transgenic papaya: a useful platform for oral vaccinesclassical approaches (greenwood 2014), i.e....
TRANSCRIPT
![Page 1: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/1.jpg)
ORIGINAL ARTICLE
Transgenic papaya: a useful platform for oral vaccines
Gladis Fragoso1• Marisela Hernandez1
• Jacquelynne Cervantes-Torres1•
Ruben Ramırez-Aquino2• Hector Chapula3
• Nelly Villalobos3• Rene Segura-Velazquez1
•
Alfredo Figueroa4• Ivan Flores8
• Herminio Jimenez2• Laura Adalid6
•
Gabriela Rosas7• Luis Galvez2
• Elias Pezzat2• Elizabeth Monreal-Escalante5
•
Sergio Rosales-Mendoza5• Luis G. Vazquez2
• Edda Sciutto1
Received: 24 August 2016 / Accepted: 31 January 2017 / Published online: 13 February 2017
� Springer-Verlag Berlin Heidelberg 2017
Abstract
Main conclusion Transgenic papaya callus lines
expressing the components of the S3Pvac vaccine con-
stitute a stable platform to produce an oral vaccine
against cysticercosis caused by Taenia solium or T.
crassiceps.
The development of effective delivery systems to cope
with the reduced immunogenicity of new subunit vaccines
is a priority in vaccinology. Herein, experimental evidence
supporting a papaya-based platform to produce needle-free,
recombinant, highly immunogenic vaccines is shown.
Papaya (Carica papaya) callus lines were previously
engineered by particle bombardment to express the three
protective peptides of the S3Pvac anti-cysticercosis vac-
cine (KETc7, KETc12, KETc1). Calli were propagated
in vitro, and a stable integration and expression of the
target genes has been maintained, as confirmed by PCR,
qRT-PCR, and HPLC. These results point papaya calli as a
suitable platform for long-term transgenic expression of the
vaccine peptides. The previously demonstrated protective
immunogenic efficacy of S3Pvac-papaya orally adminis-
tered to mice is herein confirmed in a wider dose-range and
formulated with different delivery vehicles, adequate for
oral vaccination. This protection is accompanied by an
increase in anti-S3Pvac antibody titers and a delayed
hypersensitivity response against the vaccine. A significant
increase in CD4? and CD8? lymphocyte proliferation
was induced in vitro by each vaccine peptide in mice
immunized with the lowest dose of S3Pvac papaya
(0.56 ng of the three peptides in 0.1 lg of papaya callus
total protein per mouse). In pigs, the obliged intermediate
host for Taenia solium, S3Pvac papaya was also
immunogenic when orally administered in a two-log dose
range. Vaccinated pigs significantly increased anti-vaccine
antibodies and mononuclear cell proliferation. Overall, the
oral immunogenicity of this stable S3Pvac-papaya vaccine
in mice and pigs, not requiring additional adjuvants, sup-
ports the interest in papaya callus as a useful platform for
plant-based vaccines.
Electronic supplementary material The online version of thisarticle (doi:10.1007/s00425-017-2658-z) contains supplementarymaterial, which is available to authorized users.
& Edda Sciutto
[email protected]; [email protected]
1 Instituto de Investigaciones Biomedicas, Universidad
Nacional Autonoma de Mexico, Av. Universidad 3000,
CP 04510 Mexico City, Mexico
2 Facultad de Medicina, Benemerita Universidad Autonoma de
Puebla, Calle 13 Sur 2702, CP 72420 Puebla, Mexico
3 Facultad de Medicina Veterinaria y Zootecnia, Universidad
Nacional Autonoma de Mexico, Av. Universidad 3000,
CP 04510 Mexico City, Mexico
4 Unidad Academica de Ciencias Quımico Biologicas,
Universidad Autonoma de Guerrero, Av. Lazaro Cardenas
s/n, CP 39087 Chilpancingo, GRO, Mexico
5 Laboratorio de Biofarmaceuticos Recombinantes, Facultad
de Ciencias Quımicas, Universidad Autonoma de San Luis
Potosı, Av. Dr. Manuel Nava 6, 78210 San Luis Potosı,
Mexico
6 Instituto Nacional de Neurologıa y Neurocirugıa, SSA,
Colonia la Fama, Delegacion Tlalpan, Mexico, DF, Mexico
7 Facultad de Medicina, Universidad Autonoma del Estado de
Morelos, Av. Universidad 1001, CP 62209 Cuernavaca,
MOR, Mexico
8 Facultad de Ciencias Agropecuarias, Universidad Autonoma
del Estado de Morelos, Av. Universidad 1001,
CP 62209 Cuernavaca, MOR, Mexico
123
Planta (2017) 245:1037–1048
DOI 10.1007/s00425-017-2658-z
![Page 2: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/2.jpg)
Keywords Cysticercosis � Embryogenic callus � Oralvaccine � Taenia solium � Taenia crassiceps
Abbreviations
DTH Delayed-type hypersensitivity
PBMC Peripheral blood mononuclear cell
Introduction
Vaccination is widely recognized as the most powerful tool
to prevent infectious diseases. By now, most of the effective,
commercially available vaccines were developed using
classical approaches (Greenwood 2014), i.e. attenuated or
inactivated virus, toxoids, and whole killed bacteria. How-
ever, classical vaccination approaches effectively protect
only against a few among the multitude of existing or
emerging pathogens, resulting in a persistent worldwide
morbidity and mortality by infectious diseases (WHO 2014).
The advances in the omics disciplines provide a significant
improvement in the identification and expression of
immunodominant target antigens critical for pathogen sur-
vival. With this knowledge, the development of subunit
vaccines is being greatly favored. Although such vaccines are
safer, they are usually less immunogenic than whole patho-
gen-based vaccines (Arama and Troye Blomberg 2014).
Therefore, attention is given to improve their efficacy using
new vaccine formulations and alternative immunization
routes. New approaches include the use of new delivery
systems to optimize the presentation of vaccine antigens
administered in a needle-free manner (Lebre et al. 2011). It is
also desirable to have delivery systems with adjuvant effects,
e.g. promoting some degree of inflammation and/or extend-
ing the antigen presence in the host (Rosales-Mendoza and
Salazar-Gonzalez 2014). Different delivery systems exhibited
some of these properties, in particular for injectable vaccines,
such as filamentous phages (Houten et al. 2006), Brucella
lumazine synthase (Berguer et al. 2012), and virus-like par-
ticles (Shirbaghaee 2016). On the other hand, much less
success has been attained in improving the efficacy of oral
vaccines. Attenuated or genetically modified normal flora
bacteria are currently being tested for immunization with
heterologous antigens through the oral route, with promising
results (Rosales-Mendoza et al. 2016). These needle-free
vaccines may improve both mucosal and systemic immunity,
an important issue considering that most pathogens enter
their host via the respiratory or oral tracts (Savelkoul et al.
