Transcription• The synthesis of a ribonucleic acid (RNA) polymer from a

deoxyribonucleic acid (DNA) template

– Separates storage from use– Provides a control point for regulation– Amplification step (can make many RNA copies)

RNA DNA

H

5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’

Nucleic acid structure• Natural DNA adopts a linear double helical form

– complete complementary base-pairing between two strands

• RNA “transcripts” yield complex overall shapes– synthesized as single strands that fold back upon themselves– “folding’ is driven by base pairing

noteG:U pair

General outline of transcription (txn)• Transcription (Txn) process consists of 5 general steps

– BINDING• RNA polymerase (RNAp) binds to DNA in promoter region

– UNWINDING• Duplex DNA must be unwound to expose bases of template strand

– INITIATION• Polymerize nucleotides one at a time into complementary RNA strand

– ELONGATION• Disengage from “additional factors” and the promoter region to continue

transcript synthesis throughout full length of gene– TERMINATION

• Respond to “stop” signals at the end of the gene by stopping synthesis and releasing the RNA transcript product

Binding

• RNA polymerase (RNAp) binds to DNA in Promoter region– Bind to specific sequences or “elements”

• Additional factors help RNAp recognize promoters– TXN factors

• General Txn Factors (GTFs): used at all promoters• Activators/Repressors: used at specific promoters

– Bind specific sequence “elements”– Directly or indirectly affect RNAp

Txnfactor RNAp

Co-factor

5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’

UNWINDING

• Duplex must be unwound to expose bases of template strand– Helicase: enzyme that unwinds duplex regions of

polynucleotides• DNA helicases act on DNA strands

– In txn (see below) and DNA replication (not covered)• RNA helicases act on RNA strands

– In a variety of settings, including transcriptional regulation

Txnfactor RNAp

Co-factor

5’-…TGAGTCACTGTACGCTATATAAGGC…GA3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’

TCGCCTCAGGAACCA

CATGCT…-3’C

INITIATION

• Start polymerizing nucleotides one at a time into an RNA strand that is complementary to the template DNA strand– Template DNA is “read” in 3’ --> 5’ direction– The RNA transcript is synthesized in 5’ --> 3’ direction

RNAn + NTP --> RNAn+1 + pyrophosphate (PPi)

PPi --> 2 inorganic phosphate (Pi)– A short 10-12nt region of RNA-DNA hybrid is created and

maintained

Txnfactor RNAp

Co-factor

5’-…TGAGTCACTGTACGCTATATAAGGC…GA3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’

TCGCCTCAGGAACCA

GCCUCAGGAA-3’ CATGCT…-3’C

GCCUCAGGA

ELONGATION

• Disengagement of RNAp from various GTFs, cofactors and the promoter region is often called “Promoter Escape”

• After disengaging, RNAp continues transcript synthesis throughout full length of gene

• A short 10-12nt region of RNA-DNA hybrid is maintained• Transcribed region of DNA is allowed to re-anneal (close),

displacing the RNA strand• RNAp moves 3’ --> 5’ on the DNA template strand

– Note movement is 5’ --> 3’ on the non-template DNA strand

Txnfactor

Co-factor

5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGG3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’

AACCACCATGCT…-3’

ACCACCAUGC-3’

CCAUGCU

TERMINATION

• Respond to “stop” signal sequences indicating the end of the gene– stop synthesis (a pause in the polymerization reaction)– release the RNA transcript product– Release RNAp from the DNA

5’-…CCATGCT CTTATGTACGTAGCGACT…-3’3’-…GGTACGATGTTATTTGATTTAATAATGGAATACATGCATCGCTGA…-5’

A CCAATAAACTAAATTATTA

AGAAUAAACU-3’

Bacterial txn

• RNAp “core” enzyme (no promoter specificity)– 5 subunits capable of binding DNA & RNA synthesis

• Sigma factors target RNAp to different types of promoters – Sigma70 is for “housekeeping” and most other genes

-35 element “TTGACA”

-10 element “TATAAT”– Sigma32 is for “heat shock” genes

• Chaperone genes induced in response to excess heat

BACTERIA:

• BIND

• UNWIND

• INITIATE• ELONGATE

without sigma

BACTERIA

• TERMINATE– Rho-dependent

• Rho protein (helicase) unwinds RNA-DNA duplex causing release of finished RNA transcript

– Rho-independent• Rho protein is not required• DNA “terminator” sequence

causes RNAp to pause, release from DNA and release RNA transcript

Rho

Txn in eukaryotes• Three different RNAp enzymes: RNApI, RNApII, RNApIII

• All eukaryotic RNAs require additional processing steps after synthesis to yield the mature RNA

• Primary RNA transcripts are often called “pre-RNAs”

Txn in eukaryotes: RNApI• 100s of copies of the large ribosomal RNA (rRNA) genes in most genomes

– Large numbers needed to yield large amounts of RNA• Copies are grouped into clusters called rDNA

– For example, humans have 5 rDNA clusters– rDNA clusters are grouped within the nucleus to form the nucleoli

• Nucleoli are the site of rRNA synthesis, processing and ribosome assembly

18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S

Txn in eukaryotes: RNApI• RNApI molecules, densely packed on DNA template• Very high rate of rRNA synthesis• pre-rRNA must be processed to yield mature rRNA

