gel, after photographing under UV illumination in the gel
documentation instrument, was washed in ~ 500ml of the depurination solution
(0.25M HCl) for ~ 30 minutes or until the colour of the DNA loading dye changes to
yellow on a rocker platform in a gel tray. Following depurination the gel was treated
38
2 General Methods
with same amount of denaturation solution (1.5M NaCl and 0.5M NaOH) in a glass
tray and gently shaken for 30 minutes on a rocker platform changing the colour from
yellow to light blue again. The gel was washed twice with SDW (300ml each time)
and treated with 500ml of the neutralization buffer [1M Tris (pH 7.4) & 1.5M NaOH]
and again gently shaken for 30 minutes on a rocker platform. Finally the gel was
equilibrated in 10X SSC for 10minutes.
2.16.3 Blotting
The gel after treatment was laid on the paper wick facing upward after setting the
transfer apparatus (Figure 2.2) that contains ~ 300-500ml of 10X SSC (3M NaCl and
0.3M sodium citrate). Whatman 3MM paper wick was placed on a platform in such a
way that the ends were dipping well in the 10X SSC. The paper wick was wetted with
10X SSC and air bubbles were removed with the help of thermometer, gently rolled
over the gel. A piece of positively charged Hybond-N nylon membrane (Roche,
Germany) equal to size of the gel, wetted in 10X SSC, was laid over the gel avoiding
air bubbles. The top right corner of the membrane was marked with a pencil. A few
wet Whatman No. 3 filter papers equal to gel size followed by tissue papers were
placed on the top (Figure 2.2). A weight of ~ 0.5kg was placed on the top so that the
DNA from the gel is transferred to membrane by capillary action and left overnight.
After 12-18 hours the membrane was removed and the DNA was cross linked to the
membrane by exposing it to UV light in UV cross linker (CL-1000 Ultraviolet
Crosslinker-UVP) and immediately used for hybridization. In case of later use the
membrane was air dried and stored in a plastic bag at room temperature.
2.16.4 Hybridization and X-ray Film Development
The nylon membrane was placed inside a hybridization bottle with the help of sterile
forceps and prewarmed (550C) DIG Easy Hyb (Roche Applied Science, Germany)
was added to it and placed in the hybridization oven for 2-3 hours. The DIG labelled
probes were denatured in a boiling water bath at 950C for 5 minutes and cooled
immediately on ice for 5 minutes. DIG Easy Hyb solution was removed and fresh,
prewarmed (550C) DIG Easy Hyb solution (~ 8 to 13 ml) was added to the bottle. The
denatured probe was added to the hybridization bottle, mixed well gently and
incubated overnight at 55C for 12 to 15 hours in the hybridization oven on gentle
shaking. The probe was removed and the membrane was given stringency washes
39
2 General Methods
Figure 2-2 Assembly of southern hybridization to transfer DNA from agarose gel to nylon membrane by upward capillary action.
twice with each of the following prewarmed (550C) solutions, 2X SSC, 0.1% [w/v]
SDS, 1X SSC, 0.1% [w/v] SDS and 0.5X SSC, 0.1% [w/v] SDS, for 15 minutes each.
After the stringency washes the membrane was briefly rinsed with SDW and treated
with Blocking solution for 30 minutes at room temperature to block the nonspecific
blocking sites on the membrane. Then membrane was treated with the Antibody
solution (anti-digoxigenin-AP) for 30 minutes at room temperature in the
hybridization Oven. Then the membrane was twice washed with washing buffer
[(0.1M Maleic acid, 0.15M NaCl; pH 7.5 (+15 to +250C); 0.3% (v/v) Tween 20] for
12 minutes each in the hybridizer. Finally the membrane was treated with Detection
buffer (0.1M Tris-HCl, 0.1M NaCl, pH 9.5 (+15 to +250C) for 3 minutes in the
hybridizer at room temperature to adjust pH to 9.5. The membrane was removed from
the hybridization bottle and treated with DIG CDP-Star (Disodium 2-chloro-5-(4-
methoxyspiro (1, 2-dioxetane-3, 2-{(5'-chloro) tricyclo (3.3.1.1) decan}-4-yl] phenyl
phosphate). CDP-Star was prepared as ~ 5ml of detection buffer and 7µl of CDP-Star.
The blot was covered in the cling film and developed on the X-ray film in the dark
40
2 General Methods
room. Multiple exposures of the membrane on the X-ray films were taken to get good
and clear images.
41
CHAPTER 3 An analysis of the Resistance of Gossypium arboreum to Cotton Leaf Curl Disease (CLCuD) by
Grafting
3 An Analysis of the Resistance of Gossypium arboreum to Cotton Leaf Curl Disease (CLCuD)
by Grafting
3.1 Introduction Plants resistance against a disease has been categorized as non-host and host-plant
resistances [246]. Non-host resistance (NHR) happens when genetic polymorphism
for susceptibility has not been observed, all the available genotypes within a particular
species are resistant, against a particular virus [247]. NHR, exhibited by all genotypes
in a plant species against all known genetic variants of a non-adopted pathogen
species, is the most durable form of resistance in nature [248, 249]. Despite being
very promising in the field of agriculture and also for natural plant populations, NHR
has remained extensively unexploited and very much at the beginning to know about
the underlying mechanism of its resistance [250, 251].
The successful infection of a plant by pathogen needs a compatible interaction
between the two to induce the required physical and chemical signals differentiating
host-plant cells to express the genes involved in pathogenesis [252, 253]. To eradicate
non-host pathogens plants have developed refined mechanisms. The first line of
defence (passive defence mechanisms), preventing the entry of pathogen at the
preinvasive stage, include physical and chemical barriers in the form of cell wall,
plant antimicrobial surface enzymes and secondary metabolites [252]. Constitutive
barriers, also as the first line of defence, instead of contributing to NHR of related
plant species, are more likely to induce NHR against pathogens of other plant species
[254]. Inducible defences (active defence mechanisms), second line of defence, are
activated against the pathogen at the inner surface when the constitutive barriers are
breached by forming local papillae (cell wall apposition), rich in lignin, hydrogen
peroxide and callose.
How non-host resistance operates against viruses and other pathogens is very
diverse and still a mystery [255]. However plants exhibiting NHR against oomycetes,
42
3 Analysis of Resistance in G. arboreum by Grafting
fungi and bacteria have been divided into type I and type II non-host resistances.
Similarities have been reported between gene-for-gene and non-host resistance but
with no clear evidence that the underlying mechanisms between both of these two
responses are the same [255].
Type I Non-Host Resistance
Non-host resistance characterized by the absence of any visible symptoms of the
disease is called the type I which in comparison to Type II is dominating in nature
against most of the non-host pathogens [255]. Type I non-host resistance, ignored
mostly in the previous few years, has been reported in few cases only; exemplified by
the defence no death (dnd) mutant of Arabidopsis offering NHR, non-hypersensitive
response (HR) mediated resistance, against avirulent bacteria [256]. A non-host
pathogen cannot get through the first and second line of defence in non-host-plants
results in the complete arrest of penetration and ultimate multiplication of the
pathogen. The type I non-host-plants, inspite of enormous changes happening at the
molecular level, look normal. Arabidopsis, a non-host against Pseudomonas syringae
pv. phaseolicola, activates pathogenesis related (PR) genes without any visible
symptoms of the disease when challenged against that pathogen [257]. In addition to
the PR genes Arabidopsis plants challenged against P. syringae pv. Phaseolicola
produces an array of defence related genes [258].
Type II Non-Host Resistance
Type II response, producing HR with an immediate cell death, is one of the most
frequently debated phenomenon showing a phenotypically compatible interaction
with gene-for-gene interaction [255]. The HR in plants is activated when certain
pathogenic elicitors, also called avirulence (Avr) proteins, have been recognized in
the cytoplasms or cell memebranes of plants. However in case the Avr proteins are
not recognized it can result in an increased virulence of the pathogen in the target
plant species [259]. An activated HR will arrest further spread of infection from the
site of infection/inoculation to the neighboring cells to alleviate systemic infection in
plants. INF1 (an elicitor from Phytophthora Infestans), an extracellular protein,
produced by several quarantines of oomycets, P. infestans, produces an HR in N.
benthamiana, a non-host [260]. Type III secretion system (TTSS), encoded by hrp
gene of bacteria, induces HR in non-hosts by delivering pathogenic elicitors [261].
43
3 Analysis of Resistance in G. arboreum by Grafting
Species from both plants and pathogen will determine the type of non-host
response activated when challenged against a pathogen. In some cases a non-host-
plant will display type I non-host resistance against species of one pathogen and type
II response against species of another pathogen; exemplified by Nicotiana
benthamiana displaying type II non-host resistance against P. syringae pv. Tomato
and type I non-host resistance against Xanthomonas campestris pv. Campestris [262].
Pathogen, in a similar way, can also activate both type I and type II responses on
different plant species; exemplified by P. syringae pv. Phaseolicola that can activate
type II non-host resistance against tobacco and type I against Arabidopsis [257, 263].
Plants exhibiting RNA silencing against viruses can also be considered as a non-host
resistance [264].
RNA interference (RNAi), a homology based degradation phenomenon, is
triggered by double stranded RNAs (dsRNA). During viral infection cycle the self-
complementary full or partial viral RNA transcripts are diced by RNAse III enzymes
of dicer- like family (DCL) into 21 to 24nt long dsRNAs [265, 266]. These siRNAs,
recruited to an RNA-induced silencing complex (RISC), guide the sequence-specific
degradation of homologous viral RNAs [267]. The RNAi, termed “co-suppression”,
was discovered for the first time in plants [268].The mechanism of RNAi leading to
repression of transcription, termed transcriptional gene silencing (TGS;[269]), is akin
with methylation of the promoter sequences showing a change in chromatin structure
[269]. TGS, RNA directed DNA methylation (RdDM), leads to methylation of
cytosine residues in the target or endogenous gene sequence and repression of histone
modification, epigenetic changes ensuring the stability of genomes and silencing of
the target transgene [270]. RdDM pathway is mediated by three DNA-dependent
RNA polymerases; Pol II [271], Pol IV and Pol V [272]. In addition components like
DNA methyltransferases (MET1, CMT3 and DRM1⁄ 2), histone deacetylase HDA6,
histone methyltransferases KYP (SUVH4) and DRD1, chromatin-remodeling factor,
are also playing a decisive role in TGS [273]. The mechanism of RNAi leading to
RNA degradation or translational arrest is known as post transcriptional gene
silencing (PTGS). The phenomenon is also known as quelling in fungi and RNA
interference in animals [274], serving as a natural defence response in many
organisms [264, 286]. PTGS, triggered by dsRNA, results in a sequence-specific
44
3 Analysis of Resistance in G. arboreum by Grafting
degradation of mRNA. The small RNAs, produced from the cleavage of dsRNAs by
dicer- like enzymes, either cleave or repress the translation of the target RNAs [275].
CLCuD, a sporadic nuisance in the mid-1980s and as a first major problem
occurred in the vicinity of the city of Multan (Pakistan) in 1989, is caused by whitefly
(genus Begomovirus, family Geminiviridae; reviewed by Sattar et al. [72]) and rapidly
spread across most of Pakistan and north-western parts in India. The development of
CLCuD-resistant G. hirsutum lines in the late 1990s through conventional breeding
methods which overcame losses to the disease at most and unfortunate breakdown of
that resistance in Burewala (Pakistan) in 2001, caused by a single Cotton leaf curl
Burewala virus (CLCuBuV) species and a recombinant form of CLCuMuB [156,
276], has drawn the present study to investigate durable sources of CLCuD resistant
cotton germplasm.
G. arboreum, diploid in nature, is one of the four cotton species producing
spinnable fibres. G. arboreum, named tree cotton, is cultivated in Pakistan since 6000
B.C [277]. Owing to the well adaptive features, such as deep rooting system,
resistance to pests/diseases and presence of indehiscent bolls, G. arboreum is
reflected as the top source of introducing diversity to the Old World (OW) cotton
[278]. Isolation of different important genes from these species substantiates their
worth [279].
Recently Akhtar et al. [280] have provided the first evidence that mild CLCuD
symptoms can be induced in G. arboreum by graft inoculation using scions from G.
hirsutum plants infected with CLCuBuV. The study presented here has extended this
work to provide an initial analysis of the nature of the resistance of G. arboreum to
the begomoviruses causing CLCuD.
45
3 Analysis of Resistance in G. arboreum by Grafting
3.2 Materials and Methods
3.2.1 Origin of Germplasm and Field Evaluation of G. arboreum cv. Ravi
Seeds of G. hirsutum (CIM 496 and S-12) and G. arboreum (Ravi) were kindly
provided by the Nuclear Institute for Agriculture and Biology (NIAB, Faisalabad,
Pakistan). In May 2011 and 2012, 2000 seeds each of CIM 496 and Ravi were sown
in the fields of NIAB. No whitefly control procedures were applied, and plants were
screened weekly for the appearance of CLCuD symptoms.
3.2.2 Grafting and Maintenance of Plants
Grafting of cotton was conducted by the improved “bottle shoot” grafting technique
described by Akhtar et al. [281]. This grafting technique places the graft (scion) in a
tube of water, which is refreshed daily, to support the graft in the high temperatures
under which cotton is grown, until a graft union is established. Typically the tube of
water was removed at ~ 7–9 days after grafting. Scions for grafting were obtained
from severely infected, glasshouse-maintained CIM 496 plants that were inoculated
by whitefly transmission. Plants were grown in large earthenware pots in an insect-
free glasshouse with a daytime temperature of between 38 0C and 45 0C and a night-
time temperature of between 25 0C and 30 0C. Plants were watered daily and sprayed
with insecticide (Confidor, Bayer) at regular intervals.
3.2.3 Molecular Diagnostics
DNA was extracted from leaf samples using the CTAB method [235].Viruses and
betasatellites were detected in DNA extracts by PCR with primer pairs
CLCV1/CLCV2 (5′-CCGTGCTGCTGCCCCCATTGTCCGCGTCAC-3′/5′-
CTGCCACAACCATGGATTCA CGCACAGGG-3′) and Beta01/Beta02 [241],
respectively. For samples where PCR was not successful, circular DNA molecules
were first amplified by rolling circle amplification (RCA; [239]) and the resulting
concatameric product was used as a template for PCR (this procedure will henceforth
be referred to as RCA/PCR). RCA was performed according to the manufacturer’s
instructions (Fermentas).