2015). Moreover, these needle-free vaccines are less expen-
sive, overriding the costly logistic of vaccination with
injectable formulations. Within this context, plant-based
vaccines may provide optimal delivery systems, adequate for
oral immunization, easily scalable for massive production at
low cost, and non-dependent of a ‘‘cold-chain’’ for their
application. It is also noteworthy that plants produce com-
ponents with adjuvant properties, like saponins, that may
improve the immunogenicity of the vaccines themselves
(Rosales-Mendoza and Salazar-Gonzalez 2014).
Among the plant species used for oral delivery of vac-
cines, tobacco is a widely explored system, providing
notable immunogenic activity; however, the presence of
toxic compounds limits its use as a preliminary system for
proving the concept of oral delivery by plant cells. Previ-
ous studies have also explored lettuce cells as delivery
vehicle, providing evidence on the induction of humoral
responses against hepatitis B virus (Czy _z et al. 2014).
On the other hand, we have developed a vaccine to
prevent Taenia solium cysticercosis. T. solium cysticercosis
is a major parasitic disease that frequently affects human
health and the economy of non-developed countries. The
most severe and even fatal form of the disease occurs when
cysticerci are lodged in the human central nervous system,
causing neurocysticercosis. Pigs are the obligate interme-
diate hosts to complete the life cycle of the parasite. Thus,
it is plausible to curb human transmission by reducing pig
cysticercosis through effective vaccination programs.
Different protective parasite antigens have been identified
and successfully tested for vaccination under experimental
conditions (Sciutto et al. 2008). However, only Tsol18 and
S3Pvac have been tested in field trials (Huerta et al. 2001;
Morales et al. 2011; Gauci et al. 2013). The S3Pvac vaccine
includes well-defined peptides and has been exploited to
evaluate the cost-benefit of different delivery systems and
vaccination routes. S3Pvac is based on the highly protective
18-aa epitope named GK-1 (which was identified as a highly
immunogenic peptide in the partial 100-aa-length KETc7 T.
crassiceps recombinant protein) and two additional 12-aa
(KETc1), and 8-aa (KETc12) peptides. Either synthetically
or recombinantly produced, the S3Pvac vaccine exhibited a
high protective efficiency when tested on the field under
natural conditions of transmission (Huerta et al. 2001; Mor-
ales et al. 2008, 2011). Later on, a plant-based vaccine
against cysticercosis was developed in transgenic embryo-
genic papaya cells.
Carica papaya L. ‘‘Maradol Tabasco’’ (Hernandez et al.
2007) was selected to express the S3Pvac vaccine peptides
because this system was first successfully employed in
Mexico to produce transgenic papaya plants using
embryogenic calli as target cells for particle bombardment
(Cabrera-Ponce et al. 1995). Thereafter, some anti-parasitic
components produced by papaya itself, like carpasemine
(Okeniyi et al. 2007), which underlie the remarkable yet
non-specific protection induced by subcutaneous mouse
immunization with non-transformed papaya cells (Her-
nandez et al. 2007), increased the suitability of this system.
S3Pvac-papaya induced high protection levels against T.
crassiceps and T. pisiformis cysticercosis when
1038 Planta (2017) 245:1037–1048
123
![Page 3: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/3.jpg)
parenterally or even orally administered (Hernandez et al.
2007; Betancourt et al. 2012). Further properties of the
S3Pvac-papaya vaccine are herein reported, highlighting its
potential as a vaccine platform for oral immunization.
Materials and methods
Animals
All experiments were conducted in accordance to the
principles set forth in the Guide for the Care and Use of
Laboratory Animals, Institute of Laboratory Animal
Resources, National Council, Washington, DC, USA,
1996. This study was approved by the Ethical Committee
of Instituto de Investigaciones Biomedicas.
Mice
Six- to ten-week-old BALB/cAnN female mice (a per-
missive strain to murine cysticercosis) were used for vac-
cine trials (Fragoso et al. 2008). Mice were bred in a single-
line breeding system and kept in microisolators in the
animal facilities at the Instituto Nacional de Investiga-
ciones Biomedicas, Universidad Nacional Autonoma de
Mexico (UNAM), or in the Faculty of Medicine of
Universidad Autonoma de Puebla (BUAP).
Pigs
To assess the immune response induced by orally admin-
istered S3Pvac-papaya, 40 cysticercosis-free, 2- to
4-month-old, York-Landrace pigs of both sexes and mixed
genetic background from a rural farm in a southern Mexico
City suburb were employed.
S3Pvac-papaya vaccine
Embryo tissues from each transgenic clone (5 g) and from
non-transformed papaya calli were powdered in liquid
nitrogen and homogenized in extraction buffer [PBS pH
7.4, 50 mM sodium ascorbate, 1 mM EDTA pH 8.0, 0.2%
Triton X-100 and 10 lL/mL of protease inhibitor to His-tag
protein (Sigma, St. Louis, MO, USA)] and centrifuged at
21,3209g at 4 �C for 20 min to remove insoluble debris.
The supernatant was collected, and protein concentration
was determined by the Lowry method (Lowry et al. 1951).
Peptide detection by HPLC in the S3Pvac-papaya
clones
Protein extracts were obtained by milling 50 mg of papaya
callus fresh tissue in 300 lL of extraction buffer [750 mM
Tris–HCl (pH 8.0), 15% (w/v) sucrose, 100 mM b-mer-
captoethanol and 1 mM PMSF] (Franklin et al. 2002).
Samples were centrifuged at 16,0009g for 10 min, and
supernatants were subsequently mixed with 100 lL of
0.1% trifluoroacetic acid (TFA)/water with photometric
grade TFA (Sigma). Samples were analyzed in an Agilent
1260 Infinity Binary LC Chromatography RP-HPLC sys-
tem (Agilent Technologies, Palo Alto, CA, USA) and data
were analyzed with the ChemStation software. Protein
extract samples (100 lL) from either transgenic or trans-
formed plants were injected in the equipment using a
ZORBAX Eclipse XDB C18 column (4.6 9 150 mm,
5 lm) (Agilent Technology) equilibrated with 0.1% of
TFA in water, and separation was carried out at 30 �Cusing a linear gradient of aqueous acetonitrile containing
0.1% TFA at a flow rate of 1 mL/min. Acetonitrile con-
centration was increased from 0 to 50% over 75 min and
held constant thereafter. Column effluent was monitored by
UV absorption (217 nm) to identify peptide signals. The
major peaks from the HPLC chromatogram were identified
individually and the corresponding areas calculated
(Fig. 1). Peptide concentration in plant lines was deter-
mined using a standard curve constructed with a concen-
tration range of 1.5–250 ng/lL of pure synthetic peptides,
comprising GK-1 (USV Ltd, Mumbai, Maharashtra, India),
KETc12 (AnaSpec, Fremont, CA, USA), and KETc1
(AnaSpec) (data not shown).
Immunization
The S3Pvac-papaya oral vaccine was prepared by com-
bining in equal amount of soluble extract of the three
transgenic embryogenic papaya clones named pKETc126,
pKETc19, and pKETc723, which express the KETc12.6His,
KETc1.6His, and KETc7 peptides, respectively (Hernan-
dez et al. 2007).
