THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 258.No. 3, Isue of February 10, pp. 1960-1967. 1983 Printed in U.S. A.

Transcriptional and Translational Start Sites for the Bacillus thuringiensis Crystal Protein Gene*

(Received for publication, August 4, 1982)

Hing Cheung Wong, H. Ernest Schnepf$, and H. R. Whiteley8 From the Department of Microbiology and Immunology, SC-42, University of Washington, Seattle, Washington 98195

The nucleotide sequence of the promoter region and part of the coding region of the crystal protein gene from Bacillus thuringiensis var. kurstaki HD-1-Dipel has been determined by analysis of a recombinant plas- mid from Escherichia coli. The start points for tran- scription of the gene in B. thuringiensis and in the E. coli strain carrying the recombinant plasmid were lo- cated by S1 nuclease mapping. Two adjacent start sites were identified using RNAs synthesized during sporu- lation of B. thuringiensis: transcription was initiated from one site early in sporulation and from the other site in the middle of sporulation. A good correlation was found between the appearance of the crystal pro- tein gene-specific RNA and the production of the pro- tein, indicating that the gene is primarily under tran- scriptional control during sporulation. Parallel studies with the recombinant strain of E. coli revealed the presence of only a single species of gene-specific RNA, regardless of the growth phase of the cells; the crystal protein was produced at all stages of growth. The se- quence for eight amino acids at the NH2 terminus of the crystal protein was determined and the corresponding coding sequence was located in the DNA sequence. A potential ribosome binding site of 11 nucleotides was found, located three nucleotides upstream from the initiator ATG codon. The deduced sequence for the first 333 amino acids of the crystal protein is presented.

Among the various species of the genus Bacillus, B. thurin- giensis is conspicuous for its ability to produce a parasporal crystal which is lethal to a wide variety of lepidopteran larvae. The crystal, which accounts for 20-30% of the dry weight of sporulated cultures, consists of a single M , = 130,000 protoxin polypeptide. This polypeptide is synthesized only during spor- ulation and is thought to be a component of the spore coat in Cry' strains (Lecadet et al., 1972; Bulla et al., 1975; Aronson and Pandey, 1978). Studies of mutants demonstrate an asso- ciation between the synthesis of the crystal protein and spor- ulation, although these processes are apparently not depend- ent on one another (Klier and Lecadet, 1974). However, some

* This research was supported by United States Public Health Service Grants GM-20784 and GM-26100 from the National Institutes of General Medical Science and by a grant from Cetus Corporation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

HDF-002666. + Supported by Developmental Biology Training Program Grant

5 Recipient of Research Career Award K6-GM-442 from the Na- tional Institute of General Medical Sciences. To whom correspond- ence should be addressed.

mutants which are blocked very early during sporulation fail to make crystals. The latter observation suggests that the gene coding for the crystal protein may be regulated in a manner similar to that of genes specifying other sporulation- specific polypeptides.

In vitro studies of cloned, sporulation-specific genes of Bacillus subtilis (Moran et al., 1981a; 1981b) indicate that at least some of the early developmental genes in this species are transcribed by a form of RNA polymerase in which the usual M , = 55,000 (I subunit has been replaced by a peptide of M , = 37,000. It has been proposed that a different form of RNA polymerase is also required for transcription of the crystal protein gene (Klier et al., 1973) and that the transcripts of this gene are more stable than other B. thuringiensis mRNAs (Petit-Glatron and Rapoport, 1975). Investigations of the molecular basis of crystal protein production have been hindered by the lack of an isolated, gene-specific probe. This difficulty has been overcome by the successful cloning of the crystal protein gene from plasmids of several B. thuringiensis subspecies into Escherichia coli (Schnepf and Whiteley, 1981; Whiteley et al., 1982). The E. coli strains containing the recombinant plasmids synthesize a M , = 130,000 polypeptide and extracts of these strains are lethal to larvae of the tobacco hornworm. As the first step in determining the factors which regulate the production of this protein both in B. thuringiensis and in E. coli, we have analyzed the promoter structure of one of the cloned crystal protein genes.

In this communication, we report the nucleotide sequence of the promoter region of the crystal protein gene including the two adjacent transcriptional start points utilized by B. thuringiensis and the unique start point used by E. coli. The translational start site for the crystal protein gene, the pre- dicted amino acid sequence for approximately one-fourth of the crystal protein, and preliminary data for the pattern of expression of the gene in these two hosts are also presented.

EXPERIMENTAL PROCEDURES

strain HBlOl bearing the pBR322-derived recombinant plasmid PES1 Bacterial and Bacteriophage Strains and Plasmids-E. coli

was the source of DNA coding for the crystal protein gene from B. thuringiensis var. kurstaki HD-1-Dipel (Schnepf and Whiteley, 1981). Bacteriophage M13 mp7 and E. coli strain JM103 were ob- tained from Bethesda Research Laboratories and were originally constructed by Messing et al. (1981). Plasmid PES1 and double- stranded DNA of M13 phage were prepared as described by Birnboim and Doly (1979). All plasmid preparations were additionally purified by centrifugation in CsC1-ethidium bromide gradients. Insertions of the kanamycin resistance transposon Tn5 into PES1 were obtained as described by Ruvkun and Ausubel (1981). The position of Tn5 in the resulting inserted plasmids was determined by restriction enzyme mapping.

Enzymes and Radiolabeling Procedures-All the restriction en- zymes and Tq DNA ligase were obtained from New England Biolabs; S1 nuclease and bacterial alkaline phosphatase were from Bethesda Research Laboratories and all enzymes were used as recommended

1960

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Crystal Protein Gene Transcriptional Start Sites 1961

by the suppliers. The 5'-end labeling of DNA fragments with [y-"'PI ATP (3000 Ci/mmol, New England Nuclear) was performed as de- scribed by Maxam and Gilbert (1980). The DNA polymerase I large fragment (New England Nuclear)-catalyzed fill-in reaction (Maniatis et at., 1975) was used for 3'-end labeling of DNA fragments for nucleotide sequence determination and to generate a probe for plaque hybridization ([a-'"P]dNTP, 400 Ci/mmol, New England Nuclear).