46
3 Analysis of Resistance in G. arboreum by Grafting
3.2.4 Amplification, Cloning and Sequencing of Begomovirus Components
Circular DNA molecules in DNA samples extracted from plants were amplified by
rolling circle amplification (RCA; [239]) according to the manufacturer’s instructions
(Fermentas). Begomoviruses and betasatellites were amplified from RCA products by
polymerase chain reaction (PCR) using primer pairs Begomo-F/Begomo-R [242] and
Beta01/Beta02 [241], respectively. The PCR amplified products were purified and
cloned into the pTZ57R/T vector (Fermentas). The inserts of clones were sequenced
commercially (Macrogen, South Korea). Sequences were assembled using SeqMan,
part of the Lasergene sequence analysis package (DNAStar) and compared with
sequences available in the databases by BLAST analysis
(http://www.ncbi.nlm.nih.gov/BLAST/). The sequences were aligned and
phylogenetic dendrograms were constructed using the Geneious software (Geneious
version 7.1 created by Biomatters, http://www.geneious.com).
3.2.5 Southern Blot Hybridization
DNA samples extracted from plants were electrophoresed on 1 % (w/v) agarose gels,
blotted onto positively charged nylon membranes (Roche) and UV cross- linked.
Probes of virus fragment (coordinates 378– 1,474) and full length betasatellite were
PCR amplified using specific primers CLCV1/CLCV2 and Beta01/ Beta02 [241],
respectively, and labeled with digoxigenin (DIG) using a DIG DNA labelling kit
(Roche). Hybridization was performed at 55 0C for 12– 15h followed by high
stringency washing. Hybridization signals were detected on X-ray film after treatment
with CDP-Star (Roche).
47
3 Analysis of Resistance in G. arboreum by Grafting
3.3 Results
3.3.1 Field Evaluation of the Susceptibility of G. arboreum cv. Ravi to CLCuD
The susceptibility of G. hirsutum CIM 496 and G. arboreum Ravi to CLCuD was
assessed in the field in 2011 and 2012 (Figure 3.1a and b). For CIM 496 the first
symptoms of infection were evident 50 and 54 days after sowing in 2011 and 2012,
respectively, with ultimately 78.9% (1577 plants symptomatic out of 2000 sown) in
2011 and 89.5% (1789 plants symptomatic out of 2000 sown) in 2012 showing severe
symptoms of CLCuD. In contrast, none of the 4000 Ravi plants developed symptoms
over the 12 weeks of the study.
Southern blot hybridization of total DNA samples extracted from the field
samples of Ravi plants collected at various time intervals (2, 4, 6, 8, 10 and 12 weeks
after the appearance of first symptoms in CIM 496), probed for the presence of
begomoviruses and betasatellites, did not show the presence of either component; a
total of six blots were produced, an example is shown in Figure 3.7a. In contrast,
samples extracted from symptomatic CIM 496 plants showed hybridisation to both
the virus and betasatellite probes.
All PCR and RCA/PCR diagnostic amplifications with DNA extracted from
field collected Ravi plants were negative (600 plants examined by pooling samples
from 10 plants). In contrast, both PCR and RCA/PCR for all symptomatic CIM 496
samples (12 samples from single plants examined) yielded the expected DNA
fragments (~ 1100nt for virus and ~ 1350nt for betasatellite). All field collected, non-
symptomatic CIM 496 plants were negative by both PCR and RCA/PCR.
3.3.2 Double Graft-Inoculation of G. arboreum cv. Ravi
To determine whether the resistance of Ravi to CLCuD is due to an inability of the
begomovirus-complex to move systemically in this plant, we adopted a double graft
inoculation method. In this assay, a symptomatic CIM 496 scion (scion 1 in Figure
3.3a) was grafted onto a Ravi plant (the rootstock), followed by grafting of a healthy
CIM 496 scion (scion 2 in Figure 3.3a) above the initial graft 10-14 days later. The
ability of the viral complex to move systemically through the Ravi rootstock was then
indicated by the presence or absence of symptoms/virus in the second graft. Of the
48
3 Analysis of Resistance in G. arboreum by Grafting
two repetitions of 30 Ravi plants each, tested in this assay in 2011 and 2012, 22 and
27, respectively, developed CLCuD symptoms on scion 2. The first mild symptoms in
scion 2 were evident at ~ 25 days post-grafting of the second graft. These symptoms
were typical of the initial symptoms of CLCuD and consisted of mild leaf curling
(downward cupping) and small patches of vein darkening which progressed to form
enations. Symptoms became progressively more severe over the following two to
three weeks to become full CLCuD symptoms consisting of either upward or
downward leaf curling, leaf rolling, vein darkening, vein thickening and enations from
the undersides of the leaves. In contrast, none of the double grafted Ravi plants
showed visible symptoms of infection.
Figure 3-1 Field evaluation of the susceptibility of G. hirsutum CIM 496 (a) and G. arboreum Ravi (b) to cotton leaf curl disease (CLCuD). Note that there are no
symptoms of infection in the Ravi plants but the CIM 496 plants were showing severe infection characterised by leaf curling. Photographs were taken 3 months after
sowing.
Southern blot hybridisation of DNA samples extracted from non-scion tissue
(indicated as branches 1 and 2 in Figure 3.3a) of double grafted Ravi plants after
symptoms appeared on scion 2 (30 days after the appearance of symptoms) was
unable to detect either virus or betasatellite DNA, although both components were
readily detected in both of the scions, scion 1 and symptomatic scion 2, and field
collected infected CIM 496 (Figure 3.7b). Similarly, neither virus or betasatellite
DNA could be detected in samples extracted from non-scion tissue of grafted Ravi
plants or scion 2, at the time of attaching the second graft, by either PCR or
49
3 Analysis of Resistance in G. arboreum by Grafting
RCA/PCR (one sample each from the 30 Ravi plants and scion 2 were examined in
2011 and 2012, respectively). However, both components were readily detected by
PCR in the DNA samples extracted from the infected graft (scion 1). After the
appearance of symptoms on scion 2 (25 days after attachment of scion 2) both virus
and betasatellite could be detected in DNA samples extracted from Ravi leaves
between the two grafts (indicated as branch 1 in Figure 3.3a; 22 and 27 plant samples
examined in 2011 and 2012, respectively) and from leaves above the second graft
(indicated branch 2 in Figure 3.3a; 22 and 27 plant samples examined in 2011 and
2012 respectively) by RCA/PCR but not by PCR.
For the 8 and 3 Ravi plants (in 2011 and 2012, respectively) in which the CIM
496 second (healthy) scions did not develop symptoms of infection, removal of the
tube of water supporting the graft at 7 to 9 days after grafting resulted in death of the
grafted scions in 4 and 2 cases, respectively, indicating that no successful graft union
was established. For the remaining plants (4 in 2011 and 1 in 2012) RCA/PCR was
unable to detect either virus or betasatellite in the Ravi rootstock in tissues above the
first graft.
3.3.3 Single Graft-Inoculation of G. arboreum cv. Ravi
A total of 60 Ravi plants (30 each in 2011 and 2012) were graft- inoculated with single
scions from CIM 496 plants with severe CLCuD symptoms. Of these, 21 (70%) and
24 (80%), respectively, developed very mild symptoms of CLCuD which became
evident at ~ 26-28 days post-grafting respectively, with a late onset of the disease
compared to graft-inoculated CIM 496 control plants where the symptoms of the
disease started ~ 9-10 days post-grafting. The symptoms consisted of only a few
small, dispersed darkened and swollen primary and secondary veins but no such
deformity in tertiary veins (Figure 3.2a and b). These symptoms very much resemble
the initial symptoms of CLCuD in G. hirsutum. However, unlike G. hirsutum, the
symptoms in graft- inoculated Ravi did not progress further to yield the full symptoms
of CLCuD. Surprisingly, the symptoms in grafted Ravi initiated not on the youngest,
newly developing leaves but rather on the leaves that were developing at the time of
grafting on the branch immediately above the graft (branch 1 in Figure 3.3b), The
youngest newly developing leaves (at the time of appearance of first symptoms) on
50
3 Analysis of Resistance in G. arboreum by Grafting
Figure 3-2 Foliar symptoms of single graft-inoculated Ravi plants. The symptoms appeared as small, dispersed greening of veins (a) which developed into small areas of
vein swelling/enations (b).
the branches above this (indicated as branches 2 and 3 in Figure 3.3b) did not at any
time show symptoms and, after the first few leave with symptoms, no further growth
showed symptoms.
Southern blot analysis of DNA samples extracted from symptomatic leaves of
single graft- inoculated Ravi plants (35 days post-appearance of symptoms in Ravi
plants) showed weak hybridisation with both the virus and the betasatellite probes
(Figure 3.7c). The levels of hybridisation were significantly lower than those of both
infected, field collected CIM 496 plants and of the infected scion, indicative of very
low virus and betasatellite titres. These DNA forms are indicative of virus replication
in G. arboreum tissue. No hybridisation was detected in samples extracted from non-
symptomatic leaves of grafted Ravi plants (leaves developing after the appearance of
symptoms; indicated as branches 2 and 3 in Figure 3.3b) or in any of the control, non-
grafted Ravi plants.
PCR and RCA/PCR diagnostics for virus and betasatellite from DNA samples
extracted from young, upper leaves of Ravi plants prior to grafting were uniformly
negative (samples from all of the thirty plants each in 2011 and 2012, respectively,
were examined by both PCR and RCA/PCR). In contrast, PCR-mediated
51
3 Analysis of Resistance in G. arboreum by Grafting
amplification for both virus and betasatellite were positive for both the infected scions
(samples from all of the scions, thirty each in 2011 and 2012, respectively) and the
symptomatic leaves of grafted Ravi plants (indicated as branch 1 in Figure 3.3b;
samples from 21 and 24 plants, respectively, in 2011 and 2012). However, RCA/PCR
from young leaves of grafted Ravi plants developing after appearance of symptoms
(indicated as branches 2 and 3 in Figure 3.3 panel b) showed the presence of both
virus and betasatellite (in samples from all of the 21 and 24 symptomatic plants of
Ravi, respectively, in 2011 and 2012). Neither component was detected in these
samples by PCR. RCA/PCR diagnostic with samples extracted from healthy, non
graft- inoculated Ravi plants were uniformly negative.
For the 9 and 6 single grafted Ravi plants (in 2011 and 2012, respectively) that
did not develop symptoms, removal of tube of water supporting the grafts in 5 and 3
cases, respectively, resulted in wilting and death of the graft – indicating that no graft
union was established. For the remaining plants (4 in 2011 and 3 in 2012) RCA/PCR
was unable to detect either virus or betasatellite in leaves above the graft.
3.3.4 Identification of the Virus and Betasatellite Infecting G. hirsutum cv. CIM 496 and G. arboreum cv. Ravi Plants
Full- length clones of begomovirus and betasatellite were obtained from samples by
PCR-mediated amplification from RCA products using universal primers and were
sequenced in their entirety. A total of 4 begomovirus clones were obtained; 2 from
DNA samples extracted from infected G. hirsutum CIM 496 plants which were used
for grafting (acc nos. HF569171 in 2011 and HG428699 in 2012) and 2 from
symptomatic leaves (indicated as branch 1 in Figure 3.3b) of single graft- inoculated
G. arboreum Ravi plants (acc nos. HF569046 in 2011 and HG428698 in 2012).
Similarly 4 betasatellite clones were obtained, 2 from CIM 496 plants which were
used for grafting (acc nos. HF912232 in 2011 and HG428701 in 2012) and 2 from
symptomatic, graft- inoculated Ravi plants (acc nos.HF912231 in 2011 and HG428700
in 2012).
Comparison of the 4 virus sequences showed them to share 98.4 to 100%
identity and to have the highest levels of nucleotide sequence identity to isolates of
CLCuBuV available in the databases, with the highest (98.4 to 99.3%) to two isolates
of CLCuBuV (AM774303 and FR750320) originating from the Punjab, Pakistan.
52
3 Analysis of Resistance in G. arboreum by Grafting
Figure 3-3 Diagrammatic representations of double (a) and single graft (b) inoculations of G. arboreum Ravi plants with scions from infected G. hirsutum CIM
496 plants. In each case the G. arboreum Ravi rootstock and the infected/symptomatic G. hirsutum CIM 496 graft (scion 1) is shown. The tubes of water, used to prevent the graft wilting whilst a union was established, were removed at 7-9 days after grafting.
The branches indicated as 1 to 3 are discussed in the text.
These results show the virus which was inoculated to G. arboreum, and infecting this
species, to be CLCuBuV. All 4 isolates were shown to lack a full- length C2 gene, a
characteristic of CLCuBuV [156].
Phylogenetic analysis, based on the complete alignment of sequenced clones
with the selected sequences of CLCuD associated begomoviruses, showed their
segregation with different isolates of CLCuBuV followed by CLCuShV, CLCuKoV
and CLCuMuV, well supported by bootstrapping (Figure 3.4). The phylogenetic
dendrogram further confirmed that the begomovirus inoculated to G. arboreum Ravi
indeed was CLCuBuV.
The sequences of the 4 betasatellite clones showed 91.9 to 97.7% nucleotide
sequence identity to different clones of CLCuD associated betasatellite, CLCuMuB,
with the highest (91.9 to 97.3) being to 4 CLCuMuB clones (AJ316035, AM774307,
53
3 Analysis of Resistance in G. arboreum by Grafting
AM084379 and AM774306). A closer analysis of the sequences showed them to
contain the recombinant fragment, within the satellite conserved region, originating
from Tomato leaf curl betasatellite first identified by Amin et al. [276]. This
recombinant betasatellite first appeared in cotton in Pakistan after resistance breaking.
Phylogenetic analysis, based on the complete alignment of sequenced clones
with selected full length betasatellite sequences from the database showed their
segregation with CLCuD associated betasatellite, CLCuMuB, especially with
different isolates of the recombinant betasatellite prevalent in sub-continent (Figure
3.5).
