Transcription of the Lysine-2,3-Aminomutase Gene in the kam Locusof Bacillus thuringiensis subsp. kurstaki HD73 Is Controlled by Both�54 and �K Factors

Zhe Zhang,a Min Yang,a Qi Peng,a Guannan Wang,b Qingyun Zheng,b Jie Zhang,a Fuping Songa

State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, Chinaa; College of LifeSciences, Northeast Agriculture University, Harbin, Chinab

Lysine 2,3-aminomutase (KAM; EC 5.4.3.2) catalyzes the interconversion of L-lysine and L-�-lysine. The transcription and regu-lation of the kam locus, including lysine-2,3-aminomutase-encoding genes, in Bacillus thuringiensis were analyzed in this study.Reverse transcription-PCR (RT-PCR) analysis revealed that this locus forms two operons: yodT (yodT-yodS-yodR-yodQ-yodP-kamR) and kamA (kamA-yokU-yozE). The transcriptional start sites (TSSs) of the kamA gene were determined using 5= rapidamplification of cDNA ends (RACE). A typical �12/�24 �54 binding site was identified in the promoter PkamA, which is locatedupstream of the kamA gene TSS. A �-galactosidase assay showed that PkamA, which directs the transcription of the kamA operon,is controlled by the �54 factor and is activated through the �54-dependent transcriptional regulator KamR. The kamA operon isalso controlled by �K and regulated by the GerE protein in the late stage of sporulation. kamR and kamA mutants were preparedby homologous recombination to examine the role of the kam locus. The results showed that the sporulation rate in B. thurin-giensis HD(�kamR) was slightly decreased compared to that in HD73, whereas that in HD(�kamA) was similar to that in HD73.This means that other genes regulated by KamR are important for sporulation.

Bacteria synthesize a number of different sigma factors thatallow the coordinated expression of groups of genes due to the

ability of sigma factors to confer promoter-specific transcriptionalinitiation of RNA polymerase (RNAP) (1). Most of these sigmafactors belong to a single family of proteins that appear to berelated structurally and functionally to the major Escherichia colisigma factor, �70. A second class of these factors is representedsolely by the alternative factor �54, which is widely present in pro-karyotes (2, 3). Studies of �54 have showed that this sigma factor isquite distinct both structurally and functionally from the �70 fam-ily: (i) unlike the �70 factor, which recognizes �10/�35 regions(4), �54 directs its RNAP to promoters characterized by conservedsequences located at �24 and �12 bp upstream from the tran-scriptional start site (TSS) (5), and (ii) the activator ATPase ap-proaches the leading edge of the closed RNAP-promoter complex,and a regulatory protein is required for �54 to stimulate theisomerization of the closed complexes to the corresponding opencomplexes (1, 3). �54 participates in the regulation of many met-abolic pathways in bacteria, such as the arginine degradation path-way, the isoleucine and valine degradation pathway, and the ace-toin catabolic pathway in Bacillus subtilis (6–8). We previouslyfound that the gab gene cluster involved in the GABA shunt for theutilization of GABA is controlled by �54 in Bacillus thuringiensis(9), a process that is not �54 dependent in B. subtilis (10). How-ever, other metabolic pathways controlled by the �54 factor in B.thuringiensis remain unknown.

L-Lysine is first converted to L-�-lysine by a lysine-2,3-amino-mutase (KAM; EC 5.4.3.2) in the lysine degradation pathway (11),and this intermediate is then acetylated to Nε-acetyl-�-lysine bythe action of an acetyltransferase (12). Genes potentially encodinglysine-2,3-aminomutase (ablA) and �-lysine acetyltransferase(ablB) have been identified on the chromosomes of methanogenicarchaea (13). The Gram-positive soil bacterium B. subtilis strain168 and strain JH642 (both members of the 168 group) possess a

homolog of AblA, KamA, and a protein related to AblB, YodP, thestructural genes of which are located next to each other in thegenome (Fig. 1A). The yodT-yodS-yodR-yodQ-yodP-kamA genesapparently form a transcriptional unit, because the expression ofall of these genes is upregulated during sporulation (14, 15). Tran-scription of this entire gene cluster is under the genetic control of�E, a mother cell-specific alternative sigma factor (16).

In this study, the organization and regulation of the lysine-2,3-aminomutase gene and nearby genes (HD73_2534 to HD73_2542) inBacillus thuringiensis subsp. kurstaki strain HD73 were studied.HD73_2534 to HD73_2542 of the kam locus were separately des-ignated yodT, yodS, yodR, yodQ, yodP, kamR, kamA, yokU, andyozE according to their annotation. We detected that this locusformed two operons, yodT (yodT-yodS-yodR-yodQ-yodP-kamR)and kamA (kamA-yokU-yozE). PkamA was identified to be con-trolled by both �54 and sporulation sigma factor �K. The results ofthis study provide new insight into the metabolic pathways con-trolled by the �54 factor.

MATERIALS AND METHODSBacterial strains, plasmids, and media. The bacterial strains and plas-mids used in this study are listed in Table 1. Escherichia coli was incubatedat 37°C with vigorous shaking (220 rpm) in Luria-Bertani (LB) medium(1.0% tryptone, 0.5% yeast extract, and 1.0% NaCl [pH 7.2]). The B.

Received 19 March 2014 Accepted 2 June 2014

Published ahead of print 9 June 2014

Address correspondence to Fuping Song, fpsong@ippcaas.cn.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.01675-14.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.01675-14

2934 jb.asm.org Journal of Bacteriology p. 2934 –2943 August 2014 Volume 196 Number 16

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

thuringiensis strains were grown at 30°C with vigorous shaking (220 rpm)in Schaeffer’s sporulation medium (SSM) (17). The following antibioticconcentrations were used for bacterial selection: 100 �g/ml of ampicillinfor E. coli and 5 �g/ml of erythromycin and 100 �g/ml of kanamycin for B.thuringiensis.

DNA manipulation techniques. PCR was performed using Taq DNApolymerase (TaKaRa Biochemicals Corporation, Kyoto, Japan). The am-plified fragments were purified using purification kits (Axygen, UnionCity, CA). Restriction enzymes and T4 DNA ligase (TaKaRa) were usedaccording to the manufacturer’s instructions. The digested DNA frag-ments were separated on a 1% agarose gel and extracted using a gel ex-traction kit (Axygen). Plasmid DNA was extracted from E. coli using aplasmid extraction kit (Axygen). The isolation of genomic DNA andtransformation of plasmid DNA into B. thuringiensis cells were performedusing previously described procedures (18). The oligonucleotide primers(Table 2) used in this study were designed according to the availablegenome sequences of B. thuringiensis HD73 (GenBank accession numberCP004069) and synthesized at Sangon Biotech (Shanghai, China) (19). Allconstructs were confirmed by DNA sequencing (Beijing Genomics Insti-tute, Beijing, China).