DNA and Amino Acid Sequencing-Specific restriction fragments were isolated for cloning, restriction enzyme analysis, and nucleotide sequence determination with the chemical method according to Maxam and Gilbert (1980). For the determination of the nucleotide sequences of the EcoRI-D and EcoRI-F restriction fragments using the chain termination procedure, the intact fragments were individ- ually subcloned into the EcoRI restriction site of phage M13mp7 in both orientations. Recombinant phages were then identified by plaque hybridization (Woo, 1979). DNA from the recombinant phage was extracted as described by Anderson (1981) and sequenced by the dideoxynucleotide chain termination method (Sanger et al., 1977) using a 12-nucleotide synthetic primer (Collaborative Research, Inc.).

The EcoRI-D and -F fragments are too large to sequence entirely from the ends so they were further digested and subcloned. The D and F fragments were digested with Hinfl and MspI, respectively, and the ends of the generated fragments were filled in using DNA polymerase I plus deoxynucleotide triphosphates (Maniatis et al., 1975), purified by DE52 chromatography (Smith, 1980). and ligated into the HincII site of phage M13mp7. In the case of the fragments resulting from XmnI digestion of the EcoRI-D fragment, SI nuclease treatment was used to generate blunt end fragments before they were subcloned into the HincII site of the phage. S1 nuclease treatment was performed as described below under "S1 Nuclease Mapping" with the following modifications. One pg of XmnI-digested EcoRI-D fragment was treated with 50 units/ml SI nuclease in the reaction mixture without the addition of any other DNA for 10 min a t 37 "C. The reaction mixture was then extracted twice with 50 mM Tris-HC1, pH 8.0, 1 mM EDTA-saturated phenol. The DNA from the aqueous layer was further purified by DE52 chromatography and then re- covered by ethanol precipitation.

Crystals were purified from sporulated Cultures of B. thuringiensis grown in modified G medium (Aronson et al., 1971) by four successive centrifugations in Renografin (E. R. Squibb & Sons, Inc.) gradients (Sharpe et al., 1975). T o determine the NH2-terminal amino acid sequence, 30 nmol of crystal were subjected to automated Edman degradation (Walsh et al., 1981). We wish, to thank the laboratory of Dr. Kenneth A. Walsh, Department of Biochemistry, University of Washington, for these analyses.

Sampling Sporulation Time Points-B. thuringiensis was grown in G medium with shaking at 30 "C througih three logarithmic growth transfers and then inoculated at 1% (v/v)linto each of two Fernbach flasks with 750 ml of G medium. Samples were taken a t midlog phase (300 ml) and a t about 1.5-h intervals thereafter (150 ml) until late sporulation (stage VI). Sporulation was donitored by phase micros- copy. The cells were harvested by centrifugation and the pellets were resuspended in 5 ml of 0.01 M Tris-HCI, p@ 7.0, 1 mM EDTA, 100 pg/ ml phenylmethylsulfonyl fluoride and weke broken by two passages through a French pressure cell a t 17,ooO,p.s.i. One-half-ml samples were added to boiling SDSI-gel sample buffer for SDS-polyacrylamide gel immunoblotting (Schnepf and Whiteliey, 1981) and to 8 M urea, 2% (v/v) P-mercaptoethanol, 0.01 M cyclohexylaminoethanesulfonic acid, pH 10, for ELISA tests (modified from Engvall and Perlmann, 1972).2 These samples were frozen immediately. RNA was purified from the remaining 4 ml of each sample by phenol extraction (Aiba et al., 1981). For "dot-blot" assays, purifled RNA was treated with DNase (Worthington RNase-free); 2.5 pg of RNA was spotted on nitrocellulose filters and the filters were hybridized with 'J2P-labeled EcoRI-F fragment from PES1 as describea by Thomas (1980).

sampling of E. coli-E. coli carrying Tn5 insertions in PES1 were grown overnight in 10 ml of L broth (Miller, 1972 ). The crystal protein was detected by immunoblotting as described previously (Schnepf and Whiteley, 1981). Briefly, the crystal protein was par- tially purified using cyclohexylaminoethaesulfonic acid buffer, and the samples were electrophoresed on 10% polyacrylamide gels, trans- ferred electrophoretically to nitrocellulose, reacted with rabbit anti-

' The abbreviations used are: SDS, sodi m dodecyl sulfate; ELISA,

J. P. DesRosier, K. Tomczak, and H. k. Whiteley, manuscript in enzyme-linked immunosorbent assay; bp, t ase pair.

preparation.

serum to purified crystal protein, and finally labeled with ""I-protein A (New England Nuclear).

For S1 nuclease mapping and ELISA tests, E. coli carrying the recombinant plasmid PES1 was grown in 750 ml of L broth. Cells were harvested from samples of 150 ml taken a t Af;m nm = 0.4, 0.8, 1.2, and 1.4. RNA and protein samoles were then prepared essentially as described above for B. thunngiensis.

SI Nuclease Mapping-A modified Berk-Sharp (1977) procedure was used to analyze RNAs from B. thuringiensis and E. coli. Samples of 150 pg of B. thuringiensis or 450 pg of E. coli RNA were mixed with 0.3 pg of the 850-bp MspI-RsaI restriction fragment which had been previously 5'-end labeled with [y-'"P]ATP and polynucleotide kinase at the MspI site. The mixture was precipitated with ethanol, evaporated to dryness, and dissolved in 10 pl of 40 mM 1,4-pipera- zinediethanesulfonic acid, pH 6.4, 400 lll~ NaC1, 1 mM EDTA, 80% deionized formamide (v/v). After incubation at 80 "C for 15 min, the mixture was annealed for 3 h a t 50 OC; then 300 pl of 30 nm sodium acetate (pH 4.4), 4.5 m zinc acetate, 280 mM NaCI, 20 pg/ml denatured calf thymus DNA, and 300 units/ml of S1 nuclease were added and the mixture was incubated at 37 "C for 30 min. The reaction was terminated by the addition of 75 p1 of 2.5 M NH, acetate, 50 mM EDTA. The RNA-DNA hybrids were recovered by precipita- tion with 1.2 ml of ethanol and 20 pg of yeast tRNA. The remaining RNA in the precipitates was hydrolyzed in 20 p1 of 0.1 N NaOH, 5 mM EDTA solution at 68 "C for 10 min. The S1-resistant DNA was recovered by ethanol precipitation and analyzed on a DNA sequenc- ing gel (Maxam and Gilbert, 1980).

Miscellaneous Techniques-Described methods were used for the isolation of E. coli RNA polymerase (Achberger and Whiteley, 1980), the RNA polymerase-DNA filter-binding assay (Achberger and Whiteley, 1980), and transformation (Mandel and Higa, 1970). Protein molecular weight standards were: myosin (M, = 200,000), P-galacto- sidase ( M , = 116,000), bovine serum albumin (M, = 66,000), ovalbumin (M, = 45,0001, and a-chymotrypsinogen ( M , = 26,000). Experiments involving recombinant DNA were done in accordance with the Na- tional Institutes of Health Guidelines.