3.3.5 Effects of Removal of Graft on Graft-Inoculated G. arboreum cv. Ravi Plants
The 21 and 24 of the mildly symptomatic plants of Ravi, from each of the 30 plants
grafted with infected scions from symptomatic CIM 496 plants in 2011 and 2012,
respectively, were chosen for further analysis. At ~ 26-28 days post appearance of the
first symptoms in those Ravi plants, the grafts were removed from 10 and 12 plants,
respectively. The remaining plants were maintained as controls. In most of the control
plants (8 and 9 plants of Ravi in 2011 and 2012, respectively), plants in which the
grafts were maintained, there was a slight increase in the severity of symptoms in the
symptomatic leaves over a period of 4 to 8 weeks (Figure 5b); specifically additional
areas of vein darkening/enations developed on already symptomatic leaves in
comparison to all of those graft-removed plants of Ravi. Further spread of symptoms
in all of the control Ravi plants from the initially symptomatic leaves into newly
developing leaves slightly above the first symptomatic leaves was observed compared
to all of the graft-removed plants of Ravi where no further spread of symptoms from
the initially symptomatic leaves into newly developing leaves was observed.
However, for one plant (in 2011) from which the graft was removed,
established symptoms on leaves became milder; specifically areas of vein darkening
and swelling disappeared at between 4 and 8 weeks after removal of the graft (Figure
5a). Both virus and betasatellite were detected in symptomatic Ravi leaves from
plants in which the graft was removed at 8 weeks after removal of the graft and plants
in which the graft was maintained by PCR (results not shown).
54
3 Analysis of Resistance in G. arboreum by Grafting
Figure 3-4 Phylogenetic dendrogram created using Geneious software (Geneious version 7.1 created by Biomatters, http://www.geneious.com) is based on the
alignment of selected complete genomes of OW begomoviruses and new isolates of CLCuBuV (identified in this study) from G. arboreum (Ravi, highlighted in light
green) and G. hirsutum (CIM 496, highlighted in pink) with isolate acronyms [282] and their allocated accession numbers. The statistics at nodes represents bootstrap scores in percentage (1000 replicates). The alignment is arbitrarily rooted on the DNA-A component of Tomato golden mosaic virus (TGMV), a distantly related
bipartite begomovirus from the New World (NW).
55
3 Analysis of Resistance in G. arboreum by Grafting
Figure 3-5 Phylogenetic analysis of Cotton leaf curl Multan betasatellites (CLCuMuB) isolated from G. arboreum (Ravi, highlighted in purple) and G. hirsutum
(CIM 496, highlighted in blue) with accession numbers. Using Geneious software (Geneious version 7.1 created by Biomatters, http://www.geneious.com) phylogenetic
dendrogram was produced based on the alignment of complete sequences of CLCuMB isolates mentioned above with available selected sequences of CLCuMB in
the database. The tree is arbitrarily rooted on a distantly related sequence of Cotton leaf curl Burewala alphasatellite (CLCuBuA). Comprehensive depiction with
acronyms and accession numbers are given for each of the sequence [283]. The numbers at nodes (1000 replicates) indicates the bootstrap confidence values in
percentages.
3.3.6 Back-Indexing of Graft-Inoculated Ravi Plants to G. hirsutum cv. S-12
The mildly symptomatic branches of (single) graft-inoculated Ravi plants were
grafted on G. hirsutum S-12 plants. Of the 20 plants grafted in 2011 and 30 plants
grafted in 2012, 15 and 26 plants, respectively, ultimately showed CLCuD symptoms.
Grafted plants showed the initial symptoms of CLCuD, consisting of dark spots on the
veins in the youngest newly developing leaves. The symptoms increased in severity
over the next 40 days to yield full CLCuD symptoms, consisting of upward or
downward leaf curling, thickening of the veins and enations on the veins on the
undersides of leaves that sometimes developed into leaf- like out growths. The
56
3 Analysis of Resistance in G. arboreum by Grafting
remaining grafted S-12 plants (5 in 2011 and 4 in 2012) did not develop any visible
symptoms and remained symptomless for the duration of the experiment (12 weeks
after grafting). Of the plants that did not develop symptoms, 3 and 1 in 2011 and
2012, respectively, the scions wilted and died when the tube of water was removed,
indicating that no graft union was established. In the remaining 5 plants, 2 and 3 in
2011 and 2012, respectively, the grafts survived but were non-symptomatic.
Additionally healthy/non graft-inoculated S-12 plants remained asymptomatic
throughout the experiment. Virus and betasatellite was detected in all symptomatic
grafted plants by both PCR and Southern blot hybridisation (results not shown).
However, all of the grafted non-symptomatic S-12 plants showed no amplification of
either virus or betasatellite following PCR and RCA/PCR.
Figure 3-6 Effects of the removal of the graft on the symptomatic leaves of single graft- inoculated G. arboreum Ravi plants. The leaf in the upper panel (a) was
photographed at the time of removal of the graft (left), 4 (middle) and 8 weeks (right) after removal of the graft. The photos in the lower panel (b) were taken at the same time but of a leaf of a plant on which the graft was maintained. The arrows denote
feature discussed in the text.
57
3 Analysis of Resistance in G. arboreum by Grafting
3.4 Discussion At this time no CLCuD-resistant G. hirsutum lines resulting from interspecific crosses
with G. arboreum have become available to farmers, and it remains unclear whether
this approach will be successful. One problem is that there is no information on the
nature of resistance of G. arboreum. The resistance would appear to be a generalized
resistance against all geminiviruses, not just the begomoviruses causing CLCuD,
since there are no reports in the literature of any geminivirus infecting this species.
The field evaluation of G. arboreum Ravi conducted here indicates that it is not
susceptible to CLCuD; consistent with numerous previous studies which have shown
that no varieties of G. arboreum are susceptible to the disease [284-288]. Situations
where all varieties of a species are resistant to a pathogen are commonly referred to as
“non-host resistance” [289].
Analysis of the sequences of virus and betasatellite clones obtained here
indicate that, in the area and the period that this study was conducted, the disease was
associated with only CLCuBuV and the recombinant CLCuMuBBur. This is consistent
with what is known about the present geographic distribution of viruses associated
with CLCuD – only CLCuBuV having been identified in cotton in the Punjab
province of Pakistan [156, 290]but other viruses also being identified in cotton in
Sindh province (Pakistan; [291]) and north-western parts in India [233, 234].
In the absence of a mechanism to introduce cloned viruses into G. arboreum,
such as Agrobacterium-mediated inoculation or biolistic inoculation, grafting
provides an efficient means of introducing virus without requiring a vector. The
bottle-graft method was used in this study to investigate the resistance of G. arboreum
to the viruses causing CLCuD. Some previous studies have grafted G. arboreum cv.
Ravi but reported no symptomatic response [287, 288]. There are two possible
reasons for the difference between these studies and the work reported here. The
earlier studies were conducted prior to resistance breaking (in G. hirsutum) and this
may indicate that G. arboreum responds differently to the earlier begomovirus-
complex than to CLCuBuV/CLCuMuB. Also the earlier studies used bud grafting,
which uses much less tissue for grafting than bottle grafting and possibly does not
deliver sufficient virus to the grafted plant to induce symptoms. Furthermore, the
earlier studies used only PCR and did not detect virus in Ravi.
58
3 Analysis of Resistance in G. arboreum by Grafting
The finding that by insect transmission in the field no G. arboreum plants
became symptomatically infected and no virus could be detected, yet by graft
inoculation mild symptoms were exhibited and virus could be detected, might suggest
that the resistance to CLCuD is due to a mechanism that affects the delivery of the
virus to the plant by the vector insect. Although the results obtained here cannot
entirely rule out this being the case, it is unlikely to be a major factor in the resistance
of G. arboreum to the CLCuBuV/CLCuMuB complex. However, a major difference
between graft inoculation and whitefly inoculation is in the amount of virus that is
delivered to the plant. Whiteflies deliver minute amounts of virus, and the delivery is
discontinuous and dispersed (each insect delivering virus at a different site); for the
monopartite begomovirus Tomato yellow leaf curl virus (TYLCV), single whiteflies
are estimate to harbour at most 1.6ng of virus [292] and only a tiny fraction of this is
likely to be delivered to plants during a feed. In contrast, graft inoculation delivers
more virus, and does so in a continual manner, once a graft union has been
established. The results presented here thus indicate that G. arboreum has a high
threshold level for establishment of (symptomatic) infection, higher than that of G.
hirsutum varieties. For several other virus-host systems, symptomatic infection has
been shown to be dose dependent [293, 294].
In G. arboreum both CLCuBuV and CLCuMuB DNA levels were low. In
symptomatic tissues the virus and betasatellite could be detected by Southern blot
hybridisation but were significantly lower than in symptomatic G. hirsutum. In non-
symptomatic G. arboreum tissues the components could only be detected by either
PCR or RCA/PCR – indicating that virus/betasatellite DNA levels were below the
threshold for detection by Southern hybridisation. Low virus/betasatellite levels can
indicate either low virus replication or fewer cells infected supporting virus
replication. Although the tissue specificity of CLCuBuV/CLCuMuB has not been
investigated, monopartite begomoviruses are generally phloem limited [80, 295].
Nevertheless, all viruses that use phloem long-distance movement must establish new
infection sites by exiting the phloem into companion cells and spreading into vascular
parenchyma (and beyond for non-phloem-limited viruses; [296]). The low virus levels
in G. arboreum could thus be due to either a resistance that interferes with virus
replication or that interferes with local spread of the virus, limiting the numbers of
cells infected. However, the results do show that G. arboreum can support
59
3 Analysis of Resistance in G. arboreum by Grafting
CLCuBuV/CLCuMuB replication since viral DNA forms indicative of geminivirus
replication were detected in tissues distal to the graft.
For G. hirsutum the betasatellite CLCuMuB has been shown to be essential for
efficient, symptomatic infection of begomoviruses causing CLCuD; in the absence of
the betasatellite the virus is poorly infectious, and does not induce typical symptoms
[53, 229]. Betasatellites encode a single protein, the βC1 protein, which is a dominant
symptom determinant [99, 100]. The βC1 of CLCuMuB has been shown to be capable
of inducing all the symptoms typical of CLCuD in tobacco when expressed from a
Potato virus X vector [297]. The symptoms of CLCuBuV/CLCuMuB infection in G.
arboreum are typical of early CLCuD symptoms in G. hirsutum and are more than
likely induced by CLCuMuB βC1. The analysis of Qazi et al. [297] showed βC1 to
induce cell proliferation and cell enlargement (hyper- and hypoplasia) immediately
adjacent to the vascular bundle.
The fact that the second, healthy, graft becomes infected and ultimately
develops full CLCuD symptoms indicates that the virus is able to move freely in the
phloem of G. arboreum. Many phytopathogenic viruses spread systemically in their
hosts using the phloem [296, 298]. This would seem to rule out a mechanism of
interference with long-distance spread in the phloem being involved in G. arboreum
resistance to the viruses causing CLCuD. However, the lack of visible symptoms on
double grafted G. arboreum plants (as opposed to single graft plants) is perplexing. A
possible explanation is that, in double grafted plants, the second, healthy graft acts as
sink for virus spreading in the phloem from the first graft, reducing virus titre in other
tissues to below the threshold for symptomatic infection.
Also perplexing is the apparent recovery from symptoms seen on the leaves of
a small number of symptomatic G. arboreum Ravi plants once the graft was removed.
Invariably geminivirus infected tissue does not revert to a healthy, non-symptomatic
state. In plants that do recover from infection, the initially symptomatic tissues
(leaves) remain symptomatic, but subsequent growth does not show symptoms.
Recovery phenomena have, in many cases, been shown to be due to RNA interference
[299-301]. This indicates that the plant can reverse some of the changes induced by
the begomovirus-complex, at least early during initiation of symptoms, and that a
continual supply of virus is required until symptoms are fully/irreversibly established.
60
3 Analysis of Resistance in G. arboreum by Grafting
In view of the importance of the betasatellite-encoded βC1 protein, it is tempting to
suggest that it is the supply of βC1 that is required.
Figure 3-7 Southern blot hybridization of DNAs samples extracted from the leaves of cotton plants probed for the presence of Cotton leaf curl Burewala virus (CLCuBuV,
left blot in each case) and Cotton leaf curl Multan betasatellite (CLCuMuB, right blot). (a) Analysis of field grown G. hirsutum CIM 496 and G. arboreum Ravi plants.
The DNA samples electrophoresed in lanes 3 to 8 were extracted from Ravi plants two, four, six, eight, ten and twelve weeks after the first appearance of cotton leaf curl
disease (CLCuD) symptoms in CIM 496, respectively. The sample in lane 1 was extracted from an infected (symptomatic) CIM 496 plant, whereas the sample in lane
2 was extracted from a non-symptomatic CIM 496 plant. (b) Analysis of double grafted Ravi plants. The samples were extracted from scion 1 (infected CIM 496
61
3 Analysis of Resistance in G. arboreum by Grafting
scion; lane 1), healthy/non graft- inoculated Ravi plant (lane 2), leaves of Ravi between the two grafts collected 30 days after the first appearance of symptoms in the
second graft (scion 2; lanes 3 and 6), leaves of Ravi above the second graft were collected 30 days after the first appearance of symptoms in the second graft (lanes 4 and 7) and scion 2 after appearance of symptoms (lane 8). A sample extracted from a symptomatic, field- infected CIM 496 plant was run as a control (lane 5). (c) Analysis of the single grafted Ravi plants. The samples were extracted from the graft (infected
CIM 496 scion; lane 1), healthy non graft- inoculated plants of Ravi (lane 2), symptomatic leaves of single graft- inoculated plants of Ravi collected 35 days post-
appearance of the first symptoms of the disease (lane 3 and 5), non-symptomatic leaves of single graft- inoculated plants of Ravi collected 35 days post-appearance of
the initial symptoms of the disease (lane 4 and 6). A sample extracted from a symptomatic, field infected CIM 496 was run as a control (lane 7). Approximately 10 µg of DNA was loaded in each case with a photograph of the genomic DNA bands on
the ethidium bromide stained agarose gel shown below each blot to confirm equal loading. The virus and satellite DNA forms are labelled as open-circular (oc), super-
coiled (sc) and single-stranded (ss).
The resistance of G. arboreum to CLCuBuV/CLCuMuB shows many
similarities to the resistance of tomato varieties carrying the Ty-1 resistance gene
against the monopartite begomovirus TYLCV. In both cases the resistance does not
provide immunity, but reduces virus levels in plants, and is not associated with a
hypersensitive response (HR; [302]). Recently Ty-1 has been shown to encode an
RNA-dependent RNA polymerase which is likely involved in RNAi [303]. RNAi is a
conserved eukaryotic gene regulation mechanism that plays a part in protecting plants
from pathogens [304].