Total RNA isolation and RT-PCR. Total RNA was extracted from B.thuringiensis HD73, and a reverse transcription-PCR (RT-PCR) analysiswas performed as previously described (20), unless otherwise indicated.The primers kamR-kamA for yozE-2543, as shown in Table 2, were usedto detect the expression of the kam locus. All RNA samples were routinelysubjected to 16S rRNA gene PCR using 16S rRNA gene 5/16S rRNA gene3 primers to confirm the absence of DNA contamination.

Determination of transcriptional start sites. To determine the tran-scriptional start sites, we employed the SMARTer RACE (switching mech-anism at the 5= end of the RNA transcript-rapid amplification of cDNAends) cDNA amplification kit (Clontech, Mountain View, CA) accordingto the manufacturer’s instructions. Gene-specific primers, GSP/NGSP,and universal primer mix (UPM) were used to amplify the 5= end of kamAmRNA. The extraction and purification of total RNA were performed aspreviously described.

Construction of a kamR mutant and a kamA mutant. The upstreamfragment (529 bp) of kamR and the upstream fragment (626 bp) of kamAwere PCR amplified using B. thuringiensis HD73 genomic DNA as thetemplate with the primers kamR-a/kamR-d and kamA-a/kamA-d, respec-tively. The primers kamR-c/kamR-b and kamA-c/kamA-b were used toamplify the downstream fragments of kamR (320 bp) and yozE (620 bp).The kamR-e/kamR-f and kamA-e/kamA-f primers were used to amplifythe kanamycin resistance gene (1,473 bp) from pDG780 (21). The dele-tion-insertion mutant cassette was amplified using overlapping PCR. Theupstream and downstream fragments and Kan resistance genes were usedas templates with the primers kamR-a/kamR-b and kamA-a/kamA-b, re-spectively. The kamR and kamA deletion-insertion mutant cassettes wereinserted into the BamHI and SalI restriction sites of the pMAD plasmid togenerate the recombinant plasmid pMAD-�kamR/�kamA. The recombi-nant plasmids were then electroporated into B. thuringiensis HD73 cells.Transformants resistant to erythromycin and kanamycin were grown at30°C and transferred to LB liquid medium with kanamycin at nonpermis-sive temperature (38°C) for about 10 generations. The bacterial cells werethen plated onto LB agar plates. The transformants with kanamycin resis-

FIG 1 Gene organization of the kam locus in B. subtilis 168 and B. thuringiensis HD73. (A) Gene organization of the kam locus in B. subtilis 168. The tentativeassigned functions are as follows: yodT, Nε-acetyl-�-lysine transaminase; yodS and yodR, 3-keto-6-acetamidohexanoate cleavage enzyme; yodQ, 4-acetamidobutyryl-CoA deacetylase; yodP, �-lysine acetyltransferase; and kamA, lysine 2,3-aminomutase. (B) The kam locus in B. thuringiensis strain HD73. The white arrows representopen reading frames (ORFs). The small arrows denote the lengths of the promoters present upstream of the yodT and kamA genes. The dashed lines with smallblack arrows that are annotated with numbers correspond to the RT-PCR amplicons (see lanes in panel C). The full lines below the ORFs indicate operons. (C)RT-PCR analysis of the kam locus in B. thuringiensis strain HD73. The RNA samples were prepared at T7 of bacterial growth in SSM. The RT-PCRs labeled with“c” were performed with 500 ng of RNA. The positive controls are labeled “�” (PCR with 100 ng of genomic DNA). The negative controls are labeled “�”(RT-PCR with 500 ng of RNA with heat-inactivated reverse transcriptase). The numbers represent different RT-PCR amplicons: numbers 1 to 9 represent yodT,yodS, yodR, yodQ, yodP, kamR, kamA, yokU, and yozE, respectively; numbers 10 to 18 represent kamR-kamA, yodP-kamR, yodQ-yodP, yodR-yodQ, yodS-yodR,yodT-yodS, kamA-yokU, yokU-yozE, and yozE-HD_2543, respectively.

Transcription of Lysine-2,3-Aminomutase Gene in B. thuringiensis

August 2014 Volume 196 Number 16 jb.asm.org 2935

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

tance but without erythromycin resistance were screened and identifiedby PCR (800 transformants for the kamR mutant and 1,200 for the kamAmutant).

Construction of yodT and kamA promoter fusions with lacZ. Toanalyze the transcriptional activity of PyodT and PkamA, the promoter frag-ment of the yodT gene (331 bp upstream and 101 bp downstream of thetranscriptional start codons of yodT) and the promoter fragment of thekamA gene (506 bp upstream of the transcriptional start codons of kamA)from B. thuringiensis HD73 were PCR amplified using the specific primersPyodT-F/PyodT-R and PkamA-F/PkamA-R (Table 2), respectively. TheBamHI/PstI fragments of PyodT and PkamA were separately integrated intothe B. thuringiensis-E. coli shuttle vector pHT304-18Z, which harbors apromoterless lacZ gene (22), to produce the plasmids pHT304PyodT andpHT304PkamA, respectively. The recombinant plasmid pHT304PyodT wasintroduced into B. thuringiensis strain HD73 and the HD(�sigL),HD(�sigK), and HD(�sigE) mutants, whereas the recombinant plasmidpHT304PkamA was introduced into B. thuringiensis strain HD73 and theHD(�sigL), HD(�sigK), HD(�kamR), and HD(�gerE) mutants. The cor-responding strains HDPyodT, sigLPyodT, sigKPyodT, sigEPyodT, HDPkamA,sigLPkamA, sigKPkamA, kamRPkamA, and gerEPkamA were selected usingerythromycin resistance and verified by PCR.

�-Galactosidase activity assays. B. thuringiensis strains carrying thelacZ transcriptional fusions were cultured in SSM at 30°C and 220 rpm.

After culturing, 2-ml samples were collected at 1-h intervals (T0 is the endof the exponential phase, and Tn is n hours after the end of the exponentialphase). The cells were harvested by centrifugation in 2-ml tubes (for fastprep) for 1 min at 12,000 rpm, and the supernatant was discarded. Thecells were resuspended in 0.5 ml of Z buffer (60 mM Na2HPO4, 40 mMNaH2PO4, 10 mM KCl, 1 mM MgSO4, and 50 mM �-mercaptoethanol[pH 7.0]) at 4°C. The cells were subsequently processed with a Mini-Beadbeater cell disrupter (BioSpec, VA) and centrifuged at 4°C and 12,000rpm for 7 min. The �-galactosidase activity was determined as previouslydescribed (23). The reported values represent the averages from at leastthree independent assays.

Expression and purification of SigK. SigK protein with a His tag waspurified from E. coli. The expression plasmid pETsigK was constructed byPCR amplification of the sigK sequence from the B. thuringiensis HD73genome (19) using the primer pair EMSA-F (with a BamHI restrictionsite) and EMSA-R (with a SalI restriction site) (Table 2). The DNA frag-ment was digested with BamHI and SalI, cloned into pET-21b (Novagen,Bloemfontein, South Africa) digested with the same restriction enzymes,and transferred into E. coli BL21(DE3) (24).

