The Pennsylvania State University

The Graduate School

College of Agricultural Sciences

Tomato Plant Defenses against Helicoverpa zea

A Dissertation in

Entomology

© 2012

Donglan Tian

Submitted in Partial Fulfillment

of the Requirements

for the Degree of

Doctor of Philosophy

August 2012

The dissertation of Donglan Tian was reviewed and approved* by the following:

Gary W. Felton

Professor of Entomology

Dissertation Advisor

Chair of Committee

Head of the Department of Entomology

Edwin G. Rajotte

Professor of Entomology and IPM Coordinator

John Tooker

Assistant professor of Entomology

Yinong Yang

Associate Professor of Plant Pathology

*Signatures are on file in the Graduate School

iii

ABSTRACT

When insects feed on plants, the oral secretions inevitably come in contact with wounded

plant tissue and play very important role in regulating plant defense. These studies used tomato

(Solanum lycopersicum) and Helicoverpa zea (H.zea) as model system to study how oral

secretions affect tomato defense. In my first set of experiments, I found that saliva collected

from the spinnerets of H. zea had higher glucose oxidase (GOX) activity, which induced tomato

defenses. Plants that were wounded mechanically and then treated with with saliva or fungal

GOX had higher levels of PIN2 gene expression in leaves and green fruits, while flowers and red

fruit did not show comparable induction. GOX and saliva treatment also induce trichome number

on newly growth leaf. Mechanically remove trichomes significantly increase insect damage and

growth development.

Since trichomes contribute to plant resistance against herbivory by physical and chemical

deterrents. To understand the role of different type trichome function in insect defense, the

tomato trichome mutants were used to dissect trichome function in the defense. Study showed

that hairless mutants had reduced number of twisted glandular trichomes (type I, IV, VI and VII)

on leaf and stem, while woolly mutants had high density of non-glandular trichomes (type II, III

and V) but only on the leaf. In both mutants, trichome densities were induced by methyl

jasmonate (MeJA), but the types of trichomes present were not affected by MeJA treatment.

Glandular trichomes contained high levels of monoterpenes and sesquiterpenes. High density of

non-glandular trichome on leaves negatively influenced Leptinotarsa decemlineata (Colorado

potato beetle, CPB) feeding behavior and growth, it stimulated H. zea growth. High glandular

trichome density impaired H. zea growth, but had no effect on CPB. Quantitative real-time

polymerase chain reaction (qRT-PCR) showed that glandular trichomes highly express protein

iv

inhibitors (PIN2), polyphenol oxidase (PPOF) and hydroperoxide lyase (HPL) when compared

to non-glandular trichomes. PIN2 in trichomes was highly induced by insect feeding in both

mutant and wild type plants.

As defense signaling cascade is mediated by the synthesis, movement, and perception of

jasmonate (JA) and its interaction with other plant hormones. In order to understand the

interaction of ethylene and JA in regulating plant defense, the never ripe (Nr) mutant with a

partial block of ethylene perception and the defenseless (def1) mutant with deficient in

biosynthesis of JA were used to compare ethylene and JA interactions on tomato induced

systemic defense. Proteinase inhibitor (PIN2) was used as marker gene to compare the plant

response. Exogenous application of MeJA increased plants resistance to Helicoverpa zea and

induced tomato defense gene expression and glandular trichome density on systemic leaves.

Exogenous application of ethephon, an elicitor that releases ethylene, increased insect growth

and interfere the tomato wounding response. Hormone assay showed ethephon treatment

increase salicylic acid (SA) on the systemic leaves. These results showed that JA plays the main

important role on systemic induced defense. Ethylene negatively regulated tomato systemic

defense. This study also found that insect herbivory or MeJA treatment of the maternal

generation induces transgenerational tomato defense in the offspring by increasing glandular

trichome density and by priming defense genes that are regulated by plant phytohormone signals.

v

TABLE OF CONTENTS

LIST OF FIGURES .............................................................................................. vii

LIST OF ABBREVIATIONS …………………………………………………………… viii

LIST OF TABLES ................................................................................................. ix

ACKNOWLEDGEMENTS................................................................................................. x

Chapter I Insect herbivore induced defense in plants

Introduction............................................................................................................... 1

Mechanism of plant defense...................................................................................... 2

The model system in this study……………………………………………………. 21

Reference ................................................................................................................ 24

Chapter II Herbivore Effector Triggered Immunity? Salivary Glucose Oxidase Mediates

the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant

Abstract……………………………………………………………………………… 32

Introduction.................................................................................................................. 33

Materials and Methods................................................................................................ 36

Results……………………………………………………………………………….. 40

Discussion…………………………………………………………………………… 44

Reference.................................................................................................................... 61

Chapter III Role of Trichomes in Defense against Herbivores: Comparison of Herbivore

Response to Woolly and Hairless Trichome Mutants in Tomato (Solanum lycopersicum)

Abstract........................................................................................................................ 67

Introductions................................................................................................................. 69.

vi

Materials and Methods............................................................................................. 72

Results...................................................................................................................... 76

Discussion................................................................................................................ 82

Reference.................................................................................................................. 89

Chapter IV Roles of Ethylene and Jasmonate on Tomato (Solanum lycopersicum)

Systemic Induced Defense to Helicoverpa zea

Abstract..................................................................................................................... 111

Introduction.............................................................................................................. 113

Materials and Methods............................................................................................ 116

Results....................................................................................................................... 119

Discussion................................................................................................................. 125

Reference.................................................................................................................. 139

Appendix Herbivory in the previous generation primes tomato for enhance defense

Introduction.............................................................................................................. 144

Materials and Methods............................................................................................. .145

Results and Discussion............................................................................................. 146

Reference.................................................................................................................. 152

vii

LIST OF FIGURES

Fig. 2.1 Saliva GOX detection on MicroTom-leaves ………… 53

Fig. 2.2 Relative peptide abundance of H. zea salivary proteins ………… 54

Fig. 2.3 PIN2 relative expression of PIN2 in tomato leaves 24 and 48

hours after feeding

…………

55

Fig. 2.4 Compare relative expression of defense genes 24 hours after

wounding and application of H. zea saliva from 10 larvae on

tomato leaf

…………

56

Fig. 2.5 Relative expression of PIN2 on different MicroTom tissues 24

and 48 hrs after wounding and treatment with PBS buffer,

saliva or fungal GOX

………… 57

Fig. 2.6 Trichome induction by wounding treatment or insect feeding.

Average number of trichomes on new growth leaf after

wounding or insect feeding

…………

59

Fig. 2.7 Trichomes significantly affect H. zea feeding and growth ………… 60

Fig. 3.1 Morphology of trichomes on mutant and wild type leaf and

stem, and induction by methyl jasmonate (MeJA)

…………

98

Fig. 3.2 Trichome morphology on leaves in wild type and hl, woolly

mutant plants under scanning electron microcope

…………

99

Fig. 3.3 Trichome density on hl, woolly mutant and wild type plants

and induction by MeJA

…………

100

Fig. 3.4 Representative total ion chromatograms showing MTBE

extractions of leaf trichomes

…………

101

Fig. 3.5 Comparison of monoterpenes and sesquiterpenes levels in

mutant and wild type leaves and stems

…………

102

Fig. 3.6 Relative gene expression in different types of trichomes in hl,

woolly and wild type

…………

103

Fig. 3.7 hl and woolly mutant affect Helicoverpa zea and Colorado

potato beetle growth and feeding time

…………

104

Fig. 3.8 H. zea feeding induced relative expression of proteinase

inhibitor 2 (PIN2) in mutant and wild type plants

…………

105

Fig.3.S1 Oviposition choice on different mutants. Not significantly

different among the mutants

…………

106

Fig.3.S2 Oviposition of H. zea and CPB in woolly mutant ………… 107

Fig. 4.1 Tomato growth affected by MeJA and ethephon treatment ………… 133

Fig. 4.2 MeJA and ethephon treatment induce trichome number on

systemic leaves

…………

134

Fig. 4.3 MeJA and Ethephon affect H. zea growth and neonates’ choice ………… 135

Fig. 4.4 Chemical elicitors spray affects gene expression ………… 136

Fig. 4.5 MS medium grown seedlings gene expression affected by

elicitor treatment

…………

137

Fig. 4.6 Gene expression affected by wounding ………… 138

Fig. I.1 MeJA induced defense on leaf and fruits ………… 150

Fig. I.2 Transgenerational induced resistance in tomato ………… 151

viii

LIST OF TABLES

Table 2.1 Caterpillar oral secretion collection protein and GOX assay …………… 48

Table 2.2 Primers used for real-time PCR assays of relative expression …………… 48

Table 2.3 Proteomic Identification of Salivary Proteins in H. zea by

tobacco plants receiving varying treatments

……………

49

Table 3.1 Primers used for real-time PCR assays of relative gene

expression

……………

95

Table 3.S1 Monoterpenes in mutant and wild type trichomes …………… 108

Table 3.S2 Sesquiterpenes in mutant and wild type trichomes …………… 109

Table 4.1 Primers used for real-time PCR assays of relative expression …………… 130

Table 4.2 Salicylic acid and JA affected by MeJA and Ethephon …………… 131

ix

List of abbreviations

woolly hairy mutant

hl hairless mutant

RU Rutgers wild type plants of woolly mutant

AC Alisa Craig, wild type plants of hairless mutant

MeJA methyl jasmonate

PIN2 protease inhibitor 2

HPL hydroperoxide lyase

SlCycB2 B-Type cyclin

PPOF polyphenol oxidase

CPB Colorado potato beetle

Nr Never ripe mutant

def1 Defenseless 1 mutant

RU Rutgers wild type plants of Nr mutant

CM Castlemart , wild type plants of def1 mutant

ERF1 Ethylene response factor

PR1 Pathogenesis related gene

ET

SA

Ethylene

Salicylic acid

x

ACKNOWLEDGEMENTS

I would like to express my deepest gratitude to my advisor Dr. Gary Felton for his

continuous guidance, support and encouragement during my graduate program. He has been a

great listener and mentor and helped me to develop as a scientist. He not only taught me a lot of

academic knowledge, but also offered great help in life as well. He was always there when I

needed help and without that I could not have come this far. I also want to thank my other

committee members, Dr. Edwin G. Rajotte, Dr. John Tooker and Dr. Yinong Yang; they have

given me valuable suggestions and comments to improve my research. Special thanks to Dr.

Dawn Luthe for her good suggestions on my research and presentations and my proposal writing.

I would also like to thank Michelle Peiffer for being a wonderful resource and a great

friend. I would like to thank the members of the Felton and Luthe Lab for their friendships and

various help all the way. Jinwon Kim, Helene Quaghebeur and Seung Ho Chung always give me

suggestions and help on my research and other lab members have provided endless help.

Finally, I want to thank my husband and my parents for their endless support. Without

them, I cannot have achieved this much. I also thank my two kids, Jessie and Steven. They give

me pressure as well as encouragement to go on. And I will continue to work hard in my life.

1

Chapter I

Insect herbivore-induced defense in plants

Introduction

Higher plants are continuously challenged by numerous environmental factors such as

pathogen attack or herbivory. To avoid attacks or diminish the injury they cause, plants

frequently respond by different defense strategies to protect themselves (Green and Ryan 1972;

Howe and Jander 2008; Stout et al. 1996; Wu and Baldwin 2010). Among the strategies,

synthesis of secondary metabolites and defense proteins are powerful chemical weapons that

influence herbivore nutrition and growth development (Arimura et al. 2005; Baldwin et al. 2001;

Kessler and Baldwin 2001; Vandenborre et al. 2010). These metabolites include glucosinolates,

alkaloids, phenolics, proteinase inhibitors (PIN), polyphenol oxidases (PPO), lipoxygenases

(LOX), among others. Besides these defenses, plants also can release volatile organic

compounds (VOCs) to attract the predators and parasitoids of the herbivores (Arimura et al.

2001; Dicke and Dijkman 2001; Heil and Kost 2006). Physical defenses such as trichomes are

another mechanism of defense in plants to prevent or diminish damage by herbivores. The

occurrence of different trichome types has been associated with specific resistance (Boege and

Marquis 2005; Dalin et al. 2008; Levin 1973). Evidence has accumulated over the past few years

to indicate that defenses are regulated by a network of plant hormones (Berger and Altmann

2000; Steppuhn and Baldwin 2008).

When herbivorous insects feed on plants, they not only physical damage on the plants but

also produce insect derived cues inevitably come in contact with the wounded plant tissue

(Felton and Tumlinson 2008). These chemicals, produced when insect feed or oviposit on

plants, are Herbivore associated Molecular Patters (HAMPs) called effectors and act as elicitors

2

of induced defenses. Effectors are insect secreted chemicals that suppress defenses. The ability

of plants to recognize insect cues and respond is a form of plant immunity. As sessile organisms

plants also have evolved diverse strategies to continuously adjust their response to adapt a broad

range of stresses by transferring the plant defense to next generations, which is called

transgenernational plant immunity.

Effectors and HAMPs

A diversity of plant pathogens, including bacteria, fungi, oomycetes and nematodes,

secrete molecules when invading plants. The broader definition in plant-pathogen interactions of

effectors include many molecules such as microbial (pathogen) -associated molecular patterns

(MAMPs or PAMPs) (Hogenhout et al. 2009). HAMPs are secreted by insect herbivore and

exhibit similar activity as MAMPs in regulating plant defense. Over the years evidence has

accumulated that insects produce a cocktail of chemicals that modulate plant defenses (Felton

and Tumlinson 2008; Mattiacci et al. 1995; Musser 2005; Schmelz et al. 2003b). Until now only

a small quantity of herbivore-derived chemicals have been isolated and structure identified

(Figure. 1).

a) Volicitin

N-(17-hydroxylinolenoyl)-L-glutamine N-linolenoyl-L-glutamine

O NHH

O H

OH

CH3

O

NH2

O NHH

O H

CH3

O

NH2

b) Caeliferin

CaeliferinA 16:1

3

OH

O

O

SO O

OH

O

S

O

O

OH

CaeliferinB16:1

OH

O

O

SO O

OH

O

NH

OOH

c) Inceptin

H2N-IIe-Cys-Asp-IIe-Asn-Gly-Val-Cys-Val--Asp-Ala-COOH

S S

d) Bruchin C e) Benzyl cyanide

OH

OO

(CH2)8(CH2)4

O O

OH

CN

Fig. 1 Structure of the known herbivore derived elicitors a) Fatty acid-amino acid conjugates,

volicitin and N-Linoleoyl-glutamic acid. b) Caeliferins A and B isolated from Schistocerca

americana c) Inceptin is the proteolytic product of plant chloroplastic ATP synthase γ-subunit

found from Spodoptera frugiperda oral secretions d) Bruchins C isolated from pea weevil

oviposition fluids e) Benzyl cyanide in Pieris brassicae oviposition fluids

Fatty acid amino acid conjugates (FACs)

4

Fatty acid amino acid conjugates (FACs) (Figure. 1a) are the best studied HAMPs in plant-

insect interactions. The FACs is composed of two moieties including fatty acid (or linolenic acid

LA) and amino acid moiety (Glu or Gln). The fatty acid and amino acid originate from plants

and insects, respectively and are synthesized in the insect midgut by the addition of a hydroxyl

group and glutamine to linolenic acid obtained directly from the host plants. Volicitin (N-17-

hydroxylinolenoyl-L-glutamine) was first isolated from beet armyworm (Spodoptera exigua)

regurgitant and induce corn seedling to release volatile compounds, which attract parasitic wasps

(Alborn et al. 1997). Several other FACs has been isolated from lepidopteran species, crickets

and fruit flies (Halitschke et al. 2001; Pohnert et al. 1999; Spiteller and Boland 2003; Yoshinaga

et al. 2007). Volicitin is a key component in regulating tritrophic interactions among plants,

insect herbivores, and natural enemies of the herbivores.

Inceptin

In addition to FACs, the other types of HAMPs have been discovered. Inceptin

(Figure.1b) was isolated from oral secretions of fall armyworm (Spodoptera frugiperda). It is a

disulfide-bridged peptide (+ICDINGVCVDA-) and produced by proteolytic degradation of plant

chloroplast ATP synthase γ-subunit. When fall armyworms attack cowpea plants, the ingested

cATPC is cleaved in insect midgut and forms inceptins (Carroll et al. 2006; Schmelz et al. 2006).

The inceptin could promote cowpea ethylene production and trigger increases in the defense

related phytohormones salicylic acid and jasmonic acid.

Caeliferins

5

Caeliferins (Figure 1c) were isolated from the oral secretions of the grasshopper species

Schistocerca americana. The caeliferins are composed of saturated and monounsaturated

sulfated α-hydroxyl fatty acids with varies length from 15-20 carbons. The caeliferin A 16:1 is

predominant and most active in inducing release of volatile compounds. While caeliferins A16:0,

A17:0 and 18:0 are less active in inducing volatile compounds (Alborn et al. 2007).

Bruchins and Benzyl cyanide

Bruchins and benzyl cyanide are two substances found in oviposition fluids. Bruchins

(Figure. 1d) were isolated from pea weevil (Bruchis pisorum) and elicit the tumor-like growth

under the deposited egg, which inhibits the larvae from entering the pea pod. Benzyl cyanide

(Figure. 1e) was isolated from butterfly (Pieris brassicae) which triggers the expression of

defense-related genes (Hilker and Meiners 2002; Mumm et al. 2003). These chemicals regulate

tritrophic interactions among plants, insect herbivores and natural enemies of the herbivores.

Proteins

In addition to the small molecules, the first reported HAMP protein is -glucosidase,

which is present in the regurgitant of Pieris brassicae caterpillar, triggered the emissions of

volatile in cabbage plants (Mattiacci et al. 1995). Recently, glucose oxidase (GOX) was

identified in the saliva of Helicoverpa zea (H. zea) oral secretion and mediates plant defense

response. GOX converts glucose into gluconic acid and H2O2 and is the most abundant protein

found in labial salivary glands of H. zea. Applications of GOX or labial gland extract suppress

the wound-inducible production of foliar nicotine and volatiles in tobacco leaves. The bioassays

6

showed caterpillar survival and growth increased when fed GOX-treated leaves (Bede et al.

2006; Delphia et al. 2006; Musser et al. 2002).

β-D-glucose + O2 D-gluconic acid + H2O2

Functional genomics approaches haves also been utilized to identify the green peach

aphid effectors (Bos et al. 2010). While feeding, aphid saliva secreted into plant cells and

phloem. The saliva contains proteins such as Mp10, Mp42 and MpC002 with diverse activities

and function as induce or suppress plant defense response. Also another recent study with green

peach aphid – Arabidopsis model system indicates that salivary protein fractions between 3–10

kD acts as the potential salivary components that are recognized by the host plant to modulate

plant defense responses (de Vos et al. 2010). But the detail structure and function in plant

defense need more study to confirm. The interactions between plants and insects are complex

and dynamic.

Plant perception of insect herbivore

The insect signal perception is the first step of induced plant defense and has been well

investigated in many insects (Alborn et al. 1997; Alborn et al. 2000; Musser et al. 2002;

Voelckel and Baldwin 2004). Because of different feeding behaviors, the insects use different

methods to deliver their effector to the plants and the plants may have different perception

mechanism. Phloem-feeding insects, such as aphid and whiteflies, could directly deposit their

signals into plant phloem, which alter plant defense signaling and plant development. The insects

use stylets to navigate the cuticle, epidermis, mesophyll and established feeding sites in phloem

sieve elements (SEs) on host plants (Will and van Bel 2006). During the stylet penetration in

Glucose

oxidase

7

plant tissue and feeding from the phloem sap, they inject salivary secretions into the plant. More

studies suggested the phloem-feeding insects use similar strategies as pathogens to introduce

effectors into plant cells by many biochemical and cellular process (Bos et al. 2010). When the

stylets pierce into phloem SEs, plants repair the SEs wounds by depositing callose and proteins

to rapidly seal plasma membranes to prevent the leakage of phloem sap into apoplast (Walling

2009). As a consequence, plant perception of the effectors activates plant signaling pathways to

regulate large set of genes that shape the appropriate defense responses.

The Hessian fly (Mayetiola destructor HF) has extremely minute mandibles which are

not well structured for chewing, produce a shallow punctures on the leaf surface and release

salivary secretions. This process rapid changes the surface wax composition, increases cell

permeability and results in the diffusion of nutrients to the leaf surface during early stages of the

interaction (Chen et al. 2004a). The resulting gene-for-gene recognition of larval salivary

components initiates chemical and physical defenses. Previous studies showed that the RXLR

protein motif mediates oomycete and fungal effectors entry into the plant host cell through the

plasma membrane. Similarly the most recent study on HF study showed the Ave gene in HF

genome encodes the effector proteins which have a modular structure contain RXLR-like motif

and the structure resembles the effectors of filamentous plant pathogens alter plant immunity

(Chen et al. 2010).

Chewing insects release oral secretions during feeding and plants perceive insect attack

through the direct detection of these secretions. For example, maize (Zea mays) and tobacco

(Nicotiana attenuata) can directly perceive the fatty acid amino acid conjugates (FAC) and

induce volatile emissions. Radiolabeled volicitin was identified in the caterpillar regurgitant and

recovered from corn leaves after feeding by Spodoptera exigua (Truitt et al. 2004). 2004).The

8

saliva of Lepidoptera is released from the labial glands via the spinneret and one of the key

functions is to facilitate feeding and digestion (Eichenseer et al. 1999; Felton and Eichenseer

1999). The immune-labeling method was used to confirm H. zea release saliva during feeding.

The results showed that larvae secret microgram amounts of saliva on the leaf surface during a

few hours feeding (Peiffer and Felton 2005).

R-gene mediated plant resistance

Given the diversity of insect herbivores, the inducible defenses may respond differently

in the modulating plant insect interactions. The induced defense response to phloem-feeding

insects is similar to the plant defense to pathogens (Bhattarai et al. 2007; Walling 2000). Plants

recognize pathogens through the pattern recognition receptors (PRRs) located on the cell surface

and result in PAMP (MAMP) triggered immunity (PTI). To counter PTI, the pathogens develop

mechanisms to secrete and deliver effectors into host cells which in turn triggers plant disease

resistance (R) protein production (Dangl and Jones 2001). Previous study in a few systems

showed that R gene products mediate resistance to phloem-feeding insect herbivore. The R gene

in plants encodes NBS-LRR (nucleotide binding site-leucine rich repeat) proteins which

recognize the insect hemipteran herbivore. Mi-1 gene in tomato encodes a protein sharing

structural features with the NBS-LRR confers resistance to potato aphid, white flies and

nematodes (Casteel et al. 2006). Another NBS-LRR protein, encodes by melon Vat gene, confers

increased resistance to Aphis gossypii (cotton aphid) and the transmission of plant virus by this

aphid species. The most recent finding showed that Bph14 gene encodes a coiled-coil NBS-LRR

which resistance to rice brown plant hopper Nilaparvata lugen (Chen et al. 2004b; Wang et al.

9

2004). These studies showed that some insect and plant interactions may fit the gene for gene

model (Dogimont C et al. 2010).

Induced plant defense

Plants use constitutive and/or induced defenses against insect herbivory. One group of

defenses are secondary metabolites; glucosinolate, phenolics, tannins and alkaloids are some of

the most studied toxic secondary metabolites that play important roles in defense against

herbivory (Howe and Jander 2008). The other group is anti-digestive or anti-nutritive proteins. In

addition to direct defenses induced by insect feeding, plants also produce volatile organic

compounds (VOCs) in response the damage. VOCs released by herbivore-attacked plants may

attract arthropod predators and parasitoids in plants. One study showed that volicitin (17-

hydroxylinolenoyl-L-Gln) in the regurgitant of Spodoptera exigua (beet armyworm caterpillars)

activates the emission of VOCs when applied to the damaged maize leaves (Truitt and Pare

2004). The VOCs are high specific and serve as attractants for female parasitic wasps, which

parasitize herbivore larvae (De Moraes et al. 1998).

When herbivore effectors or HAMPs are released on the plants, it could trigger a series of

molecular events in plant cells. Ca2+

has been recognized as secondary messenger involved in

plant signaling. Under normal condition, the cytosolic Ca2+

content are lower than in organelles.