Although it is tempting to speculate that the resistance of G. arboreum is due
to RNAi, which the suppressors of gene silencing encoded by the begomovirus-
complex [82] are unable to effectively counter, the results do not rule out the possible
involvement of other resistance mechanisms including resistance (R) gene-mediated
resistance [305, 306]. However, R gene-mediated resistance tends to be virus species,
or even strain, specific, whereas the resistance of G. arboreum appears to be against a
whole family of viruses. Furthermore, when they are not sufficient to completely stop
viral spread R genes tend to induce a spreading HR phenotype [307], which was not
apparent in infected G. arboreum. Alternatively the resistance could be mediated by
other host-encoded proteins. The resistance of certain Arabidopsis thaliana ecotypes
to various potexviruses has been shown to be due to lectin proteins (JAX1; [308])
whereas Tm-1 provides resistance against the tobamovirus Tomato mosaic virus in
tomato [309]. Both these resistances interfere with virus replication.
62
3 Analysis of Resistance in G. arboreum by Grafting
The results obtained here show that resistance of G. arboreum to CLCuD,
likely does not involve a mechanism that interferes with virus inoculation to the plant
by the insect vector, or virus long-distance spread in the phloem. Instead the
resistance would appear to interfere either with virus replication or with local cell- to-
cell movement of virus. Evidently G. arboreum has a higher threshold for infection
than G. hirsutum, requiring a higher virus titre (inoculum) to achieve symptomatic
infection; a threshold that whitefly-mediated virus inoculation is unable to cross and
unable to maintain. Identifying the mechanism(s) for these responses will be the
subject of future studies.
63
CHAPTER 4 Analysis of Host-plant
Resistance in French Imported Gossypium hirsutum Lines,
Dominique and Haiti, Against Cotton Leaf Curl Disease
(CLCuD) by Grafting
4 Analysis of Host-plant Resistance in French Imported Gossypium hirsutum Lines, Dominique
and Haiti, Against Cotton Leaf Curl Disease (CLCuD) by Grafting
4.1 Introduction Genetic resistance including the control of vectors, use of virus-free seeds and cultural
practices is amongst a number of approaches used for the protection of crops against
viral infections [310]. Resistant crops varieties, with proved, useable, appropriate
ranges of durable resistances if available, are still the most reliable and cost-effective
choices to control losses to agriculturally important crops.
Plants species are continuously under threats by various pathogens in the
fields and protect themselves by displaying resistance. The resistance can be
categorised into host-plant resistance (HPR) and non-host resistance (NHR) based on
the plant response to the invading pathogen. HPR, easily approached genetically,
termed genotypic resistance, specific resistance, or cultivar resistance [246], happens
when the same gene pool is exhibiting genetic polymorphism for susceptibility, some
of the genotypes are resistant while the others are susceptible, to a particular virus
[247]. The virus is either not replicating at all or replicate to some extent with
localized or masked symptoms in resistant genotypes compared to the susceptible
ones [247]. The work done earlier by Ali [311]to study HPR proposed that a single
dominant R gene control the resistance of G. hirsutum to CLCuD. Later on Rahman et
al. [288] proposed a three gene model including the involvement of suppressor gene
in resistance against CLCuD.
Resistance to the disease and to the pathogen needs to be clearly delineated. In
case of resistance to the disease the virus/pathogen either does not produce phenotypic
symptoms or produce localized symptoms (not evident at most). The virus though,
may or may not replicate, moves systemically in a manner looks restricted in
comparison to its movement in susceptible hosts [247]. The response is highly
64
4 Analysis of Resistance in Dominique and Haiti by Grafting
predominant in nature and used in some crops to a substantial benefit; for example,
the resistance in cucumber against Cucumber mosaic virus (CMV; [312, 313]).
However host-plants exhibiting resistance to the pathogen ultimately results in
resistance to the disease [247]. In some cases this response can be very severe or even
deadly, for example, the response of I gene and N gene against Bean common mosaic
virus (BCMV) and Tobacco mosaic virus (TMV) in Phaseolus vulgaris and tobacco
[293, 314], respectively.
Whitefly, Bemisia tabaci (Gennadius) Biotype B, has gradually increased and
is an important pest in major cotton growing countries [315]. Whitefly is resistant to
neonicotinoid [316], pyrethroids [316, 317] and organophosphates [318, 319] so it is
very difficult to control whiteflies. Growth regulators like pyriproxifen, diafenthiuron
and the most recently used spirotetramat [315] are heavily used for the control of
whiteflies in Australia but with an emerging risk of selecting for resistant spider mites
and cotton aphids as the latter two are used for controlling other insect pests also.
Host-plants resistance is one of the key prerequisites in cotton plants against
whitefly (carrier of the disease) and ultimately cotton leaf curl disease (CLCuD)
aiming to either reduce or completely eradicate the use of hazardous pesticides.
Constitutive, (plant morphology and biochemical components) permanently present
depending on the phenotype and growth conditions, and induced defence responses,
changes initiated in host-plants following a pathogen attack to be immune to further
attack [320],are the two broad sub-categories of host-plant resistance. Compounds
like tannins, flavonols, sugars, gossypol and phenols as constitutive biochemical
defences have also been reported to halt the population of whiteflies [321, 322].
Induced host-plant responses to whiteflies and phloem feeding species in general,
with limited host damage instead of the sustained presence, have not been studied
extensively [323]. Nevertheless, Kempema et al. [324] and Zarate et al. [325], with no
reports in cotton as yet, has reported whitefly infestation induced salicylic acid in
Arabidopsis thaliana.
Keeping an eye on the highly susceptible nature of upland cotton, G. hirsutum,
continuously threatened by CLCuD, efforts were made and still going on to find out
environment friendly and long- lasting sources of resistance. Two imported French
lines (Dominique [AS0039] and Haiti [AS0099], the wild relatives of G. hirsutum),
65
4 Analysis of Resistance in Dominique and Haiti by Grafting
found naturally resistant to CLCuD in the field (Khalid Pervez Akhtar, unpublished
reports and personal observations), can be the potent sources of resistance to improve
the cultivars of G. hirsutum.
The work presented here is envisioned to explore the nature of resistance,
level of resistance, identity of begomovirus-complex and behaviour of infection
during grafting, graft removal and back- indexing assay, offered by both Dominique
and Haiti plants against CLCuD causing begomoviruses.
66
4 Analysis of Resistance in Dominique and Haiti by Grafting
4.2 Materials and Methods
4.2.1 Grafting in Dominique and Haiti, and Maintenance of Plants
The improved “bottle shoot” grafting technique [281] was used to carry out grafting
in Dominique [AS0039] and Haiti [AS0099]. Details of the procedure are provided in
chapter 3 (section 3.2.2). The scions for grafting were obtained from severely
infected, glasshouse-maintained CIM 496 plants that were inoculated by whitefly
transmission. The plants were maintained in insect-proof greenhouse under the same
conditions detailed in Chapter 3 (section 3.2.2) following grafting.
4.2.2 Whitefly Transmission Assay in Dominique and Haiti
Non-viruliferous adult whiteflies were nurtured on greenhouse maintained accession
of G. arboreum (Ravi). These adult whiteflies were allowed an ~ 72 hours (h)
acquisition access period (AAP) on G. hirsutum (CIM 496) severely infected with
Cotton leaf curl Burewala virus (CLCuBuV)/CLCuMuB-complex (HF569171 and
HF912232, chapter 3, section 3.3.4). Following the AAP the whiteflies were
immediately transferred onto ~ 4-5 weeks old Dominique, Haiti and control plants
(glass-house maintained healthy CIM 496 plants) with an inoculation access period
(IAP) for 72h. Fifteen plants of each type were used for whitefly infestation. The
number of whiteflies varied using 50, 100 and 150 viruliferous whiteflies per plant
(five plants each of each type were caged with 50, 100 and 150 whiteflies). Following
the IAP for 72 H the whiteflies were slayed using Confidor (an insecticide, Bayer)
and the plants were shifted to insect free greenhouse.
4.2.3 Molecular Diagnostics in Dominique and Haiti
Molecular diagnostics for the presence of virus and betasatellite was performed in a
similar way described in Chapter 3 (section 3.2) using primer pairs CLCV1/CLCV2
[240] and Beta01/Beta02 [241].
4.2.4 Amplification, Cloning and Sequencing of Begomovirus Components from Dominique and Haiti
Amplification, cloning and sequencing of begomoviruses and their cognate
betasatellites was performed as described in Chapter 3 (section 3.3).
67
4 Analysis of Resistance in Dominique and Haiti by Grafting
4.2.5 Southern Blot Hybridization in Dominique and Haiti
Southern blot hybridization was also performed as described in Chapter 3 (section
3.3) using the same probes for begomovirus and betasatellite.
68
4 Analysis of Resistance in Dominique and Haiti by Grafting
4.3 Results
4.3.1 Analysis of the Susceptible Nature of Dominique and Haiti by Whitefly Transmission Assay
The French lines (Dominique [AS0039] and Haiti [AS0099]) along with CIM 496, as
a positive control, were observed for the appearance of CLCuD daily. The symptoms
of CLCuD initiated in all of the CIM 496 plants (12 plants) at ~ 10-14 days post
inoculation in the form of minor vein thickening. However, no such signs of the
disease were observed in any plant of Dominique and Haiti at the specified period of
time. The plants were observed for ~ 3 months following IAP. Excluding all of the 12
CIM 496 plants, showing full blown symptoms of CLCuD, characterized by leaf
rolling (both upward and downward), vein thickening and plants stunting (results not
shown), no such or even mild symptoms of the disease were observed in any plant of
either Dominique or Haiti throughout till the end of the experiment (3 months post-
IAP). The experiment was repeated twice in 2011 and 2012 using the same number of
plants but each time with similar results.
Diagnostic PCR and most sensitive RCA/PCR was carried out from all 15
plants of the Dominique and Haiti using Beta01/Beta02 [241] and CLCV1/CLCV2
[240] primer pairs to yield expected products (~1355nt for betasatellite and ~1100nt
for virus) if there is any at 15, 30 and 60 days post inoculation. All 12 plants of CIM
496 yielded the expected products for both begomovirus and betasatellite with
diagnostic PCR without even needed for enrichment of the begomovirus-complex by
RCA. However, none of the 15 plants each of Dominique and Haiti yielded the
expected products with either direct PCR or indirect PCR following an initial
enrichment of the circular begomoviral and betasatellite components in those DNA
samples by RCA, termed RCA/PCR, at each time interval the plants were tested.
4.3.2 Graft-Inoculation of Dominique and Haiti
Unlike G. arboreum Ravi where both single and double graft inoculation procedures
were followed, single graft inoculation procedure was used for both Dominique and
Haiti to investigate the behaviour of begomovirus and its cognate betasatellite. Forty
plants each of Dominique and Haiti (20 each in the years 2011 and 2012) were graft-
inoculated with scions from CIM 496 plants with severe symptoms CLCuD. Of these,
69
4 Analysis of Resistance in Dominique and Haiti by Grafting
15 (75%) and 17 (85%) plants of Dominique and 13 (65%) and 16 (80%) plants of
Haiti, in 2011 and 2012, respectively, developed mild symptoms of CLCuD. The first
symptoms of infection became evident at ~ 25 days post-grafting in Dominique and
almost at the same time, 26-27 days post-grafting in Haiti, respectively, with a late
onset of the disease compared to graft- inoculated CIM 496 control plants where the
symptoms of the disease started ~ 9-10 days post-grafting, just like in G. arboreum
Ravi. However, unlike G. arboreum Ravi where only the primary and secondary veins
were showing mild symptoms, swelling and thickening, ‘‘besides primary and
secondary veins’’, were also seen in the tertiary veins of both Dominique and Haiti
plants (Figure 4.1). The disease initiated in almost a similar fashion, as slight vein
thickening and darkening, in both of the graft-inoculated French lines, Dominique and
Haiti, and CIM 496 plants. However, unlike the graft- inoculated CIM 496 plants
where the symptoms developed uniformly yielding full blown symptoms of CLCuD,
the symptoms in these wild genotypes, just like G. arboreum Ravi, did not yield full
blown symptoms of the disease (results not shown).
Figure 4-1 Foliar symptoms of graft- inoculated Dominique and Haiti plants. The symptoms appeared as pronounced thickening and darkening of primary, secondary
and tertiary veins in both Dominique (a) and Haiti (b).
Symptoms initiated on the leaves that were developing at the time of grafting
on the branch immediately above the graft (branch 1 in Figure 4.2) as well as on
leaves on the branches away from the graft (branch 2 and 3 in Figure 4.2) with the
passage of time. The top most leaves in all of the graft- inoculated plants of
70
4 Analysis of Resistance in Dominique and Haiti by Grafting
Dominique and Haiti, just like in Ravi, remained symptomless (indicated as branch 4
in Figure 4.2).
Southern blot analysis of DNA samples extracted from symptomatic leaves
(indicated as branch 1, 2 and 3 in Figure 4.2) of graft- inoculated Dominique and Haiti
plants (30 days post-appearance of symptoms in Dominique and Haiti plants) just like
Ravi plants showed weak hybridisation signals with both virus and betasatellite
specific probes (Figure 4.5). The levels of hybridisation in those French lines,
Dominique and Haiti, were significantly lower than those of both infected, field
collected CIM 496 plants and of the infected scions, suggestive of very low virus and
betasatellite titres. Replicative forms of DNA, suggestive of virus replication, were
seen in both of those French lines. Hybridisation signals were not detected in samples
extracted from non-symptomatic leaves of graft- inoculated Dominique and Haiti
plants (the uppermost leaves; indicated as branch 4 in Figure 4.2) or in any of the
control, non-grafted Dominique and Haiti plants.
Prior to grafting DNA samples extracted from leaves of each of the
Dominique and Haiti plants were found uniformly negative for the presence of virus
and betasatellite by PCR and RCA/PCR diagnostics (samples from all of the 20 plants
each of Dominique and Haiti in 2011 and 2012, respectively, were tested by PCR and
RCA/PCR). However, both of the infected scions (DNA samples from all of the
scions, 20 each from Dominique and Haiti, in 2011 and 2012, respectively prior to
and after grafting) and the symptomatic leaves of Dominique and Haiti plants after
grafting (labeled as branches 1, 2 and 3 in Figure 4.2; samples from 15 and 17, and 13
and 16 plants of Dominique and Haiti in 2011 and 2012, respectively) were found
positive for the presence of virus and betasatellite by the above mentioned diagnostic
technique. Only RCA/PCR from uppermost leaves of grafted Dominique (samples
from 15 and 17 plants in 2011 and 2012, respectively) and Haiti (samples from 13 and
16 plants in 2011 and 2012, respectively) plants (indicated as branch 4 in Figure 4.2)
showed the presence of both virus and betasatellite. While the direct PCR without
being first enriched by RCA was not successful in detecting virus and betasatellite in
any single DNA sample from the uppermost leaves (branch 4 in Figure 4.2) of above
mentioned plants. RCA/PCR diagnostic with samples extracted from healthy, non
grafted Dominique and Haiti plants were also uniformly negative.