The E. coli BL21 strain harboring pETsigK was grown to log phase inLB medium with ampicillin at 37°C. When the optical density at 600 nm(OD600) reached 0.6, isopropyl-�-D-thiogalactopyranoside (IPTG) wasadded to a final concentration of 0.5 mM. After 12 h of induction at 18°C,

TABLE 1 Strains and plasmids used in this study

Strain or plasmid Characterization Source or reference

E. coli strainsJM110 rpsL (Strr) thr leu thi-1 lacY galK galT ara tonA tsx dam dcm supE44 �(lac-proAB)

[F= traD36 proAB laclqZ �M15]Laboratory collection

ET 12567 F� dam-13::Tn9 dcm-6 hsdM hsdR recF143 zjj-202::Tn10 galK2 galT22 ara14pacY1 xyl-5 leuB6 thi-1, for the generation of unmethylated DNA

Laboratory collection

BL21(DE3) F� dcm ompT hsds(rB� mB

�) gal� (DE3) 24BL21(pETsigK) BL21(DE3) with pETsigK plasmid This studyBL21(pGEXgerE) BL21(DE3) with pGEXgerE plasmid 25

B. thuringiensisstrainsHD73 B. thuringiensis subsp. kurstaki strain carrying the cry1Ac gene Laboratory collectionHD(�sigL) HD73 mutant type, �sigL 9HD(�sigK) HD73 mutant type, �sigK 48HD(�gerE) HD73 mutant type, �gerE 25HD(�sigE) HD73 mutant type, �sigE 20HD(�kamR) HD73 mutant type, �kamR This studyHDPyodT HD73 containing pHT304PyodT This studysigLPyodT HD�sigL containing pHT304PyodT This studysigKPyodT HD�sigK containing pHT304PyodT This studysigEPyodT HD�sigE containing pHT304PyodT This studyHDPkamA HD73 containing pHT304PkamA This studysigLPkamA HD�sigL containing pHT304PkamA This studykamRPkamA HD�kamR containing pHT304PkamA This studysigKPkamA HD�sigK containing pHT304PkamA This studygerEPkamA HD�gerE containing pHT304PkamA This studyHD(�kamA) HD73 mutant type, �kamA This study

PlasmidspMAD Ampr, Ermr, temperature-sensitive B. thuringiensis-E. coli shuttle vector 21pMAD-�kamR pMAD with kamR deletion fragment This studypMAD-�kamA pMAD with kamA deletion fragment This studypHT304-18Z Promoterless lacZ vector; Ermr Ampr 22pHT304PyodT Ampr Ermr; pHT304–18Z carrying PyodT This studypHT304PkamA Ampr Ermr; pHT304–18Z carrying PkamA This studypET-21b Expression vector; Ampr; 5.4 kb Laboratory collectionpETsigK pET-21b containing sigK gene; Ampr This study

Zhang et al.

2936 jb.asm.org Journal of Bacteriology

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

TABLE 2 Sequences of oligonucleotide primers used in this study

Primer name Sequence (5=¡3=) (restriction enzyme)a

kamR-kamA-F GAAGCACTTCATCAAACAGAAAAkamR-kamA-R TGCTCTTCAGTAACATCTTTCCAyodP-kamR-F GAAAGCAGTAAAACTTCCGTCTCyodP-kamR-R TACAGCGTGTATAGCCTCATCAAkamRIn-F ATTGCAAAGGATTACTCTACAATkamRIn-R AATGACTCCATCTTCTAACACTCyodPIn-F AACGTATCCGGGTAGATCACTATyodPIn-R TGTATAGGAGCAGAAAATAGATCyodQ-yodP-F CCAATTATTGAAGCATCTCCGTGyodQ-yodP-R ATAATCTAAAACGCCTTCTACTGyodQIn-F TCAGATAGCCCAAATATTGTAGCyodQIn-R CGTAATATAGTTGCTAATGTCCCyodR-yodQ-F CCGAGTGGACTTATATTACAAGAyodR-yodQ-R GCTACAATATTTGGGCTATCTGAyodRIn-F AATGTTATGTTTCATGCGGAAAATGyodRIn-R ATGATTCATCACAACAACGACCCyodS-yodR-F GGCAGATCCGTTTGGTAACCTTGTAyodS-yodR-R TCCCATGCCCACGATTCCATTTTyodSIn-F AATGACACTGGATTTCCTGATGTyodSIn-R TCGTATCAACACCAACATCAACTyodT-yodS-F AAGCGTCAGAGCTTATTTCAGTTyodT-yodS-R ACATCAGGAAATCCAGTGTCATTKamAIn-F GGACCGTGTACTATTCTTAGTAACAKamAIn-R TAGTATGGACGTACACGGATTTTkamA-yokU-f TATTACGACGTATCCAGAGCCAGAGkamA-yokU-r TCTTGGATTTCAATGGCTTTCGTyokUIn-f GCGAAAGAAAGCTTGAATACTGTyokUIn-r CGGTCTTCCCATTAATTCTTCATyoku-yoze-F ATGAAGAATTAATGGGAAGACCGyoku-yoze-R CTGCACGATGCTTCATCATATAAyozEIn-F TTATATGATGAAGCATCGTGCAGyozEIn-R TAGACATACTTTCTAGCATTCCGyozE-2543-F CGGAATGCTAGAAAGTATGTCTAyozE-2543-R CCCTACGTTGTATTTAGGTTGTTPyodT-F AACTGCAGTAAAGTAGGATAATAGGAAGGAG (PstI)PyodT-R CGCGGATCCAAATATTTATTGCCATTTTGATC (BamHI)PkamA-F AACTGCAGCATTTTCGATAAGTTGGA (PstI)PkamA-R CGCGGATCCTATAAAATATTGTAATTCCATTTTC (BamHI)kamR-a CGGGATCCCATAAAGGAAGGAAATGCAGAAT (BamHI)kamR-e ATTGCTAGCAGTTTCGACAGCGAACCATTTGAkamR-d TCAAATGGTTCGCTGTCGAAACTGCTAGCAATkamR-c GCCTACGAGGAATTTATAAACTGAGCAAGTACkamR-f GTACTTGCTCAGTTTATAAATTCCTCGTAGGCkamR-b ACGCGTCGACATCTTTCCATAATTCGATAT (SalI)kamRJD-F GATGCAGAAGAATTAGCAACTGTkamRJD-r CAAGCATAGTACGGTGTAATGTTkamA-a CGGGATCCAGGATGTACTATTATTAGCATC (BamHI)kamA-d TCAAATGGTTCGCTGTGCTATTCCCCCTTTTTkamA-e AAAAAGGGGGAATAGCACAGCGAACCATTTGAkamA-f GTTTTCAAATAGTTTAAATTCCTCGTAGGCGCkamA-c GCGCCTACGAGGAATTTAAACTATTTGAAAACkamA-b ACGCGTCGACGTAATCCGTGACAATTCATAAA (SalI)kamAJD-F TGGAGTCATTAGAAGAATTGGTGkamAJD-r TGACGATTCGTCTTAACACTCACTEMSA-F CGGATCCGTTGAGTCTATTCGCCGCAATTGG (BamHI)EMSA-R GTCGACCTCTTTCGCTTTTTTCTCTTTCTC (SalI)GSP TGCTATTCCCCCTTTTTATACGCTCATCCNGSP TGCATCCGAATCGGACAGCGTGGpMAD cx1 AGGCAGACAAGGTATAGGpMAD cx2 ATTTCCTCTGGCCATTGCa Restriction sites are underlined and in bold font.