Trans-membrane ion fluxes were generated when insect effectors release at wounding site. The

changes in intracellular Ca2+

further activate calmodulins, calmodulin binding proteins, calcium-

dependent protein kinase (CDPKs) and other calcium-sensing proteins that promote downstream

signaling to modulate plant defense response (Maffei et al. 2006; Maffei et al. 2007).

10

The mitogen- activated protein kinase (MAPK) signaling pathway plays a central role in

mediating plant response to herbivore attack. MAPKs are phosphorylated by MAPK kinases

(MAPKKs) at the threonine and tyrosine residues located in the activation loop (T-loop) between

subdomains VII and VIII of the kinase catalytic domain. Several MAPKs involved in plant

defense have been identified (Heinrich et al. 2011). Nicotiana attenuata, when attacked by

Manduca sexta (M. sexta), recognizes the FACs in M. sexta oral secretions (OS) that are

introduced into wounds during feeding and rapidly activates two MAPKs, salicylic acid-induced

kinase (NaSIPK) and wound-induced protein kinase (NaWIPK) which are required for the

herbivory-induced biosynthesis of jasmonic acid (JA) and ethylene (Wu et al. 2007). Virus

induced gene silencing (VIGS) reduce t MAPK expression confirming their important role in

plant defense. In Arabidopsis, activated (phosphorylated) MAPKs can directly phosphorylate

certain downstream targets and stimulate induced defense (Beck et al. 2011; Chang and Karin

2001).

Hormonal signals involving jasmonate acid (JA), salicylic acid (SA) and ethylene (ETH),

constitute a complex signaling network leading to defense-related gene activation and regulation

(Chini et al. 2007; Howe and Jander 2008; Ludwig et al. 2005; O'Donnell et al. 2003). JA is a

naturally occurring, non-toxic compound and a member of plant hormones which plays an

important role in plant development and control plant defense against herbivores (Wasternack et

al. 2006). The synthesis of JA is occurs in chloroplasts and peroxisomes through the

octadecanoid pathway. In chloroplasts, the reaction begins with linolenic acid (LA 18:2and 18:3),

it is catalyzed by lipoxygenases (LOXs) to form the 13-hydroyperoxide of linolenic acid. The

13-hydroperoxide further processed by allene oxide synthase (AOS) and allene oxide cyclase

(AOC) to form 12-oxophytodienoic acid (OPDA) (Bonaventure et al. 2011; Wasternack et al.

11

2006; Weber et al. 2004). After transport to peroxisomes, ODPA reductase (OPR3) catalyzes the

OPDA, followed by three cycles of β-oxidation to form JA by shortening of the hexanoic and

octanoic acid side chains (Figure. 2) (Wasternack et al. 2006; Wu and Baldwin 2010). It is well

established that JA levels increase in response to wounding, herbivory, elicitor treatment or other

abiotic stress (Constabel et al. 1995). DNA microarray studies showed that the jasmonate

pathway has a dominate role in regulating global changes in gene expression in response to both

mechanical wounding and herbivory (De Vos et al. 2005).

Insect feeding triggers the expression of plant protease inhibitors (PIs) and other defense

compounds that are regulated by the JA- pathway (Creelman and Mullet 1995; Ryan 1974).

These compounds inhibit digestion in the larval midgut and affect insect growth development

(Farmer and Ryan 1992; Pearce et al. 2001). Other enzymes such as polyphenol oxidase (PPO),

lipoxygenase (LOX), arginase (ARG) and threonine deaminase (TD) may reduce the nutritional

quality of plants.

SA is also a signal modulating plant defenses. SA is synthesized from chorismate

through two reactions catalyzed by isochorismate synthase (ICS) and isochorismate pyruvate

lyase (IPL). It’s well studied that SA play a central role as a signaling molecule involved in plant

defense. SA regulates many pathogenesis-related (PR) genes which are antifungal hydrolases

Fig 2. The octadecanoid pathway for the

biosynthesis of JA. JA synthesis is initiated in the

chloroplast, where linolenic acid is converted to 12-

oxo-phytodienoic acid (OPDA) by sequential action

of lipoxygenase (LOX), allene oxide synthase (AOS)

and allene oxide cyclase (AOC). Following transport

to the peroxisome, OPDA is catalyzed by OPDA

reductase (OPR3) and other reactions to produce JA.

JA then activates the transcription of genes (Modified

from Wasternack et al., Plant Physiology

(Wasternack et al. 2006) and Howe & Jander, Annual

Review of Plant Biology (Howe and Jander 2008)) .

12

targeted to the plant cell wall (Traw and Bergelson 2003). One studied showed that an

Arabidopsis transgenic line expressing the salicylate hydroxylase gene (NahG) had reduced the

levels of SA and were more susceptible to P. syringae (Glombitza et al. 2004).A few reports

implicate SA in defense against, but mostly focus on sucking insects like aphids and thrips. One

mutant, the non-expresser of pathogenesis related genes1 (NPR1) showed enhanced resistance to

aphids (Cole et al. 2004). Application of exogenous SA activates expression of plant

pathogenesis-related (PR) genes and induces plant resistance to H. zea and triggers the

accumulation of SA in cotton, tomato and tobacco (Bi et al. 1997).

Ethylene, as gas hormone, in addition to the central role in many plant physiological

process throughout plant development including seed germination, cell elongation, flowering,

fruit ripening, organ senescence could also elicits plant defense (Zhang et al. 2010). Ethylene is

an important signal during herbivory, herbivore attack could enhance the ET burst (Kahl et al.

2000; Schmelz et al. 2003a). In many cases, ET has been shown to act as important modulator of

plant response to SA and JA. Other wound signals include abscisic acid (ABA), reactive oxygen

species (ROS) and nitric oxide (NO) (Adie et al. 2007; Klessig et al. 2000; Liu et al. 2010).

Cross talk of hormone in plant defense

Hormone cross talk is a process in which different hormone signaling pathways act

antagonistically or synergistically to regulate plant development and/or adaptation environment

stresses (Verhage et al. 2010). There is ample evidence for cross talk between SA, JA and ET

signaling pathways in plant immunity (Pieterse and Dicke 2007).

SA-JA The interaction between SA and JA signaling appears to be complex and there is

evidence in both positive and negative interaction. JA may collaborate with the SA response

13

pathway to trigger an indirect defense against an insect herbivore (Van der Ent et al. 2009).

Walling (2000) found that phloem-feeding insects may induce both SA and JA dependent

pathways. Simultaneous expression of SA and JA pathways is also observed in Mi-resistance

gene mediated defense in tomato to aphid feeding (de Vos et al. 2010). There is increasing

evidence that JA and SA are involved in negative cross talk in plant defense networks. For

instance, herbivorous nymphs of the silver-leaf whitefly could activate the SA signaling pathway

but suppress the JA-dependent defense signaling. Some reports indicate that synergistic

interaction between JA and SA. SA could repress JA mediated genes such as PIs and PPO

(Doares et al. 1995; Thaler 2002). Felton et al. (1999) observed an inverse relationship between

endogenous concentrations of SA and JA in tobacco. The JA mutants, mitogen-activated protein

kinase4 (mpk4), suppress the SA insensitivity2 (ssi2) and coi1 (Chini et al. 2009; Kachroo et al.

2005; Liechti et al. 2006). These studies provided genetic evidence that JA signaling negatively

regulated the expression of SA mediated defense in Arabidopsis (Gfeller et al. 2006; Liechti et

al. 2006).

SA-ET Limited data shows both positive and negative interaction between SA and ET

signaling pathway. The accumulation of SA in Xanthomonas campestris infected plants is

dependent on ET synthesis, because no SA accumulation occurs in the ET-insensitive mutant.

Microarray results showed SA and ET may coordinately induce defense-related gene expression

(Odonnell et al. 1996). However the SA-dependent expression of PR genes didn’t require ET

signaling.

JA-ET There are two modes of interaction between JA and ET. One is synergistic and

the other is antagonistic (Pieterse and Dicke 2007). Several studies provide evidence for the

positive interactions. For example, both JA and ET signaling are required for the expression of

14

the defense related gene PDF2 in response to the infection of A. brassicicola in Arabidopsis

(McConn et al. 1997). Treating plants with ethephon, a synthetic ET donor, could elevate the JA,

while blocking the ET with 1-MCP could reduce herbivory-induced volatile emission which are

regulated by JA (Schmelz et al. 2003c). In tomato, the JA and ET interaction is responsible for

the induction of proteinase inhibitors (PIN2) gene after wounding. Although the ET alone is not

able to induce the PIN expression, it cooperates with JA to synergistically induce the gene

expression (O’donnell et al. 1996). Previous studied showed that ET antagonistically to suppress

JA induced gene expression in nicotine biosynthesis and in wounded leaves of Arabidopsis

(Shoji et al. 2008).

The effect of herbivory on plants involves a complex interplay among varied signaling

networks. Increasing evidence suggests that different defense pathways are activated in plants

response to different type of stress. A thorough knowledge at the molecular level of how cross

talk occurs between different hormone pathways is necessary to understand how plants respond

to different stresses and in identifying new ways improve plant defense responses.

Trichome as first line of plant defense

Trichomes are uni- or multicellular hair-like structures that develop from cells of the

aerial epidermis and are produced by many plant species. Numerous studies have shown that leaf

trichomes can serve multiple functions as structural and chemical against herbivores (Amme et

al. 2005; Kang et al. 2010a; Levin 1973). In addition resistance to insect herbivory, trichomes

also provides resistance to abiotic stress, such as drought or UV radiation.

The morphology and density of leaf trichomes vary among plant species. Arabidopsis

foliar trichomes are unicellular, stellate, non-glandular trichomes that usually contain three

15

branches and are an excellent model to study all aspects of cell differentiation (Marks et al.

2009). The trichomes of tomato Lycopersicon (or now Solanum lycopersicum) were first

described by Luckwill (Luckwill 1943) and categorized as seven types trichomes. The type I, IV,

VI and VII are glandular trichomes which have a secretory head and an important site for

biosynthesis and accumulation of a wide range of plant natural products. The type I trichomes

have multicellular base and long multicellular stalk, while type IV trichomes have a unicellular

base and short multicellular stalk compared to type I trichomes. The type VI trichomes

containing the four-celled glandular head have been the most heavily studied trichomes in

tomato. The type VII trichomes are irregularly shape and have short unicellular stalk (Luckwill

1943). The types II, III and V are non-glandular trichomes. The type II and III are similar with

the multicellular and unicellular base individually, while the type V trichomes are short with

unicellular base (Kang et al. 2010b; Levin 1973).

Trichome density is an important factor of resistance against herbivorous insects (Levin

1973; Traw and Dawson 2002a). The presence and density of leaf trichomes can influence both

host-plant selection behavior and performance (i.e. growth, survival and fecundity) of

herbivorous insects, but can be considered a relatively soft “weapon” in plant defense compared

with many other traits that are lethal to insects. The role of glandular trichomes in resistance of

L. hirsutum has been thoroughly explored by Gurr & McGrath (2002). Research has shown

glandular trichomes of tomato species spp. are responsible for resistance to various insects (Kang

et al. 2010a; Kang et al. 2010b). Studies showed the trichome density is negatively related to

insect growth and experimental removal of leaf trichome results increasing insect performance

on several species plants (Ashouri et al. 2001). Experimentally removing glandular trichome

heads and exudates significantly decreased the mortality of neonates on the two accessions with

16

highest levels of resistance in their natural state. This supports similar findings from previous

research conducted on the potato aphid (Gentile et al. 1969), H. zea (Dimock et al. 1982), L.

decemlineata (Kennedy 2003) and T. vaporariorum (Gentile et al. 1969). Glandular trichomes

can be viewed as a combination of a structural and chemical defense (Sarria et al. 2010). Non-

glandular trichome had a negative effect on oviposition, hatching rate and survival of insects

(Baur et al. 1991).

Some plant species respond to insect feeding or mechanical wounding by producing more

trichomes on new growth leaves (Agrawal 1999; Dalin and Björkman 2003). The trichome

density is typically increased between 25%-100% within days or weeks after the wounding (Baur

et al. 1991). For example Björkman study showed that the trichome production was induced by

leaf beetle herbivory in the willow Salix cinerea. The damage on the leaf could also change the

relative proportions of glandular and non-glandular trichomes. Recent study on Arabidopsis

trichomes showed jasmonate acid regulates the systemic trichome development (Karban et al.

2003; Traw and Dawson 2002). Application of jasmonic acid (JA) or methyl jasmonate (MeJA)

and gibberellin (GA) increase trichome production on newly growth leaves but salicylic acid

(SA) reduces trichome production. Thus the hormone levels in plants regulate trichome

production on leaves (Boughton et al. 2005; Traw and Bergelson 2003). The abiotic stress such

as drought and UV-radiation also could induce trichome production (Nagata et al. 1999).

The most remarkable feature of tomato trichomes is their capacity to produce and secrete

a wide variety of plant secondary compounds including terpenoids (Bos et al. 2010; Kang et al.

2010a; Schilmiller et al. 2010), phenolics (Gang et al. 2001), sucrose esters, methylketones

(Ben-Israel et al. 2009) and organic acids (Voirin et al. 1993). Many of the trichome-borne

compounds have significant value as fragrances, food additives or natural pesticide (Wagner

17

1991). Due to the importance of trichome chemicals in defense more studies need to focus on

systemic analysis of the metabolites in trichomes and elucidation of their biosynthetic pathway

(Schilmiller et al., 2008, 2009, 2010; Kang, 2010). For example type VI trichomes in tomato

produce 2-tridecanone and other methylketones that are high toxic to some arthropod pests of

tomato. In Nicotiana species, the accumulation of nicotine in trichomes induced by jasmonate is

toxic to Manduca sexta (Preston et al. 2001).

In contrast to the broad knowledge on trichome morphology and chemistry, the protein

complement of the trichome is relatively less studied. The proteomics and molecular techniques

are useful tools to analysis the enzyme and pathway of the chemicals in trichomes. Shotgun

proteomics analysis allows the identification and relative quantification of the proteins in

trichomes. Extensive DNA sequencing was combined with proteomics aids in the genes and

proteins expressed in trichomes. Studies showed that the monoterpene (MTS1) and sesquiterpene

(SST1) synthesis genes play a key role in regulating terpenoid production in glandular trichomes

in tomato (Besser et al. 2009). Proteinase inhibitor proteins, interfere the herbivory physiology

by inhibiting the digestive process of insects, are constitutively expressed in trichomes. In

addition to proteinase inhibitors, the trichomes of many Solanum species also accumulate

polyphenol oxidase which plays an important role defense insects and pathogens. Trichome-

based host plant resistance may have the potential to reduce pesticide use during tomato

production.

Because tomato (Solanum lycopersicum) is an economically important crop, it serves as a

model for studying plant defenses against herbivores and diseases (Green and Ryan 1972; Howe

and Jander 2008; Mirnezhad et al. 2010). Decades of research on tomato has shown that

jasmonate signaling (JA) plays an important role in plant defense signaling against insect

18

herbivory (Bostock et al. 2001; Thaler et al. 2001). Trichomes in cultivated tomato and related

wild species have been subjects of intense study for many decades (Steffens 1991; Kennedy et al.

1991; Peiffer et al. 2009).

In tomato, the effect of trichome-based resistance on insect herbivores has mostly

focused on glandular trichomes and there has been considerably less study on the role of non-

glandular trichomes against herbivores (Kang et al. 2010a). Because most cultivars possess both

glandular and non-glandular trichomes, it is difficult to separate trichome function(s) in these

commercial varieties. To study different trichome function in plant defense, the mutants with

different type’s trichome will be good to study the function of trichome in plant defense.

Mechanism of transgenerational plant defense

Plants being have evolved diverse strategies to continuously adjust their response to a

broad range of stresses and herbivore challenges. Herbivore resistance mediated by jasmonic

acid (JA) and related metabolites within one generation has been extensively studied

(Wasternack et al. 2006), but there is little investigation into the longer-term inducible defense in

plants or how resistance may persist across generations.

Changes in the parental condition can affect the phenotype of their offspring. This

process is considered as an epigenetic (non-genetic) phenomenon which can persist over many

generations, since the parental effects significantly affect the phenotype of its offspring via

transmission of non-genetic information. Agrawal and colleagues used wild radish (Raphanus

raphanistrum L. brassicacease) and herbivory as model to examine the induced defense in the

next generation, and they found when insects fed on maternal plants, the progeny were more

resistant than progeny from undamaged plants (Agrawal 1999). In the field experiments, plants

19

exposed to herbivory in the early season had 60% higher relative fitness than undamaged

controls (Agrawal 1999). Induced responses in wild radish showed variation corresponding with

different insect herbivores. In some instances, the offspring of the damaged plants showed

higher numbers of trichomes compared to the offspring from their undamaged parts (Agrawal

2001). A similar phenomenon was also observed that the increased glandular trichome density

in the progeny of yellow monkey flower, Mimulus guttatus, when the parents were exposed to

herbivory (Holeski 2007). Further the maternal generation exposed to herbivory also had positive

effects on other traits in the offspring such as seed biomass and flower production (Streets and

TL 2010). In addition, environmental factors can influence the properties of the offspring, when

seeds from plants grown under warm temperature during flowering and seed development, the

progeny showed higher nitrogen content, higher germination and growth rate, and increased

seed biomass and seed production (BlÖDner et al. 2007). The mechanisms of transgenerational

plant defense study could provide a useful tool for crop management (Chinnusamy and Zhu

2009).

Transgenerational plant defense means that the offspring’s immunity traits are acquired

by the adult parent; in other words the adaptation of the maternal effects responding to the

environment can improve the fitness and immunity traits of the offspring. Several studies have

examined the contribution of maternal stress to offspring’s phenotype and fitness. Agrawal and

colleagues used wild radish (Raphanus raphanistrum L. brassicacease) and insect herbivory as

model to examine induced defenses in next generation, and they found insect feeding on the

maternal wild radish caused progeny to be more resistant than progeny from unfed wild radish

(Agrawal 1999). Field experiments showed that plants exposed to herbivory in the early season

had 60% higher relative fitness than un-exposed controls (Agrawal 1999). In some instances, the

20

offspring of the damaged plants showed higher numbers of trichomes compared to the offspring

from their undamaged parents (Agrawal 2001). A similar phenomenon was also observed in the

progeny of yellow monkey flower, Mimulus guttatus, when the parents were exposed to

herbivores (Holeski 2007). Transgenerational induction of high trichome density could confer a

selective advantage, if offspring are likely to experience the same herbivore pressure as their

parents.

How plants transmit the stress responsive properties to the next generation, and the

underlying mechanisms of transgenerational adaptation are currently not well known. The

transgenerational defense should not result from random mutagenesis followed by the selection

of the fittest individuals, as the frequency of spontaneous mutations is rather low. The genome

stability is maintained by various repair mechanisms, and homologous recombination may serve

as an important mechanism involved in repair (Schuermann et al. 2005). One recent study

showed that the progeny of Nicotiana tabacum infected with tobacco mosaic virus exhibited a

high frequency of rearrangements at disease resistance gene-like loci (Kathiria et al. 2010), and

other couple studies also found the correlation between transgenerational transmission with the

homologous recombination frequency (HRF) response to stress. These data suggest that

continuous exposure to the stress may lead the evolutionary selection of the adaptive traits which

are beneficial to the plants.

Among the inheritable genome changes, reversible DNA methylation and chromatin

modifications are involved in the regulation of gene expression (Zilberman and Henikoff 2005).

This reversible epigenetic adaptation could serve plants as an alternative strategy to

environmental stresses. DNA methylation include both asymmetric (m

CpHpH)-methylation and

symmetric (m

CpG and m

CpHpG)-methylation. The low level of DNA methylation frequently

21

correlates with the expression of stress specific gene; in one study, virus-infected tomato plants

showed changes in DNA methylation at several marker loci (Mason et al. 2008). Another study

showed that dandelions expose to SA led to genome wide and possible stress specific changes in

DNA methylation and were transmitted to the immediate progeny (Verhoeven et al. 2010). DNA

cytosine methylation in gene promoter is associated with repressive chromatin and with

repression of gene. In maize roots, cold stress induced expression of ZmMI1 was correlated with

the reduction of methylation in the DNA of nucleosome core (Steward et al. 2002). In

Arabidopsis, the drought induced expression of stress responsive gene is associated with an

increase in H3K4 trimethylation and H3k9 acetylation. Histone variant H1 in tomato was shown

involved in regulation of stomatal conductance from drought afflicts (Tsuji et al. 2006).

Another epigenetic factor, short interfering RNAs (siRNAs), is also active in the stress

response, the siRNAs are able to move between cells and through the plant vasculature, and play

import role in signal transduction during the plant development (Chitwood and Timmermans

2010). In fact, a large number of miRNAs and other small regulatory RNAs are encoded by the

Arabidopsis genome and that some of them may play important roles in plant responses to

environmental stresses as well as in development and genome maintenance (Sunkar and Zhu

2004). Endogenous siRNAs that are regulated by abiotic stress have been identified in

Arabidopsis (Sunkar and Zhu 2004). These findings suggest that biotic and abiotic stress could

shape the plant genome by different mechanisms, the heritable epigenetic modification may

provide within generation and transgenerational stress memory.

It would be highly interesting to find distinct profile of DNA or histone methylation,

siRNA of specific stress response, which will supply more understanding of transgenerational

defense and possible as guidance for crop management and insect-resistant improvement.

22

Perspectives and future directions

Many research studies have contributed significant progress to deciphering the molecular

mechanism of plant immunity, including the roles of herbivore effectors in perception and

defense. But until now only very few number of HAMPs and effectors have been identified.

Recent reports from Arabidopsis thaliana have demonstrated how pathogens may exploit protein

interactions to manipulate a plant’s cellular machinery. More study is needed to focus on insect

derived effectors and their function in plant-insect interactions. It may be that insect herbivores

produce cocktails of effectors as seen with pathogens, and that these cocktails broadly induce

host-plant defenses. The study of effector networks will contribute to understanding plant-insect

interactions and may offer clues to improve plant production. The protein-protein interaction

map would be a good technique to study the complex signaling networks of plant and insects.

Main points

When herbivorous insects feed on plants, they cause not only physical damage, but also

produce chemicals which may be perceived by the plants and thus activate plant defenses.

Plants use combinations of constitutive and inducible defense traits to defend against

insect damage. The defense response is regulated by several hormone signaling networks

involving jasmonic acid, salicylic acid, and ethylene.

Induced plant defenses may even persist across generations. Such transgenerational

resistance may provide a novel approach to improve crop production with fewer

environmental problems than current pest management approaches.

The model system in this study

23

Because of its economic importance, relatively small genome, short life cycle, and ease

of growth and maintenance, tomato Solanum lycopersicum (formerly Lycopersicon esculentum)

has long served as a model system for plant genetics, development, pathology, and physiology.

Decades of applied and basic research has focused on defenses employed against tomato diseases

and insect herbivores, including caterpillars (Lepidoptera) and beetles (Coleoptera), both groups

of which include diverse and important group of agricultural insect pests that in addition to

damaging tomatoes cause widespread economic damage on food and fiber crop plant species,

fruit trees, forests, and stored grains.

In this research the generalist noctuid Helicoverpa zea and Solanaceae specialist,

Colorado potato beetle (CPB) (Leptinotarsa decemlineata) were used as the main insects to

study tomato-insect interaction. The larvae of H. zea (sometimes called the tomato fruitworm)

are a major agricultural pest because they feed on many different plants during the larval stage.

Management of the fruitworm requires careful monitoring for eggs and small larvae. It’s

essential to control the pest before the larvae enter fruit, where they are protected from

insecticide sprays and predators. Colorado beetle is a serious pest of potatoes and also cause

significant damage to tomatoes and eggplants. Both larvae and adults feed on the plant leaves

can cause damage.

Objective 1: Determine the function of H. zea saliva in tomato defense

Since tomato fruit is the target for food production in the field, it is imperative to better

understand the response of fruit to herbivores. Because of small size, short life and small genome

(950 Mb), the micro-tom tomato was used in the studying of H. zea saliva function (Yano et al.