71
4 Analysis of Resistance in Dominique and Haiti by Grafting
The remaining 5 and 3, and 7 and 4 of the grafted Dominique and Haiti plants
in the years 2011 and 2012, respectively, were unable to develop symptoms of the
disease. Of these 3 and 2, and 5 and 1 plants of Dominique and Haiti, respectively, in
the following two years, were unable to develop a successful union with their
respective grafts (infected scions of CIM 496). The tubes of water, supporting the
Figure 4-2 Diagrammatic representation of graft- inoculation in Dominique and Haiti (rootstock) using scion from infected G. hirsutum CIM 496 plants. The rootstock
(representing both Dominique and Haiti) and the infected/symptomatic scion from G. hirsutum CIM 496 is shown. The tube of water, used to prevent the graft wilting
whilst a union was established, was removed at 7-9 days after grafting. The branches indicated as 1 to 4, are discussed in the text.
72
4 Analysis of Resistance in Dominique and Haiti by Grafting
grafts in these plants just like the rest of the successfully grafted plants, when
removed resulted in wilting and ultimate death of the grafts in these plants showing an
unsuccessful union between the plant and graft. RCA/PCR diagnostic with samples
from the rest of Dominique and Haiti plants (2 and 1 of Dominique and 2 and 3 of
Haiti plants in the years 2011 and 2012, respectively) were found negative for both
virus and betasatellite with the reasons very much unknown.
4.3.3 Identification of the Begomovirus-Complex in Dominique, Haiti and their Respective Scions/CIM 496
Begomoviruses and their cognate betasatellites were amplified by PCR using
universal primer pairs Begomo-F/Begomo-R [242] and Beta01/Beta02 [241],
respectively, and cloned. A total of 8 begomovirus clones, sequenced in their entirety,
were obtained; 4 from DNA samples extracted from infected G. hirsutum CIM 496
plants which were used as scions for grafting (acc nos. HF952157 and HG428705 in
2011, and LK995396 and LK995397 in 2012) and 4 from symptomatic leaves of
graft- inoculated Dominique and Haiti plants used as the rootstocks (acc nos.
HF952154 and HG428704 from Dominique, and acc nos. HF952155 and HG428706
from Haiti, in 2011 and 2012, respectively).
When nucleotide sequences of all 8 full length viral clones were compared
they showed 99 to 100% nucleotide sequence identity. These clones showed the
highest level of nucleotide sequence identity to different isolates of CLCuBuV
available in the databases, with the highest (99.4%) to an isolate of CLCuBuV
(AM774303) originating from Punjab, Pakistan and lowest (95.7%) to an isolate
(JF502353) originating from Fazilka, India . All isolates when analysed using ORF
finder (results not shown) showed a lack of full- length C2 gene, just like the case in
G. arboreum Ravi where all the sequenced isolates were also lacking the full length
C2 gene, which is a distinguishing feature of CLCuBuV, a resistance breaking strain
[156]. These results confirmed that the begomovirus graft- inoculated to Dominique
and Haiti which induced mild symptoms of CLCuD in these species was CLCuBuV.
Phylogenetic analysis, based on the complete sequence alignment of
begomovirus clones with the selected sequences of CLCuD causing monopartite
begomoviruses, showed their segregation with different isolates of CLCuBuV
followed by CLCuShV, CLCuKoV and CLCuMuV, well supported by bootstrapping
73
4 Analysis of Resistance in Dominique and Haiti by Grafting
(Figure 4.4). These results confirmed the identity of begomovirus species in mild
symptomatic plants of both Dominique and Haiti to be isolates of CLCuBuV.
Figure 4-3 Phylogenetic dendrogram created using Geneious software (Geneious version 7.1 by Biomatters, http://www.geneious.com) is based on the alignment of selected complete genomes of Old World (OW) begomoviruses and new isolates of
CLCuBuV from French lines (Dominique and Haiti, highlighted in light gray colour) and G. hirsutum (CIM 496, highlighted in orange colour) with isolate acronyms [282]
and their accession numbers. The statistics at nodes represents bootstrap scores in percentage (1000 replicates). The alignment is arbitrarily rooted on the DNA-A
component of Tomato mottle virus (ToMoV), a distantly related bipartite begomovirus from the New World (NW).
Similarly 8 betasatellite clones, sequenced in their entirety, were also
obtained; 4 from CIM 496 plants which were used as scions for grafting on French
lines (acc nos. HF952156 and LK995398, and HG428707 and LK995399 in 2011 and
2012, respectively) and 4 from symptomatic leaves of graft- inoculated French lines,
Dominique and Haiti (acc nos.HF952152 and HG428703, and HF952153 and
HG428702 in 2011and 2012, respectively).
74
4 Analysis of Resistance in Dominique and Haiti by Grafting
Sequence comparison of those betasatellite clones showed 92.5 to 100%
nucleotide sequence identity with each other. These clones showed very high
sequence identity to different clones of betasatellite associated with CLCuD,
CLCuMuB. The 2 betasatellite specific clones isolated from CIM 496 (acc nos.
HG428707 and LK995399, scions on Haiti) had the highest level of nucleotide
sequence identity (99.9%) to clones AM712314, AM712311, AM712315 and
FN432359 from Punjab, Pakistan and lowest (89.3 %) to clone GQ259599 from Siri-
Ganganagr, India. However the rest of the 6 betasatellite clones, 2 each from
Dominique, Haiti and CIM 496 (scions on Dominique), had the highest level of
nucleotide sequence identity (99%) to an isolate AM774309 from Punjab, Pakistan
and lowest (89.2%) to an isolate HM461864 from Bihar, India.
Phylogenetic analysis, based on the complete alignment of betasatellite clones
with selected full length betasatellite sequences from the database, showed their
segregation with CLCuD associated betasatellite, CLCuMuB (Figure 4.5), further
confirmed the presence of CLCuMuB in both of the scions/grafts (clones from CIM
496) and rootstocks (clones from Dominique and Haiti).
4.3.4 Effects of Removal of Grafts on Graft-Inoculated Dominique and Haiti Plants
The mildly symptomatic plants of Dominique and Haiti like Ravi were also chosen
for further analysis of the infection. The analysis was carried out with the 15 and 17,
and the 13 and 16 of the mildly symptomatic plants of Dominique and Haiti in the
years 2011 and 2012, respectively. At ~ 5-10 days post-appearance of the initial
symptoms of the disease the grafts were removed from 7 and 8, and 6 and 7 of the
Dominique and Haiti plants, respectively. The remaining plants, 8 and 9, and 7 and 9,
respectively, were maintained as controls for comparison. A systemic spread of the
disease from the initial point of infection to the next leaves was observed in all of the
controls, Dominique and Haiti plants, just like Ravi, in which the grafts were upheld
over a period of almost two months (8 weeks). However, in the controls of Ravi the
disease was spreading only to few leaves slightly above the initial point of infection
but here the disease was spreading even farther away from the initial point of
infection (indicated as branches 2 and 3 in Figure 4.2). The newly emerging leaves at
75
4 Analysis of Resistance in Dominique and Haiti by Grafting
Figure 4-4 Phylogenetic analysis of Cotton leaf curl Multan betasatellites (CLCuMuB) isolated from French lines (Dominique and Haiti, highlighted in leaf
green) and G. hirsutum (CIM 496, highlighted in yellow) with accession numbers by using Geneious software (Geneious version 7.1 created by Biomatters,
http://www.geneious.com). Phylogenetic dendrogram was created based on the alignment of complete sequences of CLCuMuB isolates mentioned above with
available selected sequences of CLCuMuB in the database. The tree is arbitrarily rooted on a distantly related sequence of an alphasatellite (symptomless alphasatellite from G. darwini). Comprehensive depiction with acronyms and accession numbers are given for each of the sequence [283]. The numbers at nodes (1000 replicates)
indicates the bootstrap confidence values in percentages.
the top (indicated as branch 4 in Figure 4.2) in all of the controls, Dominique and
Haiti, remained symptomless, just like the case in Ravi plants. On the other hand the
systemic spread of symptoms of the disease from the initial point of infection to the
newly emerging leaves was restrained in all of the graft removed plants of Dominique
and Haiti, but it was not exactly like the case as in G. arboreum cv. Ravi. In both of
76
4 Analysis of Resistance in Dominique and Haiti by Grafting
these French lines with the removal of grafts the systemic spread of disease symptoms
was seen in some leaves on branch 2 only, but not in the leaves on branch 3 and 4,
following the initial point of infection (branch 1 in Figure 4.2, at the time of removing
the grafts) which were very mild in comparison to the control plants where the grafts
were upheld (results not shown). However, in case of G. arboreum cv. Ravi with the
removal of grafts systemic spread of the disease to the next leaves following the initial
point of infection was completely arrested in comparison to their control plants. The
symptomatic leaves, those before the removal of grafts and those that became very
mildly symptomatic after the removal of grafts at branch 2 only in both cases,
remained symptomatic in all of graft removed Dominique and Haiti plants over a
period of almost two months (8 weeks) and no single graft removed plant in both of
the genotypes was found where the already established symptoms became milder
unlike the case in G. arboreum Ravi. Both virus and betasatellite was detected in
symptomatic leaves of all graft removed and graft-maintained plants of Dominique
and Haiti by direct PCR using CLCV1/CLCV2 [240] and Beta01/Beta02 [241],
respectively, tested at the end of the experiment (8 weeks post-graft removal).
4.3.5 Back Indexing of Graft-Inoculated Dominique and Haiti Plants onto G. hirsutum cv. Coker
In this experiment the mildly symptomatic branches from graft-inoculated Dominique
and Haiti plants were grafted on G. hirsutum cv. Coker plants. Back indexing was
done by selecting 10 each plants of Coker for both Dominique and Haiti in the year
2011 and also in 2012. Of the 10 each plants of Coker, graft-inoculated with mild
symptomatic branches of Dominique and Haiti (used as scions) in 2011 and 2012, 6
and 8, and 7 and 8 plants, respectively, showed symptoms of CLCuD~ 15-17 days
post-grafting. The symptoms were initiated as mild vein thickening and darkening in
the newly emerging leaves. The symptoms became severe over the next ~ 45 days
post-grafting developing full blown symptoms of CLCuD, characterised by curling of
the leaves, both upward and downward, enhanced vein thickening and enations on the
veins on the underside of the leaves (results not shown). The remaining graft-
inoculated Coker plants (7 in 2011 and 4 in 2012) did not develop any visible
symptoms of CLCuD and remained symptomless throughout the experiment (~ 10
weeks). Wilting of scions was observed, when the tubes of water supporting the grafts
were removed, in 4 and 2 of these plants in the years 2011 and 2012, respectively,
77
4 Analysis of Resistance in Dominique and Haiti by Grafting
showing that no successful graft union was established in these plants. The remaining
graft- inoculated Coker plants (3 and 2 in the years 2011 and 2012, respectively), in
spite of developing a successful graft union, remained symptomless with the reasons
very much unknown throughout the experiment. Similarly the healthy/non graft-
inoculated Coker plants also remained asymptomatic throughout the experiment. All
the symptomatic graft- inoculated plants of Coker were found positive for the presence
of virus and betasatellite each time they were tested throughout the experiment.
However, all of the healthy/non graft- inoculated along with graft- inoculated non-
symptomatic Coker plants showed no amplification of virus and betasatellite
following direct PCR as well as RCA/PCR.
78
4 Analysis of Resistance in Dominique and Haiti by Grafting
4.4 Discussion Up until now no single accession resistant to CLCuBuV, resistance breaking strain,
have been identified in cultivated upland cotton species of G. hirsutum [72]. Cotton
being a major foreign exchange earning crop in India and, most prominently, in
Pakistan is under severe stress of CLCuD. It is feared that the disease could spread to
areas where, at present, it does not occur [72]; as obvious from the recent incidence of
the disease from China showing that the threat is not baseless [326]. The whitefly
transmission studies conducted on both of these French lines (Dominique [AS0039]
and Haiti [AS0099]), wild relatives of G. hirsutum showed a highly resistant response
against CLCuD with no detectable levels of either virus or betasatellite by the
molecular diagnostics used irrespective of the number of whiteflies being used,
although with an increase in the number of whiteflies per plant there was a slightly
early start of infection (10-11 days post inoculation using 100 and 150 whiteflies per
plant) compared to the less number of whiteflies being used (14 days post inoculation
using 50 whiteflies per plant) in control, CIM 496 plants, to augment the number of
begomovirus-complex being delivered. These results are consistent with the work
done by Akhtar et al. [284] showing that both of these genotypes are highly resistant
to the whitefly transmission of CLCuD. This is a case of host-plant resistance as
situations where genetic polymorphism for susceptibility has been observed within the
same gene pool, some of the genotypes are susceptible while the others are resistant
against a particular virus (pathogen), is referred to as “Host-plant resistance” [247].
The sequenced clones of begomvirus-complex obtained here in the present
work when analyzed were found isolates of CLCuBuV thus show that, in the time and
region where the study was conducted, CLCuBuV and its cognate betasatellite
CLCuMuBBur was responsible for disease incidence. These results are very much
consistent knowing about the current distribution of CLCuD associated
begomoviruses in the subcontinent; only CLCuBuV complex is responsible for the
disease incidence of cotton crops in the Punjab province of Pakistan [156, 290].
However begomovirus other than CLCuBuV have also been identified in the Sindh
province of Pakistan [291] and north-western regions of India [233, 234].
