tryptophan synthase in chlamydia angela ghrist lori scott

11
Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

Upload: lee-rodgers

Post on 18-Jan-2018

219 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

Tryptophan Synthase in Chlamydia

Angela GhristLori Scott

Page 2: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

BackgroundIntracellular parasites: viruses, bacteria (Chlamydias,

Rickettsias), and protozoa (plasmodia) (CDC website)Tryptophan biosynthesis genes are found to varying

degrees within the Chlamydiaceae family (“Kegg pathway” program)

Immune response of humans to Chlamydia infection involves the release of interferon. This activates an enzyme that degrades tryptophan, thereby reducing Chlamydia reproduction inside the host cell (PubMed)

Tryptophan is an essential amino acid in humans

Page 3: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott
Page 4: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

TaxonomyLineage (full): root; cellular organisms; Bacteria; Chlamydiae/Verrucomicrobia group;

Chlamydiae; Chlamydiae (class); Chlamydiales

Chlamydiaceae– Candidatus Clavochlamydia

• Candidatus Clavochlamydia salmonicola– Chlamydia

• Chlamydia muridarum • Chlamydia suis• Chlamydia trachomatis

– Chlamydophila • Chlamydophila abortus • Chlamydophila caviae • Chlamydophila felis • Chlamydophila pecorum • Chlamydophila pneumoniae • Chlamydophila psittaci

TaxBrowser in NCBI

Page 5: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

Available Genomes• Completed Candidatus Protochlamydia amoebophila UWE25 proteins;• Completed Chlamydia muridarum Nigg proteins; • Completed Chlamydia trachomatis A/HAR-13 proteins; • Completed Chlamydia trachomatis D/UW-3/CX proteins; • Completed Chlamydophila abortus S26/3 proteins; • Completed Chlamydophila caviae GPIC proteins; • Completed Chlamydophila felis Fe/C-56 proteins; • Completed Chlamydophila pneumoniae AR39 proteins; • Completed Chlamydophila pneumoniae CWL029 proteins; • Completed Chlamydophila pneumoniae J138 proteins; • Completed Chlamydophila pneumoniae TW-183 proteins

NCBI – Genomic Biology

Page 6: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

Enolase

NCBI - Genome Blast Search and Tree Building

Page 7: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

DendrogramEnolase

Unrooted tree (generated by Phylip's Drawtree)

Workbench, ClustalW

Page 8: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

ObservationThere are multiple serovars of Chlamydia

tachomatis, distinguished by route of infection.

QuestionAre there differences in their trp genes?

Page 9: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

Comparison of Ocular (A) and Genital (D) TrpA Genes

trpA_D CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTGtrpA_A CTTCTACAAAGGGACTTAGATTATCTACGCAGACTAAAAGACGCGGGAATAAATGGTGTG trpA_D TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCCATTTTTTGAAGATtrpA_A TGCGTTATAGATCTTCCAGCACCTTTATCACACGGAGAAAAATCTCC---TTTTGAAGAT trpA_D CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGGtrpA_A CTTTTAGCTGTAGGATTGGATCCTATTTTGCTTATTTCTGCAGGGACAACGCCGGAGCGG trpA_D ATGTCTTTAATACAAGAATACGCAAGAGGCTTTCTGTATTATATCCCATGTCAAGCTACGtrpA_A ATGTCTTTAATACAAGAACACGCAAGAGGCCTTCTGTATTATATCCCATA-CAAGCTACG

Page 10: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

Ocular vs. Genital Tryptophan Synthase

Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolatesJ. Clin. Invest. Harlan D. Caldwell, et al. 111:1757 doi:10.1172/JCI17993

Page 11: Tryptophan Synthase in Chlamydia Angela Ghrist Lori Scott

QuestionHas the Chlamydia L serovar that causes a

systemic lymph node infection retained the tryptophan synthase (trpA) gene like the genital serovars, as opposed to acquiring nonsense mutations like the ocular serovars?