24

2007). The main hypothesis is that H. zea saliva differentially modulates plant response at

different plant growth stages.

Previous study showed the glucose oxidase (GOX) is the primary salivary protein from

the caterpillar H. zea ((Musser et al. 2005). In this study I compared the plant defense response to

H. zea saliva at different growth stages including defense gene expression and trichome

induction.

Objective 2: Compare the function of different types of trichomes in defense

Seven types of trichome had been described in tomato, most cultivars possess both

glandular and non-glandular trichomes, it is difficult to separate trichome in the commercial

varieties. Different trichome mutants were used to compare trichomes role in tomato defense. In

this current study, I used two mutants with differing trichome phenotypes to examine the role of

glandular and non-glandular trichomes in resistance to the solanaceous specialist L. decemlineata

and the generalist H. zea. I hypothesized that both glandular and non-glandular trichome

phenotypes will provide different contributions to defense against these herbivorous insect

species.

Objective 3: Cross talk of JA and ET in tomato defense

Tomato has been a primary model for elucidating the signaling pathways and induced

defenses against herbivores. The effects of herbivore on plants involve a considerably more

complex interplay among varied signaling networks than earlier thought. Many researchers have

found that herbivores could elicit multiple defense pathways, which may result in cross talk

among the pathways (Felton and Korth, 2000). Most of the research has focused on signaling

25

and rapidly-induced defenses in leaves (Jose, 2001). The main objective is to study the

interaction of JA and ET on systemic induced defense.

Objective 4: Transgenerational defense in tomato

Previous study showed that changes in the parental condition could affect the phenotype

of their offspring. For example, plants exposed to herbivory in the early season had 60% higher

relative fitness than undamaged controls (Agrawal 1999). Induced responses in wild radish

showed variation corresponding with different insect herbivores. In order to test whether tomato

plants have transgenerational defense insect feeding, I exposed micro-tom tomato plants to H.

zea and collected seeds to compare how the progeny of treated plants respond to insect feeding.

26

References

Adie B, Chico JM, Rubio-Somoza I, Solano R (2007) Modulation of plant defenses by ethylene.

Journal of Plant Growth Regulation 26: 160-177

Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores

and plant fitness. Ecology 80: 1713-1723

Alborn H, Turlings T, Jones T, Stenhagen G, Loughrin J, Tumlinson J (1997) An elicitor of plant

volatiles from beet armyworm oral secretion. Science 276: 945-949

Alborn HT, Hansen TV, Jones TH, Bennett DC, Tumlinson JH, Schmelz EA, Teal PEA (2007)

Disulfooxy fatty acids from the American bird grasshopper Schistocerca americana,

elicitors of plant volatiles. Proceedings of the National Academy of Sciences of the

United States of America 104: 12976-12981

Alborn HT, Jones TH, Stenhagen GS, Tumlinson JH (2000) Identification and synthesis of

volicitin and related components from beet armyworm oral secretions. J. Chem. Ecol. 26:

203-220

Amme S, Rutten T, Melzer M, Sonsmann G, Vissers JPC, Schlesier B, Mock HP (2005) A

proteome approach defines protective functions of tobacco leaf trichomes. Proteomics 5:

2508-2518

Arimura G-i, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.

Biophys. Acta (BBA) - Mol. Cell Biol. Lipids 1734: 91-111

Arimura G, Ozawa R, Horiuchi J, Nishioka T, Takabayashi J (2001) Plant-plant interactions

mediated by volatiles emitted from plants infested by spider mites. Biochemical

Systematics and Ecology 29: 1049-1061

Ashouri A, Michaud D, Cloutier C (2001) Unexpected effects of different potato resistance

factors to the Colorado potato beetle (Coleoptera : Chrysomelidae) on the potato aphid

(Homoptera : Aphididae). Environ. Entomol. 30: 524-532

Baldwin IT, Halitschke R, Kessler A, Schittko U (2001) Merging molecular and ecological

approaches in plant-insect interactions. Current Opinion in Plant Biology 4: 351-358

Baur R, Binder S, Benz G (1991) Nonglandular leaf trichomes as short-term inducible defense of

the grey alder, <i>Alnus incana</i> (L.), against the chrysomelid beetle, L.

Oecologia 87: 219-226

Beck M, Komis G, Ziemann A, Menzel D, Šamaj J (2011) Mitogen-activated protein kinase 4 is

involved in the regulation of mitotic and cytokinetic microtubule transitions in

Arabidopsis thaliana. New Phytologist 189: 1069-1083

Bede J, Musser R, Felton G, Korth K (2006) Caterpillar herbivory and salivary enzymes

decrease transcript Levels of Medicago truncatula genes encoding early enzymes in

terpenoid biosynthesis. Plant Mol Biol 60: 519-531

Ben-Israel I, Yu G, Austin MB, Bhuiyan N, Auldridge M, Nguyen T, Schauvinhold I, Noel JP,

Pichersky E, Fridman E (2009) Multiple biochemical and morphological factors underlie

the production of methylketones in tomato trichomes. Plant Physiology 151: 1952-1964

Berger D, Altmann T (2000) A subtilisin-like serine protease involved in the regulation of

stomatal density and distribution in Arabidopsis thaliana. Genes Dev. 14: 1119

Besser K, Harper A, Welsby N, Schauvinhold I, Slocombe S, Li Y, Dixon RA, Broun P (2009)

Divergent regulation of terpenoid metabolism in the trichomes of wild and cultivated

tomato species. Plant Physiol. 149: 499-514

Bhattarai KK, Li Q, Liu Y, Dinesh-Kumar SP, Kaloshian I (2007) The Mi-1-Mediated Pest

27

Resistance Requires Hsp90 and Sgt1. Plant Physiol. 144: 312-323

Bi JL, Murphy JB, Felton GW (1997) Does salicylic acid act as a signal in cotton for induced

resistance to Helicoverpa zea? J. Chem. Ecol. 23: 1805-1818

Boege K, Marquis RJ (2005) Facing herbivory as you grow up: the ontogeny of resistance in

plants. Trends in Ecology & Evolution 20: 441-448

Bonaventure G, VanDoorn A, Baldwin IT (2011) Herbivore-associated elicitors: FAC signaling

and metabolism. Trends in Plant Science 16: 294-299

Bos JIB, Prince D, Pitino M, Maffei ME, Win J, Hogenhout SA (2010) A functional genomics

approach identifies candidate effectors from the aphid species Myzus persicae (green

peach aphid). Plos Genetics 6

Bostock RM, Karban R, Thaler JS, Weyman PD, Gilchrist D (2001) Signal interactions in

induced resistance to pathogens and insect herbivores. European Journal of Plant

Pathology 107: 103-111

Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased

densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol. 31:

2211-2216

Carroll MJ, Schmelz EA, Meagher RL, Teal PEA (2006) Attraction of Spodoptera frugiperda

larvae to volatiles from herbivore-damaged maize seedlings. J. Chem. Ecol. 32: 1911-

1924

Casteel CL, Ranger CM, Backus EA, Ellersieck MR, Johnson DW (2006) Influence of plant

ontogeny and abiotic factors on resistance of glandular-haired alfalfa to potato leafhopper

(Hemiptera: Cicadellidae). J Econ Entomol 99: 537-543

Chang L, Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410: 37-40

Chen H, McCaig BC, Melotto M, He SY, Howe GA (2004a) Regulation of plant arginase

by wounding, jasmonate, and the phytotoxin coronatine. J Biol Chem 279: 45998-46007

Chen M-S, Liu X, Yang Z, Zhao H, Shukle R, Stuart J, Hulbert S (2010) Unusual conservation

among genes encoding small secreted salivary gland proteins from a gall midge. BMC

Evolutionary Biology 10: 296

Chen M, Fellers J, Stuart J, Reese J, Liu X (2004b) A group of related cDNAs encoding secreted

proteins from Hessian fly [Mayetiola destructor (Say)] salivary glands. Insect Mol Biol

13: 101 - 108

Chini A, Boter M, Solano R (2009) Plant oxylipins: COI1/JAZs/MYC2 as the core jasmonic

acid-signalling module. FEBS J 276: 4682-4692

Chini A, Fonseca S, Fernandez G, Adie B, Chico JM, Lorenzo O, Garcia-Casado G, Lopez-

Vidriero I, Lozano FM, Ponce MR, Micol JL, Solano R (2007) The JAZ family of

repressors is the missing link in jasmonate signalling. Nature 448: 666-671

Cole AB, Kiraly L, Lane LC, Wiggins BE, Ross K, Schoelz JE (2004) Temporal expression of

PR-1 and enhanced mature plant resistance to virus infection is controlled by a single

dominant gene in a new Nicotiana hybrid. Mol Plant Microbe Interact 17: 976-985

Constabel CP, Bergey DR, Ryan CA (1995) Systemin activates synthesis of wound-inducible

tomato leaf polyphenol oxidase via the octadecanoid defense signaling pathway. Proc

Natl Acad Sci U S A 92: 407-411

Creelman RA, Mullet JE (1995) Jasmonic acid distribution and action in plants: regulation

during development and response to biotic and abiotic stress. Proc Natl Acad Sci U S A

92: 4114-4119

Dalin P, Ågren J, Björkman C, Huttunen P, Kärkkäinen K (2008) Leaf trichome formation and

28

plant resistance to herbivory. In: Schaller A (ed) Induced Plant Resistance to Herbivory,

pp 89-105

Dalin P, Björkman C (2003) Adult beetle grazing induces willow trichome defence against

subsequent larval feeding. Oecologia 134: 112-118

Dangl JL, Jones JDG (2001) Plant pathogens and integrated defence responses to infection.

Nature 411: 826-833

De Moraes CM, Lewis WJ, Pare PW, Alborn HT, Tumlinson JH (1998) Herbivore-infested

plants selectively attract parasitoids. Nature 393: 570-573

de Vos M, Cheng WY, Summers HE, Raguso RA, Jander G (2010) Alarm pheromone

habituation in Myzus persicae has fitness consequences and causes extensive gene

expression changes. Proceedings of the National Academy of Sciences 107: 14673-14678

De Vos MM, Van Oosten VRVR, Van Poecke RMRMP, Van Pelt JAJA, Pozo MJMJ, Mueller

MJMJ, Buchala AJAJ, Métraux JPJ-P, Van Loon LLC, Dicke MM, Pieterse CMCMJ

(2005) Signal signature and transcriptome changes of Arabidopsis during pathogen and

insect attack. Molecular Plant-Microbe Interactions 18: 923-937

Delphia CM, Mescher MC, Felton G, De Moraes CM (2006) The role of insect-derived cues in

eliciting indirect plant defenses in tobacco, Nicotiana tabacum. Plant Signaling and

Behavior 1: 243-250

Dicke M, Dijkman H (2001) Within-plant circulation of systemic elicitor of induced defence and

release from roots of elicitor that affects neighbouring plants. Biochemical Systematics

and Ecology 29: 1075-1087

Doares SH, Narvaez-Vasquez J, Conconi A, Ryan CA (1995) Salicylic acid inhibits synthesis of

proteinase inhibitors in tomato leaves induced by systemin and jasmonic acid. Plant

Physiology 108: 1741-1746

Dogimont C, Bendahmane A, Chovelon V BN (2010) Host plant resistance to aphids in

cultivated crops: genetic and molecular bases, and interactions with aphid populations. C

R Biol 333: 566-573

Eichenseer H, Mathews MC, Bi JL, Murphy JB, Felton GW (1999) Salivary glucose oxidase:

multifunctional roles for Helicoverpa zea? Arch. Insect Biochem. Physiol. 42: 99-109

Farmer EE, Ryan CA (1992) Octadecanoid precursors of jasmonic acid activate the synthesis of

wound-inducible proteinase inhibitors. Plant Cell 4: 129-134

Felton GW, Eichenseer H (1999) Herbivore saliva and its effects on plant defense against

herbivores and pathogens. In: Agrawal AA, Tuzun S, Bent E (eds) Induced Plant

Defenses Against Pathogens and Herbivores. APS Press, St. Paul, MN, pp 19-36

Felton GW, Tumlinson JH (2008) Plant-insect dialogs: complex interactions at the plant-insect

interface. Current Opinion in Plant Biology 11: 457-463

Gang DR, Wang J, Dudareva N, Nam KH, Simon JE, Lewinsohn E, Pichersky E (2001) An

investigation of the storage and biosynthesis of phenylpropenes in sweet basil. Plant

Physiol. 125: 539-555

Gfeller A, Liechti R, Farmer EE (2006) Arabidopsis Jasmonate Signaling Pathway. Sci. STKE:

stke.3222006cm3222001

Glombitza S, Dubuis PH, Thulke O, Welzl G, Bovet L, Gotz M, Affenzeller M, Geist B, Hehn

A, Asnaghi C, Ernst D, Seidlitz HK, Gundlach H, Mayer KF, Martinoia E, Werck-

Reichhart D, Mauch F, Schaffner AR (2004) Crosstalk and differential response to abiotic and

biotic stressors reflected at the transcriptional level of effector genes from secondary

metabolism. Plant Mol Biol 54: 817-835

29

Green TR, Ryan CA (1972) Wound-induced proteinase inhibitor in plant leaves: a possible

defense mechanism against insects. Science 175: 776-777

Halitschke R, Schittko U, Pohnert G, Boland W, Baldwin IT (2001) Molecular interactions

between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural

host Nicotiana attenuata. III. Fatty acid-amino acid conjugates in herbivore oral

secretions are necessary and sufficient for herbivore-specific plant responses. Plant

Physiol. 125: 711-717

Heil M, Kost C (2006) Priming of indirect defences. Ecology Letters 9: 813-817

Heinrich M, Baldwin IT, Wu J (2011) Two mitogen-activated protein kinase kinases, MKK1 and

MEK2, are involved in wounding- and specialist lepidopteran herbivore Manduca sexta-

induced responses in Nicotiana attenuata. . Journal of Experimental Botany 62: 4355-

4365.

Hilker M, Meiners T (2002) Induction of plant responses to oviposition and feeding by

herbivorous arthropods: a comparison. Entomologia Experimentalis et Applicata 104:

181-192

Hogenhout SA, Van der Hoorn RAL, Terauchi R, Kamoun S (2009) Emerging concepts in

effector biology of plant-associated organisms. Molecular Plant-Microbe Interactions 22:

115-122

Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant

Biology 59: 41-66

Steffens DW (1991) Biochemical aspects of glandular trichome-mediated insect resistance in

the Solanaceae. Naturally Occuring Pest Bioregulators. A.C.S. symposium series 449

Kachroo P, Venugopal SC, Navarre DA, Lapchyk L, Kachroo A (2005) Role of Salicylic Acid

and Fatty Acid Desaturation Pathways in ssi2-Mediated Signaling. Plant Physiol.:

pp.105.071662

Kahl J, Siemens DH, Aerts RJ, Gäbler R, Kühnemann F, Preston CA, Baldwin IT (2000)

Herbivore-induced ethylene suppresses a direct defense but not a putative indirect

defense against an adapted herbivore. Planta 210: 336-342

Kang J-H, Liu G, Shi F, Jones AD, Beaudry RM, Howe GA (2010a) The Tomato odorless-2

Mutant Is Defective in Trichome-Based Production of Diverse Specialized Metabolites

and Broad-Spectrum Resistance to Insect Herbivores. Plant Physiol.: pp.110.160192

Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010b) Distortion of trichome morphology

by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental

Botany 61: 1053-1064

Karban R, Maron J, Felton GW, Ervin G, Eichenseer H (2003) Herbivore damage to sagebrush

induces resistance in wild tobacco: evidence for eavesdropping between plants. Oikos

100: 325-332

Kennedy GG, Farrar RR, Kashyap RK (1991) 2-Tridecanone Glandular Trichome-Mediated

Insect Resistance in Tomato - Effect on Parasitoids and Predators of Heliothis-Zea. Acs

Symposium Series 449: 150-165

Kessler A, Baldwin IT (2001) Defensive Function of Herbivore-Induced Plant Volatile

Emissions in Nature. Science 291: 2141-2144

Klessig DF, Durner J, Noad R, Navarre DA, Wendehenne D, Kumar D, Zhou JM, Shah J, Zhang

S, Kachroo P, Trifa Y, Pontier D, Lam E, Silva H (2000) Nitric oxide and salicylic acid

signaling in plant defense. Proceedings of the National Academy of Sciences 97: 8849-

8855

30

Levin D (1973) The role of trichomes in plant defense. Q. Rev. Biol 48: 3-15

Liu X, Williams CE, Nemacheck JA, Wang H, Subramanyam S, Zheng C, Chen M-S (2010)

Reactive Oxygen Species Are Involved in Plant Defense against a Gall Midge. Plant

Physiology 152: 985-999

Luckwill LC (1943) The genus Lycopersicon: A historical, biological and taxonomic survey of

the wild and cultivated tomato. Aberd. Univ. Stud. 120: 1-44

Ludwig AA, Saitoh H, Felix G, Freymark G, Miersch O, Wasternack C, Boller T, Jones JDG,

Romeis T (2005) Ethylene-mediated cross-talk between calcium-dependent protein

kinase and MAPK signaling controls stress responses in plants. PNAS 102: 10736-10741

Maffei ME, Mithofer A, Arimura G-I, Uchtenhagen H, Bossi S, Bertea CM, Cucuzza LS,

Novero M, Volpe V, Quadro S, Boland W (2006) Effects of Feeding Spodoptera littoralis

on Lima Bean Leaves. III. Membrane Depolarization and Involvement of Hydrogen

Peroxide. Plant Physiol. 140: 1022-1035

Maffei ME, Mithöfer A, Boland W (2007) Insects feeding on plants: Rapid signals and responses

preceding the induction of phytochemical release. Phytochemistry 68: 2946-2959

Marks MD, Wenger JP, Gilding E, Jilk R, Dixon RA (2009) Transcriptome analysis of

Arabidopsis wild-type and gl3-sst sim trichomes identifies four additional genes required

for trichome development. Mol Plant 2: 803-822

Mattiacci L, Dicke M, Posthumus MA (1995) -Glucosidase: an elicitor of herbivore-induced

plant odor that attracts host-searching parasitic wasps. Proc. Nat. Acad. Sci. USA 92:

2036-2040

McConn M, Creelman RA, Bell E, Mullet JE, Browse J (1997) Jasmonate is essential for insect

defense Arabidopsis. Proc Natl Acad Sci USA 94: 5473-5477

Mirnezhad M, Romero-Gonzalez RR, Leiss KA, Choi YH, Verpoorte R, Klinkhamer PGL

(2010) Metabolomic Analysis of Host Plant Resistance to Thrips in Wild and Cultivated

Tomatoes. Phytochemical Analysis 21: 110-117

Mumm R, Schrank K, Wegener R, Schulz S, Hilker M (2003) Chemical analysis of volatiles

emitted by Pinus sylvestris after induction by insect oviposition. J. Chem. Ecol. 29: 1235-

1252

Musser R, Hum-Musser S, Eichenseer H, Peiffer M, Ervin G, Murphy J, Felton G (2002)

Herbivory: Caterpillar saliva beats plant defences. Nature 416: 599 - 600

Musser RO (2005) Insect saliva: an integrative approach. Arch Insect Biochem Physiol 58: 53

Nagata T, Todoriki S, Hayashi T, Shibata Y, Mori M, Kanegae H, Kikuchi S (1999) γ-

Radiation Induces Leaf Trichome Formation in Arabidopsis. Plant Physiology 120: 113-

120

O'Donnell PJ, Schmelz E, Block A, Miersch O, Wasternack C, Jones JB, Klee HJ (2003)

Multiple hormones act sequentially to mediate a susceptible tomato pathogen defense

response. Plant Physiol 133: 1181-1189

Odonnell PJ, Calvert C, Atzorn R, Wasternack C, Leyser HMO, Bowles DJ (1996) Ethylene as a

signal mediating the wound response of tomato plants. Science 274: 1914-1917

Pearce G, Moura DS, Stratmann J, Ryan CA (2001) Production of multiple plant hormones from

a single polyprotein precursor. Nature 411: 817-820

Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary

glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113

Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as

sensors for insect herbivores. New Phytologist 184: 644-656

31

Pieterse CMJ, Dicke M (2007) Plant interactions with microbes and insects: from molecular

mechanisms to ecology. Trends in Plant Science 12: 564-569

Pohnert G, Koch T, Boland W (1999) Synthesis of volicitin: a novel three-component Wittig

approach to chiral 17-hydroxylinolenic acid. Chemical Communications: 1087-1088

Preston CA, Laue G, Baldwin IT (2001) Methyl jasmonate is blowing in the wind, but can it act

as a plant-plant airborne signal? Biochemical Systematics and Ecology 29: 1007-1023

Ryan CA (1974) Assay and biochemical properties of the proteinase inhibitor inducing factor, a

wound hormone. Plant Physiol. 54: 328

Sarria E, Palomares-Rius FJ, Lopez-Sese AI, Heredia A, Gomez-Guillamon ML (2010) Role of

leaf glandular trichomes of melon plants in deterrence of Aphis gossypii Glover. Plant

Biol (Stuttg) 12: 503-511

Schilmiller A, Shi F, Kim J, Charbonneau AL, Holmes D, Jones AD, Last RL (2010) Mass

spectrometry screening reveals widespread diversity in trichome specialized metabolites

of tomato chromosomal substitution lines. Plant Journal 62: 391-403

Schmelz E, Alborn H, Engelberth J, Tumlinson J (2003a) Nitrogen deficiency increases

volicitin-induced volatile emission, jasmonic acid accumulation, and ethylene sensitivity

in maize. Plant Physiology 133: 295

Schmelz EA, Alborn HT, Tumlinson JH (2003b) Synergistic interactions between volicitin,

jasmonic acid and ethylene mediate insect-induced volatile emission in Zea mays.

Physiologia Plantarum 117: 403-412

Schmelz EA, Carroll MJ, LeClere S, Phipps SM, Meredith J, Chourey PS, Alborn HT, Teal PEA

(2006) Fragments of ATP synthase mediate plant perception of insect attack. Proc Natl

Acad Sci USA 103: 8894-8899

Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H, Tumlinson JH,

3rd (2003c) Simultaneous analysis of phytohormones, phytotoxins, and volatile organic

compounds in plants. Proc Natl Acad Sci U S A 100: 10552-10557

Shoji T, Ogawa T, Hashimoto T (2008) Jasmonate-Induced Nicotine Formation in Tobacco is

Mediated by Tobacco COI1 and JAZ Genes. Plant Cell Physiol. 49: 1003-1012

Spiteller D, Boland W (2003) N-(15,16-Dihydroxylinoleoyl)-glutamine and N-(15,16-

epoxylinoleoyl)-glutamine isolated from oral secretions of lepidopteran larvae.

Tetrahedron 59: 135-139

Steppuhn A, Baldwin IT (2008) Induced defenses and the cost-benefit paradigm. In: Schaller A

(ed) Induced Plant Resistance to Herbivory, pp 61-83

Stout M-J, Workman K-V, Duffey S-S (1996) Identity, spatial distribution, and variability of

induced chemical responses in tomato plants. Entomologia Experimentalis et Applicata

79(3): 255-271

Thaler J-S (2002) Effect of jasmonate-induced plant responses on the natural enemies of

herbivores. Journal of Animal Ecology

Thaler JS, Stout MJ, Karban R, Duffey SS (2001) Jasmonate-mediated induced plant resistance

affects a community of herbivores. Ecol Entomol 26: 312-324

Traw MB, Bergelson J (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin

on induction of trichomes in Arabidopsis. Plant Physiology 133: 1367-1375

Traw MB, Dawson TE (2002) Differential induction of trichomes by three herbivores of black

mustard. Oecologia 131: 526-532

Truitt CL, Pare PW (2004) In situ translocation of volicitin by beet armyworm larvae to maize

and systemic immobility of the herbivore elicitor in planta. Planta 218: 999-1007

32

Truitt CL, Wei H-X, Pare PW (2004) A plasma membrane protein from Zea mays binds with the

herbivore elicitor volicitin. Plant Cell 16: 523-532

Van der Ent S, Van Wees SCM, Pieterse CMJ (2009) Jasmonate signaling in plant interactions

with resistance-inducing beneficial microbes. Phytochemistry 70: 1581-1588

Vandenborre G, Groten K, Smagghe G, Lannoo N, Baldwin IT, Van Damme EJM (2010)

Nicotiana tabacum agglutinin is active against Lepidopteran pest insects. Journal of

Experimental Botany 61: 1003-1014

Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant Immunity: It’s the Hormones Talking,

But What Do They Say? Plant Physiology 154: 536-540

Voelckel C, Baldwin IT (2004) Herbivore-induced plant vaccination. Part II. Array-studies

reveal the transience of herbivore-specific transcriptional imprints and a distinct imprint

from stress combinations. Plant Journal 38: 650-663

Voirin B, C.Bayet, M.Coulso (1993) Demonstration that flavone aglycones accumulate in the

peltate glands of Mentha × piperita leaves. Phytochemistry 34: 85-87

Wagner GJ (1991) Secreting glandular trichomes - more than just hairs. Plant Physiology 96:

675-679

Walling L (2009) Adaptive defense responses to pathogens and insects. Advances in Botanical

Research 51: 551-612

Walling LL (2000) The Myriad Plant Responses to Herbivores. Journal of Plant Growth

Regulation 19: 195-216.