Mouse immunization
Groups of 6–9 mice were orally immunized with the
S3Pvac-papaya soluble extract at doses ranging from 0.56
to 56.1 ng per mouse (accounting for 0.19–19 ng of
KETc1, 0.22–22 ng of KETc7, and 0.15–15.1 ng of
KETc12) included in 0.1–10 lg of papaya callus total
extract, respectively. The immunogens were prepared by
mixing total callus protein in saline solution and/or using
vehicles like soy oil (10 lg/200 lL, Cargill) (Stein et al.
2013), corn starch (10 lg/200 lL) (Stertman et al. 2006),
canola oil (10 lg/200 lL, Cargill), or maize wafers (10 lgper wafer) (Rojo et al. 2001). These vehicles were chosen
as appealing for mice and pigs. To test the effect of papaya
alone, control groups administered with the respective
amount of soluble extract from transgenic papaya callus,
Planta (2017) 245:1037–1048 1039
123
![Page 4: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/4.jpg)
either with or without vehicle, were included. The vaccine
with or without vehicles was intragastrically administered
using a curved feeding needle, except for mice that
received the vaccine in maize wafers. In this case, each
mouse was isolated until the entire wafer was consumed.
All mice received two vaccine or vehicle doses, 15 days
apart. Mice were anesthetized with Sevorane (Abbot,
http://www.abbott.com) and bled from the orbital plexus
before sacrificed.
Pig immunization
Forty 2–4 month-old pigs (15 castrated males and 25
females) were included in this study. Pigs were randomly
divided into four groups of ten animals each. One group
was fed with a tuna oil-enriched maize bolus containing
only saline, and the other three groups received the S3P-
vac-papaya vaccine at a dose of, 1, 10, or 100 lg per pig in
the maize bolus, and a boost two weeks later. Blood
samples were obtained by intravenous puncture before the
immunization protocol and fifteen days after. Serum was
separated and stored at -70 �C until used.
Parasites for infection
Taenia crassiceps cysts for experimental mouse infection
were harvested from the peritoneal cavity of stock female
mice with 2–3 months of infection. Mice were infected
with 20 small (2-mm), non-budding, highly motile T.
Fig. 1 Identification of peptides in transgenic papaya calli by RP-
HPLC. a HPLC profile of papaya transgenic lines expressing the
KETc1 (clone 9), KETc12 (clone 6), and KETc7 (clone 23) peptides.
Peaks matching the retention time of standards evidence the
expression of the recombinant peptides. These signals are nearly
absent in WT papaya. b Results are expressed as mean ± standard
deviation of the recombinant peptide per gram of callus papaya fresh-
tissue. The background from WT papaya at the respective peaks was
subtracted to the signal yield by the transgenic lines, and mAU values
were used to determine the concentration of each recombinant peptide
1040 Planta (2017) 245:1037–1048
123
![Page 5: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/5.jpg)
crassiceps cysticerci in 0.9 mL of 0.9% isotonic saline
solution (ISS) two weeks after the last immunization. Mice
were sacrificed 30 days after infection and cysts were
harvested from the peritoneal cavity and counted to
determine the effect of vaccination, as previously reported
(Toledo et al. 1999, 2001). Organs in the peritoneal cavity
were carefully inspected to detect any remaining T. cras-
siceps larvae.
The humoral and cellular immunity
The humoral and cellular immune responses were evalu-
ated in mice and pigs fifteen days after the last oral
immunization, as described below.
ELISA assay
For antibody detection, Immulon I plates (Nunc, Thermo
Scientific, http://www.thermoscientific.com) were sensi-
tized with 1 lg/well of either papaya or S3Pvac-papaya
soluble extract (Hernandez et al. 2007) in carbonate buf-
fered saline, pH = 9.6, overnight at 4 �C. Plates were
washed and blocked with 200 lL of PBS containing bovine
serum albumin 1% w/v and 0.3% (v/v) Tween 20, and left
for 60 min at 37 �C. Pig or mouse serum samples were
diluted 1:200 or serially diluted for titration and incubated
for 30 min at 37 �C. The reaction was detected with 100
lL/well of HRP-goat anti-pig IgG (Fc) (Serotec, https://
www.bio-rad-antibodies.com) diluted 1:12,000 or HRP-
anti-mouse IgG (H?L) (Invitrogen) diluted 1:2000 and
incubated for 30 min at 37 �C. The reaction was developed
with 100 lL/well of tetramethylbenzidine (TMB) (Zymed,
San Francisco, CA, USA) for 5 min at 4 �C in the dark and
stopped by adding 100 ll 0.2 M H2SO4. OD values were
measured at 450 nm in an ELISA reader (Opsys MR
Dynex Technology, Chantilly, VA, USA).
Immediate and delayed-type hypersensitivity (DTH)
response
To account for a vaccine-induced cellular immune
response, a DTH test was conducted. Three groups of five
mice each were administered with either saline or soluble
extracts of papaya alone or S3Pvac-papaya (10 lg per
mouse) (Hernandez et al. 2007). Twenty days after the
last dose, the abdomen of each mouse was raised and 20
lL of saline or 10 lg of soluble total cysticercal antigens
(Ramos-Kuri et al. 1992), papaya, or S3Pvac-papaya
soluble extract (Hernandez et al. 2007) were subcuta-
neously inoculated in four abdomen spots. To assess
DTH, two measures were performed 48 and 72 h later. In
addition, to account for the lack of possible immediately
hypersensitive reactions, the thickness at the injection site
was determined with an electronic Vernier caliper
(Stainless Hardened Vernier Digital) 5, 10, and 15 min
after inoculation.
In-vitro lymphocyte proliferation
Fifteen days after the last immunization, a cell suspension
was made by spleen perfusion in control and vaccinated
mice. For pigs, blood samples collected before and 15 days
after the boost immunization were processed in a Ficoll-
Hypaque gradient (Sigma) to recover peripheral blood
mononuclear cells (PBMCs) as reported elsewhere
(Manoutcharian et al. 2004).
Mouse spleen cells or pig PBMCs were washed twice
with RPMI 1640 medium. Red blood cells were removed
from spleen cell suspensions by lysis with ammonium
chloride buffer as previously reported (Manoutcharian
et al. 2004). PBMCs suspensions were labeled with car-
boxyfluorescein succinimidyl ester 5 lM (CFSE; Molec-
ular Probes) according to the manufacturer’s instructions,
and extensively washed following a previously described
procedure (Segura-Velazquez et al. 2009). Cells were then
placed in RPMI 1640 medium supplemented with L-glu-
tamine (0.2 mM), penicillin (100 U/mL), streptomycin
(100 mg/mL) (Invitrogen), and FBS (10%) (Gibco).