RESULTS

Position of the Crystal Protein Gene and Its Promoter in the Recombinant Plasmid-The location of the crystal pro- tein gene on the recombinant plasmid was determined by Tn5 insertion analysis (Ruvkun and Ausubel, 1981) using immu- noblotting to monitor the synthesis of the M , = 130,000 protoxin. It is known that solubilized preparations of B. thu- ringienszs crystals frequently contain not only the latter pep- tide but also a toxic peptide of M , = 68,000 derived from the protoxin by proteolysis (Lilley et al., 1980). Extracts of E. coli bearing the recombinant plasmid PES1 produce a polypeptide of M , = 130,000 and sometimes a peptide of M,- = 68,000 which both react with antibodies to the B. thuringiensis crystal protein. Presumably, proteolysis o f the M,. = 130,000 peptide in vivo or during extract preparation accounts for the presence of the M,. = 68,000 peptide in the E. coli extracts.

As shown in lanes 1-3 and 8-10 of Fig. l A , when the transposon was inserted at positions AI, B5, B30, B6, B9, and B4 on the restriction map (Fig. l B ) , E. coli was still able to synthesize the M, = 130,000 polypeptide; trace amounts of the M , = 68,000 peptide were also found. However, when Tn5 was inserted at positions B14, BlO, B20, and B l l (lanes 4-7 o f Fig. lA), no appreciable amount o f the M , = 130,000 peptide was seen. This indicates that the crystal protein gene is located between positions B6 and B30 (Fig. 1B).

Data suggesting the orientation o f the crystal protein gene were obtained from analyses of larger amounts of extracts o f three of the strains with inserts. We found that the strain with Tn5 at position B30 produced a large amount of the M , = 130,000 peptide, the strain with Tn5 at B14 made a small amount, and the strain with Tn5 at position BlO made none (lanes 11-13 o f Fig. 1A ); extracts of all three strains contained small amounts of the M , = 68,000 peptide. Neither polypeptide was detected in repeated trials with strains having Tn5 in- serted at position Bll (lane 7 o f Fig. 1A) . Similar results were

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1962 Crystal Protein Gene Transcriptional Start Sites 1 2 3 4 6 8 7 8 B 10 11 1213

-" "- 0 A

A . B G F . D . C . E . A E ~ ~ R ~

R I ~ - - - - - - - -11.

R 1 1 . -1 I

pLSldB-1

pm-WFI - - - - - - - - - - F'IG. 1. Location of the crystal protein gene in the recombi-

nant plasmid pES1. A, SDS-polyacrylamide gel immunoblot assay of recombinant E. coli extracts from strains having Tn5 inserted into PES1 at the following positions (see B ) : lanes I , AI; 2, B5; 3, B30;4, B14; 5, BlO, 6, B20; 7, E l l ; 8, E 6 9, B9; 10, B4; 11, B30; 12, B1& 13, BlO. Lanes 1-10 contained 30-50 pg of protein; lanes 11-13, from a separate experiment, contained 80-100 pg of protein. E , restriction enzyme map of PES1 and its derivatives. Thick lines represent pBR322 DNA. Unlabeled vertical stubs represent EcoRI sites; other restriction targets are labeled. The upper line represents PES1 opened at its single SalI site, with the indicated points of Tn5 insertion marked with arrows; the boxed area shows the position of the crystal protein gene. Below it is an EcoRI cleavage map of PES1 with the fragments labeled A-G. The two bottom lines show the deletion plasmids pES1-B8-1 and pES1-B11-1 (see "Results" for details of contruction); the boxed areas denote the remaining portions of Tn5.

observed with strains having inserts at B30, B14, BlO, and BII in experiments with pulse-labeled maxicells (Sancar et al., 1979 data not shown). Our interpretation of these results is that the gene is transcribed from right to left on the map shown in Fig. 1B and that a Tn5 insertion at position B14 is near the 3' end of the gene, allowing synthesis of a nearly full length peptide, while Tn5 insertion at position BIO does not permit the accumulation of peptides larger than M , = 68,000.

Since the E. coli strain carrying PES1 synthesized a crystal protein peptide which was very similar in size to that made by B. thuringiensis (Schnepf and Whiteley, 1981), we assumed that the recombinant plasmid contained the 5' terminus of the gene. It was not known whether expression of this gene in E. coli was initiated from the promoter utilized in B. thuringien- sis or from another promoter in the inserted DNA or in the plasmid vector. The location of promoters recognized by the E. coli RNA polymerase was determined by means of the nitrocellulose binding assay (Jones et al., 1977). EcoRI frag- ments of PES1 were incubated with E. coli RNA polymerase under conditions which permit the formation of stable com- plexes (Achberger and Whiteley, 1980). The EcoRI fragments A, C, D, and E were recovered from the nitrocellulose filters (data not shown). EcoRI fragments A and E, respectively, contain promoters for the bla and tet genes of pBR322, the E. coli plasmid used in cloning the crystal protein gene. The EcoRI-C and -D fragments are both from B. thuringiensis DNA but only the D fragment is adjacent to the crystal protein gene as defined by Tn5 insertion, suggesting that this fragment might contain the crystal protein gene promoter. On the basis of these results, we determined the DNA sequence for 793 bp of EcoRI-D extending to the right of EcoRI-F on the map shown in Fig. 1B and for the 732-bp EcoRI-F frag- ment.

The DNA Sequence of the Promoter Region-Fig. 2 pre- sents a detailed restriction map of the EcoRI-D and -F frag- ments and the strategy used in sequence analysis of the

promoter region. Basically, either the intact EcoRI-F frag- ment or MspI-digested EcoRI-F fragments were individually subcloned in both orientations in the single-stranded phage M13 (Messing et al., 1981). Similar subclones were made of fragments of EcoRI-D produced by digestion with XmnI or HinfI. The nucleotide sequences of the subcloned fragments were determined by the dideoxynucleotide chain tefiination method (Sanger et al., 1977). The chemical modification method (Maxam and Gilbert, 1980) was used to confirm the nucleotide sequences determined by the dideoxynucleotide method.