79
4 Analysis of Resistance in Dominique and Haiti by Grafting
Figure 4-5 Southern blot hybridization of DNAs samples extracted from the leaves of cotton plants probed for the presence of Cotton leaf curl Burewala virus (CLCuBuV,
blot a) and Cotton leaf curl Multan betasatellite (CLCuMuB, blot b). The DNA samples were extracted from the graft (infected CIM 496 used as scions on
Dominique and Haiti; lanes 1 and 12 in both blots a and b), healthy non-graft-inoculated plants of Dominique and Haiti (lanes 2 and 7 in both blots a and b),
symptomatic leaves of graft- inoculated plants of Dominique and Haiti collected 40 days post-appearance of the first symptoms of the disease (lanes 4,5 and 6, and lanes 9,10 and 11, respectively, in both blots a and b), non-symptomatic leaves of graft-inoculated plants of Dominique and Haiti collected 40 days post-appearance of the
initial symptoms of the disease (lanes 3 and 8, respectively, in both blots a and b). A sample extracted from a symptomatic, field infected CIM 496 was run as a control
(lane 13 in both blots a and b). Approximately 10 µg of DNA was loaded in each case with a photograph of the genomic DNA bands on the ethidium bromide stained
agarose gel shown below each blot to confirm equal loading. The virus and satellite DNA forms are labelled as open-circular (oc), super-coiled (sc) and single-stranded
(ss).
80
4 Analysis of Resistance in Dominique and Haiti by Grafting
Graft inoculation has been found to be an efficient mean of introducing a virus
(pathogen) to plant species where efficient means of introducing cloned viruses
(pathogens), the most important of which is agrobacterium mediated inoculations, and
biolistic inoculation to an extent, are absent. The improved bottle graft inoculation
technique was used here to investigate the mechanism of resistance of these French
lines against CLCuD causing viruses. Similar work has also been reported earlier
[284] which was different from the present work. The previous study regarding graft
inoculation in both Dominique and Haiti reported mild symptoms of CLCuD but were
not studied at the molecular level, PCR and most importantly the highly sensitive
RCA/PCR diagnostics, Southern blot hybridization and sequencing. However, in the
present study not only the presence and replication of the begomovirus-complex have
been ensured but also these viral components have been cloned and sequenced to
confirm the begomovirus-complex inoculated through the infected scion (CIM 496)
and recovered from these mildly symptomatic Dominique and Haiti plants to be
CLCuBuV and its cognate betasatellite. Similar technique was also used to investigate
resistance of G. arboreum cv. Ravi against CLCuD causing begomoviruses [240]. In
both cases the symptoms of the disease initiated from the older leaves close to the
symptomatic scions. However, in case of G. arboreum cv. Ravi the symptomatic
spread of the disease was restricted to very few leaves slightly away from the site of
inoculation (symptomatic scions) while in case of both of these French lines the
disease spread symptomatically to distal parts of the plants farther away from the site
of inoculation (symptomatic scions). However the top most leaves, just like the case
in G. arboreum cv. Ravi, remained asymptomatic with no detectable level of the
begomovirus-complex through direct PCR showing the importance of these
germplasm for breeders.
Graft inoculation on the other hand induced mild symptoms of CLCuD,
slightly severe in comparison to the mild symptoms induced in G. arboreum cv. Ravi
[240], along with molecular detection of the begomovirus-complex in both of these
French lines shows that the resistance in both of these lines is due to the mechanism
of the delivery of the begomovirus-complex to the plant species i.e. by the insect
vector (Bemisia tabaci). Similar results have also been reported in case of G.
arboreum Ravi where graft inoculation induced mild symptoms of the disease with
molecular detection of begomovirus-complex and the insect vector failed to do so
81
4 Analysis of Resistance in Dominique and Haiti by Grafting
[240]. The difference between the two techniques, graft inoculation and whitefly
inoculation, mainly is the amount (number of begomovirus-complex) of virus being
delivered by both. Graft inoculation, once the union between the symptomatic scion
and rootstock has been established; continuously deliver a much higher amount of
begomovirus-complex to the plant. In contrast whiteflies deliver comparatively much
smaller amount of virus and also in a discontinuous and dispersed manner (each insect
delivering virus at a different site). In case of Tomato yellow leaf curl virus (TYLCV),
a monopartite begomovirus, single whiteflies are estimated to harbour 1.6ng of virus
at most [292] and deliver an even smaller amount of this virus to plants during a
single feed. Symptomatic infections have been found to be dose dependent in most of
the host virus systems [293, 294].
The levels of begomovirus-complex, CLCuBuV and CLCuMuB, detected by
Southern blot hybridization in the symptomatic tissues only of both of these lines,
Dominique and Haiti, were significantly lower than in symptomatic G. hirsutum CIM
496. On the other hand only RCA/PCR have successfully amplified begomovirus-
complex from the non-symptomatic tissues in both of these genotypes where direct
PCR amplification was not possible; signifying an even further low titre of the
begomovirus-complex to be detected by Southern blot hybridization. From the
comparatively low titre of begomovirus-complex in both of these lines it can be
deduced that either the virus was restrained and only a small amount of the
begomovirus-complex infected few cells only or these genotypes are supporting the
virus replication but to a very limited extent just like the graft inoculation studies in
G. arboreum cv. Ravi which showed extremely low level of virus accumulation [240].
The very limited replication of begomovirus-complex in these genotypes indicate that
host-plant resistance is operating limiting the number of begomovirus-complex and
ultimately the number of cells being infected as was also reported in G. arboreum cv.
Ravi [240]. However, the replicative forms obtained here through Southern blot
hybridization suggest that both of these genotypes support the replication of the
begomovirus-complex as was also the case in G. arboreum cv. Ravi [240].
Betasatellite is the key to induce and augment the characteristic symptoms of
disease in the primary hosts and this function is attributed to βC1 protein which is a
dominant symptom determinant [99, 100]. The βC1 protein is attributed to be
involved in the movement of virus, as an inducer of disease symptoms and as a
82
4 Analysis of Resistance in Dominique and Haiti by Grafting
suppressor of gene silencing [82, 103]. The begomoviruses causing CLCuD needs
CLCuMuB to efficiently induce the symptomatic infection in G. hirsutum without
which the virus is poorly infectious [53, 229]. The βC1 protein expressed from Potato
virus X vector induced the symptoms typical of CLCuD in tobacco [297]. The
symptoms induced in both of these genotypes are more likely to be induced by the
βC1 protein, which are very much typical of the symptoms of CLCuD induced in G.
arboreum cv. Ravi reported recently [240] and also in susceptible genotypes of G.
hirsutum.
None of the graft removed plants in both of the French lines showed recovery
from the already established symptoms, unlike the case in some of the graft removed
plants from G. arboreum cv. Ravi where the already established symptoms in some of
their leaves recovered [240]. The systemic spread of the disease, though very mild in
comparison to the initial point of infection (symptomatic leaves on branch 1 in Figure
4.2) in both of the genotypes, Dominique and Haiti plants, to the leaves on the
following branch (branch 2 in Figure 4.2) and ultimate recovery in subsequent
growths (branch 3 and 4 in Figure 4.2 ) shows that host-plant resistance, with the most
possible involvement of RNA interference [299, 300], is involved overcoming the low
titer of the begomovirus-complex when its continuous supply is blocked by the
removal of the grafts. Almost a similar recovery of disease phenotype was also
observed in G. arboreum cv. Ravi plants when the grafts were removed. The
difference between the two is that in G. arboreum cv. Ravi plants the recovery of the
disease phenotype was immediate with no subsequent growth showing any visible
symptoms of disease when the grafts were removed contrasting the case in both of
these French lines where the recovery of disease phenotype was slightly delayed
showing that the level of resistance in the former is stronger than the later. However,
the involvement of other mechanisms of resistance such as R-gene-mediated [306] or
non-R-gene-mediated (other host-protein mediated) can also be the case in both of
these genotypes. Several ecotypes in Arabidopsis thaliana have been found to resist
potexviruses by expressing lectin proteins (JAX1) interfering with the replication of
virus [308].
The resistance response incited by resistant tomato lines, with introgression of
resistance genes (Ty-1, Ty-2, Ty-3, Ty-4 and Ty-5) from wild accessions of Solanum
chilense [302, 327], against Tomato yellow leaf curl virus (TYLCV) infestation is not
83
4 Analysis of Resistance in Dominique and Haiti by Grafting
associated with hypersensitive response (HR), classical Resistance (R) genes
mediated response, contrasting the involvement of R genes [303]. In addition nearly
all of the TYLCV resistant lines of tomatoes were reported to support its replication
[328, 329]. Although the results produced here cannot entirely rule out the possible
involvement of R genes, it is very much unlikely to be the major factor involved in
the resistance of Dominique and Haiti against CLCuBuV complex.
From the results obtained here it is evident that the resistance in both of these
French lines, host-plants, impede either with cell-to-cell movement or replication of
begomovirus-complex in a very similar fashion reported in G. arboreum cv. Ravi, non
host-plant [240], and has nothing to do with either long distance systemic spread of
the begomovirus-complex through phloem or the mechanism by which insect vector
deliver/inoculate begomovirus-complex to the plant. To attain a symptomatic
infection in both of these French lines a threshold titre of the begomovirus-complex is
required, which is probably beyond the reach of whitefly mediated virus inoculation
to induce symptoms in glasshouse or field condition. To identify the mechanism of
these responses, difference in the level of resistance between these French lines
(tetraploid) and G. arboreum cv. Ravi (diploid) and incorporation of resistance in
cultivated varieties of G. hirsutum will be the subject of future interest.
84
CHAPTER 5 Investigation of Resistance to Cotton Leaf Curl Disease in
Cotton Using Biolistic Inoculation
5 Investigation of Resistance to Cotton Leaf Curl Disease in Cotton Using Biolistic
Inoculation
5.1 Introduction One of the major biotic hurdles, causing a substantial loss to cotton industry in
Pakistan and India, is CLCuD [330]. The disease with first noticeable epidemic in
Pakistan during the 1980s occurred frequently as multiple infections of monopartite
begomoviruses (seven distinct species identified) coalescing with cotton leaf curl
Multan betasatellite (CLCuMuB), a symptom modulating betasatellite [109]. The
deployments of resistant cotton varieties, using different exotic germplasm including
LRA 5166, CP15/2 and Cedix in the late 1990s, were very promising against CLCuD
reinstating cotton production to the pre-epidemic levels [311]. However, the
resistance offered by these exotic germplasm was not long lasting and from 2001
onwards, CLCuD reverted on all the previously resistant varieties in a more
overwhelming form known as the “Burewala” strain [232].
Agroinoculation (using Agrobacterium tumefaciens), to deliver cloned viral
DNAs as partial or complete dimers into host plant, is predominantly used [331, 332]
producing the genome-sized viral DNAs. The first ever successful transformation of
rice following agroinoculation was achieved in 1993 producing several fertile plants
[333]. Since then it has been the method of choice for the transformation of cereals
especially wheat, maize and rice. Geminiviruses uses specific insect vectors for their
natural transmission to host plants, however agroinoculation has been used as a
preferred method, in case of cloned viral genomes, to carry out the infectivity analysis
to determine their host range. Nevertheless agroinoculation sometimes fail to induce
infections in some of the host plants using dimeric clones from some of the
geminiviruses mentioned below. Infectious clones of Tomato golden mosaic virus
(TGMV) DNA-A and DNA-B fails to induce infection in tomato, following
agroinoculation, in spite of being a natural host of TGMV [214], however, biolistic-
inoculation of these clones produced symptoms typical of TGMV in tomato [334].
85
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
Same is the case with Tomato leaf curl New Delhi virus (ToLCNDV DNA-A) and
CLCuMuB where agroinoculation fails to induce symptoms in tomatoes [334]
compared to their biolistic- inoculation inducing the disease symptoms [103]. Adding
to these agroinoculation not only demands an extensive labour to clone tandem repeat
constructs of viral DNAs into binary vectors but also is a potential threat in itself
causing infections in some of the hosts [335] which has been shown to possibly
overcome the natural resistance of several wild species of tomato when
agroinoculated with tandem repeats of cloned TYLCV DNA [89]. The highly
recalcitrant nature of cotton to agroinoculation and concerns of host-range specificity
linked to agrobacterium-mediated transformation can be easily overcome by biolistic-
inoculation procedure [336].
One of the lately developed techniques for the inoculation of the cloned DNA
into plants is particle bombardment/particle acceleration [337]. Gilbertson et al. [338]
reported the first successful use of this technique with clones of Bean golden mosaic
virus (BGMV), inoculating radicles of the germinating seeds. This technique was also
used to inoculate rice seedlings with a very limited success rate, only one out of 200
plants being infected, following bombardment with Rice tungro bacilliform virus
(RTBV), a badnavirus [339]. The partial success in rice, whether due to its
monocotyledonous nature or the badnavirus itself, is not very clear. High inoculation
efficiency was achieved, for the bipartite begomoviruses, using biolistic inoculation of
either unit-length (monomer) or tandem repeats (dimer) of cloned begomoviruses,
thus eliminating the need for excessive DNA manipulations and assisting the genetic
analysis of begomoviruses [340]. The first ever biolistic inoculation of a monopartite
begomovirus was reported for Tomato leaf curl Karnataka virus (TLCKV)in 2002
[341]using cloned monomeric DNA. Morilla et al. [342] reported the first biolistic
inoculation of plants with dimeric forms of DNA cloned from Tomato yellow leaf curl
virus (TYLCV)-Alm (Almeria isolate), TYLCV-Mld (mild strain) and Tomato yellow
leaf curl Sardinia virus (TYLCSV). Lapidot et al. [343] most recently reported the
first biolistic inoculation of cloned monomeric linear or closed-circular form of
TYLCV double-stranded DNA in Tomato (Solanum lycopersicum) and Datura
(Datura stramonium) plants, with an inoculating efficiency of 40% and 85%,
respectively. Successful biolistic-inoculation of cotton (S-12 plants), using infectious
clone of CLCuD-associated monopartite begomovirus (CLCuMuV), was reported at
86
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
John Innes Centre with very low percentage of infectivity [344]. Mansoor et al. [109]
also reported successful biolistic- inoculation of cotton (S-12) and Nicotiana
benthamiana using infectious clones of CLCuMuV, CLCuKoV and Papaya leaf curl
virus (PaLCuV).
The present study was intended to investigate the potential of biolistic, as an
alternative approach, for direct inoculation of CLCuBuV, the resistance breaking
strain of CLCuD, and CLCuKoV, old strain of CLCuD, into the selected germplasm
of cotton to get an insight into the mechanism of their resistance against CLCuD
under controlled conditions.
87
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
5.2 Materials and Methods
5.2.1 Test Plants and the Monopartite Begomoviruses Used in this Study
Seeds from different germplasm of cotton, including G. arboreum cv. Ravi, G.
hirsutum cvs. Dominique, Haiti, Coker and S-12, were obtained from both NIBGE
(National Institute for Biotechnology and Genetic Engineering) and NIAB (Nuclear
Institute for Agriculture and Biology) and grown in small pots having a proper
combination of silt, clay and sand in an insect proof greenhouse.