Wang B, Wang Y, Wang Q, Luo G, Zhang Z, He C, He SJ, Zhang J, Gai J, Chen S (2004)

Characterization of an NBS-LRR resistance gene homologue from soybean. J Plant

Physiol 161: 815-822

Wasternack C, Stenzel I, Hause B, Hause G, Kutter C, Maucher H, Neumerkel J, Feussner I,

Miersch O (2006) The wound response in tomato - role of jasmonic acid. Journal of Plant

Physiology 163: 297-306

Weber H, Chetelat A, Reymond P, Farmer EE (2004) Selective and powerful stress gene

expression in Arabidopsis in response to malondialdehyde. The Plant Journal 37: 877-888

Will T, van Bel AJE (2006) Physical and chemical interactions between aphids and

plants. Journal of Experimental Botany 57: 729-737

Wu J, Baldwin IT (2010) New Insights into Plant Responses to the Attack from Insect

Herbivores. Annual Review of Genetics 44: 1-24

Wu J, Hettenhausen C, Meldau S, Baldwin IT (2007) Herbivory rapidly activates MAPK

aignaling in attacked and unattacked leaf regions but not between leaves of Nicotiana

attenuata. Plant Cell 19: 1096-1122

Yoshinaga N, Aboshi T, Ishikawa C, Fukui M, Shimoda M, Nishida R, Lait CG, Tumlinson JH,

Mori N (2007) Fatty acid amides, previously identified in caterpillars, found in the

cricket Teleogryllus taiwanemma and fruit fly Drosophila melanogaster larvae. J. Chem.

Ecol. 33: 1376-1381

Zhang Y, Xu S, Ding P, Wang D, Cheng YT, He J, Gao M, Xu F, Li Y, Zhu Z, Li X, Zhang Y

(2010) Control of salicylic acid synthesis and systemic acquired resistance by two

members of a plant-specific family of transcription factors. Proceedings of the National

Academy of Sciences 107: 18220-18225

33

Chapter II

Salivary glucose oxidase from caterpillars mediates the induction of rapid and

delayed-induced defenses in the tomato plant

Tian, D1, Peiffer, M.

1, Shoemaker, E

1, Tooker, J.

1, Haubruge, E.

2, Francis, F.

2, Luthe, D.S.

3 and

Felton, G.W.1

1Department of Entomology

Center for Chemical Ecology

Penn State University

University Park, PA 16802, USA

2Functional and Evolutionary Entomology

Gembloux Agro-Bio Tech

University of Liege, Liege, Belgium

3Department of Crop and Soil Science

Center for Chemical Ecology

Penn State University

University Park, PA 16802, USA

Correspondence: G.W. Felton

e-mail: gwf10@psu.edu

Tian D, Peiffer M and Felton GW (2012) Herbivore Effector Triggered Immunity? Salivary Glucose

Oxidase Mediates the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant. Plos one

April 2012 | Volume 7 | Issue 4 | e36168

34

Abstract

When Helicoverpa zea (H. zea) feeds on plants, the oral secretions inevitably comes in

contact with wounded plant tissue and play very important role in regulating plant defense. The

proteomic analysis showed glucose oxidase (GOX) is the main protein in H. zea saliva. Saliva

collected from spinneret had higher GOX activity, while the regurgitant showed no GOX

activity. Mechanical ablated spinneret could stop saliva release which is confirmed by

immunodetection method with anti-GOX. Intact insect fed significantly induce proteinase

inhibitor (PIN2) gene expression and trichome number on the newly growth leaves compared to

the ablated fed. Mechanical wounded with saliva or fungal GOX treatment at different growth

stages, showed different induction. Both GOX and saliva induce leaf and green fruit PIN2 gene

expression, while the flower and red fruit didn’t show any induction compare to non-treatment.

GOX and saliva treatment also induce the newly growth leaf trichome number. Experimentally

remove trichome significantly increase the leaf damage and insect growth. These findings

showed that H. zea saliva play important role in tomato defense, including induces defense gene

expression and increase trichome density on newly growth leaves which affect insect growth.

Key words: Helicoverpa zea, Saliva, Glucose oxidase, Solanum lycopersicum, Induced defense,

trichome

35

Introduction

Emerging evidence indicates that when herbivores initiate feeding on a host plant, they

not only mechanical damage plants, but also present “cues” that the plant perceives and uses to

rapidly mobilize induced defenses in response to attack (Fatouros et al. 2008; Maffei et al. 2006;

Mithofer et al. 2005; Musser et al. 2002; Peiffer et al. 2009; Tooker et al. 2010). Over the years

evidence has accumulated that insect derived a cocktail of chemicals during feeding which

modulate plant defenses (Felton and Tumlinson 2008; Mattiacci et al. 1995; Musser 2005;

Schmelz et al. 2007). These include fatty acid-amino acid conjugates (FACs) identified in

various lepidopteran larvae (Alborn et al. 1997; Spiteller et al. 2000), β-glucosidase from larvae

of white cabbage butterfly (Pieris brassicae)(Mattiacci et al. 1995), inceptins isolated from fall

armyworm (Spodoptera frugiperda) larvae and caeliferins identified from grasshopper species

(Schistocerca americana) (Alborn et al. 2007). Glucose oxidase (GOX) was first characterized a

salivary enzyme from Helicoverpa zea (H. zea) (Musser et al. 2002). Although already identified

some chemicals from specific species of insects, our understanding of the chemistry of these

secretions is still very much in its infancy. Identification more chemicals in the oral secretions

will be better to study the oral secretions function.

To investigate oral secretion specific function, researchers have applied larval oral

secretions or regurgitant to mechanical wounds or directly mechanically stop secretions. Several

studies demonstrated that application of insect oral secretion to artificial wounds can mimic most

plant responses to herbivory (Maffei et al. 2004; Musser et al. 2006). For example, β-glucosidase

from Pieris brassicae induces the release of a volatile blend when applied to wounded cabbage

leaves, causing the attraction of the parasitoid Cotesia glomerata (Mattiacci et al. 1995). Fatty

acid–amino acid conjugates (FACs) are produced by many lepidopteran caterpillars and induce

36

direct and indirect defense responses in plants (Alborn et al. 1997; Roda et al. 2004). In general,

these insect oral secretions are important effectors which act as elicitor or suppressor in

mediating of indirect or direct defense (Consales et al. 2011; Delphia et al. 2006; Felton and

Eichenseer 1999; Musser et al. 2005; Weech et al. 2008a; Will et al. 2007).

Plants defensively respond to insect herbivory by both general and specific induced

defense has been documented in a voluminous literature (Kaloshian and Walling 2005; Walling

2000). Among the strategies, the synthesis of secondary metabolites in plants is the powerful

chemical weapon and function similar as toxins to inhibit herbivore's nutrition and growth

(Bergey et al. 1999; Chao et al. 1999; Hui et al. 2003). Besides chemicals weapon plants also

could attract the predators and parasitoids of herbivore through release of volatile organic

compounds (VOCs) (Arimura et al. 2005). The more extensive research found that the plant

induce defense were regulated by plant hormones (Berger and Altmann 2000; Steppuhn and

Baldwin 2008), such as Jasmonic acid (JA) which is rapidly synthesize from fatty acid precursor

following herbivore attack and play a key role in induction of plant defense to chewing

herbivore. The cascade of proteins include proteins such as proteinase inhibitors (Diez-Diaz et al.

2004; Thipyapong et al. 2007); polyphenol oxidases (Constabel et al. 1995; Felton et al. 1989;

Felton et al. 1992); ascorbate oxidase (Felton and Summers 1993); leucine aminopeptidase

(Pautot et al. 1993); arginase and threonine deaminase (Lin et al. 2008) which are regulated by

the octadecanoid pathway (Farmer 2007; Howe et al. 1996; Victoriano and Gregório 2002). In

addition to these proteins, the role of glandular trichomes in resistance of insect feeding has

recently been more thoroughly explored by Gurr & McGrath (2002). Glandular trichomes in

tomato are a formidable defense against some herbivores by secreting sticky, noxious

compounds that affect insect growth (Kang et al. 2010a; Kang et al. 2010b). The production of

37

these trichomes is induced by insect feeding or application of methyl jasmonate (Agrawal 1999;

Boughton et al. 2005).

Every plant has different development growth stage during life. The production of

defense response insect herbivore may be different. The induced plant defense has been mainly

focused on studied in leaves since the biosynthesis of defense compounds is thought to be energy

and nutrient demanding (Karban et al. 2000). Defense on fruits, despite being the preferred

feeding site of a number of caterpillar pests such as H. zea, has been largely ignored. Only a few

study investigate the induce defense in plant reproductive tissues (McCall and Karban 2006;

Wang et al. 2009). Because tomato fruit is the main target for food production, it is imperative to

better understand the response of fruits to herbivory.

Because of the complexity of plant signaling networks, there are multiple points at which

caterpillar secretions may intercept or amplify signaling components. For example, the chewing

herbivores use mandibles and maxillae for chewing and processing the food. By way of

background, their secretions may arise from regurgitant derived from the digestive system

(Peiffer and Felton 2009) or from saliva produced by the salivary glands (Felton 2008a). The

previous study showed that glucose oxidase from the labial glands may suppress wound-induced

accumulation of nicotine in tobacco (Musser et al. 2002). Regurgitant is known to contain scores

of proteins (Liu et al. 2004), as well as fatty acid-glutamine conjugates such as volicitin, which

elicit the production of plant volatiles—important components of indirect defense and plant-plant

signaling (Engelberth et al. 2004; Mori et al. 2001). We initiated this investigation in tomato to

examine the role of saliva in mediating tomato defense at different growth stages. This study

provided evidence of saliva as effectors in induced plant defenses at different growth stages. The

38

micro-tom tomato is the best for us to study the defense at different growth stage because of its

short generation time (ca. 55days), diminutive size and known JA signaling pathway.

Material and Methods

Plants and insects

The tomato (Solanum lycopersicum, cv. Better boy and Micro-Tom) were grown as

described (Peiffer and Felton, 2005) and used at different growth stage. For all induction

experiments, plants were maintained in greenhouse under 800W Super Spectrum lights (Sunlight

Supply Co., Vancouver, WA). Tomato fruit worm (H. zea) eggs were purchased from BioServ

(Frenchtown, NJ) and reared on a wheat germ and casein-based artificial diet (Bansal et al. 2011)

with ingredients from Bioserv in the Entomology Department, Penn State University (University

Park PA, USA).

Collection of H. zea saliva and regurgitant

To collect H. zea saliva, 5th

instar larva were chilled on ice. Flaccid larva were then

immobilized in a metal hair clip and observed with a dissecting microscope. As the larva

returned to room temperature, the saliva was collected from spinneret secretions in glycerol with

gel loading pipette tip (VWR, West Chester, PA) and pooled 10 caterpillar collection as one

sample dispensing them into micro-centrifuge tube on ice. Regurgitant was collected from these

larvae by gently squeezing the caterpillars, collecting the oral secretions using pipette and

dispensing them into a micro-centrifuge tube on ice. All the collections were stored at –80º C

until use.

Proteomics of H. zea Saliva

39

For proteomic identification of saliva proteins, saliva was collected as described above,

except 5mM EDTA in 50 mM Tris-HCl, pH 8.0 was used in place of glycerol. Saliva was

collected from 100 H. zea larva into 30 µl of buffer and stored at -80 C. NanoLC was carried out

using a Dionex Ultimate 3000 (Milford, MA). Mobile phase solvents A and B were 0.1% TFA

(v/v) in water and 0.1% TFA (v/v) in 80% Acetonitrile respectively. Tryptic peptides were

fractionated at a flow rate of 0.6 µl/min using linear gradients and the following program: 5% B

for 5min, 5 to 15% B over 5min, 15 to 60% B over 40 min, 60 to 95% B over 1 min and hold for

5 min. The mobile phase was ramped back to the initial conditions. Fractions were collected at

20-seconds intervals followed by Mass Spectrometry analysis on Applied Biosystems proteomics

Analyzer. Peptides were searched against an insect database.

Glucose oxidase (GOX) activity assay and visualize on leaf

The GOX activity was determined according to the method described by Eichenseer et al.

(1999). The glucose (0.1mM) and o-dianisidine (2.1M) were use as reaction cocktail with the

sample and measure spectrophotometric at 460mm. The regurgitant was used directly after

centrifuge. Because small volume of saliva, it was combined with 30μl PBS buffer for GOX

activity assay. To compare whether ablated and insect fed affect GOX on leaf surface, tissue

printing experiments were followed Peiffer and Felton description (2005). Ablated and intact six-

instar larvae were fed overnight on detached tomato leaf. Then after transfer to nitrocellulose and

superblock, and incubated with anti-GOX, detected with vector ABC Elite and Vector DAB kit.

Insect feeding induce defense

Fifth-instar H. zea larvae were ablated using previous described method (Peiffer, 2005).

The caterpillars were chilled on ice until flaccid and then the spinneret was cauterized by

toughing with a heat pen (Electron Microscopy Sciences, Fort Washington, PA). The ablated

40

larva was allowed to recover and feed on artificial diet for 7 hrs, then starved overnight ready for

experiments. At 4th

node stage, the ablated and intact larvae were caged individually on the

fourth leaf with 6 hour feeding and then removed caterpillar and cages, empty caged plants were

use as control. After 24 hours and 48hrs caterpillar feeding, 100mg caged leaf was harvest in

liquid nitrogen and stored at -80 ° C for later RNA extraction.

Wounding induce defense on different tissues

To investigate the saliva function in regulating tomato defense, the collected saliva was

directly applied to the wounded site. Better boy and Micro-Tom seedlings were both treated to

compare different varieties response saliva treatment. The regurgitant was applied on leaf to

study its function on tomato. To test how saliva directly induce tomato defense on different

growth stages. We wounded tomato on different tissue by punching two ¼ inch diameter hole

along the mid-vein of the terminal leaflet of the 4th

leaf. Fruits were wounded by punching one

hole at the side of the fruits. Green fruit is two weeks after flowering. Red fruit is at the

beginning turning red. Flower treatment I wound at the pedicel. After wounding, we

immediately pipette 20 l of PBS buffer, H. zea saliva or fungal GOX (20ng/µl) onto the edges

of wounded site. Control plants were unwounded leaf, flower or fruit. After treatment 24 and 48

hours, 100mg plant tissues were harvest for RNA extraction and gene expression assay.

Trichome induction and function

To learn how H. zea feeding and oral secretions affect glandular trichome induction, two

methods were used to treat the plants. One treatment is ablated and intact H. zea in caged plants

feeding 6 hours then remove the cage. The other is direct wounding with saliva or fungal GOX

treatment. Each treatment replicated on 10 plants. Tomato plants were maintained in the

41

greenhouse for two weeks after wounding and secretion application, two leaf discs beside the

main vein were sampled and counted as previously described (Boughton et al. 2005).

To test the function of trichome, we mechanically removed trichome by gently touching

and rubbing with hands along the mid-vein of the leaves. In petri-dish we let 3rd

instar larvae

feeding for 24 hours and measure the damage by scanning the leaf and analysis with Sigma Scan.

And also in the small cup we use 1st instar larvae for 5 days bioassay to measure the larvae

weight.

Quantitative Real Time PCR

Tissue (100 mg), harvested from the area around the wound, was homogenized in liquid nitrogen

and total RNA extracted with RNeasy Plus Mini-kit (Qiagen, Valencia, CA). 1g purified RNA

was used with High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City,

CA) to create cDNA. Real-time PCR primers were designed using Primer Quest Software

(Applied Biosystems) (Table 1). All reactions used Power SYBR Green PCR Master Mix and

were run on a 7500 Fast Real-Time PCR System (Applied Biosystems).

The housekeeping gene ubiquitin (Rotenberg et al. 2006) was used to normalize C(T) values.

Relative quantifications, with unwounded plants as the reference group, were then calculated

using the 2-C(T)

method (Livak and Schmittgen 2001). To validate this analysis method,

primer efficiency was analyzed by comparing the normalized C(T) values of 5 serial dilutions of

cDNA. The primers used were list in Table 1. For statistical analysis, relative expression values

were analyzed by ANOVA with MiniTab (Minitab Inc., State College, PA) using Fisher’s

separation of means (P<0.05).

42

Results

GOX activity determination and detection

On the average we can collect about 5 µl of regurgitant and about 0.5 nl of saliva from

each caterpillar. Although the volume is small, regurgitant contains about 0.12µg/µl protein in

the collections, and 10 caterpillar saliva collections contain approximately 560 ng proteins, as

measured by a modified Bradford assay (Vincent and Nadeau, 1983). GOX activity assay

showed regurgitant was no GOX activity, while saliva had high activity around 1.8 mol/min/mg

proteins (Table 1).

To verify the ablation procedure successfully prevented release of saliva, we performed a

tissue blot of leaves fed on by the treated caterpillars (Peiffer and Felton, 2005). Anti-GOX was

used to detect GOX on leaf after H. zea overnight fed, there was significantly different between

the ablated and intact fed on leaf. Most of the GOX were spread on the leaf with intact fed, while

no GOX were detected on the leaf after ablated caterpillar fed. This confirmed that saliva was

released from the caterpillar spinneret at the same time when insect feeding.

The collected saliva was sent to company for shotgun proteomic analysis of secreted

salivary proteins from H. zea to identify potential candidates for plant defense elicitation. The

number of mass spectral counts obtained for each protein provides a quantitative measure of

protein abundance (Old et al. 2005). Of the 33 proteins that were identified, glucose oxidase

(GOX) was by far the most abundant protein accounting for 34% of the identified proteins

(Table 3 and Figure 2). Carboxylesterase, ecdysone oxidase, and fructosidase were the next

most abundant proteins.

H. zea feeding induces tomato defense

43

The previous study showed the H. zea fed on tobacco significantly reduce tobacco

defense by decrease the nicotine synthesis (Musser et al. 2002). To know how H. zea feeding

affect tomato defense, we caged the H. zea on tomato leaf and compare the tomato defense by

gene expression assay. Proteinase inhibitors 2 (PIN2) was chosen as a defense marker gene

because it has been well characterized as a defense in tomato (Ryan 1990). The results showed

H. zea feeding significantly induced PIN2 expression in tomato leaves (Figure 3); after 24 h

feeding, the PIN2 expression was significantly higher than untreated control plants (ANOVA, F

(24hour)=17.46, P=0.03), however, there was no significant difference in PIN2 expression induced

between damage caused by caterpillars whose spinneret was intact and individuals with ablated

spinnerets, which renders them unable to release saliva (Musser et al. 2002). But after 48 h,

feeding by intact caterpillars significantly induced greater PIN2 expression than feeding by

ablated caterpillars (F(48hour)= 36.25, P<0.01). H. zea fed significantly induced PIN2 expression

on tomato leaf (figure 3a.).

To determine if saliva is affecting the genes in signaling pathways in the tomato plant, we

also check quantify the gene expression after 24 hours insect feeding. The results showed that

leaves fed by H. zea had significantly higher expression of PPO compared to untreated controls,

and also the intact fed significantly induced PPO expression than the ablated fed leaves (figure

3b). While the “early responding” signaling genes AOS, LOX and ARG associated with the

octadecanoid pathway after 24hours insect fed were not significantly induced by insect feeding,

since these gene are JA biosynthesis gene and responding at every early stages (figure3b).

Caterpillar secretions affect tomato induced defense

These data showed that H. zea saliva play an important role in induction of PIN2. To

further confirm the role of saliva in inducing defense gene expression, we wounded Better Boy

44

and MicroTom leaves and applied saliva on the wounded site. The amount of salivary protein

(~0.5 g) used in these experiments is a very conservative estimate of how much is secreted

during feeding (Peiffer and Felton 2005). The application of H. zea saliva to wounded leaves

significantly induced the expression of PIN2 after 48 h in both Better Boy and MicroTom

cultivars compared to the wounded control (ANOVA, FBetter boy =8.5, p=0.007; FMicroTom =70.09,

p<0.001 Figure 4a). In contrast, we found that regurgitant did not significantly affect PIN2

expression in micro-tom tomato leaves with 20µl regurgitant (ANOVA, F=2.71 p=0.115)

compared to the wounded control (Figure 4b).

Saliva and GOX affect tomato defense on different tissue

Because GOX was the most abundant salivary protein and earlier reports showed that

infiltration of tomato petioles with a H2O2 generating system consisting of glucose and fungal

glucose oxidase triggered PIN2 expression (Orozco-Cardenas et al. 2001). To test how saliva and

GOX affect tomato defense we tested the effect of GOX and saliva on PIN2 expression in tomato

leaves, green and red fruit, and flower tissues. We applied fungal GOX (0.4µg) at levels

consistent with the amount secreted by caterpillars (0.5µg) (Peiffer and Felton 2005). The fungal

GOX has very similar substrate specificity as the GOX from H. zea salivary glands (Eichenseer

et al. 1999) and thus serves as appropriate model for the insect enzyme.

Relative expression of the late responding gene PIN2 was examined after 24 and 48 hours

wounding and treatment. H. zea saliva or fungal GOX had different effect on the gene

expression on different tissue (Figure 5). Wounding with PBS, saliva or GOX both induce PIN2

induction on the leaf at 24 and 48 hours. However the H. zea saliva and GOX treatment

significantly induced more PIN2 expression than PBS treatment at both time points. At 48 hour,

the PIN2 expression in leaf treatment with saliva and GOX is significantly higher than at

45

24hours time points, while the PBS treatments at the different times were not significantly

different. The effect of induction of PIN2 expression by GOX and saliva was not significantly

different at the two time points (ANOVA, F=20.70, p<0.001, Figure 5a). Treatments of green

fruit with wounding and PBS, saliva or GOX showed PIN2 induction relative to the unwounded

control. Compared to PBS, the saliva and fungal GOX treatments induced PIN2 expression in

green fruit after wounding. At 24 hour, the saliva treatment induced higher PIN2 than the GOX

treatment, while at 48 hour, the two treatments showed no significant differences between saliva

and GOX (ANOVA, F=14.39, p<0.001, Figure 5b). But with red mature fruit, wounding with

PBS, saliva or GOX treatment caused no significant PIN2 induction compared with non-treated

fruits (ANOVA, F=4.43, p=0.058 Figure. 5c) Floral tissues had higher constitutive PIN2

expression level, but again there was no significant response to wounding or saliva in the flower

tissues (Figure. 5d) (ANOVA, F=0.28, p=0.761).

Trichome Induction by H. zea feeding or Saliva treatment

Two weeks after H. zea fed, we counted the glandular trichome number on the newly

growth expanded leaves. The results showed inset fed significantly induce the glandular

trichome number on the newly growth leaves compared to unwounded leaves (425.6/ cm2,

SE=37.3). Compared to mechanical ablated insect fed, the glandular trichome number on the

intact caterpillar fed were significantly induced (ANOVA, F=11.84, p<0.05) (Figure 6a). This

result indicates that insect fed with secretion of saliva induce the glandular trichome number on

the newly growth leaves.