Either S3Pvac peptides for mice (10 lg/mL) or S3Pvac-
papaya soluble extract for pigs (0.6 and 6 lg/mL) were
added to the culture wells containing 2 9 105 cells in 200
lL of culture medium and plates were incubated at 37 �Cin a 5% CO2 humidified atmosphere in flat-bottomed
microtiter plates (Costar, Cambridge, MA, USA). Con-
canavalin A (ConA, 2.5 lg/mL) was added to the cultures
as a positive control. After 5 days of culture, T cell pro-
liferation was measured by flow cytometry in pigs by
counting blast cells identified by forward scatter (FSC)
and side scatter (SSC) in a FACScan flow cytometer
(Becton–Dickinson, Palo Alto, CA, USA). For mice, cell
suspensions were stained at 4 �C with the antibodies
CD4-phycoerithrine and CD8-PerCP-Cy5.5 (Biolegend,
http://www.biolegend.com), and analyzed by flow
cytometry.
Real-time reverse transcription PCR (RT-qPCR)
To evaluate the stability of the expression of the S3Pvac
components in the transgenic lines, transcript levels of the
genes KETc12.6His, KETc1.6His, and KETc7 were ana-
lyzed using specific primers (Hernandez et al. 2007). In
parallel, four housekeeping genes were amplified for nor-
malization: elongation factor 1-alpha (EF1), elongation
factor 2-alpha (EF2), TATA binding protein 1 (TBP1),
TATA binding protein 2 (TBP2), which were previously
reported by Zhu et al. (2012). The following primers were
Planta (2017) 245:1037–1048 1041
123
![Page 6: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/6.jpg)
used: EF1 forward 50GGCAGATTGGAAATGGCA30
reverse 50AGGAGGATACTGGGAGAA30; EF2 forward
50CTTTGCCTTCGGTCGTGTCTTC30 reverse 50CACTGTCTCCTGCTTCTTTCCC30; TBP1 forward 50GGTAGTAGTAGTTAGGTATGTG30 reverse 50GGCAATCTGGTCTCACTT30 TBP2 forward 50TGTGAATACTGGTGCTGAG30 reverse 50GGCATGAGACAAGACCTATA30.
RT-qPCR was carried out in 48-well plates using a
StepOneTM Real-Time PCR System and StepOneTM Real-
Time PCR System Software (Applied Biosystems, Carls-
bad, CA, USA) using a SYBR Green-based PCR assay.
Each reaction mix containing 2 lL of diluted cDNAs, 5 lLof iTaqTM Universal SYBR Green Supermix (Bio-Rad),
0.5 mM of each primer to a final volume of 10 lL was
subjected to the following amplification conditions: 95 �Cfor 10 min; followed by 40 cycles of 95 �C for 15 s, 60 �Cfor 60 s, and 95 �C for 15 s. Melting curves were analyzed
at 65–95 �C after 40 cycles. Each RT-qPCR analysis was
performed in triplicate and the mean was used for RT-
qPCR analysis.
Statistical analysis
Data were collected in Excel 7.0 (Microsoft, Redmond,
WA, USA) and analyzed with the InStat software
(GraphPad, La Jolla, CA, USA). Parasite load was com-
pared between mouse groups using the Mann–Whitney
non-parametric test. Data on antibody levels were com-
pared using an unpaired t test. Stimulation index data were
analyzed by the Tukey–Kramer multiple comparisons test.
A value of P\ 0.05 was considered as statistically
significant.
Results
Stability of the S3Pvac papaya transgenic lines
To investigate the stability of transformation events in the
transgenic embryogenic papaya clones pKETc126,
pKETc19, and pKETc723, transcript levels of the corre-
sponding transgenes were measured by qPCR. KETc12
transcripts were the most abundant, while KETc7 showed
an intermediate expression and KETc1 the lowest levels
(Suppl. Fig. S1). Transgene expression was normalized
using four different housekeeping genes (EF1, EF2, TBP1,
TBP2), observing no significant changes in the abundance
patterns among the distinct transgene transcripts, suggest-
ing that these housekeeping genes provide a consistent
constitutive expression and thus a proper normalization
(Suppl. Fig. S1).
Peptide detection by HPLC
Peptides with molecular masses between 2 and 9 kDa were
identified in supernatants from three different transgenic
papaya cell lines by RP-HPLC chromatography, using a
ZORBAX Eclipse XDB C18 column (4.6 9 150 mm,
5 lm). The peptides were quantified in the transgenic
clones using synthetic peptides as a standard in RP-HPLC.
First, peaks corresponding to synthetic KETc1, GK-1, and
KETc12 peptides were identified with retention times of
20, 33, and 41 min, respectively. Protein extracts from
transgenic cell lines were individually injected in the
equipment, and one main peak was observed in the chro-
matograms for the pKETc19, pKETc723, and pKETc126clones, with retention times matching the respective pep-
tides (Fig. 1a). Other minor peaks were observed, corre-
sponding to peaks present in the WT plant chromatogram.
Peptide concentration in plant lines was determined using a
standard curve constructed with a concentration range of
1.5–250 ng/lL of pure synthetic peptides and the mAU
response. The mAU values obtained for each recombinant
peptide were used to determine the concentration using
linear regression. Results are expressed in ng of recombi-
nant peptide per microgram of total extract. (Fig. 1b).
Oral S3Pvac-papaya vaccine using differentvehicles
In mice
Protection
The protective effect induced by oral immunization in mice
with papaya or S3Pvac-papaya soluble extract is shown in
Table 1. Considering the dose dependence of antigens
orally administered in triggering mucosal tolerance, three-
log doses were tested for their protective capacity against
murine cysticercosis. A statistically significant protection
was induced by the three tested doses: 0.56, 5.6 and 56 ng
of S3Pvac soluble extract per mouse, with protection
ranging from 55.8 to 66.2%. In contrast, the corresponding
papaya soluble extract did not significantly modify the
expected parasite load.
Towards the vaccine formulation, different vehicles were
tested. As shown in Table 2, either orally administered in
saline or included in three of the four different vehicles, the
vaccine significantly reduced the expected parasite load
from 75 to 89.8%. A statistically non-significant reduction
(41.4%) was observed when the vaccine was administered
formulated with corn starch as the vehicle.
1042 Planta (2017) 245:1037–1048
123
![Page 7: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/7.jpg)
Humoral immune response
Specific antibodies were detected both in mice immunized
with papaya alone or with S3Pvac-papaya. As shown in
Table 3, significantly higher levels of anti-S3Pvac papaya
antibodies were found in mice immunized with the
vaccine.
Type-IV DTH response
To evaluate the role of vaccination on Th1/Tc1 differen-
tiation in vivo, cell-mediated type-IV DTH was measured.