Transcription of Lysine-2,3-Aminomutase Gene in B. thuringiensis

August 2014 Volume 196 Number 16 jb.asm.org 2937

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

the bacterial cells were harvested by centrifugation at 13,500 rpm for 10min in 50-ml tubes and resuspended in 10 mM imidazole NPB buffer (10mM imidazole, 1 M NaCl, and 20 mM sodium phosphate [pH 7.4]). Thebacteria were lysed on ice by sonication using an ultrasonic cell disruptionsystem. The bacterial lysate was centrifuged at 13,500 rpm for 10 min at4°C, and the resulting supernatant contained the solubilized SigK-Hisprotein. The supernatant was filtered through a 0.45-mm pore-size mem-brane filter and loaded onto a HiTrap chelating column (1 ml; Pharma-cia). After binding of the protein, the column was washed with 10 mMimidazole NPB solution, and the target SigK-His protein was eluted withNPB solution containing a stepwise gradient of imidazole from 100 to 500mM. The purified His-SigK protein was analyzed by SDS-PAGE on a 12%polyacrylamide gel with a protein molecular standard.

Expression and purification of GerE. GerE protein with a glutathioneS-transferase (GST) tag was purified from E. coli. The expression plasmidpGEXgerE was constructed by PCR amplification of the gerE sequencefrom the B. thuringiensis HD73 genome and transferred into E. coliBL21(DE3) (25).

When the optical density at 600 nm (OD600) reached 0.6, IPTG wasadded to a final concentration of 1 mM. After 4 h of induction at 37°C, thebacterial cells were harvested by centrifuging the culture at 13,500 rpm for10 min. The pellet was resuspended in phosphate-buffered saline (PBS)buffer and sonicated on ice. All subsequent procedures were carried out at4°C. The supernatant was collected by centrifuging the lysate at 13,500rpm for 20 min and loading it onto a glutathione-Sepharose 4B columnpreviously equilibrated with PBS buffer. The column was washed with 50mM Tris-HCl (containing 10 mM reduced glutathione [pH 8.0]). Thefractions were analyzed by SDS-PAGE. Fractions with the target proteinwere pooled and dialyzed against PBS buffer. The purified GST-GerEprotein was analyzed by SDS-PAGE on a 12% polyacrylamide gel with aprotein molecular standard. All the steps described above were performedaccording to the manufacturer’s instructions (Amersham Pharmacia Bio-tech).

Gel mobility shift assays. His-tagged SigK protein and GST-taggedGerE protein were purified from E. coli BL21(DE3) as described above.The binding experiments were performed using a modified gel mobilityshift assay described previously (26). The DNA probe (1 mg) was incu-bated with various concentrations of purified protein at 25°C for 20 minin a buffer containing 0.5 mM EDTA, 0.5 mM dithiothreitol (DTT), 50mM NaCl, and 4% (vol/vol) glycerol in a total volume of 100 ml. Afterincubation, nondenaturing 5% (wt/vol) polyacrylamide gels were stainedwith SYBR gold nucleic acid gel stain (Invitrogen) for 40 min in TBE (89mM Tris base, 89 mM boric acid, and 1 mM EDTA [pH 8.0]) buffer andphotographed under UV transillumination using a Fuji X-5000.

Determination of sporulation efficiency. Sporulation efficiency wasmeasured in SSM. The total number of cells at T1 was determined. Thespores released were collected at T24; the cell suspension was heated to65°C for 20 min to inactivate the vegetative cells and then plated onto LB

agar medium. The sporulation frequency was defined as the ratio of thenumber of colonies after heat treatment to the number of colonies at T1.

RESULTSSequence analysis of the kam locus. In contrast to the kam locusof B. subtilis 168 (Fig. 1A), nine open reading frames (ORFs) arelocated at the kam locus (8,571 bp) of B. thuringiensis HD73 andare annotated as follows: Nε-acetyl-�-lysine transaminase (yodT,HD73_2534), 3-keto-6-acetamidohexanoate cleavage enzyme(yodS-yodR, HD73_2535-HD73_2536), 4-acetamidobutyryl co-enzyme (CoA) deacetylase (yodQ, HD73_2537), �-lysine acetyl-transferase (yodP, HD73_2538), L-lysine aminomutase regula-tor (kamR, HD73_2539), lysine 2,3-aminomutase (kamA,HD73_2540), and hypothetical protein (yokU-yozE, HD73_2541-HD73_2542) (Fig. 1B). Orthologs of the kam locus have beenfound in many B. cereus group strains. The gene cluster from B.thuringiensis HD73 is conserved in the genome sequences of B.cereus group strains, and their kam locus sequence similarities areabove 90% (see Fig. S1 in the supplemental material).

A conserved domain analysis showed that the KamR proteinconsists of three typical domains: a central AAA� (for ATPaseassociated with various cellular activities) domain that interactswith �54 and couples ATP hydrolysis to promoter DNA melting byRNA polymerase, a helix-turn-helix DNA-binding domain (27),and a PAS-sensing domain. It has been suggested that the KamRprotein is a �54-dependent transcriptional activator, also called anenhancer-binding protein (EBP), which is essential for the tran-scriptional activation of �54 promoters and the integration of pro-moter activation with host signal responses to environmental cuesand physiological status (28, 29). The sequence of TTGGCATAACTATTGC as the �12/�24 consensus sequence (BYGGCMYRNNNYYGCW), �54 binding site (30), was identified upstream of thestart codons in the kamA gene. In addition, a putative �K-depen-dent sequence of CACC. . . . . .CATATATAA (HDCA and CATANNNDD) (31) and a GerE-dependent sequence of TAATAGGGTTCT (RWWTRGGY–YY) (32) were found upstream of thekamA gene. All the above analysis suggested that the promoter ofkamA might be controlled by both �54 and �K factors and regu-lated by GerE protein.

Transcriptional units of the kam locus. To determine thetranscriptional units of the kam locus, pairs of primers were de-signed according to the kam locus gene sequences in B. thuringien-sis HD73. RT-PCR was carried out with total RNA extracted at T7

from B. thuringiensis HD73 cultures grown in SSM. The RT-PCR

FIG 2 The transcriptional start sites (TSSs) of the kamA gene. The �12/�24 consensus sequences, the GG-N10-GC �54 factor binding sites, and �K factor-dependent �10/�35 sequences are in bold font; the TSSs are indicated numerically (�1) and marked in bold font. The codon underlined is the transcription startsite of kamA.

Zhang et al.