To further examine the effect of caterpillar saliva on trichome induction, plants were

wounded and saliva or GOX (20ng/µl) immediately applied to the wound site. After two weeks

treatment, plants treated with saliva increase77.8% trichomes on the new growth leaf compared

46

to unwounded plants. GOX treatment also significantly induced trichome number on the new

growth leaf (Figure 6b) (ANOVA, F=7.42, p<0.05).

Previous studies have shown glandular trichomes of Lycopersicon spp. is responsible for

resistance to various insects (Gentile& Stoner 1968; Gentile et al. 1968; Dimock & Kennedy

1983; Kennedy & Sorenson 1985). Our Sigma Scan analysis showed after mechanical remove

trichome, the leaf got more damage by H. zea 3rd

larvae in 24 hours feeding compared to the

control leaf (Figure7a). The bioassay showed remove leaf trichome could significantly increase

H. zea growth in 5 days feeding assay (Figure 7b). These results consistent with the previous

study of glandular trichome play important role in tomato defense. The trichome hairs on leaf

surface contain chemical that affect insect growth. It may also physically prohibit insect feeding.

DISCUSSION

Noctuid herbivores produce multiple secretions during feeding that have potential to

mediate the induction of direct and indirect plant defenses (Felton 2008b). The typical mount of

saliva released from a single larva is very tiny (~ 0.5nl) and regurgitant is about 5µl from each

caterpillar. The regurgitant contain high quantity protein around 0.60µg in one caterpillar

collections, there is no GOX activity was detected in the collection. The saliva contains 0.056 µg

total protein in one caterpillar collections, but showed high GOX activity. The immunodetection

confirmed when insect feed on leaf they release saliva which main composition is GOX.

One previous study showed highly polyphagous species possess relative high level of

GOX compared to species with limited host range by examining the labial gland GOX activities

in 23 families of Lepidoptera (85 species) (Eichenseer et al. 2010). Our results from shotgun

proteomic analysis based on protein abundance showed that among total 33 proteins identified

47

(Table S1), glucose oxidase (GOX) was by far the most abundant protein in H. zea saliva, which

accounting for 34% of the identified proteins. Since H. zea has wide host range from vegetable

such as asparagus and watermelon to crops such as cotton and corn. This result confirmed the

GOX is the main protein in H. zea saliva. And also carboxylesterase, ecdysone oxidase, and

fructosidase were the next most abundant proteins in saliva. These proteins also need to be

studied to know more functions in plant defense.

Salivary GOX has been reported in a few insect species which function as an effector in

regulating plant defense in multiple plant species including Nicotiana tabacum (Musser et al.

2002), Nicotiana attenuate(Diezel et al. 2009), Medicago truncatula (Bede et al. 2006), and

Arabidopsis thaliana (Weech et al. 2008). In one example with the tobacco budworm Heliothis

virescens showed that the effect of saliva had an inhibitory effect on volatile induction and that

both saliva and regurgitant were necessary to elicit the “volatile signature” of H. virescens

feeding. Since proteinase inhibitor (PIN2) is the marker gene in JA pathway, in our current

study we quantify relative PIN2 gene expression to compare the different response of insect

feeding or saliva treatment. The results showed that insect fed induce PIN2 gene expression.

The intact H. zea fed significantly induce PIN2 gene expression compared with the spinneret

ablated H. zea fed, which stop saliva secretions on leaf. This is different from the previous report

of caterpillar saliva interferes with induce Arabidopsis defense (Weech et al. 2008). These data

are particularly interesting because in tobacco, glucose oxidase acts an effector by suppressing

the induction of nicotine in tobacco (Musser et al. 2005; Musser et al. 2002). When larvae feed

on tomato they synthesize and secrete less glucose oxidase when feeding on tobacco (Peiffer and

Felton 2005). This suggests that larvae may adjust their saliva or salivation to minimize

induction and/or maximize suppression of induced defenses based on their host plant.

48

Since the main component of H. zea saliva is GOX, the results showed that wounding

treatment with saliva or fungal GOX both induce PIN2 expression compared control treatment.

This is different from one previous study; the salivary gland homogenates had a small inhibitory

effect on the induction of trypsin inhibitor activity in tomato (Musser et al. 2005). There were

two differences in the methods employed in these studies. In the current study we used saliva

directly collected from the spinneret, whereas in the previous paper salivary gland homogenates

were used. The homogenates may contain materials that are not secreted during feeding.

However the amounts of saliva that we can collect from the spinneret are small and less than the

caterpillars normally would secrete during feeding (Peiffer and Felton 2005). Second, in the

current study we tested the effects on induction of PIN2, whereas in the first paper total trypsin

inhibitory activity was measured. While the regurgitant from H. zea, at the amounts tested, did

not affect the expression of the defense gene PIN2 compared to control. This is different from

one previous study that oral secretion from the tobacco hornworm Manduca sexta elicits PIN2

expression in the related species Solanum tuberosum (Korth and Dixon 1997). Although the

exact amount of saliva that are secreted by larvae are not known, we used amounts that are

consistent with what has been published in the literature for many lepidopteran species (Alborn

et al. 1997; Qu et al. 2004; Rose and Tumlinson 2005).

Induced plant defense have mainly been studied in leaves (Karban et al. 2000) and only

very few research have investigated induced plant defense on reproduction tissue. This disparity

may be due to the allocation of resources to defense is determined by the cost of production. In

this study we compared tomato leaves, flower, green fruit and red fruit response to wounding

treatment, the results showed saliva and GOX treatment induce PIN2 expression in leaves and

green fruits. While the red fruits didn’t show any PIN2 induction compared to unwounded fruits.

49

The expression of PIN2 in flowers showed significantly higher than in leaves and green fruits,

but no induction by wounding and saliva or GOX treatment compared to unwounded flowers.

This is consistent with the optimal defense theory (ODT)which explained the patterns of plant

chemical defense and predict that induced defense should be rare in reproductive tissues (McCall

and Karban 2006).

Trichome production is an important component of resistance against herbivorous

insects (Antonious and Synder 1993; Levin 1973). While most plants produce trichomes

constitutively, some plant species respond to damage by producing new leaves with an increased

density of trichomes. Both artificial wounding and damage by herbivores can induce trichome

production. The induction of trichome has been observed in both annual and perennial plants

(Abdala-Roberts and Parra-Tabla 2005; Agrawal 1999). This study found insect feeding or

wounding with saliva/GOX treatment could induce the newly growth leaf trichome density. This

confirmed the saliva plays important role in inducing glandular trichome on the newly growth.

The magnitude of the increase in trichome density is between 37%-139% in this study.

Experimentally remove glandular trichome could increase H. zea consume more leaf foliage and

significantly increase insect growth. This supports that trichome density negatively affects insect

growth (Handley et al. 2005, Gentile et al. 1969, Dimock et al. 1982).

In summary, this study confirmed H. zea release saliva when they are feeding on tomato

plants which play important role in regulating tomato and H. zea interactions. The saliva could

induce tomato defense in leaf and green fruit, while flower and red fruit had no defense in

response to the treatment. PIN2 as JA pathway maker gene was induced by insect feeding and

wounding treatment. Trichomes function as defense insect feeding were highly induced by insect

feeding or saliva and GOX treatment.

50

Table 1 Caterpillar oral secretion collection protein and GOX assay

Table 2 Primers used for real-time PCR assays of relative expression

Regurgitant Saliva

Total Protein/Caterpillar 0.6µg 0.56µg GOX activity 0 1.785714 mol/min/mg

Primer

name

Gene Name/ Accession number Primer sequence (5'-3", forward/reverse)

LOX Lipoxygenase D/u37840 F: GTT CAT GGC CGT GGT TGA CAC ATT /

R : TGG TAA TAC ACC AGC ACC ACA CCT

AOS Allene Oxide Synthase/af230371 F: ACC CGT TTA GCA AAC GAG ATC CGA /

R: CGT TGC AAA TGG TTG GTA CCC GAA

ARG Arginase/ AY656838 F: TGG TGA AGG TGT AAA GGG CGT GTA /

R: TTA CCA GCT TCG CAG CAA CCA TTG

PPO Polyphenol oxidase F/ Z12838 F: ATG TGG ACA GGA TGT GGA ACG AGT R:ACT TTC ACG CGG TAA GGG TTA CGA

PIN2 Wound inducible proteinase

inhibitor 2/ K03291

F: GGA TTT AGC GGA CTT CCT TCT G /

R: ATG CCA AGG CTT GTA CTA GAG AAT G

Ubi Ubiquitin/ X58253 F: GCC AAG ATC CAG GAC AAG GA /

R: GCT GCT TTC CGG CGA AA

51

Table 3. Proteomic Identification of Salivary Proteins in H. zea

Protein identification Organism NCBI Accession # of

Pept

ides

Total

Ion

Score

MW pI

1 glucose oxidase Helicoverpa zea gi|215982092 20 1658 66939.1 5.3

2 glucose oxidase-like enzyme Helicoverpa armigera gi|186909546 17 1373 66858.9 5.0

3 carboxyl/choline esterase CCE016d Helicoverpa armigera gi|294846818 13 1243 61508.4 4.8

4 putative ecdysone oxidase Helicoverpa zea gi|219815604 10 680 63822.7 5.4

5 Fructosidase Helicoverpa armigera gi|156968287 3 316 53971.8 4.9

6 epoxide hydrolase Trichoplusia ni gi|2661096 1 116 52813.6 8.6

7 GF21896 Drosophila ananassae gi|194765569 1 86 65895.2 6.1

8 aryl-alcohol oxidase precursor, putative Ixodes scapularis gi|241592310 1 64 62991.9 6.7

9 GM16912 Drosophila sechellia gi|195356860 1 62 19478.5 10.4

10 AGAP001021-PA Anopheles gambiae str. PEST gi|58376848 1 61 112289.2 6.7

11 GH18582 Drosophila grimshawi gi|195036744 1 58 35803.1 7.2

12 GH18646 Drosophila grimshawi gi|195036490 1 58 205225.0 8.9

13 PREDICTED: similar to alaserpin, partial Acyrthosiphon pisum gi|193629771 1 57 39086.8 5.4

14 wd-repeat protein Aedes aegypti gi|157133770 1 56 54519.2 4.4

15 hypothetical protein TcasGA2_TC013848 Tribolium castaneum gi|270007291 1 56 36914.2 9.7

16 esterase Plutella xylostella gi|22324345 1 56 11776.8 4.7

17 GJ14811 Drosophila virilis gi|195401845 2 55 320874.0 6.5

18 GL10752 Drosophila persimilis gi|195150013 1 53 59935.6 5.4

19 dachshund Culex quinquefasciatus gi|170037058 1 53 67174.6 6.6

20 PREDICTED: similar to nuclear receptor

subfamily 2, group E, member 3

Acyrthosiphon pisum gi|193683726 1 53 54684.5 8.7

21 serine protease Culex quinquefasciatus gi|170036773 1 53 17642.0 9.1

22 Putative aminopeptidase W07G4.4 Camponotus floridanus gi|307185505 1 52 46591.9 6.8

23 CG4593-PA Drosophila ananassae gi|269972528 1 52 24610.3 5.8

24 cytochrome P450 4C1 Culex quinquefasciatus gi|170059524 1 52 29405.6 5.4

52

25 GI18727 Drosophila mojavensis gi|195123267 1 51 6764.8 3.8

26 hypothetical protein AaeL_AAEL009299 Aedes aegypti gi|157121612 1 51 75960.2 9.0

27 hypothetical protein EAG_00548 Camponotus floridanus gi|307166578 1 51 31249.9 9.2

28 protein C9orf39, putative Pediculus humanus corporis gi|242019086 1 50 140011.8 8.9

29 carboxylesterase clade A, member 5 Nasonia vitripennis gi|289177094 1 50 60470.7 5.8

30 GF19006 Drosophila ananassae gi|194770241 1 50 997115.9 5.9

31 CG41265, isoform B Drosophila melanogaster gi|161075927 1 49 95193.6 8.9

32 CG33127 Drosophila melanogaster gi|28573984 1 49 30895.5 5.1

33 GF21209 Drosophila ananassae gi|194763357 1 49 70846.1 7.1

53

FIGURE LEGENDS

Fig. 1. Saliva GOX detection on MicroTom-leaves The Micro-tom tomato leaf were fed by

ablated and intact H. zea overnight, Then after transfer to nitrocellulose and superblock, and

incubated with anti-GOX, detected the GOX spread on leaf with vector ABC Elite and Vector a).

Ablated H. zea fed leaf b). Intact H. zea fed leaf

Fig. 2. Relative peptide abundance of H. zea salivary proteins Shotgun proteomic analysis

of secreted salivary proteins showed most abundant protein accounting for the total identified

proteins. Glucose oxidase (GOX) was by far the most abundant protein accounting for 34% of

the identified proteins

Fig. 3. PIN2 relative expression of PIN2 in tomato leaves 24 and 48 hours after feeding, real-

time PCR compare PIN2 gene expression. Data shows mean relative expression ±SE. Letters

represent significant differences between PBS and saliva treated samples (P<0.05) by Fisher’s

comparison. (ANOVA, F(24hour)=17.46, P=0.03; F(48hour)=7.51, P=0.023).

Fig. 4. Compare relative expression of defense genes 24 hours after wounding and application of

H. zea saliva from 10 larvae on tomato leaf. a) Treatment on different varieties Better boy and

Micro-tom tomato leaf both induce PIN2 induction compared to PBS treatment (ANOVA, FBetter

boy =8.5, p=0.007; FMicroTom =70.09, p<0.001). b) Regurgitant treatment on the Micro-Tom leaf

didn’t significantly induce PIN2 relative expression compared to PBS treatment (ANOVA,

F=2.71, p=0.115). Data shows mean relative expression ±SE. Asterisk represent significant

differences between PBS and saliva treated samples (P<0.05) by Fisher’s –LSD comparison

54

Fig. 5. Relative expression of PIN2 on different MicroTom tissues 24 and 48 hrs after

wounding and treatment with PBS buffer, saliva or fungal GOX a) PIN2 significantly induced by

saliva and GOX treatment compared to PBS buffer on leaf; b): PIN2 significantly induced by

saliva and GOX treatment compared to PBS buffer on Green fruit; c) No PIN2 induction on red

fruit, d) Flower Receptacle wounding with treatment didn’t show PIN2 induction. Error bars

represent mean + SE.

Fig. 6. Trichome induction by wounding treatment or insect feeding Average number of

trichomes on new growth leaf after wounding or insect feeding a) Ablated and Non-ablated

insect feeding increase the new growth leaf trichome number b) Wounding and treatment with H.

zea saliva or fungal glucose oxidase (20ng/µl), non-wounding and wounding with PBS buffer

treatment as control. Data shown are error bars represent mean + SE.

Fig. 7. Trichome significantly affect H. zea feeding and growth a) After removing the leaf

surface trichomes, the leaf damage significantly increased. b) The leaf with trichome removed

significantly increased H. zea growth.

55

Fig. 1. Saliva GOX detection on MicroTom-leaves The Micro-tom tomato leaf were fed by

ablated and intact H. zea overnight, Then after transfer to nitrocellulose and superblock, and

incubated with anti-GOX, detected the GOX spread on leaf with vector ABC Elite and Vector a).

Ablated H. zea fed leaf b). Intact H. zea fed leaf

a) Ablated fed b) Intact fed

56

Fig. 2. Relative peptide abundance of H. zea salivary proteins Shotgun proteomic analysis

of secreted salivary proteins showed most abundant protein accounting for the total identified

proteins. Glucose oxidase (GOX) was by far the most abundant protein accounting for 34% of

the identified proteins

Relative Peptide Abundance

glucose oxidase

carboxylesterase

ecdysone oxidase

fructosidase

all others

57

Fig. 3. Relative gene expression in tomato leaves after H. zea feeding. Cage H. zea on the 4th

leaf for 6 hours feeding, after 24 and 48 hours, real-time PCR compare the gene expression.

Ablated fed means the 5th

instar larvae spinneret was ablated, intact fed means regular insect

feeding, control means empty cage on the leaf. a) PIN2 relative expression by ablated and intact

fed with 24h and 48h. b) LOX, AOS, ARG and PPOF relative expression after 24 hour H. zea

fed. Data shows mean relative expression ±SE.

58

Fig. 4. Compare relative expression of defense genes 24 hours after wounding and application

of H. zea saliva from 10 larvae on tomato leaf. a) Treatment on different varieties Better boy and

Micro-tom tomato leaf both induce PIN2 induction compared to PBS treatment (ANOVA, FBetter

boy =8.5, p=0.007; FMicroTom =70.09, p<0.001). b) Regurgitant treatment on Micro-Tom leaf didn’t

significantly induce PIN2 relative expression compared to PBS treatment (ANOVA, F=2.71,

p=0.115). Data shows mean relative expression ±SE. Asterisk represent significant differences

between PBS and saliva treated samples (P<0.05) by Fisher’s –LSD comparison

59

Fig. 5. Relative expression of PIN2 on different MicroTom tissues 24 and 48 hrs after

wounding and treatment with PBS buffer, saliva or fungal GOX a) PIN2 significantly induced by

saliva and GOX treatment compared to PBS buffer on leaf; b): PIN2 significantly induced by

saliva and GOX treatment compared to PBS buffer on Green fruit; c) No PIN2 induction on red

fruit, d) Flower Receptacle wounding with treatment didn’t show PIN2 induction. Error bars

represent mean + SE.

60

61

Fig. 6. Trichome induction by wounding treatment or insect feeding Average number of

trichomes on new growth leaf after wounding or insect feeding a) Ablated and Non-ablated

insect feeding increase the new growth leaf trichome number b) Wounding and treatment with H.

zea saliva or fungal glucose oxidase (20ng/µl), non-wounding and wounding with PBS buffer

treatment as control. Data shown are error bars represent mean + SE.

62

Fig. 7. Trichome significantly affects H. zea feeding and growth a) After removing

trichomes, the leaf damage significantly increased. b) The leaf with trichome removes

significantly increased H. zea growth.

63

Reference

Abdala-Roberts L, Parra-Tabla V (2005) Artificial defoliation induces trichome production in the

tropical shrub Cnidoscolus aconitifolius (Euphorbiaceae). Biotropica 37: 251-257

Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores

and plant fitness. Ecology 80: 1713-1723

Alborn H, Turlings T, Jones T, Stenhagen G, Loughrin J, Tumlinson J (1997) An elicitor of

plant volatiles from beet armyworm oral secretion. Science 276: 945-949

Alborn HT, Hansen TV, Jones TH, Bennett DC, Tumlinson JH, Schmelz EA, Teal PEA (2007)

Disulfooxy fatty acids from the American bird grasshopper Schistocerca americana,

elicitors of plant volatiles. Proceedings of the National Academy of Sciences of the

United States of America 104: 12976-12981

Antonious GF, Synder JC (1993) Trichome density and pesticide retention and half-Life.

Journal of Environmental Science and Health Part B-Pesticides Food Contaminants and

Agricultural Wastes 28: 205-219

Arimura GI, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.

Biophys. Acta (BBA) - Mol. Cell Biol. Lipids 1734: 91-111

Bansal R, Hulbert S, Schemerhorn B, Reese JC, Whitworth RJ, Stuart JJ, Chen MS (2011)

Hessian fly-associated bacteria: transmission, essentiality, and composition. Plos One 6

Bede J, Musser R, Felton G, Korth K (2006) Caterpillar herbivory and salivary enzymes

decrease transcript levels of Medicago truncatula genes encoding enzymes in terpeniod

biosynthesis. Plant Mol Biol 60: 519 - 531

Berger D, Altmann T (2000) A subtilisin-like serine protease involved in the regulation of

stomatal density and distribution in Arabidopsis thaliana. Genes Dev. 14: 1119

Bergey DR, Orozco-Cardenas M, de Moura DS, Ryan CA (1999) A wound- and systemin-

inducible polygalacturonase in tomato leaves. Proc Natl Acad Sci U S A 96: 1756-1760

Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased

densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol. 31:

2211-2216

Chao WS, Gu YQ, Pautot VV, Bray EA, Walling LL (1999) Leucine aminopeptidase RNAs,

proteins, and activities increase in response to water deficit, salinity, and the wound

signals systemin, methyl jasmonate, and abscisic acid. Plant Physiol 120: 979-992

Chippendale G (1970) Development of artificial diets for rearing the Angoumois grain moth.

J.Economic Entomology 63: 844-848

Consales F, Schweizer F, Erb M, Gouhier-Darimont C, Bodenhausen N, Bruessow F, Sobhy I,

Reymond P (2011) Insect oral secretions suppress wound-induced responses in

Arabidopsis. Journal of Experimental Botany

Constabel CP, Bergey DR, Ryan CA (1995) Systemin activates synthesis of wound-inducible

tomato leaf polyphenol oxidase via the octadecanoid defense signaling pathway. Proc

Natl Acad Sci U S A 92: 407-411

Delphia CM, Mescher MC, Felton G, De Moraes CM (2006) The role of insect-derived cues in

eliciting indirect plant defenses in tobacco, Nicotiana tabacum. Plant Signaling and

Behavior 1: 243-250

Diez-Diaz M, Conejero V, Rodrigo I, Pearce G, Ryan CA (2004) Isolation and characterization

of wound-inducible carboxypeptidase inhibitor from tomato leaves. Phytochemistry 65:

1919-1924

64

Diezel C, von Dahl C, Gaquerel E, Baldwin IT (2009) Different lepidopteran elicitors account

for crosstalk in herbivory-induced phytohormone signaling. Plant Physiol 150: 1576-

1586

Dimock MB, Kennedy GG, Williams WG (1982) Toxicity studies of analogs of 2-tridecanone, a

naturally-occurring toxicant from a wild tomato. J. Chem. Ecol. 8: 837-842

Eichenseer H, Mathews MC, Bi JL, Murphy JB, Felton GW (1999) Salivary glucose oxidase:

multifunctional roles for Helicoverpa zea? Arch. Insect Biochem. Physiol. 42: 99-109

Eichenseer H, Mathews MC, Powell JS, Felton GW (2010) Survey of a salivary effector in

caterpillars: glucose oxidase variation and correlation with host range. J Chem Ecol 36:

885-897

Engelberth J, Alborn HT, Schmelz EA, Tumlinson JH (2004) Airborne signals prime plants

against insect herbivore attack. Proceedings of the National Academy of Sciences 101:

1781-1785

Farmer EE (2007) Plant biology: Jasmonate perception machines. Nature 448: 659-660

Fatouros NE, Broekgaarden C, Bukovinszkine'Kiss G, van Loon JJA, Mumm R, Huigens ME,

Dicke M, Hilker M (2008) Male-derived butterfly anti-aphrodisiac mediates induced

indirect plant defense. Proceedings of the National Academy of Sciences 105: 10033-

10038

Felton G-W, Summers CB (1993) Potential role of ascorbate oxidase as a plant defense protein

against insect herbivory. J. Chem. Ecol.

Felton G (2008) Caterpillar secretions and induced plant responses. In: Schaller A (ed) Induced

Plant Resistance to Herbivory. Springer, Hohenheim, Germany, pp 369-387

Felton GW, Donato K, Delvecchio RJ, Duffey SS (1989) Activation of plant foliar oxidases by

insect feeding reduces nutritive quality of foliage for noctuid herbivores. Journal of

Chemical Ecology 15: 2667-2694

Felton GW, Donato KK, Broadway RM, Duffey SS (1992) Impact of oxidized plant phenolics

on the nutritional quality of dietary protein to a noctuid herbivore, Spodoptera exigua.