Four out of five mice immunized with S3Pvac-papaya
showed an infiltrated erythematous reaction that enlarged
Table 1 Dose-dependent protection induced by oral S3Pvac-papaya
vaccine against murine cysticercosis
Mice immunized with Number of cysticerci Mean ± SD�
Saline (control) 24, 52, 36, 18, 15, 18 27.2 ± 14.2a
Soluble extract (lg/dose)
Papaya
0.1 25, 30, 17, 34, 25, 22 25.5 ± 5.9a
1 10, 22, 28, 16, 25, 15 19.3 ± 6.8a
10 37, 29, 24, 12, 13, 40 25.8 ± 11.8a
S3Pvac-papaya�
0.1 9, 11, 18, 11, 10, 15 12.3 ± 3.4b
1 8, 13, 10, 8, 13, 13 10.8 ± 2.5b
10 8, 9, 10, 8, 11, 9 9.2 ± 1.0b
Letters indicate statistically significant differences between groups at
95% confidence using the unpaired t test with Welch correction,
which assumes the populations may have different SD� Mean ± standard deviation of the number of parasites recovered in
each mouse group� The content of the three peptides in each dose was 0.56, 5.6, and
56 ng in 0.1, 1, and 10 lg of soluble extract, respectively
Table 2 Effect of different
vehicles in the protection
against murine cysticercosis
induced by oral S3Pvac-papaya
vaccine
Oral immunized with Mean ± standard deviation % Protection
1st experiment
Saline 141.2 ± 114.2a
S3Pvac-papaya-saline 18.6 ± 17.3b 86.8
Corn starch 70.5 ± 56.8a
S3Pvac-papaya in corn starch 29.8 ± 31.4a,b 41.4
Soil Oil 41.2 ± 16.4a
S3Pvac-papaya in soy oil 10.3 ± 2.2a,b 75
Canola oil 72.4 ± 68.2a
S3Pvac-papaya in canola oil 11.5 ± 8.6b 84.1
2nd experiment
Saline (control) 122.8 ± 73.2a
S3Pvac-papaya 17.8 ± 33.9b 85.5
S3Pvac-papaya in maize wafers 12.5 ± 18.2b 89.8
Groups of six mice were fed with S3Pvac-papaya soluble extract (5.6 ng in 1 lg of total protein from
papaya callus per mouse) in saline or into different vehicles
Different literals indicate significant differences in the parasite load between mice that received the dif-
ferent treatments (P\ 0.05) using the unpaired t test with Welch correction, which assumes the populations
may have different SD
Table 3 Humoral and cellular immunity induced in mice with oral
S3Pvac-papaya vaccine
Groups Antibody levels (OD450 nm ± SD) against�
Papaya S3Pvac-papaya
Saline 0.16 ± 0.10a 0.26 ± 0.25b
Papaya 0.39 ± 0.14c 0.64 ± 0.27c
S3Pvac-papaya 0.57 ± 0.15c 0.92 ± 0.16d
Intradermal reaction [diameter (in cm) ± SD]
against�
Saline 0a 0a
Papaya 0a 0a
S3Pvac-papaya 0a 1.3 ± 0.79b
Different literals indicate significant differences at P\ 0.05 using an
un-paired t-test� Serum antibody levels in mice (n = 7–8) orally immunized with
saline, papaya or S3Pvac-papaya (56 ng in 10 lg of total protein frompapaya callus per mouse) measured by ELISA� DTH responses induced in saline, papaya or S3Pvac-papaya orally
immunized mice (n = 5) were measured by an electronic Vernier
caliper. A larger lesion diameter was measured in S3Pvac-papaya
immunized mice, 48 h after intradermal inoculation
Planta (2017) 245:1037–1048 1043
123
![Page 8: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/8.jpg)
48 h after inoculation (Table 3). No reaction was detected
in those mice that received saline or papaya only; also,
S3Pvac-papaya vaccination did not induce an immediate
reaction (5, 10, or 15 min after subcutaneous inoculation).
In vitro T cell proliferation
To further analyze the phenotype of the T cell population
involved in the increased DTH response induced by the
vaccine, the recall antigen response of CD4? and CD8? T
lymphocytes was measured. Figure 2 shows the index of
CFSE incorporation in CD4? and CD8? T cells from
mouse spleen. Oral immunization with S3Pvac-papaya
induced a significant increase in the percentage of prolif-
erating CD4? and CD8? cells, although with some dif-
ferences depending on the peptide used for stimulation
in vitro and on the vaccine dose employed.
In pigs
Humoral immune response
The levels of antibodies against papaya and S3Pvac-papaya
in sera from vaccinated and control pigs are shown in
Fig. 3. A significant increase in antibody levels was found
in pigs immunized with 5.6 or 56 ng of vaccine per pig as
confirmed by antibody titration (Fig. 3b). Immunization
using 560 ng of vaccine per pig did not significantly
increased Ab levels. A higher non-specific binding was
observed when S3Pvac-papaya was used as the antigen
source compared to papaya alone.
In vitro T cell proliferation
Figure 4 shows the T cell proliferation level induced
in vitro by two different doses of soluble S3Pvac-papaya
extract in peripheral blood cells from pigs that either
received saline or the three vaccine doses (Chavarrıa et al.
Fig. 2 CD4 and CD8 proliferative response induced by S3Pvac-
papaya orally administered in mice. Splenocytes from mice orally
immunized with ISS or S3Pvac-papaya were stimulated in vitro with
the synthetic peptides GK-1, KETc1, or KETc12, and CFSE-stained.
Five days after culture, cell suspensions were labeled with anti-CD4
or anti-CD8 antibodies and analyzed by flow cytometry. Stimulation
index of CD4 or CD8 proliferative T cells is shown. Asterisk
Significantly increased proliferation in cells from mice immunized
with S3Pvac-papaya vaccine with respect to those that received saline
only (P\ 0.05)
Fig. 3 a Individual antibody responses in pigs orally immunized with
three different S3Pvac-papaya vaccine doses administered in maize
bolus or formulated in maize wafers. Antibody levels are significantly
higher in those pigs vaccinated with 5.6 and 56 ng of vaccine than in
controls pigs (P\ 0.05). b Antibody titration in pooled sera of non-
immunized and S3Pvac immunized pigs
1044 Planta (2017) 245:1037–1048
123
![Page 9: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/9.jpg)
2003; Manoutcharian et al. 2004). A statistically significant
increase was observed only in pigs vaccinated with either
5.6 or 56 ng of vaccine with respect to the group that
received saline only. It is also remarkable the overall
increase of the proliferative response in vitro, disregarding
the presence of the antigen. Indeed, significant differences
were observed in proliferation levels among cells from the
pigs immunized with 1 or 10 lg in the S3Pvac-vaccinated
groups. It is also noteworthy the high heterogeneity in the
proliferative response in the pigs that received a same
treatment; this heterogeneity is more marked when the
highest vaccine dose was used for immunization.
Discussion
Oral vaccination would be the optimal route to prevent
infectious diseases in which pathogens are acquired by the
mucosal route. It also offers clear advantages for a sus-
tained application of vaccines at low costs (Lamichhane
et al. 2014). Despite the convenience of oral vaccines, no
subunit oral vaccines are under use to prevent any human
disease; only recombinant cholera toxin B subunit is used
as a component of an internationally licensed oral cholera
vaccine, including whole killed Vibrio cholerae cells as its
main component (Baldauf et al. 2015). The limited
absorption of antigens from mucosal surfaces and their
possible degradation by proteolytic enzymes that limit the
elicitation of the desired immunity and the feasibility of
inducing oral tolerance may underlie this absence.