2938 jb.asm.org Journal of Bacteriology

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

results showed mRNA overlapping the yodT and kamR genes andthe kamA and yozE genes (Fig. 1C). However, no mRNA overlap-ping kamR and kamA, as well as no mRNA overlapping yozE andHD_2543 (encoding a hypothetical protein), was transcribed.These results indicated that kamR and 5 upstream genes (yodT-yodS-yodR-yodQ-yodP) formed a transcriptional unit, whereaskamA, yokU, and yozE formed a transcriptional unit.

To define the transcriptional start sites (TSSs) of kamA, theprimers GSP/NGSP were designed according to the kam locussequence in B. thuringiensis HD73. 5= RACE analysis in both sigKmutant HD(�sigK) and sigL mutant HD(�sigL) was performed.The transcriptional start site was confirmed to be a single 5=-endnucleotide residue A located 27 nucleotides (bp) upstream fromthe kamA translational start codon according to the sequences of11 random clones obtained by 5= RACE-PCR in the HD(�sigK)mutant and to be a single 5=-end nucleotide residue G located 143nucleotides (bp) upstream from the kamA translational start

codon according to the sequences of 12 random clones obtainedby 5= RACE-PCR in the HD(�sigL) mutant (Fig. 2). These datawere consistent with the �54 and �K putative binding sites (Fig. 2).

The PkamA promoter is controlled by both �54 and �K factors.To clarify the transcriptional mechanism of the kam locus, thekamR gene, which encodes a �54-dependent transcriptional acti-vator, was deleted via homologous recombination to generate thekamR mutant HD(�kamR). To study the transcription and regu-lation of the promoter PkamA, a PkamA-lacZ fusion was constructedand transformed into B. thuringiensis HD73, HD(�sigL),HD(�sigK), HD(�kamR), and HD(�gerE). A �-galactosidase as-say indicated that the transcriptional activity of PkamA was abol-ished from T0 to T6 in HD(�kamR) [T0 to T4 in HD(�sigL)] andincreased sharply thereafter (Fig. 3A), which suggested that it wascontrolled by some other factors in the late stage of sporulation.�K is a sigma factor that plays a role in the late stage of sporulation,and it has been reported that some �K-dependent genes are neg-

FIG 3 Analysis of the transcription of PkamA. (A) Analysis of the activity of PkamA (T0 to T10). The promoter-directed �-galactosidase synthesis of these strainswas determined at the indicated times after culturing the cells in SSM at 30°C. Tn is n hours after the end of the exponential phase. Each value represents the meanof results of at least three independent replicates. Error bars show standard deviations. (B) Analysis of the activity of PkamA in HD(�sigK). The promoter-directed�-galactosidase synthesis of these strains was determined at the indicated times after culturing the cells in SSM at 30°C. Tn is n hours after the end of theexponential phase. Each value represents the mean of results of at least three independent replicates. Error bars show standard deviations. (C) Analysis of theactivity of PkamA in HD(�gerE). The promoter-directed �-galactosidase synthesis of these strains was determined at the indicated times after culturing the cellsin SSM at 30°C. Tn is n hours after the end of the exponential phase. Each value represents the mean of results of at least three independent replicates. Error barsshow standard deviations. (D) Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions, using labeled PkamA and increasingconcentrations of recombinant SigK-His. Lanes 1 to lane 8 contained 0, 15, 30, 45, 60, 75, 90, and 105 ng/�l of SigK-His, respectively. F, free DNA; B, bound DNA.(E) EMSA for detecting protein-nucleic acid interactions, using labeled PkamA and increasing concentrations of recombinant GerE-GST. Lanes 1 to lane 7contained 0, 10.5, 21, 42, 63, 84, and 126 ng/�l of GerE-GST, respectively.

Transcription of Lysine-2,3-Aminomutase Gene in B. thuringiensis

August 2014 Volume 196 Number 16 jb.asm.org 2939

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

atively or positively regulated by the GerE regulator in the latestage of sporulation (32). So the �-galactosidase activity assay wasalso tested in both sigK and gerE mutant strains containing thePkamA-lacZ fusion, respectively. The PkamA promoter activity in thesigK mutant strain was significantly decreased compared with thatin the wild type after T8, which suggested that it was controlled by�K in the late stage of sporulation (Fig. 3B). At the same time, a�-galactosidase activity assay was tested in gerE mutant strainHD(�gerE), and the results showed that the �-galactosidase activ-ity in the HD(�gerE) strain increased significantly from T11 com-pared to that in HD73 (Fig. 3C). The results of our electrophoreticmobility shift assay showed that SigK and GerE could bind to thekamA promoter (Fig. 3D and E). All these results revealed that thepromoter PkamA is controlled by �L and regulated by the KamRprotein yet is directly controlled by �K and regulated by the GerEprotein in the late stage of sporulation.

The PyodT promoter is neither �54 dependent nor �E depen-dent. The promoter of the yodT operon in B. subtilis is reported tobe controlled by the �E factor (16). To test whether the PyodT

promoter in B. thuringiensis is controlled by �L and sporulation-specific sigma factors, a PyodT-lacZ fusion was constructed andtransformed into B. thuringiensis HD73, HD(�sigL), HD(�sigE),and HD(�sigK). A �-galactosidase assay indicated that the tran-scriptional activities of PyodT in HD(�sigL) and HD(�sigK) weresimilar to that in HD73 (Fig. 4); thus, the transcriptional unit yodT(yodT-yodS-yodR-yodQ-yodP-kamA) is not under the control of�54 or �K. The �-galactosidase activity of PyodT was also deter-mined in HD(�sigE), and the result showed that the yodT genewas not �E dependent (Fig. 4).

Sporulation rates of HD(�kamR) and HD(�kamA). Becausethe kamA operon is controlled by a late sporulation sigma factor,the triple mutant HD(�kamA-yokU-yozE) [named HD(�kamA)]was constructed to test its effect on the sporulation rate. Thegrowth rates of HD(�kamA) and HD(�kamR) were similar tothat of HD73, and the sporulation rate of HD(�kamA) was similarto that of HD73 (Fig. 5), suggesting that the lysine-2,3-aminomu-tase gene mutation had no effect on the formation of spores. How-

ever, it was surprising that the sporulation rate of HD(�kamR)was slightly decreased compared to that of HD73, indicating thatKamR may control some genes controlled by �54 to affect sporeformation.

DISCUSSION

We found that the kam locus of B. thuringiensis formed two tran-scriptional units (yodT and kamA operons) while sharing genessimilar to that of B. subtilis, in which the kam locus forms a tran-scriptional unit, yodT-yodS-yodR-yodQ-yodP-kamA (Fig. 1A).The transcription of this entire gene cluster is under the geneticcontrol of �E (16), and a �E-dependent promoter was detectedupstream of yodT in B. subtilis (14). However, we found that theyodT operon of the kam locus in B. thuringiensis is not controlledby a sporulation-dependent sigma factor and that the kamAoperon is controlled by two sigma factors, �K and �54. The regu-lation of the kam locus in B. subtilis is quite different from that inB. thuringiensis. This is the first report that a lysine-2,3-aminomu-tase gene is controlled by �54 and that a �54-dependent promoteris also controlled by a sporulation sigma factor.