Journal of Insect Physiology 38: 277-285

Felton GW, Eichenseer H (1999) Herbivore saliva and its effects on plant defense against

herbivores and pathogens. In: Agrawal AA, Tuzun S, Bent E (eds) Induced Plant

Defenses Against Pathogens and Herbivores. APS Press, St. Paul, MN, pp 19-36

Gentile A, wEBB R, Stoner A (1969) Lycopersicon and solanum spp. resistant to the carmine

and the two-spotted spider mite. Journal of Economic Entomology 62: 834-836

Handley R, Ekbom B, Agren J (2005) Variation in trichome density and resistance against a

specialist insect herbivore in natural populations of Arabidopsis thaliana. Ecological

Entomology 30: 284-292

Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant

Biology 59: 41-66

Howe GA, Lightner J, Browse J, Ryan CA (1996) An octadecanoid pathway mutant (JL5) of

tomato is compromised in signaling for defense against insect attack. Plant Cell 8: 2067-

2077

Hui D, Iqbal J, Lehmann K, Gase K, Saluz HP, Baldwin IT (2003) Molecular interactions

between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural

host Nicotiana attenuata: V. microarray analysis and further characterization of large-

scale changes in herbivore-induced mRNAs. Plant Physiol 131: 1877-1893

Kaloshian I, Walling LL (2005) Hempiterans as plant pathogens. Annual Review of

65

Phytopathology 43: 491-521

Kang JH, Liu G, Shi F, Jones AD, Beaudry RM, Howe GA (2010a) The tomato odorless-2

mutant is defective in trichome-based production of diverse specialized metabolites and

broad-spectrum resistance to insect herbivores. Plant Physiol.: pp.110.160192

Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010b) Distortion of trichome morphology

by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental

Botany 61: 1053-1064

Karban R, Baldwin IT, Baxter KJ, Laue G, Felton GW (2000) Communication between plants:

induced resistance in wild tobacco plants following clipping of neighboring sagebrush.

Oecologia 125: 66-71

Kennedy GG, Farrar RR, Kashyap RK (1991) 2-Tridecanone glandular trichome-mediated

insect resistance in tomato - effect on parasitoids and predators of Heliothis Zea. Acs

Symposium Series 449: 150-165

Korth KL, Dixon RA (1997) Evidence for chewing insect-specific molecular events distinct from

a general wound response in leaves. Plant Physiol. 115: 1299-1305

Levin D (1973) The role of trichomes in plant defense. Q. Rev. Biol 48: 3-15

Lin L, Shen TC, Chen YH, Hwang SY (2008) Responses of Helicoverpa armigera to tomato

plants previously infected by ToMV or damaged by H-Armigera. J. Chem. Ecol. 34: 353-

361

Liu F, Cui LW, Cox-Foster D, Felton GW (2004) Characterization of a salivary lysozyme in

larval Helicoverpa zea. Journal of Chemical Ecology 30: 2439-2457

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time

quantitative PCR and the 2-C(T) method. Methods 25: 402-408

Maffei M, Bossi S, Spiteller D, Mithofer A, Boland W (2004) Effects of feeding Spodoptera

littoralis on lima bean leaves. I. Membrane potentials, intracellular calcium variations,

oral secretions, and regurgitate components. Plant Physiol. 134: 1752-1762

Maffei ME, Mithofer A, Arimura G-I, Uchtenhagen H, Bossi S, Bertea CM, Cucuzza LS,

Novero M, Volpe V, Quadro S, Boland W (2006) Effects of Feeding Spodoptera littoralis

on Lima Bean Leaves. III. Membrane Depolarization and Involvement of Hydrogen

Peroxide. Plant Physiol. 140: 1022-1035

Mattiacci L, Dicke M, Posthumus MA (1995) β-Glucosidase: an elicitor of herbivore-induced

plant odor that attracts host-searching parasitic wasps. Proc. Nat. Acad. Sci. USA 92:

2036-2040

McCall AC, Karban R (2006) Induced defense in Nicotiana attenuata (Solanaceae) fruit and

flowers. Oecologia 146: 566-571

Mithofer A, Wanner G, Boland W (2005) Effects of feeding Spodoptera littoralis on lima bean

leaves. II. Continuous mechanical wounding resembling insect feeding is sufficient to

elicit herbivory-related volatile emission. Plant Physiol. 137: 1160-1168

Mori N, Alborn HT, Teal PE, Tumlinson JH (2001) Enzymatic decomposition of elicitors of

plant volatiles in Heliothis virescens and Helicoverpa zea. J Insect Physiol 47: 749-757

Musser R, Hum-Musser S, Eichenseer H, Peiffer M, Ervin G, Murphy J, Felton G (2002)

Herbivory: Caterpillar saliva beats plant defences. Nature 416: 599 - 600

Musser RO, Cipollini DF, Hum-Musser SM, Williams SA, Brown JK, Felton GW (2005)

Evidence that the caterpillar salivary enzyme glucose oxidase provides herbivore offense

in solanaceous plants. Arch. Insect Biochem. Physiol. 58: 128-137

Musser RO, Farmer E, Peiffer M, Williams SA, Felton GW (2006) Ablation of caterpillar labial

66

salivary glands: Technique for determining the role of saliva in insect-plant interactions.

J. Chem. Ecol. 32: 981-992

Old WM, Meyer-Arendt K, Aveline-Wolf L, Pierce KG, Mendoza A, Sevinsky JR, Resing KA,

Ahn NG (2005) Comparison of label-free methods for quantifying human proteins by

shotgun proteomics. Molecular & Cellular Proteomics 4: 1487

Orozco-Cardenas ML, Narvaez-Vasquez J, Ryan CA (2001) Hydrogen peroxide acts as a second

messenger for the induction of defense genes in tomato plants in response to wounding,

systemin, and methyl jasmonate. Plant Cell 13: 179-191

Pautot V, Holzer FM, Reisch B, Walling LL (1993) Leucine aminopeptidase: an inducible

component of the defense response in Lycopersicon esculentum (tomato). Proc Natl Acad

Sci U S A 90: 9906-9910

Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary

glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113

Peiffer M, Felton GW (2009) Do caterpillars secrete "oral secretions"? J Chem Ecol 35: 326-335

Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as

sensors for insect herbivores. New Phytologist 184: 644-656

Qu N, Schittko U, Baldwin IT (2004) Consistency of Nicotiana attenuata's Herbivore- and

Jasmonate-Induced Transcriptional Responses in the Allotetraploid Species Nicotiana

quadrivalvis and Nicotiana clevelandii. Plant Physiol. 135: 539-548

Roda A, Halitschke R, Steppuhn A, Baldwin IT (2004) Individual variability in herbivore-

specific elicitors from the plant's perspective. Mol Ecol 13: 2421-2433

Rose USR, Tumlinson JH (2005) Systemic induction of volatile release in cotton: How specific

is the signal to herbivory? Planta 222: 327-335

Ryan CA (1990) Proteinase inhibitors in plants: genes for improving defenses against insects and

pathogens. Ann Rev Phytopathol 28: 425

Spiteller D, Dettner K, Boland W (2000) Gut bacteria may be involved in interactions between

plants, herbivores and their predators: Microbial biosynthesis of N-acylglutamine

surfactants as elicitors of plant volatiles. Biological Chemistry 381: 755-762

Steppuhn A, Baldwin IT (2008) Induced defenses and the cost-benefit paradigm. In: Schaller A

(ed) Induced Plant Resistance to Herbivory, pp 61-83

Thipyapong P, Stout MJ, Attajarusit J (2007) Functional analysis of Polyphenol Oxidases by

Antisense/Sense technology. Molecules 12: 1569-1595

Tooker JF, Peiffer M, Luthe DS, Felton GW (2010) Trichomes as sensors: Detecting activity on

the leaf surface. Plant Signal Behav 5: 73-75

Vandenabeele S, Van Der Kelen K, Dat J, Gadjev I, Boonefaes T, Morsa S, Rottiers P, Slooten

L, Van Montagu M, Zabeau M, Inze D, Van Breusegem F (2003) A comprehensive

analysis of hydrogen peroxide-induced gene expression in tobacco. Proc Natl Acad Sci U

S A 100: 16113-16118

Victoriano E, Gregório EA (2002) Ultrastructure of the excretory duct in the silk gland of the

sugarcane borer Diatraea saccharalis (Lepidoptera: Pyralidae). Arthropod Structure &

Development 31: 15-21

Walling LL (2000) The Myriad Plant Responses to Herbivores. Journal of Plant Growth

Regulation 19: 195-216.

Wang FD, Feng GH, Chen KS (2009) Defense responses of harvested tomato fruit to burdock

fructooligosaccharide, a novel potential elicitor. Postharvest Biology and Technology 52:

110-116

67

Weech M-H, Chapleau M, Pan L, Ide C, Bede J (2008) Caterpillar saliva interferes with

induced Arabidopsis thaliana defence responses via the systemic acquired resistance

pathway. J Exp Bot 59: 2437 - 2448

Will T, Tjallingii WF, Thönnessen A, van Bel AJE (2007) Molecular sabotage of plant defense

by aphid saliva. Proceedings of the National Academy of Sciences 104: 10536-10541

68

Chapter III

Role of Trichomes in Defense against Herbivores:

Comparison of Herbivore Response to Woolly and Hairless Trichome Mutants in Tomato

(Solanum lycopersicum)

Donglan Tian, J. Tooker, M. Peiffer, S. Chung, and G. W. Felton1

Department of Entomology

Center for Chemical Ecology

Penn State University

University Park, PA16802

1Corresponding author: gwf10@psu.edu; 814-863-7789; 814-865-3048 (FAX)

Tian D, Tooker J, Peiffer M and Felton GW (2012) Role of Trichomes in Defense against

Herbivores: Comparison of Herbivore Response to hl and woolly Mutants in Tomato (Solanum

lycopersicum) Planta DOI 10.1007/s00425-012-1651-9

69

Abstract

Trichomes contribute to plant resistance against herbivory by physical and chemical

deterrents. To better understand their role in plant defense, we systemically studied trichome

morphology, chemical composition and the response of insect herbivores Helicoverpa zea and

Leptinotarsa decemlineata (Colorado potato beetle) on the tomato hairless (hl) and hairy (woolly)

mutants. Hairless mutants showed reduced number of twisted glandular trichomes (type I, IV, VI

and VII) on leaf and stem, while woolly mutants showed high density of non-glandular trichomes

(type II, III and V) but only on the leaf. In both mutants, trichome densities were induced by

methyl jasmonate (MeJA), but the types of trichomes present were not affected by MeJA

treatment. Glandular trichomes contained high levels of monoterpenes and sesquiterpenes. A

similar pattern of transcript accumulation was observed for monoterpene MTS1 (=TPS5) and

sesquiterpene synthase SST1 (=TPS9) genes in trichomes. While high density of non-glandular

trichome on leaves negatively influenced CPB feeding behavior and growth, it stimulated H. zea

growth. High glandular trichome density impaired H. zea growth, but had no effect on CPB.

Quantitative real-time polymerase chain reaction (qRT-PCR) showed that glandular trichomes

highly express protein inhibitors (PIN2), polyphenol oxidase (PPOF) and hydroperoxide lyase

(HPL) when compared to non-glandular trichomes. The SlCycB2 gene, which participates in

woolly trichome formation, was highly expressed in the woolly mutant trichomes. PIN2 in

trichomes was highly induced by insect feeding in both mutant and wild type plants. Thus both

the densities of trichomes and the chemical defenses residing in the trichomes are inducible.

Key words: jasmonate, plant defenses, induced defenses, herbivores, Leptinotarsa

decemlineata, Helicoverpa zea

70

Abbreviations:

woolly hairy mutant

hl hairless mutant

RU Rutgers wild type plants of woolly mutant

AC Alisa Craig, wild type plants of hairless mutant

MeJA methyl jasmonate

PIN2 protease inhibitor 2

HPL hydroperoxide lyase

SlCycB2 B-Type cyclin

PPOF polyphenol oxidase

CPB Colorado potato beetle

71

Introduction

Trichomes are hair-like protuberances that develop from the aerial epidermis on leaves,

stems and other organs on many plant species (Creelman and Mullet 1995; Duffey 1986; Kang et

al. 2010a; Kang et al. 2010b; Reeves 1977; Steffens and Walters 1991; Wagner 1991).

Trichomes are normally classified as either glandular or non-glandular and may vary in size,

shape, number of cells, morphology, and chemical composition(Goffreda et al. 1989; Kang et al.

2010a; Kang et al. 2010b; Schilmiller et al. 2010; Stout et al. 2002). Numerous studies have

shown that trichomes serve multiple functions including defense against herbivores by

interfering with their movement and/or by direct toxicity through chemicals they produce and/or

release (Arimura et al. 2005; Dimock et al. 1982; Kang et al. 2010a; Kang et al. 2010b; Kennedy

2003; Peiffer et al. 2009; Wagner 1991). Trichome-based plant resistance holds potential to

improve sustainability of insect pest management by reducing pesticide use and decreasing the

likelihood that pesticide resistance will develop (Dalin and Björkman 2003; Radhika et al. 2010;

Simmons and Gurr 2004).

High densities of foliar trichomes may prevent feeding damage by herbivores (Handley et

al. 2005; Horgan et al. 2009; Kessler et al. 2011). Several studies have shown that herbivore

feeding or mechanical damage to leaves leads to newly formed leaves with higher densities of

trichomes (Agrawal et al. 2002; Agren and Schemske 1994; Andrade et al. 2005; Stratmann and

Ryan 1997; Traw and Dawson 2002a). In some instances, jasmonic acid regulates trichome

production and plant defense (Halitschke et al. 2008; Li et al. 2004; Traw and Bergelson 2003).

In tomato, application of methyl jasmonate (MeJA) increases densities of glandular trichomes on

new leaves (Boughton et al. 2005). The inducibility of trichome density is ecologically

significant because trichome density can negatively influence herbivore populations (Agrawal

72

1999; Horgan et al. 2009; Kessler et al. 2011). While herbivory or wounding is known to affect

the quantitative variation in trichome density, is unknown if herbivory may also influence

qualitative variation by altering the expression of defensive chemistry within glandular trichomes.

Because tomato (Solanum lycopersicum) is an economically important crop, it serves as a

model for studying plant defenses against herbivores and diseases (Green and Ryan 1972; Howe

and Jander 2008; Li et al. 1999; Mirnezhad et al. 2010; O'Donnell et al. 1996). Decades of

research on tomato has shown that jasmonate signaling (JA) plays an important role in plant

defense signaling against insect herbivory (Bostock 2005; Felton et al. 1994; Howe and Jander

2008; Thaler et al. 2001). Trichomes in cultivated tomato and related wild species have been

subjects of intense study for many decades (Kennedy 2003; Peiffer et al. 2009; Steffens and

Walters 1991). Unlike Arabidopsis, which only has non-glandular trichomes (Seo et al. 1999),

trichomes in Solanum are highly diverse in morphology and chemistry. Tomato foliar trichomes

are categorized as types I-VII, with types I, IV, VI and VII being glandular and types II, III and

V being non-glandular (Kang et al. 2010b; Luckwill 1943). The major distinction between non-

glandular and glandular is that glandular trichomes have heads containing various sticky and/or

toxic chemicals that may poison or repel herbivores (Schilmiller et al. 2010). Non-glandular

trichomes do not have heads and are thought to mainly function in defense by physically

hindering insect feeding behavior and movements (Higgins et al. 2007).

Insect behavior can be dramatically influenced when trichomes obstructs movement

across the plant surface (Radhika et al. 2010; Simmons and Gurr 2005). Moreover, glandular

trichomes may have profound effects on herbivore performance (i.e., growth, survival and

fecundity) and host-plant-selection behavior (Duffey 1986; Higgins et al. 2007; Kennedy 2003;

Neill et al. 2002; Pelletier and Dutheil 2006). The most remarkable feature of tomato glandular

73

trichomes is their capacity to produce and secrete a wide variety of plant secondary compounds

including terpenoids (Hogenhout and Bos 2011; Kang et al. 2010b; Karban and Baldwin 1997;

Ma et al. 2011; Panizzi 1997; Schilmiller et al. 2010), phenolics (Gang et al. 2001), sucrose

esters, methyl ketones (Fridman et al. 2005) and organic acids (Toth et al. 2005). By studying

isolated glands, many of genes involved in the biosynthesis of the chemicals have been

characterized, including the roles of monoterpene MTS1(=TPS5) and sesquiterpene SST1(=TPS9)

synthesis genes in regulating terpene biosynthesis (Besser et al. 2009).

Several methods have been used to study trichome functions in defense including

manipulative and genetic methods. For instance, the experimental removal of tomato glandular

trichome heads and exudates significantly decreased the mortality of aphids, the tomato

fruitworm Helicoverpa zea, and the Colorado potato beetle Leptinotarsa decemlineata (Dimock

et al. 1982; Kennedy 2003; Simmons and Gurr 2004). However, such mechanical treatments of

the leaf are likely to induce JA-regulated defenses (Peiffer et al. 2009) and can confound

interpretation of results by altering the leaf surface and chemistry in ways unrelated to natural

variation in trichome density. The use of mutants is a more rigorous and less ambiguous

experimental approach for deciphering the roles of different trichome types in resistance against

herbivores (Kang et al. 2010a; Kang et al. 2010b).

In tomato, the effect of trichome-based resistance on insect herbivores has mostly

focused on glandular trichomes and there has been considerably less study on the role of non-

glandular trichomes against herbivores (Kang et al. 2010a; Kang et al. 2010b). Because most

cultivars possess both glandular and non-glandular trichome, it is difficult to separate trichome

function(s) in these commercial varieties. In this current study, we use two mutants with

differing trichome types to examine the role of glandular and non-glandular trichomes in

74

resistance to the solanaceous specialist L. decemlineata and the generalist H. zea. In addition to

characterizing the morphologies and densities of the trichomes in these mutants, we also report

their terpene composition. We hypothesize that both glandular and non-glandular trichome

phenotypes will provide different contributions to defense against the herbivorous insect species.

Materials and Methods

Plants and Insects

Tomato (S. lycopersicum) hairless mutant (hl, LA3556) and wild type Alisa Craig (AC,

accession number LA2838), hairy mutant (woolly, LA0258) and wild type Rutgers (RU,

accession number LA1090) were used in all experiments. Seeds were originally obtained from

Tomato Genetics Resource Center (University of California, Davis, CA, USA). Seedlings were

grown as described previously (Peiffer and Felton 2005) in Metromix 400 potting mix (Griffin

Greenhouse & Nursery Supplies Tewksbury, MA) in greenhouse at Penn State University,

University Park, PA, USA). The greenhouse was maintained on a 16-h photoperiod.

Tomato fruitworm (Helicoverpa zea) and Colorado potato beetle (=CPB) (Leptinotarsa

decemlineata) were reared in the Entomology Department, Penn State University (University

Park PA, USA). Helicoverpa zea eggs were purchased from BioServ (Frenchtown, NJ) and

reared on a wheat germ and casein-based artificial diet (Bansal et al. 2011) with ingredients from

Bioserv. Colorado potato beetle was collected from tomato plants in Centre County PA and

reared on tomato plants as described previously (Chung and Felton 2011).

Morphology and density of different type trichome on mutant

At four-leaf stage, ten plants of each cultivar were sampled to compare trichome

morphology and density of the trichome on leaf. Two leaf discs from the youngest fully

75

expanded leaf were cut from each side of the mid-vein. Trichome numbers were counted under a

light microscope on each leaf disc. The density of trichomes was calculated as the number per

disc/cm2.

Scanning electron microscopy (SEM) was performed to compare the morphology of

trichomes on different mutants and followed the protocol described in Kang et al (Kang et al.

2010b). Briefly, tissues were fixed overnight in a solution of 2.5% paraformaldehyde, 2.5%

glutaraldehyde buffered with 0.1M sodium cacodylate, pH 7.0. Samples were dehydrated in a

graduated ethanol series, critical point dried, then mounted, and sputter coated. Samples were

then examined with a 20 kV accelerating voltage with a JEOL JSM5400 microscope (Tokyo,

Japan).

Trichome purification and Real-time PCR

Trichomes were purified following well-established methods with slight modifications

(Peiffer et al. 2009). To isolate trichomes, leaflets/stems were removed, placed in a 50ml conical

tube containing 1g glass beads (diameter, 4mm) (Kimble chase, Vineland, NJ, USA) and liquid

N2, and the tube was shaken vigorously to shear trichomes off the leaf/stem. We then poured the

slurry through a 1mm strainer for non-glandular trichomes and rinsed with liquid N2 while

glandular trichomes need go through100µm strainer again and rinsed with liquid N2. The

purified trichome preparation was used for chemical analyses and quantification of trichome

specific gene expression.

Quantitative real-time polymerase chain reaction (qRT-PCR) was used to compare gene

expression. One hundred mg of purified trichomes were homogenized in liquid nitrogen and total

RNA was purified with an RNeasy Plus Mini-kit which can remove genomic DNA (Qiagen,

Valencia, CA, USA). A High Capacity cDNA Reverse Transcription kit (Applied Biosystems,

76

Foster City, CA,) was used for cDNA synthesis. All qRT-PCR reactions used Power SYBR

Green PCR Master Mix and ran on 7500 Fast Real-Time PCR system (Applied Biosystems)

following standard protocols (10min at 95ºC, with 40 cycles of 15s at 95ºC and 60s at 60ºC).

Relative quantifications were calculated with wild type RU leaf RNA as the reference group. The

ubiquitin gene was used as the housekeeping gene to normalize 2−ΔΔC(T)

(Rotenberg et al. 2006).

To validate this analysis method, primer efficiency was analyzed by comparing the normalized

C(T) values of five serial dilutions of cDNA. Melting curve analysis was conducted to confirm

the specificity of the primers. Three replicates for each varieties. The relative gene expression

value was analyzed by one way ANOVA followed by Fisher-LSD to do the multi-comparisons.

The primers used are shown in Table 1.

Terpene Analyses

Because terpenes have been reported to be important phytochemical components of

tomato trichome-based resistance (Kang et al. 2010a; Kang et al. 2010b; Wagner 1991), we

explored terpene content using two methods. In the first method, we dissolved 100 mg of

purified leaf or stem trichomes directly in 1ml methyl tertiary-butyl ether (MTBE) buffer. For

the second method, we dipped leaves into MTBE to remove surface terpenes. After weighing

two leaves sampled from youngest fully expanded, the leaves were incubated at room

temperature in 1.0 ml of (MTBE) for three minutes with gentle shaking. For both assays, we

collected three replicate samples per treatment.

For all trichome extractions, we added to each sample 200 ng n-octane and 400 ng nonyl

acetate as external standards. Trichome extracts were injected in 1 µl aliquots into an Agilent

model 7890 gas chromatograph (GC) fitted with a flame ionization detector, using a splitless

77

injector held at 250ºC. The column (HP-5; 30 m long × 320 µm interior diameter × 0.25 µm

film thickness; J&W Scientific, Folsom, CA) was maintained at 35º C for 1 min sec, then ramped

at º C per min to 250º C. Quantifications of compounds were made relative to the nonyl acetate

standard using Chem Station software (Agilent Technologies, Wilmington, DE). Identifications

of trichome components were made with GC-MS in electron ionization mode comparing

retention times and spectra with that of commercial standards.

Trichome induction by MeJA and Bioassay

To compare different trichome responses to MeJA treatment, we treated plants with 3.3

mM MeJA (Sigma, St. Louis, MO, USA) in 0.8% ethanol at 4th

leaf stage. Two weeks after the

spray treatment, we counted trichomes on the youngest fully expanded leaf as previously

described. From the same cohort of plants, the two youngest leaves were collected for bioassays

with H .zea and CPB. Thirty insects per treatment were used for the bioassay.

Bioassays using the mutants were conducted to compare how different types of trichomes

affect insect growth. Detached leaves were used for the bioassay. Newly hatched H. zea larvae

were reared on artificial diet for two days before transfer to tomato leaf for bioassay. Newly

hatched CPB larvae were put on tomato leaf directly in a standard 1 oz. cup (BioServ,

Frenchtown, NJ) with 2% agar on the bottom to maintain leaf moisture. Insects were kept at 27º

C, with a 16:8 L:D photoperiod in an incubator. Thirty insects were used for each bioassay. After

5 days, larval weights were recorded using a precision balance and were statistically analyzed by

one-way ANOVA followed by Fisher-LSD for multiple comparisons.

To compare how different trichome type affects insect feeding behavior, we used 3rd

instar H .zea or 2nd

instar CPB larvae on a detached tomato leaf. We recorded in a ten minute

78

interval the time spent feeding during our observation under microscope. Fifteen larvae were

observed for each species and genotype.