In this study, experimental evidence clearly indicates
that the papaya-based delivery system is stable and ade-
quate to elicit oral immunity, using a broad antigen dose
range, as confirmed in two different mammal species.
These findings overcome the limitation of several oral
vaccines in inducing mucosal tolerance (Buchanan et al.
2012; Lamichhane et al. 2014). During our research using
the anti-cysticercosis vaccine (S3Pvac) based in three
peptides separately expressed in papaya transgenic calli, it
became clear that a plant-based platform will be an ade-
quate system for oral immunization (Hernandez et al.
2010). In this respect, it should be remarked that transgenic
plants are recognized as an advantageous platform for oral
delivery of subunit vaccines, since they allow vaccine
production at low cost and protect the antigen from
degradation in the digestive system.
In a first study, the transgenic lines that induced the
highest protection levels against experimental murine cys-
ticercosis were selected by immunizing mice with the
respective soluble extract from different clones that
expressed each of the peptides (KETc7, KETc1, or KETc12)
(Hernandez et al. 2007). This strategy let us to select three
highly protective clones that express each of the vaccine
antigens. In the latter study, clones that expressed KETc7
were administered by subcutaneous injection in two differ-
ent doses, i.e. 200 and 1000 lg of total soluble extract per
mouse. Since a similar level of protection was obtained
disregarding the dose employed, the lower dose was selected
for further experiments. The protective capacity of the
vaccine included in soluble extracts or in a transgenic callus
suspension was then compared (Hernandez et al. 2010).
Interestingly, high and similar protection levels were
induced by both vaccine formulations. Indeed, high levels of
sterile immunity to experimental T. crassiceps cysticercosis
were conferred to female mice immunized with the
pKETc19, pKETC723, or pKETc126 clone. It has been
considered that plant cell walls can protect vaccine antigens.
However, the high and similar protection levels found when
powdered calli or a soluble extract were employed for
vaccination do not support this hypothesis. Instead, it is
likely that other components of the papaya itself can
improve vaccine protection. Among these components fig-
ure saponins, extensively used as adjuvants in veterinary
vaccine formulations, which along with flavonoids, alka-
loids, and tannin have been found in Carica papaya
(Sasidharan et al. 2011).
The protective and immunogenic capacity of the oral
S3Pvac anti-cysticercosis vaccine was thoroughly studied
herein.
A critical feature to assess was the range of dose-de-
pendent protection induced by the vaccine. Considering the
Fig. 4 In vitro proliferative response induced by two concentrations
of S3Pvac-papaya in peripheral cells from pigs immunized with three
doses of S3Pvac-papaya, formulated in maize wafers. A significantly
increased proliferation was observed in cells from pigs immunized
with 1 or 10 lg of S3Pvac-papaya vaccine with respect to those that
received saline only (P\ 0.01). No differences were detected
between non-treated cells and cells treated in vitro with immunogen
(P[ 0.05). Statistical analysis was performed using the Kruskal–
Wallis test (non-parametric ANOVA)
Planta (2017) 245:1037–1048 1045
123
![Page 10: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/10.jpg)
protection induced by the S3Pvac-papaya vaccine when
subcutaneously applied a lower three-log range of
0.1–10 lg of total protein per mouse was tested herein. The
vaccine, formulated with 0.19–19 ng of KETc1,
0.22–22 ng of KETc7, and 0.15–15.0 ng of KETc12 orally
administered as a soluble extract, induced statistically
significant protection in the three doses tested, ranging
from 55 to 66% (Table 1). Then, the feasibility of
improving the vaccine protective capacity using different
vehicles for administration was tested. The vaccine pro-
tective capacity was maintained when administered in
combination with different vehicles, i.e. soy oil, canola oil,
and maize wafers (Table 2). The most interesting results
were observed when a maize bolus was employed to feed
mice. These results indicate that the vaccine can be
incorporated directly into animal food without losing its
protective capacity (Table 2). A significant protection was
induced by oral vaccination with S3Pvac-papaya, although
in a lower extent than that induced when injectable vaccine
was applied (Hernandez et al. 2007). However, since the
experiments were performed in different times, results are
hardly comparable.
In this regard, it is important to mention that the pro-
portion of totally protected mice and the average decrement
in the parasite load in the immunized group varied in
experiments performed on different occasions (Toledo
et al. 1999, 2001). Variation in parasite infection intensity
within experimental groups and between experimental
sessions is a common finding in this form of cysticercosis
due to factors not fully identified but that we attribute to
variation in infectivity of each parasite harvest and
inoculums. It is noteworthy that the low peptide amount
included in the vaccine resulted in an immunogenic
response. Several factors may account for this unexpected
result, namely the high molar ratio of the peptides used
with respect to proteins, and the adjuvant properties of
papaya components. Nevertheless, it would be relevant to
test much higher doses than those tested herein for oral
vaccination (Fragoso et al. 2011).
An interesting finding is the fact that the high level of
mRNA expression of the pKETc12 clone does not corre-
spond to the protein concentration as shown by HPLC, a
point that may be related with transcriptional gene
regulation.
The immunity accompanying the observed protection
was tested in mice and pigs, and a specific antibody
response was observed in both species (Table 3; Fig. 3). It
is also unexpected that the lowest and medium vaccine
doses elicited significantly increased antibody levels. It is
feasible that the immunogenic properties of papaya con-
stituents may be involved in this unusual response. An
increased specific proliferative response of CD4? and
CD8? cells was also detected in mice (Fig. 2). Additional
DTH experiments, suggesting the induction in vivo of a
Th1/Tc1-type effector T cells response are reported
(Table 3). An increased proliferative response was also
observed in pigs orally immunized with two of the three
tested vaccine doses. Proliferation of peripheral mononu-
clear cells from S3Pvac-immunized pigs was observed
disregarding additional in vitro re-calling (Fig. 4). It is
likely that the mitogenic proteolytic enzymes contained in
papaya latex as a protection against insects (Konno et al.
2004), which may override the in vitro effect of the vac-
cine, may account for these increased proliferation levels.
It is also interesting to note the observed heterogeneous
response, since vaccination failed to increase the cell pro-
liferative capacity in some pigs. The reasons behind these
differences are not explored in this study, but genetic
make-up as well as differences in food intake could be
underlying them. Nevertheless, once the immunological
parameters related with vaccine-induced protection have
been elucidated, the heterogeneity of induced immunity
should be evaluated to maximize the protection induced.