We found that kam loci were highly conserved in the B. cereusgroups, including B. cereus ATCC 14579, Bacillus thuringiensisBMB 171, Bacillus thuringiensis 407, B. thuringiensis H-789, Bacil-lus anthracis Ames, Bacillus mycoides DSM 2048, Bacillus pseudo-mycoides DSM 12442, and Bacillus weihenstephanensis KBAB4(33–39) (see Fig. S1 in the supplemental material). The organiza-tions of the kam locus are very different among the B. cereus groupstrains. However, kamR, a �54-dependent transcriptional activa-tor gene, and kamA, an L-lysine 2,3-aminomutase gene, werefound to be organized together in some other strains, such as B.azotoformans LMG 9581, which is able to denitrify nitrate, nitrite,and nitrous oxide to produce nitrogen (40, 41); the Gram-vari-able, rod-shaped, motile, and endospore-forming bacterial strainPaenibacillus taiwanensis DSM 18679 (42); and Caloramator sp.strain ALD01 (see Fig. S1). The promoter region of the kamA genein the above-mentioned strains except Caloramator sp. strainALD01 was found to contain a conservative recognition sequencefor �54 (see Fig. S2 in the supplemental material), suggesting thatthe kamA gene in these strains might be controlled by �54. The �K

FIG 4 Analysis of the activity of PyodT. The promoter-directed �-galactosidasesynthesis of these strains was determined at the indicated times after culturingthe cells in SSM at 30°C. Tn is n hours after the end of the exponential phase.Each value represents the mean of results of at least three independent repli-cates. Error bars show standard deviations.

FIG 5 Comparisons of sporulation frequency between the HD(�kamR) mu-tant, HD(�kamA) mutant, and wild-type strain, HD73. The graph depictssporulation frequency. Error bars show standard deviations.

Zhang et al.

2940 jb.asm.org Journal of Bacteriology

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

recognition sequences in the kamA promoter were also predictedin most B. cereus group strains (see Fig. S2). All these data suggestthat the regulation mechanisms of the kamA genes are similarthroughout the B. cereus group.

The L-lysine 2,3-aminomutase encoded by the kamA gene in B.thuringiensis HD73 showed 68% sequence similarity with that inB. subtilis, an enzyme that is involved in the formation of L-�-lysine from L-lysine. L-�-Lysine is then acetylated by reaction withacetyl-CoA to form Nε-acetyl-L-�-lysine by a �-lysine acetyltrans-ferase (43), and the �-lysine acetyltransferase-encoding gene,yodP, in B. thuringiensis HD73 showed 44% sequence similaritywith that in B. subtilis. An L-�-lysine degradation pathway wasreported for Pseudomonas strain B4. Nε-Acetyl-L-�-lysine isdeaminated to 3-keto-6-acetamidohexanoate by an Nε-acetyl-�-lysine transaminase in the presence of 2-ketoglutarate (44). A3-keto-6-acetamidohexanoate cleavage enzyme then catalyzes areaction between 3-keto-6-acetamidohexanoate and acetyl-CoAto form 4-acetamidobutyryl-CoA and acetoacetate (45). Then,4-acetamidobutyryl-CoA deacetylase converts 4-acetamidobu-tyryl CoA to 4-aminobutyrate (45); 4-aminobutyrate is readilyconverted via succinic semialdehyde to succinate (44), which iscalled the GABA shunt in B. thuringiensis. The succinate productwill enter the tricarboxylic acid (TCA) cycle (46). In the kam locusof B. thuringiensis HD73, yodT, yodS, and yodR-yodQ were anno-tated as Nε-acetyl-�-lysine transaminase, 3-keto-6-acetamido-

hexanoate cleavage enzyme, and 4-acetamidobutyryl-CoA deacety-lase, respectively. According to the analysis of IMG PathwayDetails at the IMG (Integrated Microbial Genomes) website (47),these three enzymes in B. thuringiensis HD73 were supposed to beinvolved in the same reaction as in Pseudomonas. Thus, we deducethe connection between the L-lysine degradation pathway andGABA shunt from L-lysine to succinic acid in B. thuringiensis (Fig.6). Three enzyme-encoding genes, kamA in the kam locus in thisstudy and gabT and gabD in the gab gene cluster, were proven to becontrolled by �54 (9).

ACKNOWLEDGMENT

This work was supported by grants from the National Natural ScienceFoundation (no. 31270111).

REFERENCES1. Merrick M. 1993. In a class of its own—the RNA polymerase sigma factor

�54 (�N). Mol. Microbiol. 10:903–909. http://dx.doi.org/10.1111/j.1365-2958.1993.tb00961.x.

2. Wigneshweraraj S, Burrows P, Bordes P, Schumacher J, Rappas M,Finn R, Cannon W, Zhang X, Buck M. 2005. The second paradigm foractivation of transcription. Prog. Nucleic Acids Res. Mol. Biol. 79:339 –369. http://dx.doi.org/10.1016/S0079-6603(04)79007-8.

3. Buck M, Gallegos M-T, Studholme DJ, Guo Y, Gralla JD. 2000. Thebacterial enhancer-dependent �54 (�N) transcription factor. J. Bacteriol.182:4129 – 4136. http://dx.doi.org/10.1128/JB.182.15.4129-4136.2000.

FIG 6 The L-lysine degradation pathway in HD73. L-Lysine is converted to �-lysine by a lysine-2,3-aminomutase (KamA) that is subsequently acetylated to Nε-acetyl-�-lysine by the action of an acetyltransferase (YodP); Nε-acetyl-L-�-lysine is deaminated to 3-keto-6-acetamidohexanoate by an Nε-acetyl-�-lysine transaminase (YodT)in the presence of 2-ketoglutarate. The conversion of 3-keto-6-acetamidohexanoate and acetyl-CoA to 4-acetamidobutyryl-CoA and acetoacetate is catalyzed by a3-keto-6-acetamidohexanoate cleavage enzyme (YodS and YodR); 4-acetamidobutyryl-CoA deacetylase (YodQ) converts 4-acetamidobutyryl-CoA to 4-aminobu-tyrate. 4-Aminobutyrate is readily converted via succinic semialdehyde to succinate, which is called GABA shunt. The succinate product will enter the tricarboxylic acid(TCA) cycle. The encoding genes are annotated in parentheses, and the dashed arrows marked the genes controlled by �54.

Transcription of Lysine-2,3-Aminomutase Gene in B. thuringiensis

August 2014 Volume 196 Number 16 jb.asm.org 2941

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

4. Lonetto M, Gribskov M, Gross C. 1992. The sigma 70 family: sequenceconservation and evolutionary relationships. J. Bacteriol. 174:3843–3849.

5. Wigneshweraraj S, Bose D, Burrows PC, Joly N, Schumacher J, RappasM, Pape T, Zhang X, Stockley P, Severinov K. 2008. Modus operandi ofthe bacterial RNA polymerase containing the �54 promoter-specificityfactor. Mol. Microbiol. 68:538 –546. http://dx.doi.org/10.1111/j.1365-2958.2008.06181.x.