We also tested whether the mutants would impact the oviposition of CPB or H. zea moths.

Ten mated female H. zea moths or ten randomly selected CPB adults were released in cages

containing one plant from each of the four genotypes. After 24 h, we examined the plants

thoroughly and counted the number of eggs on each plant. The experiment was replicated in

eight cages. The average number of eggs on plants was compared on different mutant and wild

type plants through one way ANOVA.

Plant response to insect feeding

At the four- leaf stage, 5th

instar H. zea were individually caged on the fourth leaf for 6 h,

control plants had empty cages. Experiment was replicated nine times. Larvae were removed

and after 24 h, the caged leaf was sampled for RNA extraction and qRT-PCR as previous

described to compare PIN2 relative expression with control leaf. Ubiquitin gene was used as

internal control to normalize data.

Statistical analyses

Data was analyzed using general linear models for analysis of variance (ANOVA) and

where appropriate with post-hoc comparison of means using the Fisher-LSD means separation

test using Minitab (University Park, PA).

Results

Morphology and density of trichome on mutants and induction by MeJA

As observed with light microscopy and SEM, the morphology and trichome densities of

the mutants and their respective wild types were highly variable (Fig. 1, 2). The woolly mutant

79

had abundant trichomes on leaves (Fig. 1 a), but primarily non-glandular types II, III and V.

Trichome types II and III were similar in length, but differed in their base, which was multi-

cellular under type II trichomes, but unicellular base under type III (Fig. 2 a). Type V trichomes

were shorter and had unicellular bases (Fig. 2 a). While trichomes on the woolly mutant stem

possessed both glandular and non-glandular trichomes, but were dominated by non-glandular

trichomes on leaf (Fig. 1 a, c)

The hl mutant, which has been described in Kang et al (2010a), had fewer foliar

trichomes than wild-type leaves. These mutant leaves had normal type I trichomes but most

others were highly twisted and swollen (Fig. 1 g). Type VI glandular trichomes have short neck

cells that connect to the four-celled gland, and they showed irregular patterns and low density on

the leaf surface (Fig.1 g and Fig. 2 b). The trichomes on stems of the hl mutant showed similar

twisted, swollen morphology and lower density (Fig.1 g, i). Both wild types AC and RU leaves

and stems possessed all types of trichomes including glandular and non-glandular, but type VI

glandular trichomes were the most abundant on leaves and stems (Fig.1 d, f, j, i & Fig. 2 c, d).

Densities of trichomes on the mutants were significantly different than their respective

wild type genotypes. The mutant hl displayed twisted and low density of glandular trichomes on

leaf surface; the glandular trichome density was reduced by 57% compared to wild AC plants

and no non-glandular trichome on the leaf surface. The density of the twisted glandular

trichomes on hl was induced by MeJA treatment; twisted glandular trichomes on newly growth

leaf were increased 85.8% after MeJA treatment. While the woolly mutant showed high density

of non-glandular trichomes with very few glandular trichome on leaf surface compared to wild

type RU plants (Fig. 3 a, b). The non-glandular trichomes on the woolly mutant also were

induced by MeJA; non-glandular trichome numbers increased 37.8% following treatment. Also

80

the non-glandular trichome length was increased 71.4% by MeJA compared to untreated plants

(Fig. 3 c). The glandular trichome densities on the RU and AC leaf surface were increased 48.1%

and 64.8% by MeJA (Fig. 3 b). Both type trichome densities on the leaf are induced by MeJA

treatment.

Accumulation of terpenes in different trichomes

Glandular trichomes function either as sites for synthesis and/or the site of release for

various defensive compounds. Previous reports indicate that monoterpenes and sesquiterpenes

are produced in leaf trichomes (Fridman et al. 2005). Because there is significant variability in

the morphology and density of trichomes on the leaf and stem of mutants, we compared the

terpenoid composition of trichomes in these mutant lines to their wild types. Trichomes

produced a mixture of several monoterpenes with β-phellandrene, (Z)-3-hexenyl acetate and α/β-

pinene being the main constituents. Monoterpenes in leaf trichomes were significantly more

abundant than in stem trichomes (Fig. 5 a). In the hl mutant, all the monoterpenes in leaf

trichomes were significantly higher than in wild type trichomes. Compared to the hl mutant and

wild type, woolly mutants showed similar monoterpene profiles, with β-phellandrene and (Z)-3-

hexenyl acetate as the main constituents, whereas β-pinene was not detected in the woolly mutant

leaf trichomes (Table S1). The total monoterpenes in the woolly leaf mutant were significantly

less than in the wild type (Fig. 5 a; Table S1). These results indicate that foliar trichome

monoterpene levels were significantly higher than in stems, and also monoterpenes are mainly

produced in glandular trichomes.

The profile of sesquiterpenes in trichomes showed the main components are e-2-

hexenylbutyrate, β-caryophyllene and z-jasmone (Table S2). Compared to monoterpenes, the

quantity of sesquiterpenes was significantly less in the both leaf and stem trichomes (Fig. 5 a, b).

81

Most sesquiterpene levels in stem trichomes were less than foliar trichomes. Also the z-3-

hexenyl butyrate, α-humulene and β-farnesene weren’t detected in both hl and woolly stem

trichomes (Table S2). The hl glandular trichome sesquiterpene level showed higher quantity than

wild type plants, while woolly mutant non-glandular trichome showed lower quantity than wild

type plants.

Analysis of leaf dip extracts also showed that the hl and woolly mutants had less

monoterpenes and sesquiterpenes than their respective wild types AC and RU. This is likely due

to decreased trichome density on hl plants relative to wild types, and the lack of glandular

trichomes on woolly mutants (Fig. 5 c). Results from both extraction methods indicate that

glandular trichomes are the main source of monoterpenes and sesquiterpenes. Kang et al (2010)

reports on the trichome terpenoids analysis showed less β-phellandrene and other sesquiterpenes

in type VI trichomes. These results showed that compared to glandular trichomes, the non-

glandular trichomes accumulate less of these chemicals in the trichomes. Although the

trichomes on the hl mutant showed distorted morphology, it did not significantly affect the

chemical composition in the leaf trichomes.

Comparison of gene expression in different tomato trichomes

Trichomes on many solanaceous species are known to express terpene synthases and

produce a variety of terpenes (Seo et al. 1999). Previous study showed that trichome specific

transcripts play a role in controlling terpenoid production (Besser et al. 2009). In this study, we

examined the expression of two genes encoding terpenoid synthesis: MTS1 (=TPS5) which

encodes for monoterpene synthase and SST1 (=TPS9) which encodes for sesquiterpene synthase.

Transcript levels measured by qRT-PCR showed that MTS1 (=TPS5) and SST1 (=TPS9) are

highly expressed in glandular trichomes (Fig. 6). The relative expression of MTS1 (=TPS5) and

82

SST1 (=TPS9) in the woolly mutant is 9.2 and 3.6- fold lower than the wild type, while in the hl

mutant MTS1 (=TPS5) and SST1 (=TPS9) are more highly expressed than wild type (Fig. 6 a, b).

These results are consistent with the monoterpene and sesquiterpene levels in the trichomes.

In addition to the defense provided by terpenes, Proteinase inhibitors are another class of

defensive proteins in tomato and can accumulate in many plant tissues (Kang et al. 2010a; Kang

et al. 2010b; Ryan 1990). Our study showed the relative expression of PIN2 is highly expressed

in hl trichomes compared to the non-glandular woolly trichomes (Fig. 6 c.). Polyphenol oxidase

(PPO) is another important defensive protein which is encoded by seven-member gene family

and high expressed tomato trichomes (Chen et al. 2010; Thipyapong and Steffens 1997). Our

results showed that PPOF gene is highly expressed in glandular trichomes, but has very low

expression in the woolly mutant, which lacks glandular trichomes. Hydroperoxide lyase (HPL)

cleaves C18-lipid hydroperoxides to form a C6 aldehyde and a 12 carbon oxoacid. HPL activity

has been found in a variety of plants and is associated with plant development and defense. In

our experiments, compared with wild type leaf RNA, the HPL was highly expressed in glandular

trichomes, but less expressed in non-glandular trichomes (Fig. 6 e). Recent study showed that

the B-type cyclin (SlCycB2) gene participates in trichome formation(Chen et al. 2008), and our

study showed that SlCycB2 was highly expressed in woolly mutant trichome, but with lower

expression in hl mutant (Fig 6 d). This result confirmed that SlCycB2 plays an important role in

non-glandular trichome formation.

Effects of mutants on insect growth and oviposition

Because the morphology, density and chemical composition of trichomes are different

between mutants and their wild types, these varieties may differ in their resistance to insect

herbivores. Bioassays showed that H. zea larval grew significantly better on hl mutants than on

83

wild type AC plants indicating that glandular trichomes are an important source of resistance to

this insect. Both hl mutant and wild type glandular trichomes are high induced by MeJA

treatment and the larval growth on induced leaves was significantly reduced on both hl and the

AC wild type plants (Fig. 7 a). While woolly mutant had high density of non-glandular

trichomes, H. zea growth was significantly better on this mutant compared to wild type RU

plants. Again, MeJA treatment enhanced resistance to H. zea for both woolly mutant and wild

type plants (Fig. 7 a). This result confirmed glandular trichome density is an important factor in

resistance to H. zea.

In contrast to H. zea, Colorado potato beetle (CPB) larvae showed no significant

differences in larval growth on hl mutants compared to wild type (Fig. 7 b). These data indicate

that the density of glandular trichomes found on the wild type is not an important mediator of

larval growth in CPB. Additionally, MeJA treatment did not affect larval growth on newly

formed leaves for the hl mutant or its AC wild type. Conversely, the woolly mutants

significantly reduced CPB growth compared to wild type plants (Fig. 7 b), indicating that the

very high densities of non-glandular trichomes on this mutant strongly influenced CPB growth.

To determine if the larval growth data relate to feeding behavior, we recorded the time

larval H. zea and CPB spent feeding on mutant and wild-type plants. The duration of CPB

feeding on the woolly mutant was significantly lower than the amount of time spent feeding on

wild-type leaves indicating that growth reduction can be, in part, explained by a reduction in

feeding due to the high density of non-glandular trichomes. The amount of time H. zea spent

feeding was not influenced by non-glandular trichomes on woolly mutants, but fewer glandular

trichomes on woolly leaves appeared to allow H. zea to feed longer than on wild type plants.

During our observations of H. zea feeding, we found that larvae preferentially ingested non-

84

glandular trichomes prior to feeding on leaf mesophyll. There was no evidence that larvae later

regurgitated the non-glandular trichomes. The CPB do not preferentially feed on the trichomes

and it appears that the trichomes interfere with their access to the leaf (Fig. 7 c).

Because trichomes have been reported to influence insect oviposition (Heinz and Zalom

1995; Horgan et al. 2009; Kessler et al. 2011), we conducted this experiment to determine if

tomato trichomes influence ovipositional choice for both insect species. We found no observable

differences in ovipositional choice for the different plant varieties (Fig. S1). H. zea moths laid

eggs randomly on the adaxial leaf surface of all varieties and CPB laid eggs in clumps of 5-20 on

the adaxial leaf surface equally across varieties (Fig. S2).

PIN2 Induction by insect feeding

Because trichome expression has been shown to be partly dependent upon a functional

jasmonate signaling pathway (Peiffer et al. 2009), we tested if induction of the JA-regulated

defense gene PIN2 was influenced by H. zea feeding. In all genotypes, the expression of PIN2

was significantly induced by feeding compared with their unwounded plants. However, no

differences in levels of PIN2 induction were detected among the different mutants and wild type

plants (Fig. 8). These results indicate that JA signaling is activated by insect feeding damage in

both mutants and wild type plants and suggest that differences in insect growth on the mutants

were likely not due to significant impairments in jasmonate signaling.

Discussion Trichome-based resistance in tomato plants offers a feasible approach to reduce pesticide

applications (Simmons and Gurr 2004). Trichome morphology, density and chemical

composition are important mechanisms of defense to prevent or decrease herbivore damage. The

morphology and density of leaf trichomes vary considerably among plant species and may also

85

vary among populations and within individual plants (Dalin and Björkman 2003). However, in

plants such as tomato which possess a variety of trichome types, these specialized cell types can

be difficult to isolate separately to study the function of each type of trichome. Thus, the use of

mutants provides a good tool to study trichome function. The hl mutant was described as

hairless, and the phenotypic expression of this mutant at the microscopic level shows a

characteristic twisting and shortening of trichomes (Kang et al. 2010b; Reeves 1977). The woolly

mutant was described as hairy with a high density of type II and III non-glandular trichomes on

leaf surface.

Numerous studies have shown that trichomes are capable of synthesizing and either

storing or secreting large amounts of specialized metabolites that could influence their

interaction with herbivores (Hogenhout and Bos 2011; Schilmiller et al. 2010). Chemical profiles

of type VI trichome in hl mutant showed similar profiles of monoterpenes and sesquiterpenes

with wild type plants, but with less β-phellandrene, β-caryophyllene and α-humulene (Kang et al.

2010b). In our experiment, we collected both types of trichome from the hl mutant, but the

profiles of chemical composition were different from previous results. The β-phellandrene, β-

caryophyllene and α-humulene levels were higher in hl trichomes than in the AC wild type

trichomes. The leaf dip method showed the same pattern with previous results (Kang et al. 2010a;

Kang et al. 2010b). These results indicated that although the trichomes were distorted in the hl

mutant, the chemical accumulation in the twisted head cells was not affected. Not surprisingly

the woolly mutant trichomes showed significantly low monoterpenes and sesquiterpenes

confirming that that the glandular trichome is the main source of terpenes. Our results also

indicated that the foliar trichomes had higher levels of monoterpenes and sesquiterpenes than the

stem trichomes.

86

Our results indicate that both glandular and non-glandular trichomes function in insect

defense. The non-choice bioassay showed the growth of H. zea larvae was substantially

improved by feeding on the hl genotype compared to the wild type parent (cv. Alisa Craig). The

bioassay results with the hl mutant are consistent with Kang (2010a) who observed similar

effects with another caterpillar species, Manduca sexta. These results show that caterpillar

growth is compromised by the presence of glandular trichomes which contain an arsenal of

chemical defenses (e.g., terpenes, polyphenol oxidase, etc.) that may entrap small larvae as they

attempt to move on the leaf surface (Simmons and Gurr 2004). Moreover, the feeding time of H.

zea was significantly longer on the hl genotype compared to the parent wild type (cv. Alisa

Craig). Larval H. zea spent more time feeding and had enhanced growth on the woolly genotype

compared to the parent wild type (cv. Rutgers). These results indicate that the absence of

glandular trichomes combined with a high density of non-glandular trichomes greatly enhances

H. zea larval growth. We observed that larvae preferentially ingested the non-glandular

trichomes prior to feeding on the remaining leaf tissue. By comparison, when H. zea feed on

leaves with high densities of glandular trichomes, they frequently are observed to remove the

trichomes and egest them (personal observations). Our results are quite different from the recent

finding in Nicotiana attenuata where neonate M. sexta preferentially consume tobacco glandular

trichomes as their first meal (Celorio-Mancera et al. 2011).

The results with the specialist beetle L. decemlineata were markedly different from what

we observed with H. zea. The L. decemlineata growth was not improved when larvae fed on the

hl genotype compared to the wild type parent. The hl mutant possesses a low density of

glandular trichomes and reduced total terpenes in the leaves compared to the wild type plants.

Although beetle larvae were observed to feed for longer bouts on the hl mutant leaf compared to

87

wild plants, this did not result in improved growth during the time course of our bioassay. Our

bioassay results were different from Kang et al (2010b). They investigated resistance of the

odorless-2 (od-2) mutant and found that larval growth of L. decemlineata was significantly

increased on od-2 mutant compared to wild type plants. Although od-2 possesses a normal

glandular trichome phenotype, the levels of terpenes and flavonoids in the trichomes are

compromised. In our study we used L. decemlineata which originated from tomato fields and

has been reared solely on tomato. Perhaps our colony is better adapted to tomato and is not as

sensitive to the level of terpenes and flavonoids in the glandular trichomes. The most surprising

results we observed were with the woolly genotype which negatively influenced larval beetle

weight gain and feeding time. We observed that L. decemlineata larvae prefer to feed on leaves

with very low density of trichomes. We observed that larval L. decemlineata had difficulty

finding a suitable feeding site on the woolly mutant leaf which contains a very high density of

non-glandular trichomes (personal observation). These results indicate that non-glandular

trichomes although harmless or perhaps even beneficial for caterpillar growth, were detrimental

to beetle feeding and growth.

We did not find that trichomes impacted oviposition by either insect species in the

genotypes we tested. Levin (1973) and others have reported that trichomes influence insect

oviposition in a wide range of insects and that trichome length on the leaf surface is often

negatively correlated with the number of eggs laid. But in our study, using a choice-test, H. zea

and CPB adults did not exhibit ovipositional preference for any of the genotypes tested. While

we cannot conclude that trichomes have no effect on oviposition for these insects, at least for

these genotypes there was not sufficient variation in trichome type or density to uncover

differences in ovipositional preference.

88

Trichome density is often inducible by insect herbivory or by plant hormones (Kessler et

al. 2011; Traw and Dawson 2002b). Trichome density is regulated by jasmonates,

brassinosteroids and ethylene in tomato (Boughton et al. 2005; Campos et al. 2009). In fact,

induction of glandular trichomes by herbivory, wounding, or MeJA treatment in the parent

generation persists in the offspring of the parents (Rasmann et al. 2012). In this study, both

glandular and non-glandular types of trichomes were up-regulated by MeJA, although the

specific trichome type was not induced by hormone treatment. When plants were treated with

MeJA, H. zea growth was significantly reduced on treated plants of all genotypes. The growth

of L. decemlineata was not affected by y MeJA treatment in the hl, AC or RU genotypes, except

in the case of the woolly mutant where the non-glandular trichome length was significantly

increased by MeJA treatment. The increase in the length of non-glandular trichomes may further

impair larval feeding. These results provide further support for the role of non-glandular

trichomes in resistance to L. decemlineata.

Trichomes are initiated in the epidermis of developing leaves; previous studies on

Arabidopsis have revealed several key regulators that participate in trichome formation and

induction (need references). The mechanisms trichome formation in tomato is less clear.

Previous study on hl mutant showed that the Hl gene plays an important role in the synthesis of

new cell wall material in developing trichomes. Cloning of the gene is needed to understand the

precise function of Hl in trichome development (Kang et al. 2010b). The woolly (Wo) gene is

responsible for trichome formation and regulates SlCyB2 gene expression that participates in

trichome formation. Suppression of Wo and SlCyB2 using RNAi on the mutant (LA3186)

produced low densities trichomes the leaf surface (Chen et al. 2008). In our study, we used a

89

different woolly mutant (LA0258) from the previous study and our results showed the SlCyB2

gene was also highly expressed in woolly trichomes.

While the induction of high densities of trichomes may impact herbivores, the secondary

metabolites produced by glandular trichomes may also negatively impact herbivore feeding and

growth. Transcriptional co-regulation is an important hallmark of genes involved in secondary

metabolite pathway and our results confirmed that there is high degree of association between

monoterpene and sesquiterpene content and gene expression (i.e., MTS1 (=TPS5) and SST1

(=TPS9) ). In addition to terpenes, glandular trichomes contained other defenses including anti-

nutritive proteins and phenolics, thus it is not surprising that tomato glandular trichomes have

been implicated in resistance to a variety of herbivore species including caterpillars and aphids

(Chen et al. 2008; Kang et al. 2010b). For instance, trichomes of many Solanum species

accumulate significant levels of polyphenol oxidase and play roles in the oxidation of phenolics

that may defend against insects and pathogens (Thipyapong et al. 1997). Proteinase inhibitors are

another class of defensive proteins in tomato and can accumulate in many plant tissues which

affect insect growth (Kang et al. 2010a; Kang et al. 2010b; Ryan 1990). HPL is also associated

with plant development and defense. Our results confirmed that PIN2, PPOF and HPL are highly

expressed in glandular trichomes. High expression of these proteins in the trichomes may reduce

the nutritional quality of dietary protein available to H. zea (Felton and Duffey 1992), but not

that available to CPB (Felton et al. 1992) due to differences in the physico-chemical environment

of their digestive systems (Johnson and Felton 1996; Zhu-Salzman et al. 2008). Moreover, the

expression of the PIN2 gene in the trichomes is induced by H. zea feeding indicating that

herbivory may impact both the density of trichomes as well as their chemical composition.

90

Trichomes of the cultivated tomato are an important source of constitutive and inducible

resistance to insect herbivores and offer potential for exploitation in plant breeding programs.

Novel secondary metabolites are present in the glandular trichomes of wild species of tomato and

could be used for sources of host resistance been shown to produce numerous arthropod

defensive compounds (Karban and Baldwin 1997; Li et al. 2004). Our results with H. zea

provide further substantiation that glandular trichomes play a role in resistance; however, our

study provides several important caveats for development of host plant resistance programs.

Although, H. zea growth was compromised on the hl mutant, the growth of L. decemlineata was

not. The use of non-glandular trichomes may be useful in resistance programs to L.

decemlineata, but could inadvertently enhance susceptibility to some insects such as H. zea.

Thus our findings underscore the necessity to clarify the roles of specific trichomes to different

herbivorous insect species before embarking on a comprehensive plant breeding program.

Acknowledgments: The support of the United State Department of Agriculture, National

Research Initiative is greatly appreciated (2007-35302-18218, awarded to G.W.F.). Tomato

seeds were provided by the Tomato Genetics Resource Center (University of California, Davis,

CA, USA)

91

Reference

Agrawal AA, Conner JK, Johnson MTJ, Wallsgrove R (2002) Ecological genetics of an

induced plant defense against herbivores: additive genetic variance and costs of

phenotypic plasticity. Evolution 56: 2206-2213

Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores

and plant fitness. Ecology 80: 1713-1723

Agren J, Schemske DW (1994) Evolution of trichome number in a naturalized population of

Brassica rapa. American Naturalist 143(1):1-13

Andrade A, Vigliocco A, Alemano S, Miersch O, Botella MA, Abdala G (2005) Endogenous

jasmonates and octadecanoids in hypersensitive tomato mutants during germination and

seedling development in response to abiotic stress. Seed Science Research 15: 309-318

Arimura GI, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.

Biophys. Acta (BBA)- Mol. Cell Biol. Lipids 1734: 91-111

Bansal R, Hulbert S, Schemerhorn B, Reese JC, Whitworth RJ, Stuart JJ, Chen MS (2011)

Hessian fly-associated bacteria: transmission, essentiality, and composition. Plos One 6

Besser K, Harper A, Welsby N, Schauvinhold I, Slocombe S, Li Y, Dixon RA, Broun P (2009)

Divergent regulation of terpenoid metabolism in the trichomes of wild and cultivated

tomato species. Plant Physiol. 149: 499-514

Bostock RM (2005) Signal crosstalk and induced resistance: Straddling the line between cost and

benefit. Annual Review of Phytopathology 43: 545-580

Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased

densities of glandular trichomes on tomato, Lycopersicon esculentum. Journal of

Chemical Ecology 31: 2211-2216

Campos ML, de Almeida M, Rossi ML, Martinelli AP, Litholdo CG, Figueira A, Rampelotti-

Ferreira FT, Vendramim JD, Benedito VA, Peres LEP (2009) Brassinosteroids

interact negatively with jasmonates in the formation of anti-herbivory traits in tomato.