18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S

Txn in eukaryotes: RNApIII• RNApIII can recognize as “promoter” sequences, regions

internal to the transcription unit– Specific General Transcription Factors (GTFs) enable promoter binding

• TFIIIA, TFIIIC

(Note, there are GTFs for RNApI also, TFIA, etc…)

RNAp

5’-…TACGCTGTCTAGGCGA3’-…ATGCGACAGATCCGCTAGCGGAGTCCTTGGTGGCATAGGAGTTAGGGA…-5’

TCGCCTCAGGAACCA

CGTATCCTCAATCCCT…-3’C

GTF

Txn in eukaryotes: RNApIII• Transcribe 5S rRNA genes

– Product transported to nucleoli for processing/assembly into ribosomes• Transcribe tRNA genes

– Exist in genomic clusters– Clusters contain a variety of different tRNAs– Total number of tRNA genes can be very high

• (e.g. ~275 in yeast, ~1300 in humans)– Primary tRNA transcripts require processing to mature form

• Processing involves cutting and trimming reactions

Txn in eukaryotes: RNApII• For messenger RNA (mRNA), microRNA (miRNA) genes

– 12 subunits = core RNApII enzyme– Promoter specificity requires 6 additional GTFs

• TFIID, TFIIA, TFIIB, TFIIF, TFIIE, TFIIH• TATA box, at -24 to -32 matches closely to “TATATAA”

– TFIID contains the TATA Binding Protein (TBP)

RNApII txn

BIND

• TFIID, via TBP, binds TATA box DNA sequence

• TFIIA & TFIIB add next, assemble with some DNA sequence selectivity

• A TFIIF-RNApII complex binds

• TFIIE & TFIIH bind to complete the “pre-initiation complex”

RNApII txn

UNWIND

• TFIIH contains a helicase subunit for unwinding the promoter region

INITIATE

• Synthesize 10-12nts

ELONGATE

• TFIIH contains two kinase subunits that phosphorylate the C-terminal Domain (CTD) of RNApII

CTD repeat: YSPTSPS

• Breaks contacts w/ promoter

RNApII transcript processing• mRNA structure

– 5’-end is “capped”

• Capping enzymes bind to phospho-CTD of RNApII

• Unusual 5’ -- 5’ linkage of 7-methylG-PPP

• Protects 5’-end from exonucleases

• Enhances nuclear export

• Enhances mRNA tln

RNApII transcript processing• mRNA structure

– 5’-untranslated region (UTR)• Regulation of translation (TLN) and stability

– Coding region• Sequence of nucleotides continuously encoding a protein• Also called an ‘open reading frame’ (ORF)

– 3’-UTR• Regulation of translation (TLN) and stability

• mRNA structure– 3’-end is polyadenylated

• Requires a large protein complex– (e.g. CPSF, CStF)

• Recognizes 5’-AAUAAA-3’ sequence in primary transcript

• Cleaves pre-RNA ~20nt downstream of AAUAAA

• PolyA polymerase adds 50-250 adenosines at new 3’-end

– Protects 3’-end from exonucleases

TERMINATE• Recognition of AAUAAA coupled

with RNApII destabilization• Cleavage effectively releases

pre-RNA from RNApII• RNApII with reduced processivity

falls off DNA template

RNApII transcript processing• Primary transcripts for protein coding genes (hnRNAs)

are much larger than their corresponding mRNAs

• Heteronuclear RNAs– Localized to the cell nucleus– Contain “exon” sequences– Contain “intron” sequences

• mRNAs– Localized to the cell cytoplasm– Contain only “exon” sequences

• RNA splicing– Removal of introns– Joining exons together

RNApII transcript processing: splicing• Exons can be either protein coding or 5’-/3’-UTR sequences

– Exons contribute to the final mRNA product– ~150nts each

• Intervening sequences between exons are introns– Introns must be removed to yield the final mRNA product– ~3500nts each

RNApII transcript processing: splicing• Specific RNA sequences demarcate the exon/intron borders

– Subunits of the “spliceosome” recognize these “exon junctions”

• The spliceosome catalyzes two reactions that eliminate the intron and join upstream and downstream exons together

• How does the cell machinery determine which exons to splice together?

– Which ones should be made?

Exon 1 Exon 2 Exon 3 Exon 4

Exon 1 Exon 2 Exon 3 Exon 4

Exon 1 Exon 3 Exon 4

Exon 1 Exon 2 Exon 4

??

?

?

• Spliceosomes are assembling on pre-RNA during Elongation– Provides mechanism to avoid confusing which exons go together– Sequential assembly of spliceosomes as pre-RNA is synthesized helps

assure no exon/intron junctions are accidentally missed

Alternative splicing• Not all exons have “ideal” exon/intron splicing sequences

– Not all are efficiently recognized by spliceosome

– Exonic Splicing Enhancer (ESE) sequences• Binding factors can promote use of an exon/intron junction

- ESE binding protein

+ ESE binding protein

Exon 1 ESE Exon 3 Exon 4

Exon 1 Exon 3 Exon 4

Exon 1 ESE Exon 3 Exon 4