6. Ali NO, Jeusset J, Larquet E, Le Cam E, Belitsky B, Sonenshein AL,Msadek T, Débarbouillé M. 2003. Specificity of the interaction of RocRwith the rocG-rocA intergenic region in Bacillus subtilis. Microbiology 149:739 –750. http://dx.doi.org/10.1099/mic.0.26013-0.

7. Debarbouille M, Gardan R, Arnaud M, Rapoport G. 1999. Role of BkdR,a transcriptional activator of the SigL-dependent isoleucine and valinedegradation pathway in Bacillus subtilis. J. Bacteriol. 181:2059 –2066.

8. Ali NO, Bignon J, Rapoport G, Debarbouille M. 2001. Regulation of theacetoin catabolic pathway is controlled by sigma L in Bacillus subtilis. J.Bacteriol. 183:2497–2504. http://dx.doi.org/10.1128/JB.183.8.2497-2504.2001.

9. Zhu L, Peng Q, Song F, Jiang Y, Sun C, Zhang J, Huang D. 2010.Structure and regulation of the gab gene cluster, involved in the -ami-nobutyric acid shunt, are controlled by a �54 factor in Bacillus thuringien-sis. J. Bacteriol. 192:346 –355. http://dx.doi.org/10.1128/JB.01038-09.

10. Belitsky BR, Sonenshein AL. 2002. GabR, a member of a novel proteinfamily, regulates the utilization of -aminobutyrate in Bacillus subtilis.Mol. Microbiol. 45:569 –583. http://dx.doi.org/10.1046/j.1365-2958.2002.03036.x.

11. Chirpich T, Zappia V, Costilow R, Barker H. 1970. Lysine 2,3-aminomutase purification and properties of a pyridoxal phosphate andS-adenosylmethionine-activated enzyme. J. Biol. Chem. 245:1778 –1789.

12. Roberts M, Lai M, Gunsalus R. 1992. Biosynthetic pathways of theosmolytes Nε-acetyl-�-lysine, beta-glutamine, and betaine in Methano-halophilus strain FDF1 suggested by nuclear magnetic resonance analyses.J. Bacteriol. 174:6688 – 6693.

13. Pflüger K, Baumann S, Gottschalk G, Lin W, Santos H, Müller V. 2003.Lysine-2,3-aminomutase and �-lysine acetyltransferase genes of metha-nogenic archaea are salt induced and are essential for the biosynthesis ofNε-acetyl-�-lysine and growth at high salinity. Appl. Environ. Microbiol.69:6047– 6055. http://dx.doi.org/10.1128/AEM.69.10.6047-6055.2003.

14. Steil L, Serrano M, Henriques AO, Völker U. 2005. Genome-wideanalysis of temporally regulated and compartment-specific gene expres-sion in sporulating cells of Bacillus subtilis. Microbiology 151:399 – 420.http://dx.doi.org/10.1099/mic.0.27493-0.

15. Fawcett P, Eichenberger P, Losick R, Youngman P. 2000. The transcrip-tional profile of early to middle sporulation in Bacillus subtilis. Proc. Natl.Acad. Sci. U. S. A. 97:8063– 8068. http://dx.doi.org/10.1073/pnas.140209597.

16. Errington J. 2003. Regulation of endospore formation in Bacillus subtilis.Nat. Rev. Microbiol. 1:117–126. http://dx.doi.org/10.1038/nrmicro750.

17. Schaeffer P, Millet J, Aubert J-P. 1965. Catabolic repression of bacterialsporulation. Proc. Natl. Acad. Sci. U. S. A. 54:704 –711. http://dx.doi.org/10.1073/pnas.54.3.704.

18. Schurter W, Geiser M, Mathé D. 1989. Efficient transformation of Ba-cillus thuringiensis and B. cereus via electroporation: transformation ofacrystalliferous strains with a cloned delta-endotoxin gene. Mol. Genet.Genomics 218:177–181. http://dx.doi.org/10.1007/BF00330581.

19. Liu G, Song L, Shu C, Wang P, Deng C, Peng Q, Lereclus D, Wang X,Huang D, Zhang J. 2013. Complete genome sequence of Bacillus thurin-giensis subsp. kurstaki strain HD73. Genome Announc. 1(2):e00080 –13.http://dx.doi.org/10.1128/genomeA.00080-13.

20. Du L, Qiu L, Peng Q, Lereclus D, Zhang J, Song F, Huang D. 2012.Identification of the promoter in the intergenic region between orf1 andcry8Ea1 controlled by sigmah factor. Appl. Environ. Microbiol. 78:4164 –4168. http://dx.doi.org/10.1128/AEM.00622-12.

21. Arnaud M, Chastanet A, Débarbouillé M. 2004. New vector for efficientallelic replacement in naturally nontransformable, low-GC-content,gram-positive bacteria. Appl. Environ. Microbiol. 70:6887– 6891. http://dx.doi.org/10.1128/AEM.70.11.6887-6891.2004.

22. Agaisse H, Lereclus D. 1994. Structural and functional analysis of thepromoter region involved in full expression of the cryIIIA toxin gene ofBacillus thuringiensis. Mol. Microbiol. 13:97–107. http://dx.doi.org/10.1111/j.1365-2958.1994.tb00405.x.

23. Bouillaut L, Perchat S, Arold S, Zorrilla S, Slamti L, Henry C, Gohar M,Declerck N, Lereclus D. 2008. Molecular basis for group-specific activa-

tion of the virulence regulator PlcR by PapR heptapeptides. Nucleic AcidsRes. 36:3791–3801. http://dx.doi.org/10.1093/nar/gkn149.

24. Munson R, Sasaki K. 1993. Protein D, a putative immunoglobulin D-binding protein produced by Haemophilus influenzae, is glycerophos-phodiester phosphodiesterase. J. Bacteriol. 175:4569 – 4571.

25. Yang J, Peng Q, Chen Z, Deng C, Shu C, Zhang J, Huang D, Song F.2013. Transcriptional regulation and characteristics of a novel N-acetylmuramoyl-L-alanine amidase gene involved in Bacillus thuringiensismother cell lysis. J. Bacteriol. 195:2887–2897. http://dx.doi.org/10.1128/JB.00112-13.

26. Li R, Liu G, Xie Z, He X, Chen W, Deng Z, Tan H. 2010. PolY, atranscriptional regulator with ATPase activity, directly activates transcrip-tion of polR in polyoxin biosynthesis in Streptomyces cacaoi. Mol. Micro-biol. 75:349 –364. http://dx.doi.org/10.1111/j.1365-2958.2009.06968.x.

27. Tucker NP, Ghosh T, Bush M, Zhang X, Dixon R. 2010. Essential rolesof three enhancer sites in �54-dependent transcription by the nitric oxidesensing regulatory protein NorR. Nucleic Acids Res. 38:1182–1194. http://dx.doi.org/10.1093/nar/gkp1065.