The orientation of the EcoRI-F and -D fragments was determined by using two deletion plasmids formed from Tn5 insertions in pES1. PlasmidspESl-B11-1 and pES1-B8-1 were formed by joining the PstI site near the right end of the B. thuringiensis DNA insert of PES1 to the PstI site in the leftward arm of Tn5 inserted into the EcoRI-F and -D frag- ments, respectively, deleting the DNA between these points (Fig. 1B). pES1-Bll-1 contains an EcoRI fragment with only the leftward end of the PES1 EcoRI-F fragment. Both ends of this fragment were sequenced and compared to the complete sequence of the PES1 EcoRI-F fragment. The sequence in common to both fragments was therefore located at the left end of the PES1 EcoRI-F fragment. Similarly, pESl-B8-1 has an EcoRI fragment which contains only the leftward end of the EcoRI-D fragment of pES1. This fragment and the PES1 EcoRI-D fragment were labeled at the EcoRI ends and di- gested with HinfI, and the digests were compared by electro- phoresis on a 4% polyacrylamide gel and autoradiography. A fragment of 345 bp was common to both digests and is there- fore the left end of the pESI EcoRI-D fragment (Fig. 2).

Fig. 3 presents 1175 of the 1525 nucleotides determined for the coding strand. This sequence contains all of the EcoRI-F fragment and part of the EcoRI-D fragment to the right of the F fragment on the map shown in Fig. 2. The sequence of 350 nucleotides preceding the promoter region in the EcoRI- D fragment has not been shown.

Translational Start Point for the Crystal Protein-To correlate the DNA sequence data with the structure of the protein, crystals were purified from sporulated cultures of B. thuringiensis by extensive washing, successive centrifugations in Renografin, and additional washing. The NH&erminal amino acid sequence was determined through nine cycles of the automated Edman degradation procedure (Walsh et al., 1981). The first nine amino acids were found to be Met-Asp- Asn-Asn-X-Asn-Ile-Asn-Glu ( X could not be determined due to insufficient material). The amino acid sequence deduced from the DNA coding sequence starting at position 527 com-

""_" - ""_ """ - - "" """

""" - - """

"""

"""

" " -

1 F "

0 J EcoRI

1 ' Hint1

1 , ' Xmnl

' Yspl

1 ' R0.l

1 1 ' HP.1

1 ".."\"-.%..

IOL6bp

FIG. 2. Restriction enzyme map of the EcoRI-F-EcoRI-D por- tion of PES1 and sequencing strategy. EcoRI sites are labeled with arrowheads; sites for other enzymes are shown as vertical stubs on lines for the indicated enzyme. The cross-hatched line between the MspI and RsaI maps is the 850-bp fragment used for S1 nuclease mapping. Horizontal arrows represent the areas sequenced. Dashed arrows denote the chemical method with a 3' end label, and solid arrows are for the dideoxy method.

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Crystal Protein Gene Transcriptional Start Sites 1963

600 650

G A A T G C A T T C C T T A T A A T T G T T T A A G T A A C C C T G A A G T A G A A G T A T T A G G T G G A G A A A G A A T A G A A A C T G G T T A C A C C C C A A T C G A T A T T T C C T T G T C G C CluCysIleProTyrAsnCysLeuSerAsnProGluValGluValLeuGlyGlyGluArgIleGluThrGlyTyrThrProIleA~pIleSerLeuSerL

700 750

T A A C G C A A T T T C T T T T G A G T G A A T T T G T T C C C G G T G C T G G A T T T G T G T T A G G A C T A G T T G A T A T A A T A T G G G G A A T T T T T G G T C C C T C T C A A T G G G A C G C e u T h r C l n P h e L e u L e u S e r ~ l u P h e V a l P r o C l y A t o C / y P h e V a ~ L e u C l y L e u V a l A s p I l e I ~ e T r p C l y I ~ e P h e C l y P r o S ~ r G l n T r p A ~ p A ~

800 850

A T T T C C T G T A C A A A T T G A A C A G T T A A T T A A C C A A A G A A T A G A A G A A T T C G C T A G G A A C C A A G C C A T T T C T A G A T T A G A A G G A C T A A G C A A T C T T T A T C A A a ~ h e P r o V a t ~ t n I t e C t u C t n L e u I l e A ~ n G l n A r g I ~ e G l u C ~ u P h e A l a A r g A s n G ~ n A l a I ~ e S e r A r g L e u G ~ u G l y L e u S e r A s n L e u T y r C l n

900 950

ATTTACGCAGAATCTTTTAGAGACTGGGAAGCAGATCCTACTAATCCAGCATTAAGAGAAGAGATGCGTATTCAATTCAATGACATGAACAGTGCCCTTA IteTyrAtaCtuSerPheArg~luTrpGluAlaAspProThrAsnProA~aLeuArgG~uGluMetArgI~eC~nPheAsnA~p~etAsnSerA~aLeuT

1000 1050

C A A C C G C T A T T C C T C T T T T G G C A G T T C A A A A T T A T C A A G T T C C T C T T T T A T C A G T A T A T G T T C A A G C T G C A A A T T T A C A T T T A T C A G T T T T G A G A G A T G T hrThrAtaIteProLeuL~uAlaValGlnAsnTyr~lnValProLeuLeuSerVa~TryVa~G~nA~aA~aAanLeuH~sLeuSerVa~LeuArgAs~Va

1100 1150

TTCAGTGTTTGGACAAAGGTGGGGATTTGATGCCGCGACTATCAATAGTCGTTATAATGATTTAACTAGGCTTATTGGCAACTATACAGATTATGCTGTG ~SerValPheClyClnArgTrpGl~PheAspAlaAlaThrIleAanSerArgTyrAenAspLeuThrArgLsuIleGlyAsnTyrThrAspTyrAlaVal

1200 1250

C G C T G G T A C A A T A C G G G A T T A G A G C G T G T A T G G G G A C C G G A T T C T A G A G A T T G G G T A A G G T A T A A T C A A T T T A G A A G A G A G C T A A C A C T T A C T G T A T T A G ArgTrpTyrAsnThrCtyLeuGl~ArgVa~TrpC~yFroAspSerArgAspTrpVatAr~T~rAsnG~nPheArgArgG~uLeuThrLeuThrValLeuA

1300 1350

A T A T C G T T G C T C T A T T C T C A A A T T A T G A T A G T C G A A G G T A T C C A A T T C G A A C A G T T T C C C A A T T A A C A A G A G A A A T T T A T A C G A A C C C A G T A T T A G A A A A spI~eVa~A~aLeuPheSerAsnTyrAs~SerArgArgTyrProIleArgThrValSerGlnLeuThrArgGluIleTyrThrAsnProValLeuGluAs