Evidence on the feasibility of using plants as vehicle for
oral delivery of several biopharmaceuticals has been gen-
erated during the last two decades (Kwon and Daniell
2015). In the case of vaccines, freeze-dried material from
lettuce plants expressing the hepatitis B surface antigen
(HBsAg) was processed by lyophilization using sucrose as
a lyoprotectant, and employed as an oral boosting vaccine
in mice. This approach succeeded in enhancing the anti-S-
HBsAg humoral response in a scheme comprising intra-
muscular priming with the conventional antigen. The
boosting effect was comparable to that attained when
boosting by injection of the pure antigen (Czy _z et al. 2014).
Papaya vaccine does not require neither priming with pure
antigens, which is expensive, nor using excipients during
freeze-drying process. Moreover, the efficiency of expres-
sion for foreign antigens in papaya, along with its intrinsic
anti-parasitic properties, points to its usefulness to express
other antigens for vaccine development against intestinal
pathogens.
In conclusion, this study demonstrates the usefulness of
the papaya platform for oral immunization and the effec-
tiveness of oral S3Pvac-papaya anti-cysticercosis vaccine
to elicit an effective immunity against murine cysticercosis
and evidences its immunogenic capacity in pigs. Further
studies to evaluate its protective properties against porcine
cysticercosis in the most immunogenic dose range are
needed to propose its inclusion in sustainable and realistic
control campaigns to prevent transmission.
Author contribution statement GF, conception and design
of the study, data analysis and interpretation, manuscript
drafting; MH, data acquisition and analysis, sample pro-
cessing; JC, protective study in mice; RRA, sample
1046 Planta (2017) 245:1037–1048
123
![Page 11: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/11.jpg)
processing; HC, data acquisition and sample processing;
NV, data acquisition; RS, humoral and cellular response
evaluation in mice; AF, cellular response assay in pigs; IF,
cellular response assay in pigs; HJ, technical support in
swine care; GR, design and analysis of DTH study; LG,
DTH assay; EP, DTH assay; EM, qRT-PCR; SM, qRT-
PCR; LGV, Data analysis; ES, conception and design of
the study, data analysis and interpretation, manuscript
drafting.
Acknowledgements This work was supported by CONACyT
(201448, 152793), DGAPA (IG-200414), Programa de Investigacion
para el Desarrollo y la Optimizacion de Vacunas, Inmunomodu-
ladores y Metodos Diagnosticos del Instituto de Investigaciones
Biomedicas, UNAM, and Programa de Redes Tematicas de Colabo-
racion academica, PRODEP. The authors acknowledge Georgina
Diaz, Carlos Escamilla Weinman, Francisco Ramos Collazo, Daniel
Garzon, Heriberto Prado-Garcia, Jorge Rebollar and Omar Rangel for
technical support, and Juan Francisco Rodriguez for English edition
of this manuscript. All authors have read and approved the final
manuscript draft.
Compliance with ethical standards
Conflict of interest The authors declare no financial or commercial
conflict of interest.
References
Arama C, Troye Blomberg M (2014) The path of malaria vaccine
development: challenges and perspectives. J Intern Med
275:456–466
Baldauf KJ, Royal JM, Hamorsky KT, Matoba N (2015) Cholera
toxin B: one subunit with many pharmaceutical applications.
Toxins (Basel) 7:974–996
Berguer PM, Alzogaray VA, Rossi AH, Mundinano J, Piazzon I,
Goldbaum FA (2012) A polymeric protein induces specific
cytotoxicity in a TLR4 dependent manner in the absence of
adjuvants. PLoS One 7:e45705
Betancourt MA, de Aluja AS, Sciutto E, Hernandez M, Bobes RJ,
Rosas G, Hernandez B, Fragoso G, Hallal-Calleros C, Aguilar L,
Flores-Perez I (2012) Effective protection induced by three
different versions of the porcine S3Pvac anticysticercosis
vaccine against rabbit experimental Taenia pisiformis cysticer-
cosis. Vaccine 30:2760–2767
Buchanan RM, Tetland S, Wilson HL (2012) Low dose antigen
exposure for a finite period in newborn rats prevents induction of
mucosal tolerance. PLoS One 7:e51437
Cabrera-Ponce JL, Vegas-Garcia A, Herrera-Estrella L (1995)
Herbicide resistant transgenic papaya plants produced by an
efficient particle bombardment transformation method. Plant
Cell Rep 15(1–2):1–7
Chavarrıa A, Roger B, Fragoso G, Tapia G, Fleury A, Dumas M,
Dessein A, Larralde C, Sciutto E (2003) TH2 profile in
asymptomatic Taenia solium human neurocysticercosis.
Microbes Infect 5:1109–1115
Czy _z M, Dembczynski R, Marecik R, Wojas-Turek J, Milczarek M,
Pajtasz-Piasecka E, Wietrzyk J, Pniewski T (2014) Freeze-
drying of plant tissue containing HBV surface antigen for the
oral vaccine against hepatitis B. Biomed Res Int 2014:485689.
doi:10.1155/2014/485689
Fragoso G, Meneses G, Sciutto E, Fleury A, Larralde C (2008)
Preferential growth of Taenia crassiceps cysticerci in female
mice holds across several laboratory mice strains and parasite
lines. J Parasitol 94:551–553
Fragoso G, Esquivel-Guadarrama F, Santana MA, Bobes RJ,
Hernandez B, Cervantes J, Segura R, Goldbaum FA, Sciutto E,
Rosas G (2011) Heterologous prime-boost oral immunization
with GK-1 peptide from Taenia crassiceps cysticerci induces
protective immunity. Clin Vaccine Immunol 18:1067–1076
Franklin S, Ngo B, Efuet E, Mayfield SP (2002) Development of a
GFP reporter gene for Chlamydomonas reinhardtii chloroplast.