Infectious clone of Cotton leaf curl Burewala virus (CLCuBuV; AM421522;
[156]) and its cognate betasatellite CLCuMuBBur (AM774307; [156], as tandem
repeats (dimers), in a binary vector, pGreen0029.
Infectious clone of Cotton leaf curl Kokhran virus (CLCuKoV; AJ 496286;
[109]) and its cognate betasatellite (CLCuMuBMul, AJ298903; [345]), as tandem
repeats (dimers), in a binary vector, pBin19.
CLCuBuV/CLCuMuB (HF569171 and HF912232, section 3.3.4, Chapter 3)
maintained in severely infected plants of cotton, G. hirsutum CIM 496, in the
greenhouse.
5.2.2 Extraction of DNA
DNA was extracted from leaf samples using the CTAB method [235]described in
detail earlier (Chapter 2, section 2.5).
5.2.3 Rolling Circle Amplification (RCA) of Total DNA Extracted from G. hirsutum CIM 496
Begomovirus from CIM 496 confirmed to be CLCuBuV/CLCuMuBBur (HF569171
and HF912232; chapter 3, section 3.3.4) with circular DNA molecules, serving as a
template for ɸ29 DNA polymerase from bacteriophage [346], was first amplified by
RCA (Chapter 2, section 2.7.1) using the above mentioned enzyme and random
hexamer primer (RHP; [239]). The resulting concatameric product was used for
biolistic-inoculation.
88
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
5.2.4 Biolistic-Inoculation and Maintenance of Plants
The gold particles (1μm, INBIO Gold, Victoria), used as microcarrier, for biolistic-
inoculation were prepared as described in detail earlier (Chapter 2, section 2.1). The
corresponding viral DNAs (CLCuBuV/CLCuMuBBur and CLCuKoV/CLCuMuBMul)
were precipitated onto it and the resulting gold/DNA mix was bombarded to cotton
seedlings at the first 2-3 true leaf stage detailed earlier (Chapter 2, section 2.2) using
helium pressure-based apparatus (Helios Biolistic PDS-1000; Bio-Rad, Hercules, CA)
with 28mm Hg of vacuum. The gold/DNA mix was bombarded to cotton seedlings at
pressure of 450 psi maintaining ~ 3-4cm of distance between the rupture disc and
plant target.
Seedlings of Ravi, Dominique, Haiti, Coker and S-12 at the first and second
true leaf stage were inoculated with infectious clones of CLCuBuV/CLCuMuBBur and
CLCuKoV/CLCuMuBMul as dimers in binary vectors; pGreen0029 and pBin19,
respectively, as well as RCA product of CLCuBuV/CLCuMuBBur. A total of 40 plants
each of Ravi, Coker and S-12 (along with 5 plants each as controls without
inoculation from each of the genotype) and 30 plants each of Dominique and Haiti
(along with 2 plants each as controls without inoculation from each of the genotype)
for each of the two viral constructs were used for inoculation. The same numbers of
plants from the mentioned genotypes were used for inoculation with RCA product of
CLCuBuV/CLCuMuBBur except for Dominique and Haiti where the number of plants
were reduced to 20 each. Following biolistic inoculation the plants were transferred to
insect-proof greenhouse and kept under thorough observation for the appearance of
symptoms of cotton leaf curl disease (CLCuD) if there is any. The observations were
taken daily following inoculation for the first month and then every 2-3 days till the
end of the experiment (~ 10 weeks post-inoculation [pi]).
5.2.5 Whitefly Transmission Assay of CLCuKoV in S-12 and CIM 496 Plants
The whitefly transmission assay was performed as described in detail earlier (Chapter
4, section 4.2.2) using acquisition access period (AAP) and inoculation access period
(IAP) for ~ 72 hours. The S-12 plants infected with CLCuKoV/CLCuMuBMul
(following biolistic-inoculation) were used as the source of inoculum to transmit the
disease to healthy S-12 and CIM 496 plants using viruliferous adult whiteflies. Five
89
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
each of S-12 and CIM 496 plants, with 50 whiteflies per plant, were used for whitefly
infestation.
5.2.6 Phenotypic Scoring of Disease and Molecular Diagnostics
The plants were shifted to greenhouse following biolistic- inoculation and whitefly
infestation and scored for the appearance of visible symptoms of the disease regularly.
Molecular diagnostics of the begomovirus-complex, using primers pairs
CLCV1/CLCV2 [240] and Beta01/Beta02 [241] for virus and betasatellite,
respectively, were carried out at different intervals. To be absolutely sure of the
presence or absence of begomovirus-complex in inoculated plants RCA/PCR
described in detail earlier (section 3.2.3, chapter 3) was also used.
90
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
5.3 Results
5.3.1 Biolistic-Inoculation Using Dimers of Begomovirus-Complex
No symptomatic evidence of the initiation of CLCuD was observed in any single
plant of G. arboreum cv. Ravi, G. hirsutum cvs. Dominique and Haiti inoculated with
Cotton leaf curl Burewala virus (CLCuBuV) and Cotton leaf curl Kokhran virus
(CLCuKoV) along with their cognate betasatellites, cotton leaf curl Multan
betasatellites (CLCuMuBBur and CLCuMuBMul), from the time of inoculation to the
end of the experiment (~ 10 weeks post-inoculation [pi]; Table 5.1).
The situation was very much the same in all of the G. hirsutum cvs. Coker and
S-12 plants inoculated with CLCuBuV/CLCuMuBBur. However the situation was
different when Coker and S-12 plants were inoculated using
CLCuKoV/CLCuMuBMul. The initiations of symptoms of CLCuD were evident
almost 21 and 19 days pi in 4 of Coker and 7 of S-12 plants in the newly emerging
leaves (Table 5.1).
The symptoms were mild in the form of small enations on the underside of
leaves in case of both Coker and S-12 plants encircled in red (Figure 5.1, on the left,
panel a and b). Almost 1 month pi all the biolistic- inoculated plants (Ravi,
Dominique, Haiti, Coker and S-12) were transferred to larger earthen pots and kept
under observation till the end of the experiment (~ 10 weeks pi). Recovery of disease
phenotype was observed in all 4 of the Coker (Figure 5.1, in the middle, panel a) and
3 of the S-12 plants with no systemic spread of the disease to the newly emerging
leaves (following the leaves with initial mild symptoms of the disease) almost 45 days
pi. However the rest of the 4 S-12 plants (with mild symptoms) were observed to have
a systemic spread of the disease to the newly emerging leaves 45 days pi encircled in
red (Figure 5.1, in the middle, panel b) and almost 70 days pi full blown symptoms of
the disease, characterized by leaf rolling and cupping, enhanced vein thickening and
darkening, and plant stunting (Figure 5.1, on the right, panel b), were observed in S-
12 plants compared to Coker plant (Figure 5.1, on the right, panel a).Molecular
diagnostics, using PCR and the most sensitive RCA/PCR [240], was carried out with
inoculated plants of Ravi, Dominique, Haiti, Coker and S-12 sampled at 25, 50 days
pi and at the end of the experiment (10 weeks pi). Neither of the
CLCuBuV/CLCuMuBBur or CLCuKoV/CLCuMuBMul inoculated plants of Ravi,
91
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
Dominique and Haiti produced the expected products (~1100nt for virus and ~1350nt
for betasatellite) with primer pairs CLCV1/CLCV2 [240] and Beta01/Beta02 [241]
following both direct PCR and RCA/PCR. All of the Coker and S-12 plants (Table
5.1) inoculated with CLCuBuV/CLCuMuBBur was also found negative for the
presence of begomovirus/betasatellite following PCR and RCA/PCR. However only
the 4 and 7 mildly symptomatic plants of Coker and S-12, inoculated with
CLCuKoV/CLCuMuBMul, produced the expected products (~ 1100nt for virus and
~1350nt for betasatellite) following both direct PCR and RCA/PCR25 days pi. The
remaining CLCuKoV/CLCuMuBMul inoculated plants of Coker and S-12 with no
symptoms (36 and 33 plants, respectively) were unable to yield the expected products
using PCR and RCA/PCR 25 days pi. However after the recovery of disease
Table 5.1 Biolistic inoculations of cotton plants using cloned dimers of CLCuBuV and CLCuKoV in binary vectors as well as rolling circle amplified (RCA) DNA from
CLCuBuV-infected CIM 496 plants under vacuum.
phenotype in all 4 and 3 of the mildly symptomatic Coker and S-12 plants,
respectively, direct PCR and even RCA/PCR was not able to produce expected
products in those recovered plants 50 days pi and at the end of the experiment (10
weeks pi). The remaining 4 of the CLCuKoV/CLCuMuBMul inoculated S-12 plants
where the systemic spread of the disease was observed 45 days pi were able to yield
the expected products (~ 1100nt for virus and ~ 1350nt for betasatellite) with both
direct and indirect RCA/PCR 50 days pi and at the end of experiment (10 weeks pi).
92
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
The remaining CLCuKoV/CLCuMuBMul inoculated Coker and S-12 plants (36 and 33
plants, respectively) were unable to yield the expected products using PCR and
RCA/PCR 50 days pi and at the end of experiment (10 weeks pi).
Figure 5-1 Photographs showing symptoms of disease in the form of small enations on the undersides of leaves in both Coker and S-12 plants (panels a and b, on the left)
21 and 19 days pi, respectively, systemic spread of disease to the newly emerging leaves in S-12 plant as vein thickening and upward cupping of leaves 45 days pi (panel b, in the middle) compared to Coker plant (panel a, in the middle) and full
blown symptoms of disease almost 70 days pi in S-12 plant (panel b, on the left) as enhanced vein thickening and darkening, leaf rolling and cupping, and plant stunting
compared to Coker plant (panel a, on the left). The red circles denote features described in the text.
5.3.2 Biolistic-Inoculation Using RCA of the Total DNA from Infected Plants of CIM 496
Purified RCA products amplified from the total DNA of symptomatic leaves of
CLCuBuV/CLCuMuBBur infected CIM 496 was also used for biolistic- inoculation of
the above mentioned plants. The numbers of Ravi, Coker and S-12 plants (along with
5 plants from each of the genotypes as control with no biolistic- inoculation)
inoculated were the same except Dominique and Haiti where the number of plants
inoculated were reduced due to limited availability of the seeds (Table 5.1). No
93
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
Visible symptoms of CLCuD were seen, following thorough observations in the
greenhouse, in any single plant of Ravi, Dominique, Haiti, Coker and S-12 from
inoculation till the end of the experiment (10 weeks pi). The aseptic nature of these
plants was also ensured by molecular diagnostics, PCR and RCA/PCR, using specific
primer pairs mentioned earlier 25, 50 days pi and at the end of the experiment (10
weeks pi).
5.3.3 Bombarded Plants as a Source of Inoculum for Acquisition and Transmission by Whiteflies
All 5 plants of S-12 were infected following whitefly transmission of
CLCuKoV/CLCuMuBMul; however, all of the 5 CIM 496 plants remained
asymptomatic (healthy) throughout the experiment (~ 2 months post inoculation).
Molecular diagnostics, PCR and RCA/PCR using primer pairs CLCV1/CLCV2 [240]
and Beta01/Beta02 [241], produced the expected products (~ 1100nt for virus and ~
1350nt for betasatellite) but only from all 5 of infected S-12 plants and none from any
single of the 5 asymptomatic plants of CIM 496 ~ 30 and 60 days post inoculation.
The purpose of this study was to show how long it takes for the whitefly to get the
initial as well as full blown symptoms of the disease in comparison to biolistic-
inoculation. The initiation of symptoms of CLCuD in all 5 of the S-12 plants were
evident ~ 13-14 days post inoculation as mild vein thickening which became severe
within the next ~ 40-45 days post inoculation; characterized by intense vein
thickening, leaf rolling and cupping (Result not shown).
94
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
5.4 Discussion The study tested the ability of CLCuBuV/CLCuMuBBur and
CLCuKoV/CLCuMuBMul, monopartite begomoviruses cloned as dimers in binary
vectors, to infect different germplasm of cotton, the highly resistant Ravi, Dominique
and Haiti, and highly susceptible Coker and S-12 genotypes, using the commercially
available Gene Gun (Helios Biolistic PDS-1000; Bio-Rad, Hercules, CA), as an
attempt to get an insight into the underlying mechanism of their resistance against
CLCuD. Similarly using ɸ 29 DNA polymerase from bacteriophage the total nucleic
acid from CLCuBuV/CLCuMuBBur-infected plants of CIM 496 was also amplified by
rolling circle amplification (RCA) and inoculated to the above mentioned germplasm
of cotton under same conditions.
The highly resistant nature of Ravi also determined through field trials [240],
Dominique and Haiti also determined through whitefly transmission assay (section
4.3.1, Chapter 4), following biolistic- inoculation, scored by the absence of visual
phenotypic symptoms of CLCuD and molecular diagnostics (PCR and sensitive
RCA/PCR), shows the likely involvement of resistance, possibly contributed by
resistance (R)-genes [305, 306], or lectin proteins; certain ecotypes of Arabidopsis
thaliana produces lectin proteins (JAX1) to resist various potexviruses [308]. There is
a phenomenal difference between biolistic- and whitefly- inoculation procedures;
whiteflies inoculate/inject the begomovirus-complex directly into the phloem cells
from where it is translocated to different parts of the plant contrasting biolistic-
inoculation delivering begomovirus-complex to the non-phloem cells where it needs
to be replicated to reach phloem cells for translocation to the remote parts of the plant.
The resistance response from Ravi, Dominique and Haiti against
CLCuBuV/CLCuMuBBur and CLCuKoV/CLCuMuBMul is very much understandable
due to the fact that very mild symptoms of CLCuD were evident in Ravi [240] and
French lines, Dominique and Haiti (chapter 4), following grafting that consistently
delivers a much higher amount of the begomovirus-complex directly into the phloem
contrasting both whitefly and biolistic-inoculation procedures delivering a much more
smaller amount of the begomovirus-complex.