1400 1450

T T T T G A T G G T A G T T T T C G T G G A A T G G C T C A G A G A A T A G A A C A G A A T A T T A G G C A A C C A C A T C T T A T G G A T A T C C T T A A T A G T A T A A C C A T T T A T A C T G A T nPheAspClySerPheArgCtyWetAlaGlnArgIleG~uGlnAsnIleArgGlnFroH~sLeuNetAspIleLeuAsnSerIleThrIleTyrThrAsp

1500

G T G C A T A G A G G C T T T A A T T A T T G G T C A G G G C A T C A A A T A A C A G C T T C T C C T G T A G G G T T T T C A G G A C C A G A A T T C V a ~ H i s A r g C l y P h e A s n T y r T r p S e r C l y E ~ s G l n I l e T h r A l a S e r ~ r o V ~ l ~ l y p h e S e r ~ l y p ~ ~ ~ l ~ p ~ ~

FIG. 3. DNA sequence of the NH,-terminal portion of the crystal protein gene and 5’-flanking se- quences. Bases are in block type, amino acids are in italics, dots are positioned every 10 base pairs (the first 350 sequenced bases are not shown). The underlined buses from position 563-573 show complementarity to the 3’ end of the I6 S rRNA of B. subtilis. Wavy underlining shows the position of transcription initiation as determined by SI nuclease mapping. Btl, BtZZ, and Ec, respectively, indicate the start sites for RNA I and RNA I1 in B. thuringiensis and the start site in E. coli.

pletely matches the identified amino acids at the NH? termi- nus of the crystal protein.

The sequence given in Fig. 3 includes 176 nucleotides pre- ceding the initiation codon, followed by a single continuous open reading frame for 999 nucleotides. As indicated in Fig. lB, insertion of Tn5 in this latter portion of the sequence prevents expression of the crystal protein gene. The deduced amino acid sequence for the fust 333 amino acid residues of the crystal protein is given in Fig. 3. Three bases upstream from the ATG codon (position 523), there is an 11-base sequence which shows good complementarity (9 of 11 bases match) to the sequence found at the 3’ end of the 16 S rRNA in several bacilli (McLaughlin et al., 1981). This 11-base sequence could serve as a ribosome binding site for translation of the encoded protein.

Location of the Transcriptional Start Point of the Crystal Protein Gene in B. thuringiensis and in E. coli-We em- ployed the S1 nuclease-mapping procedure of Berk and Sharp (1977) to identify transcriptional start sites. For B. thurin- giensis, RNA preparations were isolated from synchronized cultures harvested at about 1.5-h intervals beginning at midlog phase and continuing to late sporulation. The extracted RNAs were hybridized to an 850-bp denatured MspI-RsaI fragment (shown as a cross-hatched bar in Fig. 2) which had been 5’- end labeled at the MspI terminus. S1 nuclease was added to remove single-stranded nucleic acids, and the DNA-RNA hybrids were denatured and subjected to electrophoresis on DNA-sequencing gels, using as markers base-specific degra- dation fragments of the 850-bp MspI-RsaI fragment.

Fig. 4 shows the results of such an experiment. No crystal

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1964 Crystal Protein Gene Transcriptional Start Sites

1 2 3 4 5 6 7 8 9 1011 12131415

FK. 4. S1 nuclease analysis of crystal protein gene transcription in E. coli and B. thuri&ensis. The 850-bp MspI-RsaI fragment (cross-hatched line in Fig. 2). 5”end labeled at the MspI terminus, was hybridized with the indicated RNA samples, treated with SI nuclease, and analyzed on a DNA sequencing gel (see “Experimental Procedures” for details). Base-specific chemical cleavages of this same labeled fragment are shown in lanes 2 and 13, G-reaction; 3 and 14, G + A reaction; 4 and 15, C + T reaction. RNA samples were extracted from: lane 1, E. coli containing pESl harvested at midlog phase. Lanes 5-12, B. thuringiensis HD-l-Dipel harvested at: lane 5, midlog phase; 6, onset of stationary phase; 7, 1.5 h; 8, 3 h; 9, 4 h; 10, 5.5 h; 11, 6.5 h 12, 7.5 h after the onset of stationary phase. The RNAs were extracted from the same samples analyzed in Fig. 5. The sequence complementary to positions 421 through 463 in Fig. 3 is indicated at the right.

protein gene-specific RNA was found in cells harvested at midlog phase (lune 5 of Fig. 4) or at the onset of the stationary phase (lune 6 of Fig. 4). However, gene-specific RNA was detected in cells extracted 1.5,3, and 4 h after the onset of the stationary phase (lunes 7-9 of Fig. 4). Two bands of approxi- mately equal intensity were seen on the autoradiograms, possibly indicating heterogeneity in initiation (discussed be- low). Although the amount of gene-specific RNA in these samples was not quantitated, the same amount of RNA was used in each analysis. Visual inspection indicates that the relative intensities of the two radioactive bands seen in the sample taken at 1.5 h (lune 7 of Fig. 4) increased in samples taken at 3 and 4 h into stationary phase (lunes 8 and 9 of Fig. 4) and then decreased in subsequent samples.

Interestingly, about 6 h after the cells entered the stationary phase, a second set of RNA start sites was revealed (lune 10 of Fig. 5). Moreover, the second set of RNAs, which yielded bands of high relative intensity, displayed an even greater apparent heterogeneity in initiation sites than the first set. The significance of the heterogeneous start sites shown in Fig. 4 is not known but similar multiple bands have been reported in S1-mapping experiments with other promoters in bacteria and also for promoters in some eucaryotic genes (Moran et ul., 1981b; Kahana et ul., 1981; Heilig et ul., 1982). Additional experiments will be required to determine whether the mul- tiple bands seen in Fig. 4 represent adjacent initiation sites or result from artifacts related to S1 digestion (Hentschel et ul.,

1980). Regardless of the interpretation of the latter observa- tion, the results presented in Fig. 4 clearly demonstrate that more than one promoter site is utilized by RNA polymerase(s) for the transcription of the crystal protein gene during spor- ulation. The RNAs detected in Fig. 4 will be referred to as RNA I (produced early in sporulation with a start point a t about position 457 in Fig. 3) and RNA I1 (produced a t mid- sporulation with a start point at about position 442 in Fig. 3). The start points have been corrected by one base to account for the different migration of DNA fragments having a 3”OH or a 3”phosphate terminal base (Hentschel et ul., 1980).