28. Shingler V. 2011. Signal sensory systems that impact �54-dependent tran-scription. FEMS Microbiol. Rev. 35:425– 440. http://dx.doi.org/10.1111/j.1574-6976.2010.00255.x.

29. Rappas M, Bose D, Zhang X. 2007. Bacterial enhancer-binding proteins:unlocking �54-dependent gene transcription. Curr. Opin. Struct. Biol. 17:110 –116. http://dx.doi.org/10.1016/j.sbi.2006.11.002.

30. Francke C, Kormelink TG, Hagemeijer Y, Overmars L, Sluijter V,Moezelaar R, Siezen R. 2011. Comparative analyses imply that the enig-matic sigma factor 54 is a central controller of the bacterial exterior. BMCGenomics 12:385. http://dx.doi.org/10.1186/1471-2164-12-385.

31. Eichenberger P, Fujita M, Jensen ST, Conlon EM, Rudner DZ, WangST, Ferguson C, Haga K, Sato T, Liu JS. 2004. The program of genetranscription for a single differentiating cell type during sporulation inBacillus subtilis. PLoS Biol. 2:e328. http://dx.doi.org/10.1371/journal.pbio.0020328.

32. Zheng L, Halberg R, Roels S, Ichikawa H, Kroos L, Losick R. 1992.Sporulation regulatory protein GerE from Bacillus subtilis binds to andcan activate or repress transcription from promoters for mother-cell-specific genes. J. Mol. Biol. 226:1037–1050. http://dx.doi.org/10.1016/0022-2836(92)91051-P.

33. Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, KapatralV, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A. 2003. Genomesequence of Bacillus cereus and comparative analysis with Bacillus anthra-cis. Nature 423:87–91. http://dx.doi.org/10.1038/nature01582.

34. He J, Shao X, Zheng H, Li M, Wang J, Zhang Q, Li L, Liu Z, Sun M,Wang S. 2010. Complete genome sequence of Bacillus thuringiensis mu-tant strain BMB171. J. Bacteriol. 192:4074 – 4075. http://dx.doi.org/10.1128/JB.00562-10.

35. Sheppard AE, Poehlein A, Rosenstiel P, Liesegang H, Schulenburg H.2013. Complete genome sequence of Bacillus thuringiensis strain 407Cry�. Genome Announc. 1(1):e00158–12. http://dx.doi.org/10.1128/genomeA.00158-12.

36. Doggett NA, Stubben CJ, Chertkov O, Bruce DC, Detter JC, JohnsonSL, Han CS. 2013. Complete genome sequence of Bacillus thuringiensisserovar israelensis strain HD-789. Genome Announc. 1(6):e01023–13.http://dx.doi.org/10.1128/genomeA.01023-13.

37. Read TD, Peterson SN, Tourasse N, Baillie LW, Paulsen IT, Nelson KE,Tettelin H, Fouts DE, Eisen JA, Gill SR. 2003. The genome sequence ofBacillus anthracis Ames and comparison to closely related bacteria. Nature423:81– 86. http://dx.doi.org/10.1038/nature01586.

38. Zwick ME, Joseph SJ, Didelot X, Chen PE, Bishop-Lilly KA, StewartAC, Willner K, Nolan N, Lentz S, Thomason MK. 2012. Genomiccharacterization of the Bacillus cereus sensu lato species: backdrop to theevolution of Bacillus anthracis. Genome Res. 22:1512–1524. http://dx.doi.org/10.1101/gr.134437.111.

39. Lapidus A, Goltsman E, Auger S, Galleron N, Ségurens B, Dossat C,Land ML, Broussolle V, Brillard J, Guinebretiere M-H. 2008. Extendingthe Bacillus cereus group genomics to putative food-borne pathogens ofdifferent toxicity. Chem. Biol. Interact. 171:236 –249. http://dx.doi.org/10.1016/j.cbi.2007.03.003.

40. Heylen K, Keltjens J. 2012. Redundancy and modularity in membrane-associated dissimilatory nitrate reduction in Bacillus. Front. Microbiol.3:371. http://dx.doi.org/10.3389/fmicb.2012.00371.

41. Pichinoty F, De Barjac H, Mandel M, Asselineau J. 1983. Description of

Zhang et al.

2942 jb.asm.org Journal of Bacteriology

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

Bacillus azotoformans sp. nov. Int. J. Syst. Bacteriol. 33:660 – 662. http://dx.doi.org/10.1099/00207713-33-3-660.

42. Lee F-L, Kuo H-P, Tai C-J, Yokota A, Lo C-C. 2007. Paenibacillustaiwanensis sp. nov., isolated from soil in Taiwan. Int. J. Syst. Evol. Micro-biol. 57:1351–1354. http://dx.doi.org/10.1099/ijs.0.64764-0.

43. Müller S, Hoffmann T, Santos H, Saum SH, Bremer E, Müller V. 2011.Bacterial abl-like genes: production of the archaeal osmolyte Nε-acetyl-�-lysine by homologous overexpression of the yodP-kamA genes in Bacillussubtilis. Appl. Microbiol. Biotechnol. 91:689 – 697. http://dx.doi.org/10.1007/s00253-011-3301-8.

44. Bozler G, Robertson JM, Ohsugi M, Hensley C, Barker H. 1979.Metabolism of l-�-lysine in a Pseudomonas: conversion of 6-N-acetyl-L-�-lysine to 3-keto-6-acetamidohexanoate and of 4-aminobutyrate to suc-cinic semialdehyde by different transaminases. Arch. Biochem. Biophys.197:226 –235. http://dx.doi.org/10.1016/0003-9861(79)90240-6.

45. Ohsugi M, Kahn J, Hensley C, Chew S, Bozler G, Robertson JM, BarkerH. 1980. Metabolism of L-�-lysine by a Pseudomonas: purification andproperties of 3-keto-6-acetamidohexanoate cleavage enzyme. Arch.Biochem. Biophys. 203:437– 452. http://dx.doi.org/10.1016/0003-9861(80)90197-6.

46. Bown AW, Shelp BJ. 1997. The metabolism and functions of -aminobu-tyric acid. Plant Physiol. 115:1–5.

47. Markowitz VM, Chen I-MA, Palaniappan K, Chu K, Szeto E, Pillay M,Ratner A, Huang J, Woyke T, Huntemann M. 2014. IMG 4 version of theintegrated microbial genomes comparative analysis system. Nucleic AcidsRes. 42:D560 –D567. http://dx.doi.org/10.1093/nar/gkt963.

48. Du L, Wei J, Han L, Chen Z, Zhang J, Song F, Huang D. 2011.Characterization of Bacillus thuringiensis sigK disruption mutant andits influence on activation of cry3A promoter. Acta Microbiol. 51:1177–1184.

Transcription of Lysine-2,3-Aminomutase Gene in B. thuringiensis

August 2014 Volume 196 Number 16 jb.asm.org 2943

on April 10, 2018 by guest

http://jb.asm.org/

Dow

nloaded from