On the other hand a very small number of Coker and S-12 (10% and 17.5%,
respectively) plants showed very mild symptoms of CLCuD in which none of Coker
95
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
and only 4 of the S-12 plants were able to develop full blown systemic infection with
a slight delay for few days during the onset as well as development of full blown
symptoms of the disease compared to whitefly transmission of the virus, following
biolistic-inoculation with cloned dimers of CLCuKoV/CLCuMuB. The slight delay
during the initiation as well as fully established systemic infection compared to
whitefly transmission of the same begomovirus-complex might be a contribution of
several factors. One of the key factors might be the lack of capsid protein which has
been reported to be an important nuclear shuttle protein shuttling the viral DNAs into
and out of the nucleus; the capsid protein of Tomato yellow leaf curl virus (TYLCV)
was shown to be an important nuclear shuttle protein [194, 347]. The second
important factor causing the delay might be the lower amount of viral DNAs reaching
to the nuclei of the host plant following biolistic- inoculation compared to whitefly
transmission of the virus; TYLCV infecting tomato and datura plants produced
delayed symptoms of disease following biolistic- inoculation compared to its whitefly
transmission [343].
Bipartite begomoviruses have been found, in most cases, to have a higher rate
of infectivity compared to monopartite begomoviruses following biolistic- inoculation;
Tomato mottle virus (ToMV), a bipartite virus, infected approximately 58% (8/14) of
tomato plants compared to Tomato yellow leaf curl virus (TYLCV), a monopartite
virus, infecting only 5% (2/40) of tomato plants following biolistic- inoculation using
RCA-enriched total DNA from infected tomato leaves [348]. Cotton plants inoculated
with Cotton leaf crumple virus (CLCrV), a bipartite virus of Western Hemisphere,
have shown 100% (16/16) infectivity rate following biolistic- inoculation [349]. It can
be speculated, might not be the case, that the lower rate of infectivity in these cotton
plants might be due to the monopartite nature of the begomovirus used in this study.
However, cloned dimers of CLCuBuV in pGreen29, found infectious when
agroinoculated into Nicotiana benthamiana, N. glutinosa and N. tabacum [156], and
RCA-enriched total nucleic acid from CLCuBuV-infected CIM 496 plants failed to
induce CLCuD in Coker and S-12 following biolistic- inoculation with reasons very
much unknown. Some previous studies, following biolistic- inoculation with infectious
clones of monopartite begomoviruses (CLCuMuV, CLCuKoV and PaLCuV), have
also reported lower infectivity in cotton (S-12; [109, 344]). Previous studies have used
pre-resistance breaking species of the CLCuD-causing begomoviruses, and as
96
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
infectious clones only but no RCA product. However, in the present study both pre-
and post-resistance breaking species, both as infectious clones as well as RCA
product (in case of CLCuBuV), were used. Similarly in the previous study only highly
susceptible germplasm of cotton were inoculated but in the present study both
susceptible and highly resistant germplasm of cotton were inoculated.
Recovery of disease phenotype was observed in all of mildly symptomatic
Coker (4 plants) and 3 of the S-12 plants with no evidence of CLCuD in the newly
emerging leaves, following the initial few leaves with mild symptoms, suggests the
low titre of the begomovirus-complex and possible involvement of posttranscriptional
gene silencing (PTGS), RNA-interference. The absence of begomovirus-complex in
those non-symptomatic leaves by molecular diagnostics, PCR and RCA/PCR,
somehow confirms the involvement of these forces overcoming the low titre of
begomovirus-complex. The remission of symptoms had also been witnessed in plants
infected by Pepper golden mosaic virus (PepGMV) in several cases [350, 351], where
the recovered plants have shown either a complete disappearance or decline of
symptoms in the newly emerging leaves after the first two or three symptomatic
leaves. Recovery of hosts from viral infections have also been reported in numerous
systems of host-virus interactions [161, 352], counting geminiviruses [301, 351], and
also in transgenic plants injected by viral replicons comprising the transgene [353,
354]. The recovery phenomenon in most of these cases have been explained as
posttranscriptional gene silencing (PTGS; [355-357]), a specific RNA-degradation
procedure directed by double stranded RNA (dsRNA), generating 21- to 25-
nucleotide long RNA fragments known as small interfering RNAs (siRNAs; [161,
358]). The remaining 4 of the S-12 plants developing full blown symptoms of the
disease, with reasons very much unknown, suggest a possible escape from RNA-
interference.
Whitefly transmission of disease to S-12 plants by back-indexing shows that
biolistic-inoculated (4 of the S-12 plants with full blown symptoms of the disease)
plants can also be used as a source of virus for whitefly transmission of the disease.
The failure in whitefly transmission of disease to CIM 496 plants further confirms the
virus to be transmitted (from biolistic-inoculated S-12 to healthy S-12 plants) is
CLCuKoV/CLCuMuBMul as CIM 496 is resistant to the virus complex causing the
97
5 Biolistic-Inoculation to Evaluate Cotton Germplasm
disease pre-resistance breaking [359] but highly susceptible to the new, Burewala
strain [284].
The results indicated a successful biolistic- inoculation, though with a limited
rate of success in the susceptible germplasm of cotton, needs improvements to
increase the efficiency of the procedure. Once improved, this procedure can ease the
screening of resistant germplasm of cotton against CLCuD under controlled
conditions.
98
CHAPTER 6 General Discussion
6 General Discussion
Cotton, contributing significantly to the local textile industries with significant
influence on the labor employment sector, is the principal component of foreign
exchange via exports as lint and textile products. Pakistan’s economy, listed as the
fifth leading cotton grower worldwide according to the Economic Survey of Pakistan
[360], is heavily based on the production of cotton. Unfortunately the production of
cotton is under severe stress of CLCuD since its first epidemic in the mid-1980s till
now. The introductions of resistant cotton varieties in the late 1990s, produced by
conventional breeding programs, have shown promise refurbishing cotton production
to the pre-epidemic levels. The resistance however proved to be a slight pause and the
disease soon reappeared in an even more deadly shape, as CLCuBuV, in 2001. Since
then CLCuBuV is playing havoc with cotton crops throughout Pakistan and north-
western parts in India. It is very much possible that the begomovirus-complex might
find its way to areas where it is not present at present; as evident from its recent
introduction into China [326], a far more distantly located region from CLCuD
affected areas in India and Pakistan. The fear was even further promulgated when the
begomovirus-complex was reported in plants species other than cotton like China rose
(Hibiscus rosa-sinensis; [361]) and Brinjal (Solanum melongena; [362]), serving as
potent reservoirs where the virus can overwinter thus providing the primary source to
infect subsequent cotton crops.
Natural resistance and use of carriers (vectors) targeted insecticides to
alleviate begomoviruses induced losses to crops, cotton of course being a major
concern, have remained the main weapons. Concerns to the environment regarding
the excessive use of insecticides, in particular, and lack of suitable genes for
resistance in most of the crop species can possibly limit the use of these approaches in
future [363]. Most of the high yielding, but at the same time highly susceptible,
commercial cotton varieties introduced from the New World (NW) initiated the first
epidemic of CLCuD. The resistant cotton varieties on the other hand, released for
cultivation under conventional breeding programs and main players involved in the
99
6 General Discussion
second epidemic of CLCuD, also did not offer durable resistance due to several
factors; including the lack of knowledge underlying the molecular mechanism of
resistance and even most importantly due to higher propensity of begomoviruses for
recombination/mutation [364]. The dominance of CLCuBuV-induced infection in
cotton fields and lack of resistant germplasm, considering the case in hugely
cultivated tetraploids in particular, is an alarming concern for cotton growers in
Pakistan, in particular, as well as in north-western parts of India. Understanding the
molecular basis of resistance in these germplasm, before being utilized in breeding
programs to produce resistant varieties with durable resistance, is needed to properly
address the problem, CLCuD. Unfortunately the absence of infectivity system to
introduce cloned viruses in different germplasm of cotton has precluded us to
investigate mechanism of their resistance, the question yet to be answered. The
described work was instigated with that aim in mind, hoping from the outset that it
will be useful to combat the disease.
At present no single CLCuD-resistant G. hirsutum (upland cotton) lines have
become available to farmers following interspecific crosses with G. arboreum, scored
naturally immune with no single report of infectivity as yet by begomoviruses, to be
specific, and even geminiviruses, in general [284, 286-288]. Grafting is an efficient
mean of inoculation delivering a much larger amount of virus and is consistent in
comparison to much lower and highly dispersed delivery by its whitefly vector. A
genotype from G. thurberi and AS0349 (an Exotic accession of G. hirsutum) were
found highly resistant with no symptoms or any detectible level of virus when
exposed to whiteflies in fields compared to their graft- inoculation where they were
scored highly susceptible indicating a possible resistance against the whitefly vector
[284]. The study conducted here is in support of the work done by Akhtar et al. [284].
Resistance to the vector can either be complete, where resistance cannot be breached
by changing the number of viruliferous insect vectors, or partial, where resistance can
be breached by changing the number of viruliferous insect vectors, depending on the
host-plants. Melon plants exhibited complete resistance against the insect vector
Aphis gossypii transmitting non-circulative viruses [365] controlled by a single
dominant gene [366]. Maize and Solanum pimpinellifolium (accession LA1478) plants
on the other hand were reported to be partially resistant against plant hopper
(Peregrinus maidis), transmitting Maize mosaic virus (MMV) and Maize stripevirus
100
6 General Discussion
(MSV; [367]), and whitefly, transmitting Potato yellow mosaic virus (PYMV; [368]),
respectively. From the response of French lines (Dominique and Haiti) in the work
presented here it can be speculated, might not be the case, to be offering complete
resistance against the virus vector. However, exhibition of extremely mild symptoms
with ultimate recovery from disease symptoms in the work presented here (chapter 3,
section 3.3.3) shows possible involvement of additional forces of resistance in
operation.
RNA silencing/Post transcriptional gene silencing (PTGS), an adaptive
defence mechanism in plants against foreign genomes, is induced against viruses or
transgenes to protect host plants [264]. Small interfering (si) RNA, an intermediate of
the silencing pathway [264, 369], is the key feature of RNA silencing mechanism.
The work presented here, both in G. arboreum cv. Ravi and French lines (cvs.
Dominique and Haiti), have shown recovery of disease phenotype but still with
detectable levels of the begomovirus-complex consistent with most reports on RNAi
based resistance studies against geminiviruses where the plants were found
symptomless but still infected [370-373].
Following successful inoculation most plant viruses, moving locally from cell-
to-cell, stretch to vascular tissues, phloem in particular and also to xylem in very rare
cases, for distribution to other parts of the plants triggering systemic infection [374].
The resistance to movement displayed by host plants can either be local, preventing
cell-to-cell movement, or systemic, preventing long distance movement, depending
both on the invading pathogens and host plants. The 30kDa movement protein (MP)
of Tobacco mosaic virus (TMV) was found to mediate its cell-to-cell movement [375,
376] capable of modifying the size exclusion limit of plasmodesmata [377]. Tobacco
etch virus (TEV) was found to show a restricted long distance/systemic spread in the
Col-3 ecotype of Arabidopsis thaliana, with normal cell- to-cell movement, due to the
presence of a specific locus designated as RTM1 (restricted TEV movement 1; [378]).
The impaired systemic movement of Tomato leaf curl virus (TLCV) in FLA653, a
tomato breeding line supporting replication and local cell- to-cell movement of the
virus in inoculated leaves, was attributed to the presence of a recessive allele tgr-1
[379]. The presence of low titre of begomovirus-complex in grafted G. arboreum cv.
Ravi and both of the French lines in comparison to their respective controls, evident
from RCA/PCR diagnostics and Southern hybridization (Figure 3.7 and 4.5, chapter 3
101
6 General Discussion
and 4 respectively), and at the same time symptomatic infections in the second
healthy grafts (section 3.3.2, chapter 3), ruling out the possible involvement of
resistance to the systemic spread of begomovirus-complex, can be speculated to be
due to their resistance to the local spread of the begomovirus-complex.
Mutation and recombination, together with multiple infections in the fields,
are the main players of evolution producing a large number of variants of which the
fittest one, with selection based on vector population and host plants [380], are
recruited. The introduction and widespread cultivation of resistant host varieties, a
possible selection pressure, can introduce resistance breaking strains; as is evident
from the emergence of CLCuBuV in those resistant cultivars of cotton at Vehari
district [156]. Keeping these things in mind the completely sequenced clones of the
begomovirus-complex from G. arboreum cv. Ravi and both of the French lines
(section 3.3.4 and 4.3.3, chapter 3 and 4 respectively) when analysed, suspecting the
possible appearance of resistance breaking strain other than CLCuBuV or some other
major recombination events, were found to be isolates of the existing strain.
Owing to the highly recalcitrant nature of cotton to agroinoculation other
approaches of inoculation needs to be established to investigate the mechanism of
their resistance under controlled conditions. Following successful biolistic inoculation
of TGMV (Both DNA-A and B; [334]) and ToLCNDV (ToLCNDV DNA-A and
CLCuMuB; [103]) in tomatoes, where agroinoculation failed to do so using the same
viral clones [214, 334], this technique, less labor oriented with no host-specificities
attached, can be employed to explore the mechanism of resistance in different
germplasm of cotton. Higher rates of infectivity in plants have been reported with
bipartite begomoviruses than monopartite viruses in most cases; 58 % of tomato
plants were infected following biolistic inoculation with ToMV, a bipartite virus,
compared to 5% of its infectivity using TYLCV, a monopartite virus [348]. An
infectivity rate of even 100% was reported in cotton plants following biolistic
inoculation with a bipartite CLCrV from USA [349]. The lower rate of infectivity,
combined with infectivity in susceptible germplasm of cotton only (S-12 and Coker),
reported here can be the possible outcome of monopartite nature of the begomovirus-
complex as well as highly resistant nature of the resistant germplasm (G. arboreum
cv. Ravi and both of the French lines) of cotton.
102
6 General Discussion
The findings provide clues to breeders about the presence and level of
resistance in the tested germplasm evident from their responses to CLCuBuV (the
prevailing strain of CLCuD). Both of the French lines, tetraploids with no
incompatibility issues when triggered into interspecific crosses with cultivated
germplasm (productive but at the same time highly susceptible) and highly resistant
diploid genome of G. arboreum cv. Ravi, naturally immune to CLCuD in field, need
to be employed in conventional breeding programs to develop new resilient varieties,
hoping to be the ones, restraining the prevailing strain of CLCuD.
Improving the rate of infectivity of momopartite begomoviruses in cotton via
biolistics, ensuring interspecific crosses of the investigated germplasm of cotton and
analysing the behaviour of different possible siRNAs when triggered with infection in
G. arboreum cv. Ravi and both of the French lines (G. hirsutum cvs. Dominique and
Haiti), in comparison to their respective controls, should be the focus of future
studies.
103