Strikingly different results were obtained in experiments performed with RNA extracted from E. coli bearing the recombinant plasmid. In E. coli, a unique start point was found a t about position 450, again with multiple bands indi- cating some heterogeneity. Lune I of Fig. 4 shows the results obtained with RNA from midlog phase cells; the same start point was found with RNAs from earlier and later stages of growth (data not shown).

Time of Appearance of the Crystal Protein Antigen-The time of appearance of the crystal protein antigen relative to the synthesis of gene-specific RNA was also investigated. Fig. 5 presents data on the hybridization of RNAs extracted from B. thuringiensis at different time intervals to a gene-specific probe (the EcoRI-F fragment from the recombinant plasmid; see Fig. 1B) using the dot-blot method (Thomas, 1980). In agreement with the data presented in Fig. 4, hybridization

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Crystal Protein Gene Transcriptional Start Sites 1965

1 2 3 4 5 6 7 8 9

A

-200

-116

-66

-45

-26

FIG. 5. Expression of the crystal protein in B. thuringiensis HD-1-Dipel and in E. coli containing pES1. Lunes 1-9 of A-C are B. thuringiensis samples from the following growth stages (see “Experimental Procedures” for preparation): I , midlog; 2, onset of stationary phase; 3, 1.5 h 4, 3 h; 5, 4 h; 6, 5.5 h; 7, 6.5 h; 8, 7.5 h after the onset of stationary phase; 9, sporulated culture. A, dot-blot analysis of the indicated RNA samples hybridized with ‘”P-labeled EcoRI-F fragment from pES1. B, the M, = 130,000 area of an SDS- polyacrylamide gel immunoblot of the indicated protein samples (20 p1 of each extract; about 50 pg) reacted with anticrystal antibody and ’“I-protein A. C, a Coomassie brilliant blue-stained 10% SDS-poly- acrylamide gel of the indicated samples ( 2 0 4 extract; about 50 pg of protein). Molecular weight standards are X lo-,’. D, an ELISA test for crystal protein antigen. Durk burs over numbers represent the same B. thuringiensis samples as in A-C. The cross-hatched burs represent samples from E. coli containing PES1 taken at (from left to right) the midlog, late log, onset of stationary, and stationary phases of growth. Note that these represent IO’ less material than the durh burs.

was detected in samples 3-8 of Fig. 5A; RNA was not extracted from spores (sample 9). Fig. 5 also shows assays for the crystal protein antigen as detected by an immunoblot analysis (Schnepf and Whiteley, 1981), an electrophoretic examination of total extract peptides (SDS-polyacrylamide gels stained with Coomassie blue) and ELISA. The antigen was found in samples 3-8 by the ELISA assay ( D ; sample 9 was not as- sayed), in samples 4-9 by the immunoblot assay ( B ) and a heavily staining band of about M, = 130,000 was clearly visible in lanes 6-9 on the SDS-polyacrylamide gel (C); this is the band detected by immunoblot assays in B. The identity of the other fairly intensely staining band of about M , = 66,000 seen in lanes 6-9 is unknown. This band may be a proteolytic degradation product of the M , = 130,000 protoxin or a spore component or another toxin (Yamamoto and McLaughlin, 1981). Overall, these results show a good correlation between the appearance of gene-specific RNA and the production of the crystal protein antigen in B. thuringiensis and suggest that expression of the crystal protein during the initial stages of sporulation is regulated primarily at the transcriptional level rather than at the translational level.

In contrast, when the ELISA assay was used to analyze extracts of the E. coli strain carrying the recombinant plasmid, we found comparable amounts of the crystal protein antigen in extracts of midlog, early stationary, and late stationary cells (Fig. 5) and also after 24 h of growth (data not shown). The amounts of crystal protein antigen detected in the E. coli extracts were significantly less than in extracts of sporulating B. thuringiensis cells. A number of factors (inefficient tran- scription and/or translation, degradation, etc.) may contribute to the low level of expression of this gene in E. coli.

DISCUSSION

The cloning of the crystal protein gene from a plasmid in B. thuringiensis into E. coli has allowed a determination of the DNA sequence of the promoter region of the gene. The 1175- bp nucleotide sequence reported in this study contains 999 bp of crystal protein coding sequence and a 5’-flanking sequence of 176 bp. The translational start site was established by the determination of eight of the amino acids at the NHz terminus of the protein. A relatively long potential Shine-Dalgarno (1974) sequence was found three nucleotides upstream from the initiator ATG codon. Nine of the 11 bp in this sequence (GATGGAGGTAA) are complementary to the 3’ end of the 16s Bacillus rRRA (complementary bases are underlined), implying an efficient translation (McLaughlin et al., 1981) of

~ C ~ T T G A T ~ T T T A G T ~ T T E ) G T T G C A E T T T G T ~ A T ~ T T T T C A T A A ~ T ~ ~ T ~ T G T T T T ~ T ~ Crystal Protein

AGCT~CCATTTTTEGAGGTTT~TCCTTATCG;TATGGGTAT;GTTTGTM~~ spovc

FIG. 6. Sequence comparison of some Bacillus promoters: generalized recognition sequences for B. subtilis us‘, crystal protein, spoVG, and spoVC. Arrows represent transcription initiation sites as determined by S1 nuclease mapping. Single underlining denotes the -10 regions for RNA I, the spoVG “downstream promoter,” and the spoVC promoter; double underlining denotes the -10 regions for RNA I1 and the spoVG “upstream promoter.” Sections in bruchets are the highly A + T-rich regions.

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1966 Crystal Protein Gene Transcriptional Start Sites

the crystal protein mRNA. This could be a contributing factor to the massive production of the protein during sporulation.

The pattern of codon usage in the crystal protein was compared to that in E. coli proteins (Granthan et al., 1980) and in the p-lactamase from B. licheniformis (Neugebauer et al., 1981). Significant differences in codon preferences were found for several amino acids. The CAT codon for Asp, the TAT codon for Tyr, and the CTT and TTC codons for Leu appear to be used preferentially in the two Bacillus proteins; in E. coli, the predominant codons for Asp, Tyr, and Leu are GAC, TAC, and CTG, respectively. Similarities in the pre- ferred codons can also be found in the Bacillus proteins and the E. coli proteins, e.g. the codons used for Glu. However, a more reliable and detailed analysis of codon preference cannot be made until more Bacillus genes and gene products have been sequenced.