Plant J 30:733–744
Gauci C, Jayashi C, Lightowlers MW (2013) Vaccine development
against the Taenia solium parasite: the role of recombinant
protein expression in Escherichia coli. Bioengineered 4:343–347
Greenwood B (2014) The contribution of vaccination to global health:
past, present and future. Philos Trans R Soc Lond B Biol Sci
369:20130433
Hernandez M, Cabrera-Ponce JL, Fragoso G, Lopez-Casillas F,
Guevara-Garcıa A, Rosas G, Leon-Ramırez C, Juarez P,
Sanchez-Garcıa G, Cervantes J, Acero G, Toledo A, Cruz C,
Bojalil R, Herrera-Estrella L, Sciutto E (2007) A new highly
effective antycisticercosis vaccine expressed in transgenic
papaya. Vaccine 25:4252–4260
Hernandez M, Cervantes J, Cabrera-Ponce JL, Herrera-Estrella L,
Rosas G, Villareal ML, Fragoso G, Sciutto E (2010) Develop-
ment of an oral anti-cysticercosis vaccine delivered in geneti-
cally modified embryogenic callus of papaya. Transgenic Plant J
4(special issue 1):64–70
Houten N, Zwick M, Menendez A, Scott J (2006) Filamentous phageas an immunogenic carrier to elicit focused antibody responses
against a synthetic peptide. Vaccine 24(19):4188–4200
Huerta M, de Aluja AS, Fragoso G, Toledo A, Villalobos N,
Hernandez M, Gevorkian G, Acero G, Dıaz A, Alvarez I, Avila
R, Beltran C, Garcia G, Martinez JJ, Larralde C, Sciutto E (2001)
Synthetic peptide vaccine against Taenia solium pig cysticerco-
sis: successful vaccination in a controlled field trial in rural
Mexico. Vaccine 20(1–2):262–266
Konno K, Hirayama C, Nakamura M, Tateishi K, Tamura Y, Hattori
M, Kohno K (2004) Papain protects papaya trees from herbiv-
orous insects: role of cysteine proteases in latex. Plant J
37:370–378
Kwon KC, Daniell H (2015) Low-cost oral delivery of protein drugs
bioencapsulated in plant cells. Plant Biotechnol J 13:1017–1022
Lamichhane A, Azegamia T, Kiyonoa H (2014) The mucosal immune
system for vaccine development. Vaccine 32:6711–6723
Lebre F, Borchard G, de Lima MC, Borges O (2011) Progress towards
a needle-free hepatitis B vaccine. Pharm Res 28:986–1012
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein
measurement with the Folin phenol reagent. J Biol Chem
193:265–275
Manoutcharian K, Dıaz-Orea A, Gevorkian G, Fragoso G, Acero G,
Gonzalez E, De Aluja A, Villalobos N, Gomez-Conde E, Sciutto
E (2004) Recombinant bacteriophage-based multiepitope vac-
cine against Taenia solium pig cysticercosis. Vet Immunol
Immunopathol 99:11–24
Morales J, Martınez JJ, Manoutcharian K, Hernandez M, Fleury
Gevorkian G, Acero G, Blancas A, Toledo A, Cervantes J, Maza
V, Quet F, Bonnabau H, de Aluja AS, Fragoso G, Larralde C,
Sciutto E (2008) Inexpensive anti-cysticercosis vaccine: S3Pvac
expressed in heat inactivated M13 filamentous phage proves
effective against naturally acquired Taenia solium porcine
cysticercosis. Vaccine 26:2899–2905
Morales J, de Aluja AS, Martınez JJ, Hernandez M, Rosas G,
Villalobos N, Hernandez B, Blancas A, Manoutcharian K,
Gevorkian G, Cervantes J, Dıaz A, Fleury A, Fragoso G,
Planta (2017) 245:1037–1048 1047
123
![Page 12: Transgenic papaya: a useful platform for oral vaccinesclassical approaches (Greenwood 2014), i.e. attenuated or inactivated virus, toxoids, and whole killed bacteria. How-ever, classical](https://reader033.vdocuments.mx/reader033/viewer/2022060920/60ac2a3b9126d46fba7c4fde/html5/thumbnails/12.jpg)
Larralde C, Sciutto E (2011) Recombinant S3Pvac-phage
anticysticercosis vaccine: simultaneous protection against cys-
ticercosis and hydatid disease in rural pigs. Vet Parasitol
176:53–58
Okeniyi J, Ogunlesi T, Oyelami O, Adeyemi L (2007) Effectiveness
of dried Carica papaya seeds against human intestinal parasito-
sis: a pilot study. J Med Food 10:194–196
Ramos-Kuri M, Montoya RM, Padilla A, Govezensky T, Dıaz ML,
Sciutto E, Sotelo J, Larralde C (1992) Immunodiagnosis of
neurocysticercosis. Disappointing performance of serology (en-
zyme-linked immunosorbent assay) in an unbiased sample of
neurological patients. Arch Neurol 49:633–636
Rojo A, Perez V, Bayardo A, Correa HJ, Cuaron J (2001) Pasta de
canola como suplemento proteico en dietas para la finalizacion
de cerdos. Tecnica Pecuaria en Mexico 39:179–192. http://www.
redalyc.org/articulo.oa?id=61339301
Rosales-Mendoza S, Salazar-Gonzalez JA (2014) Immunological
aspects of using plant cells as delivery vehicles for oral vaccines.
Expert Rev Vaccines 13:737–749
Rosales-Mendoza S, Angulo C, Meza B (2016) Food-grade organisms
as vaccine biofactories and oral delivery vehicles. Trends
Biotechnol 34:124–136
Sasidharan S, Sumathi V, Jegathambigai NR, Latha LY (2011)
Antihyperglycaemic effects of ethanol extracts of Carica papaya
and Pandanus amaryfollius leaf in streptozotocin-induced dia-
betic mice. Nat Prod Res 25:1982–1987
Savelkoul HF, Ferro VA, Strioga MM, Schijns VE (2015) Choice and
design of adjuvants for parenteral and mucosal vaccines.
Vaccines (Basel) 3:148–171
Sciutto E, Fragoso G, de Aluja AS, Hernandez M, Rosas G, Larralde
C (2008) Vaccines against cysticercosis. Curr Top Med Chem
8(5):415–423
Segura-Velazquez R, Fragoso G, Sciutto E, Sarukhan A (2009)
Towards identification of the mechanisms of action of parasite-
derived peptide GK1 on the immunogenicity of an influenza
vaccine. Clin Vaccine Immunol 16:1338–1343
Shirbaghaee Z (2016) Different applications of virus-like particles in
biology and medicine: vaccination and delivery systems.
Biopolymers 105:113–132
Stein HH, Roth JA, Sotak KM, Rojas OJ (2013) Nutritional value of
soy products fed to pigs. Swine Focus #004. The University of
Illinois at Urbana-Champaign. http://nutrition.ansci.illinois.edu/
sites/default/files/SwineFocus004.pdf
Stertman L, Lundgren E, Sjoholm I (2006) Starch microparticles as a
vaccine adjuvant: only uptake in Peyer’s patches decides the
profile of the immune response. Vaccine 24:3661–3668
Toledo A, Larralde C, Fragoso G, Gevorkian G, Manoutcharian K,
Hernandez M, Acero G, Rosas G, Lopez-Casillas F, Garfias CK,
Vazquez R, Terrazas I, Sciutto E (1999) Towards a Taenia
solium cysticercosis vaccine: an epitope shared by Taenia
crassiceps and Taenia solium protects mice against experimental
cysticercosis. Infect Immun 67:2522–2530
Toledo A, Fragoso G, Rosas G, Hernandez M, Gevorkian G, Lopez-
Casillas F, Hernandez B, Acero G, Huerta M, Larralde C, Sciutto
E (2001) Two epitopes shared by Taenia crassiceps and Taenia
solium confer protection against murine T. crassiceps cysticer-
cosis along with a prominent T1 response. Infect Immun
69:1766–1773
WHO (2014) Weekly epidemiological record, vol 47. World Health
Organization, pp 517–528. http://www.who.int/wer/2014/en
Zhu X, Li X, Chen W, Chen J, Lu W, Chen L, Fu D (2012) Evaluation
of new reference genes in papaya for accurate transcript
normalization under different experimental conditions. PLoS
One 7:e44405
1048 Planta (2017) 245:1037–1048
123