The transcriptional start points utilized by B. thuringiensis and E. coli and the time of appearance of gene-specific RNA were determined by S1 nuclease mapping. In B. thuringiensis, gene-specific RNA could not be detected in cells until about 1.5 h after the onset of the stationary phase (approximately at stage I1 of sporulation, i.e. the formation of the spore septum). This RNA (RNA I) increased in relative amount and then decreased concomitantly with the appearance of a second species (RNA 11) at midsporulation (stage 111-IV, “phase-dark prespores”). The time of synthesis of functional mRNA and the production of the crystal protein was examined previously (Gould et al., 1973). However, the data did not eliminate the possibility that a mRNA was made during vegetative growth or early in sporulation and then activated for translation a t later stages. This type of post-transcriptional regulation has been observed both in Gram-negative and in Gram-positive bacteria (Gold et al., 1981; Horinouchi and Weisblum, 1980). In the present investigation, the technique of SI mapping provided an unambiguous probe for the gene-specific mRNA. A good correlation was found between the appearance of the mRNA and the production of the crystal protein, indicating that the gene is primarily under transcriptional control, at least in the initial stages of sporulation.

As seen from Fig. 6, comparison of the nucleotide sequences upstream from the initiation site of RNA I with a consensus B. subtilis ass promoter sequence (Losick and Pero, 1982) shows little or no homology in the region centered 10 bp upstream from the initiation site and virtually no homology in the region 35 bp upstream. The -10 and -35 regions have been shown to be important in promoter recognition by both B. subtilis and E. coli RNA polymerase. As noted elsewhere (Losick and Pero, 1982), the promoters recognized by these fairly dissimilar polymerases do not differ significantly in the respective -10 and -35 regions.

Transcription of the gene in E. coli carrying the recombi- nant plasmid occurred a t all stages of growth and was initiated near promoters utilized by B. thuringiensis RNA polymer- ase(s). However, sequences centered a t -10 and -35 from the start point were not substantially homologous to the se- quences which are essential for recognition by E. coli RNA polymerase (Rosenberg and Court, 1979; Siebenlist et al., 1980). This may contribute to the low level of expression of the cloned gene in E. coli. Interestingly, sequences which give an equally good or slightly better match to the -10 and -35 consensus sequences can be found centered a t nucleotides 487 and 461, respectively, about 20 bp downstream from the in vivo initiation site of the E. coli transcript. Why this region does not serve as a promoter for the transcription of the cloned gene in E. coli is not known.

Since the cyrstal protein gene is expressed during sporula- tion, we compared the nucleotide sequences from the two

crystal protein transcriptional start sites with the promoter sequences for two B. subtilis sporulation genes, the spoVG and spoVC genes (Moran et al., 1981a; 1981b) which are activated early in sporulation. The spoVC gene is transcribed by RNA polymerase containing a‘’?. The spoVG gene contains two overlapping promoters, one of which, the “upstream pro- moter,” is recognized by RNA polymerase containing d’; the second or “downstream promoter” is apparently transcribed by polymerase containing additional polypeptides. Comparing the decanucleotide sequences around -10, both the spoVG “downstream promoter” and the spoVC promoter have ho- mology (7 and 5 out of 10 bases, respectively) with the -10 region for the promoter for RNA I of the crystal protein gene. The latter and the spoVC gene both have the sequence TGTTT (at -9 to -5 in the crystal protein sequence and at -10 to -6 in the spoVC gene); the comparable -10 regions for the RNA I promoter and the spoVG “downstream pro- moter” contain the seqeunce C- - ATG-TTT (at -8 to -2). I t is of interest that there is a sequence (-ATTGTT-) approxi- mately 80 bp upstream from the initiation site for RNA I which shows homology with the -10 region for the spoVC promoter but this region is apparently not utilized by the polymerase which synthesizes RNA I. The crystal protein gene sequence and the spoVG sequence also both contain a highly AT-rich region about 45 and 50 bp upstream, re- spectively, from the initiation sites; this AT-rich region was shown to be indispensable for transcription from the spoVG “downstream promoter” (Moran et al., 1981a). We find little or no homology in the -35 regions of the presumed promoter for RNA I of the crystal protein gene and the spoVC and spoVG genes. It has been speculated (Moran et al., 1981a) that the latter either lacks a -35 region or that this region is not in the proper position for efficient recognition by RNA polymerase and that additional sp00 regulatory proteins may be required to compensate for the lack of the -35 region. Lastly, virtually no homology can be found in the -10 and -35 regions of the presumed promoter for RNA I1 of the crystal protein gene (the midsporulation start site) and the respective -10 and -35 regions of the promoter for RNA I or the spoVC gene or either of the two spoVG start sites. The RNA I1 promoter which has an unusually high content of Ts in the -10 region, may have some homology to the 0.3-kb gene of B. subtilis which is transcribed beginning at stage I11 or 1V of sporulation, possibly by a polymerase containing another a-like peptide (Ollington and Losick, 1981). In toto, the finding that the crystal protein gene is not

transcribed until the onset of sporulation plus the sequence comparisons described above strongly suggests that expres- sion of the plasmid-borne crystal protein gene is regulated by the same mechanisms that regulate expression of chromo- somally located sporulation genes. Thus, synthesis of RNA I early in sporulation of B. thuringienszs may involve a polym- erase with a a’”-like specificity and another polymerase may be needed for synthesis of RNA I1 at midsporulation. Whether the several forms of RNA polymerase which have been re- ported to be present in sporulating cells of B. thuringiensis (Klier et al., 1973) include such enzymes remains to be deter- mined. This explanation does not preclude the existence of additional mechanisms of regulating the crystal protein gene at some stage of growth of B. thuringiensis, e.g. via a negative regulatory element. Two regions between nucleotides 428 and 473 and between nucleotides 449 and 475 in Fig. 3 contain segments of hyphenated dyad symmetry. The fist consists of TTTTTCAT-30 bp-ATGAAAAA, and the second consists of TGTTTT--ATT-5 bp-AAT--AAAACA. This type of sym- metry, which is characteristic of operator sites, is located in regions which include both start sites for transcription of the

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Crystal Protein Gene Transcriptional Start Sites 1967

crystal protein gene and could, therefore, interfere with its expression.

Lastly, it may be surmised that arrangement of two pro- moters in close juxtaposition as revealed by the S1-mapping experiments in this investigation would constitute a useful mechanism for the continued high expression of the crystal protein gene if two forms of RNA polymerase were produced at different stages of sporulation and each recognized one of the two promoters. A similar proposal could be made regard- ing the overlapping promoters found in the spoVG gene. Purification of polymerase from different stages of sporulation of B. thuringiensis and in vitro transcription of the cloned DNA should identify the polymerases which recognize the different promoter sequences involved in the production of RNAs I and 11.

Acknowledgment-We wish to thank Kathleen Tomczak for tech- nical assistance.

REFERENCES Achberger, E. C. and Whiteley, H. R. (1980) J. Biol. Chem. 255,

Aiba, H., Adhya, S., and de Crombrugghe, B. (1981) J. Biol. Chem.

Anderson, S. (1981) Nucleic Acids Res. 9, 3015-3027 Aronson, A. I., Angelo, N., and Holt, S. C. (1971) J. Bacteriol. 106,

1016-1025 Aronson, A. I., and Pandey, N. K. (1978) in Spores VI1 (Chambliss,

G., and Vary, J . C., eds) pp. 54-61, American Society for Microbi- ology, Washington, D. c.

11957-11964

256, 11905-11910

Berk, A. J., and Sharp, P. A. (1977) Cell 12, 721-732 Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523 Bulla, L. A,, Rhodes, R. A,, and St. Julian, G. (1975) Annu. Reel.

Engvall, E., and Perlmann, P. (1972) J . Zmmunol. 9, 129-135 Gold, L., Pribnow, D., Schneider, T., Shinedling, S., Singer, B. S., and

Gould, H. J., Loving, T. F. L., Vasu, S.-S., and Herbert, B. N. (1973)

Granthan, R., Gautier, C., Gouy, M., Mercier, R., and Pave, A. (1980)

Heilig, R., Muraskowsky, R., and Mandel, J.-L. (1982) J. Mol. Bioi.

Hentschel, C., Irminger, J.-C., Baucher, P., and Birnstiel, M. L. (1980)

Microbiol. 29, 163-190

Stormo, G. (1981) Annu. Rev. Microbiol. 35, 365-403

Eur. J. Biochem. 37,449-458

Nucleic Acids Res. 8, r49-r62

156, 1-19

Nature (L0n.d.) 285, 147-151 Horinouchi, S., and Weisblum, B. (1980) Proc. Natl. Acud. Sci.

U. S. A . 77. 7079-7083 Jones, B. B., Chan, H., Hothstein, S., Wells, R. D., and Reznikoff, W.

Kahana, C., Gidoni, D., Canaani, D., and Groner, Y. (1981) J. Virol. S. (1977) Proc. Natl. Acad. Sci. U. S. A . 74,4914-4918

37, 7-16

Klier, A. F., and Lecadet, M.-M. (1974) Eur. J . Biochem. 47, 111-119 Klier, A., Lecadet, M.-M., and Dedonder, R. (1973) Eur. J. Biochem.

Lecadet, M.-M., Chevrier, G., and Dedonder, R. (1972) Eur. J. Bio-

Lilley, M., Ruffel, R. N., and Somerville, H. J . (1980) J. Gen. Micro-

Losick, R., and Pero, J. (1981) Cell 25, 582-584 Mandel, M., and Higa, A. (1970) J. Mol. Biol. 53, 159-162 Maniatis, T., Jeffrey, A,, and Kleid, D. G. (1975) Proc. Natl. Acad.

Maxam, A,, and Gilbert, W. (1980) Methods Enzymol. 65,499-559 McLaughlin, J . R., Murray, C. L., and Rabinowitz, J. C. (1981) J.

Messing, J., Crea, R., and Seeburg, P. (1981) Nucleic Acids Res. 9,

Miller, J. (1972) in Experiments in Molecular Genetics, pp. 31-36,

Moran, C. P., Jr . , Lang, N., Banner, C. D. B., Haldenwang, W. G., and

Moran, C. P., Lang, N., and Losick, R. (1981b) Nucleic Acids Res. 9,

Neugebauer, K., Sprengel, R., and Schaller, H. (1981) Nucleic Acids

Ollington, J . F., and Losick, R. (1981) J. Bacteriol. 147, 443-451 Petit-Glatron, M.-F., and Rapoport, G. (1975) in Spores VI (Gerhardt,

P., Costilow, R. N., and Sadoff, H. L., eds) pp. 255-265, American Society for Microbiology, Washington, D. C.

36,317-327

chem. 25,349-358

biol. 118, 1-11

Sci. U. S. A . 72, 1184-1188

Biol. Chem. 256, 11283-11291

309-321

Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Losick, R. (1981a) Cell 25, 783-791

5979-5990

Res. 9, 2577-2588

Rosenberg, M., and Court, D. (1979) Annu. Reu. Genet. 13,319-353 Revkun, G. B., and Ausubel, F. M. (1981) Nature (Lond.) 289,85-88 Sancar, A,, Hack, A. M., and Rupp, W. D. (1979) J. Bacteriol. 137,

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Prof. Natl. Acad.

Schnepf, H. E., and Whiteley, H. R. (1981) Proc. Natl. Acad. Sci. U.

Sharpe, E. S., Nickerson, K. W., Bulla, L. A,, and Aronson, J. N.

Shine, J., and Dalgarno, L. (1974) Proc. Natl. Acad. Sci. U. S. A. 71,

Siebenlist, U., Simpson, R. B., and Gilbert, W. (1980) Cell 20, 269-

Smith, H. 0. (1980) Methods Enzymol. 65, 371-380 Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 5201-5205 Walsh, K. A., Ericsson, L. H., Parmelee, D. C., and Titani, K. (1981)

Annu. Rerl. Biochem. 50, 261-284 W h i t e h , H. R., Kronstad, J. W., Schnepf, H. E., and DesRusier, J.

P. (1982) in Molecular Cloning and Gene Regulation in Bacilli (Ganesan, A. T., Chang, S., and Hoch, J . A. eds) pp. 131-144, Academic Press, New York

692-693

Sci. U. $7. A . 74,5463-5467

S. A. 78, 2893-2897

(1975) Appl. Microbiol. 30, 1052-1053

1342-1346

281

Woo, s. L. C. (1979) Methods Enzymol. 68, 389-395 Yamamoto, T., and McLaughlin, R. E. (1981) Biochern. Biophys. Res.

Commun. 103,414-421

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

H C Wong, H E Schnepf and H R Whiteleyprotein gene.

Transcriptional and translational start sites for the Bacillus thuringiensis crystal

1983, 258:1960-1967.J. Biol. Chem. 

  http://www.jbc.org/content/258/3/1960Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/258/3/1960.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on April 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from