Journal of Experimental Botany 60: 4346-4360

Celorio,MM, Courtiade J, Muck A, Heckel DG, Musser RO, Vogel H (2011) Sialome

of a generalist lepidopteran herbivore: identification of transcripts and proteins from

Helicoverpa armigera labial salivary glands. Plos One 6: e26676

Chen MS, Zhao HX, Zhu YC, Scheffler B, Liu X, Liu X, Hulbert S, Stuart JJ (2008) Analysis

of transcripts and proteins expressed in the salivary glands of Hessian fly (Mayetiola

destructor) larvae. Journal of Insect Physiology 54: 1-16

Chen MS, Liu XM, Yang ZH, Zhao HX, Shukle RH, Stuart JJ, Hulbert S (2010) Unusual

conservation among genes encoding small secreted salivary gland proteins from a gall

midge. Bmc Evolutionary Biology 10

Chung SH, Felton GW (2011) Specificity of induced resistance in tomato against specialist

Lepidopteran and Coleopteran species. Journal of Chemical Ecology 37: 378-386

Creelman RA, Mullet JE (1995) Jasmonic acid distribution and action in plants: regulation

during development and response to biotic and abiotic stress. Proc Natl Acad Sci U S A

92: 4114-4119

Dalin P, Björkman C (2003) Adult beetle grazing induces willow trichome defence against

subsequent larval feeding. Oecologia 134: 112-118

Dimock MB, Kennedy GG, Williams WG (1982) Toxicity studies of analogs of 2-tridecanone, a

naturally-occurring toxicant from a wild tomato. Journal of Chemical Ecology 8: 837-842

92

Duffey SS (1986) Plant glandular trichomes: their partial role in defence against insects. In:

Juniper BE, Southwood TE (eds) Insects and the plant surface Arnold, London, England,

pp 151-172

Felton GW, Bi JL, Summers CB, Mueller AJ, Duffey SS (1994) Potential role of lipoxygenases

in defense against insect herbivory. J Chem Ecol 20: 651-666

Felton GW, Duffey SS (1992) Ascorbate oxidation reduction in Helicoverpa Zea as a

scavenging system against dietary oxidants. Archives of Insect Biochemistry and

Physiology 19: 27-37

Felton GW, Workman J, Duffey SS (1992) Avoidance of antinutritive plant defense - role of

midgut pH in Colorado potato beetle. Journal of Chemical Ecology 18: 571-583

Fridman E, Wang JH, Iijima Y, Froehlich JE, Gang DR, Ohlrogge J, Pichersky E (2005)

Metabolic, genomic, and biochemical analyses of glandular trichomes from the wild

tomato species Lycopersicon hirsutum identify a key enzyme in the biosynthesis of

methylketones. Plant Cell 17: 1252-1267

Gang DR, Wang J, Dudareva N, Nam KH, Simon JE, Lewinsohn E, Pichersky E (2001) An

investigation of the storage and biosynthesis of phenylpropenes in sweet basil. Plant

Physiol. 125: 539-555

Goffreda JC, Mutschler MA, Ave DA, Tingey WM, Steffens JC (1989) Aphid deterrence by

glucose esters in glandular trichome exudate of the wild tomato, Lycopersicon pennellii.

Journal of Chemical Ecology 15: 2135-2147

Green TR, Ryan CA (1972) Wound-induced proteinase inhibitor in plant leaves: a possible

defense mechanism against insects. Science 175: 776-777

Halitschke R, Stenberg JA, Kessler D, Kessler A, Baldwin IT (2008) Shared signals - 'alarm

calls' from plants increase apparency to herbivores and their enemies in nature. Ecology

Letters 11: 24-34

Handley R, Ekbom B, Agren J (2005) Variation in trichome density and resistance against a

specialist insect herbivore in natural populations of Arabidopsis thaliana. Ecological

Entomology 30: 284-292

Heinz KM, Zalom FG (1995) Variation in trichome-based resistance to bemisia-argentifolii

(Homoptera, Aleyrodidae) oviposition on tomato. J. Econ. Entomol. 88: 1494-1502

Higgins R, Lockwood T, Holley S, Yalamanchili R, Stratmann J (2007) Changes in extracellular

pH are neither required nor sufficient for activation of mitogen-activated protein kinases

(MAPKs) in response to systemin and fusicoccin in tomato. Planta 225: 1535-1546

Hogenhout SA, Bos JIB (2011) Effector proteins that modulate plant–insect interactions. Current

Opinion in Plant Biology 14: 422-428

Horgan FG, Quiring DT, Lagnaoui A, Pelletier Y (2009) Effects of altitude of origin on

trichome-mediated anti-herbivore resistance in wild andean potatoes. Flora 204: 49-62

Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant

Biology 59: 41-66

Johnson KS, Felton GW (1996) Potential influence of midgut pH and redox potential on protein

utilization in insect herbivores. Arch Insect Biochem Physiol 32: 85-105

Kang JH, Liu G, Shi F, Jones AD, Beaudry RM, Howe GA (2010a) The Tomato odorless-2

mutant Is defective in trichome-based production of diverse specialized metabolites and

broad-spectrum resistance to insect herbivores. Plant Physiol.: pp.110.160192

Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010b) Distortion of trichome morphology

93

by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental

Botany 61: 1053-1064

Karban R, Baldwin IT (1997) Induced responses to herbivory. University of Chicago Press

Kennedy GG (2003) Tomato, Pests, parasitoids, and predators: Tritrophic interactions involving

the genus Lycopersicon. Annual Review of Entomology 48: 51-72

Kessler A, Halitschke R, Poveda K (2011) Herbivory-mediated pollinator limitation: negative

impacts of induced volatiles on plant-pollinator interactions. Ecology 92: 1769-1780

Li AX, Eannetta N, Ghangas GS, Steffens JC (1999) Glucose polyester biosynthesis. Purification

and characterization of a glucose acyltransferase. Plant Physiology 121: 453-460

Li L, Zhao YF, McCaig BC, Wingerd BA, Wang JH, Whalon ME, Pichersky E, Howe GA

(2004) The tomato homolog of CORONATINE-INSENSITIVE1 is required for the

maternal control of seed maturation, jasmonate-signaled defense responses, and glandular

trichome development. Plant Cell 16: 126-143

Luckwill LC (1943) The genus Lycopersicon: A historical, biological and taxonomic survey of

the wild and cultivated tomato. Aberd. Univ. Stud. 120: 1-44

Ma KW, Flores C, Ma W (2011) Chromatin configuration as a battlefield in plant-bacteria

interactions. Plant Physiology 157: 535-543

Mirnezhad M, Romero-Gonzalez RR, Leiss KA, Choi YH, Verpoorte R, Klinkhamer PGL

(2010) Metabolomic analysis of host plant resistance to thrips in wild and cultivated

tomatoes. Phytochem. Anal. 21: 110-117

Neill SJ, Desikan R, Clarke A, Hurst RD, Hancock JT (2002) Hydrogen peroxide and nitric

oxide as signalling molecules in plants. Journal of Experimental Botany 53: 1237-1247

O'Donnell PJ, Calvert C, Atzorn R, Wasternack C, Leyser HMO, Bowles DJ (1996) Ethylene as

a signal mediating the wound response of tomato plants. Science 274: 1914-1917.

Panizzi AR (1997) WILD HOSTS OF PENTATOMIDS:Ecological Significance and role in

their pest status on crops. Annual Review of Entomology 42: 99-122

Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary

glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113

Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as

sensors for insect herbivores. New Phytologist 184: 644-656

Pelletier Y, Dutheil J (2006) Behavioural responses of the Colorado potato beetle to trichomes

and leaf surface chemicals of Solanum tarijense. Entomologia Experimentalis et

Applicata 120: 125-130

Radhika V, Kost C, Boland W, Heil M (2010) The role of jasmonates in floral nectar secretion.

Plos One 5: e9265

Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, Felton GW,

Jander G (2012) Herbivory in the previous generation primes plants for enhanced insect

resistance. Plant Physiology PMID: 22209873

Reeves AF (1977) Tomato trichomes and mutations affecting their development American

Journal of Botany. 64: 186–189

Rotenberg D, Thompson TS, German TL, Willis DK (2006) Methods for effective real-time RT-

PCR analysis of virus-induced gene silencing. Journal of Virological Methods 138: 49-59

Ryan CA (1990) Proteinase inhibitors in plants: genes for improving defenses against insects and

pathogens. Ann Rev Phytopathol 28: 425

Schilmiller A, Shi F, Kim J, Charbonneau AL, Holmes D, Jones AD, Last RL (2010) Mass

94

spectrometry screening reveals widespread diversity in trichome specialized metabolites

of tomato chromosomal substitution lines. Plant Journal 62: 391-403

Seo S, Sano H, Ohashi Y (1999) Jasmonate based wound signal transduction requires

activation of WIPK,a tobacco mitogen-activated protein kinase.The Plant Cell 11:289-

298

Simmons AT, Gurr GM (2004) Trichome-based host plant resistance of Lycopersicon species

and the biocontrol agent Mallada signata: are they compatible? Entomologia

Experimentalis et Applicata 113: 95-101

Simmons AT, Gurr GM (2005) Trichomes of Lycopersicon species and their hybrids: effects on

pests and natural enemies. Agricultural and Forest Entomology 7: 265-276

Steffens JC, Walters DS (1991) Biochemical aspects of glandular trichome-mediated insect

resistance in the Solanaceae. Acs Symposium Series 449: 136-149

Stout MJ, Zehnder GW, Baur ME (2002) Potential for the use of elicitors of plant resistance in

arthropod management programs. Archives of Insect Biochemistry and Physiology 51:

222-235

Stratmann JW, Ryan CA (1997) Myelin basic protein kinase activity in tomato leaves is induced

systemically by wounding and increases in response to systemin and

oligosaccharide elicitors. Proceedings of the National Academy of Sciences 94: 11085-

11089

Thaler JS, Stout MJ, Karban R, Duffey SS (2001) Jasmonate-mediated induced plant resistance

affects a community of herbivores. Ecol Entomol 26: 312-324

Thipyapong P, Joel DM, Steffens JC (1997) Differential expression and turnover of the tomato

polyphenol oxidase gene family during vegetative and reproductive development. Plant

Physiology 113: 707-718

Thipyapong P, Steffens JC (1997) Tomato polyphenol oxidase - Differential response of the

polyphenol oxidase F promoter to injuries and wound signals. Plant Physiology 115: 409-

418

Toth GB, Langhamer O, Pavia H (2005) Inducible and constitutive defenses of valuable seaweed

tissues: consequences for herbivore fitness. Ecology 86: 612-618

Traw MB, Bergelson J (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin

on induction of trichomes in Arabidopsis. Plant Physiology 133: 1367-1375

Traw MB, Dawson TE (2002) Reduced performance of two specialist herbivores (Lepidoptera :

Pieridae, Coleoptera : Chrysomelidae) on new leaves of damaged black mustard plants.

Environmental Entomology 31: 714-722

Wagner GJ (1991) Secreting glandular trichomes - more than just hairs. Plant Physiology 96:

675-679

Zhu-Salzman K, Luthe DS, Felton GW (2008) Arthropod-inducible proteins: broad spectrum

defenses against multiple herbivores. Plant Physiol. 146: 852-858

95

Table .1. Primers used for real-time PCR assays of relative gene expression

Primer Gene name/accession number Primer sequence (5’-3’) PIN2 Wound-inducible proteinase

inhibitor 2 K03271 F: GGA TTT AGC GGA CTT CCT TCT G R: ATG CCA AGG CTT GTA CTA GAG AAT

MTS1 (=TPS5)

Monoterpene synthase TC191446

F: GTA ACA TAG GGA TGA TGG TGG TCA CCTT R: CTG AAC GCC TTG TGG TGG AAAT

SST1 (=TPS9)

Sesquiterpene synthase TC197727

F: AGC AAA CCT TAG AAC AAA CAA GCAA R: CCA AAC AGT TGG GTG AAA ATT AGC

PPO Polyphenol oxidase Z12838

F: ATG TGG ACA GGA TGT GGA ACG AGT R:ACT TTC ACG CGG TAA GGG TTA CGA

SlCycB2 B-type cyclin F: TGA GCA GGA GAA ATG GAA R: CAT TGT CAG CGA CCT TGT

HPL Hydroperoxide lyase AY028373

F:CCT CGG CGC TGA TCC ATC TGT CTCC R:CTT GCA TAT CCG GGT TTT TCT CAT CTC

Ubi Ubiquitin X58253

F: GCC AAG ATC CAG GAC AAG GA R: GCT GCT TTC CGG CGA AA

96

Figure legends

Fig. 1. Morphology of trichomes on mutant and wild type leaf and stem, and induction by methyl

jasmonate (MeJA): (a-c) woolly mutant trichome on leaf , stem and MeJA induction (d-f) Wild type

Rutgers (RU) trichomes on leaves and stems, (g-i) hairless (hl) mutant trichome on leaves and stems and

induction by MeJA, (j –l) wild type Alisa Craig (AC) trichomes

Fig. 2. Trichome morphology on leaves in wild type and hl, woolly mutant plants under scanning electron

microcope: a) woolly mutant with type I and type III trichomes b) hl mutant showing fewer trichomes,

mostly type VI trichomes, and some distored type I trichomes. c) wild type RU leaf with type I, IV and

VI trichomes. d) wild type AC leaf with type I, IV and VI trichomes

Fig. 3. Trichome density on hl, woolly mutant and wild type plants and induction by MeJA. a) Density of

non-glandular trichome on hl, woolly mutant and wild type leaves , induction by MeJA. b) Density of

glandular trichome on hl, woolly mutant and wild type leaves and induction by MeJA. c) Trichome

length induced by MeJA. Data show trichome density as the mean (±SE) trichome number of 20 replicate

leaves of 4th leaf, trichome length is the mean (±SE) mm of 15 non-glandular trichomes on different

leaves . Means followed by different letters are significantly different at P= 0.05).

Fig. 4. Representative total ion chromatograms showing MTBE extractions of leaf trichomes from a)

Rutgers (RU; wild type for woolly), b) woolly (non-glandular trichomes), c) hl (glandular trichomes).

Compounds are: 1) α-pinene, 2) unknown monoterpene, 3) cis-3-hexenyl acetate, 4) β--phellandrene, 5)

nonyl acetate (external standard).

Fig. 5. Comparison of monoterpenes and sesquiterpenes levels in mutant and wild type leaves and stems.

a) Monterpenes in stem and stem b) Sesquiterpenes in stem and leaf c) Leaf dip method for comparion

monoterpenes and sesquiterpenes. Each data point represents the mean±SE of three replicates. Means

followed by different letters are significantly different at P= 0.05).

Fig. 6. Relative gene expression in different types of trichomes in hl, woolly and wild type. Trichomes

were extracted from 30 plant leaves, relative expression is calculated to wild type RU leaf RNA. Bars

indicates standard error of three technical replicates. PIN2 proteinase inhibitor 2 gene, MTS1 (=TPS5)

monosesquiterpene synthase 1 gene, SST1 (=TPS9) Sessquiterpene synthase 1, PPO polyphenol oxidase

gene. SlCycB2, B type cyclin gene. HPL, Hydroperoxide lyase gene. Means followed by different letters

are significantly different at P= 0.05).

Fig. 7. hl and woolly mutant affect Helicoverpa zea and Colorado potato beetle growth and feeding time.

No choice bioassay were performed by placing first instar H. zea and CPB for 4 days bioassay. a) hl,

woolly mutants and wild type influence H. zea growth . b) hl, woolly mutants and wild type influence

CPB growth . c) Feeding time influenced by different mutants compared to wild type plants. Data

represents mean±SE of larval weight (n=30); data of feeding time represents mean±SE of larvae (n=15)

feeding on leaves. Means followed by different letters are significantly different at P= 0.05).

Fig.8. H. zea feeding induced relative expression of proteinase inhibitor 2 (PIN2) in mutant and wild

type plants. woolly is the woolly (hairy) mutant, hl is the hairless mutant, RU and AC are the wild type of

woolly and hl mutant. Relative expression of PIN2, Means followed by different letters are significantly

different at P= 0.05).

97

Fig.S1. Oviposition choice on different mutants. Not significantly different among the mutants. F= 0.03,

P= 0.993 for H. zea; F=0.09, P=0.967 for CPB (n=8)

Fig .S2. Oviposition of H. zea and CPB in woolly mutant. a) H .zea egg on woolly leaf surface with

non-glandular trichomes. b) H .zea eggs on woolly stem with both glandular and glandular trichomes c)

CPB lay eggs on underside leaf of woolly mutant

98

Fig.1.

99

Fig.2.

100

Fig.3.

101

Fig.4.

a)

b)

c)

102

Fig. 5

103

Fig. 6

104

Fig. 7.

105

Fig.8.

106

Fig.S1.

107

Fig. S2.

108

Table S 1. Monoterpene in mutant and wild type trichomes (ng/fresh weight g)

(Z)-3-hexen-1-ol α-pinene β-pinene Myrcene (Z)-3-hexenyl acetate eBocimene Linalool β-phellandrene

hl stem 365.8±78.3 672.7±10.1 84.1±23.1 131.7±7.1 6251.6±57.7 119.6±25.8 62.1±10.5 15621.4±240.6

hl leaf 3123.0±634.6 3909.7±336.7 3966.0±436.8 497.5±45.4 26545.9±245.9 7081.5±726.9 290.5±32.6 78232.8±1172.2

AC stem 321.3±10.7 1054.7±151.8 196.6±13.9 nd 9448.8±1218.5 nd 19.2±2.4 24573.6±582.6

AC leaf 1616.9±184.8 1559.9±141.1 2163.7±108.5 Nd 12971.3±965.8 nd 175.5±42.5 35440.6±505.4

woolly stem 261.9±30.5 625.1±33.4 69.2±25.8 142.2±53.9 5026.6±147.7 169.9±57.4 56.1±3.2 14469.9±796.4

woolly leaf 65.3±10.2 177.8±5.7 nd 98.8±6.3 1341.1±38.2 79.0±21.3 90.4±8.7 4316.6±267.5

RU stem 229.8±6.6 1313.2±27.3 153.7±42.1 184.3±43.1 9488.9±121.8 235.6±46.4 23.5±5.1 30009.8±1158.2

RU leaf 268.4±21.8 1752.1±14.1 189.5±26.9 231.6±16.1 12137.4±53.7 307.7±14.1 28.0±8.5 37958.8±338.6

109

Table S 2. Sesquiterpenes in mutant and wild type trichomes (ng/fresh weight g)

z-3-hexenyl butyrate e-2-hexenyl butyrate z-jasmone caryophyllene α-humulene β-farnescene nerolidol

hl stem Nd 76.17±10.39 18.22±5.68 33.62±2.93 nd nd nd

hl leaf 643.07±78.8 2318.10±323.33 704.62±88.77 902.62±152.55 282.14±29.67 354.61±39.43 206.77±25.73

AC stem 17.2±5.12 67.43±18.07 35.69±13.81 64.98±16.35 nd 11.75±2.53 nd

AC leaf 234.87±67.3 786.18±232.68 340.80±69.85 582.34±168.57 144.13±27.95 147.22±34.98 141.18±43.29

woolly stem nd 53.23±5.19 15.25±6.31 23.70±14.32 nd 6.47±3.49 nd

Woolly leaf nd nd 31.47±10.23 81.92±18.59 35.21±3.73 21.95±10.23 34.08±2.48

RU stem 49.54±4.98 128.91±10.89 54.29±7.05 40.92±3.68 24.46±4.78 21.18±4.50 22.84±1.59

RU leaf 59.66±1.82 150.85±3.38 68.19±3.69 80.25±7.47 31.514.68 22.68±5.77 27.27±3.87

110

Chapter IV

Roles of Ethylene and Jasmonic Acid in Systemic Induced Defense in

Tomato (Solanum lycopersicum) against Helicoverpa zea

Donglan Tian, Michelle Peiffer, Consuelo DeMoraes and Gary W. Felton1

Department of Entomology

Center for Chemical Ecology

Penn State University

University Park, PA 16802

1 Corresponding author. gwf10@psu.edu

111

Abstract

The plant defense-signaling is mediated by the synthesis, movement, and perception of

jasmonate (JA), and through the interaction with other plant hormones and messengers. To

characterize the interaction of ethylene and JA on induced defenses in tomato, we used the never

ripe (Nr) mutant, which contains a partial block in ethylene perception and the defenseless (def1)

mutant, which is deficient in JA biosynthesis. The defense gene proteinase inhibitor (PIN2) was

used as marker gene to compare plant responses. The Nr mutant showed a normal wounding

response with PIN2 induction, whereas the def1 mutant did not. As expected, methyl JA (MeJA)

treatment restored the normal wound response in the def1 mutant. Exogenous application of

MeJA increased resistance to Helicoverpa zea, induced defense gene expression, and increased

glandular trichome density on systemic leaves. Exogenous application of ethephon, which

penetrates tissues and decomposes to ethylene, resulted in increased H. zea growth and interfered

with the wounding response. Ethephon treatment increased salicylic acid (SA) in the systemic

leaves. These results showed that while JA plays the main role in systemic induced defense,

ethylene acted antagonistically to negatively regulate systemic defense in tomato to H. zea.

Key words: methyl jasmonate, ethephon, induced systemic defense, insect herbivore, trichomes,

proteinase inhibitor, hormones, jasmonic acid, salicylic acid, and elicitors

112

Abbreviations:

Nr Never ripe mutant

def1 Defenseless 1 mutant

RU Rutgers wild type plants of Nr mutant

CM Castlemart , wild type plants of def1 mutant

MeJA methyl jasmonate

PIN2 protease inhibitor 2

ERF1 ethylene response factor

PR1 pathogenesis related gene

PPOF polyphenol oxidase

ET

SA

ethylene

salicylic acid

113

Introduction

Biotic and abiotic stresses negatively impact plant health and fitness. Plants respond to

the biotic stress of insect herbivores and pathogens by inducing systemic resistance pathways.

Plant hormones play important role in regulating this defensive process (Erb et al. 2012; Howe

and Jander 2008). Among them, jasmonic acid (JA), salicylic acid (SA), ethylene (ET) and

abscisic acid (ABA) have been intensively investigated in terms of plant defense against

pathogen infection or insect herbivory (Abe et al. 2011; Fan et al. 2009; Leon-Reyes et al. 2009).

Other plant hormones, such as brassinosteroids (BA), gibberellins (GAs) and auxins have also

been reported as part of the defense-signaling network (Navarro 2006; Yasuda et al. 2003;

Zsogon et al. 2008).

JA is a naturally occurring phytohormone that occurs ubiquitously in plant species and

functions in regulation of seed germination, root growth, pollen development and fruit ripening

(Zhang et al. 2011). In addition to its role in plant growth development, JA and its precursors

perform an important function in regulating host defensive responses. The regulation of plant

defense by JA has been studied by observing the gene expression patterns following exogenous

application of jasmonates or through the use of loss of function or gain of function mutants

(Browse 2009; Howe 2004). Proteinase inhibitors (PINs) and polyphenol oxidases (PPO) are

two of the best studied groups of JA-regulated defense proteins in vegetative tissues. Wound-

induced proteinase inhibitors have been shown to enhance the plant’s resistance to insects by

inhibiting the proteolytic enzymes of the attacking insects (Koiwa et al. 1998). In some instances,

JA partially regulates trichome production, which functions in plant defense (Halitschke et al.

2008; Li et al. 2004; Traw and Bergelson 2003;Tian et al. 2012b). In tomato, application of

methyl jasmonate (MeJA) increases densities of glandular trichomes on new leaves (Boughton et

114

al. 2005). The inducibility of trichome density is ecologically significant because increased

trichome density can negatively influence herbivore populations (Agrawal 1999; Horgan et al.

2009; Kessler et al. 2011).

In addition to jasmonic acid, additional plant hormones are known to regulate plant

defenses. Ethylene was the first identified gaseous hormone and it is involved in many plant

physiological process throughout plant development including, seed germination, flowering, fruit

ripening, organ senescence and response to stress (Zhang et al. 2010). Previous study showed

that the key components of ethylene biosynthesis, 1-amino-cyclopropane - 1carboxylic acid

synthesis (ACS) and 1-aminocyclopropane-carboxylic acid oxidase (ACO) are critical for

ethylene biosynthesis (An et al. 2006; Yang and Hoffman 1984). Regulation of the ethylene

pathway is important in mediating plant development and stress response (Diaz et al. 2002;

Mantelin 2009; Zhang et al. 2011). Ethylene accumulation during pathogen infection up-

regulates the expression of many genes in plants (Diaz et al. 2002). Ethylene response factors

(ERFs), which represent the second largest transcription factor family in plants, have been shown

to integrate signals from different plant hormone pathways and play important roles in stress

response (Onate-Sanchez et al. 2007).

Hormone cross talk is a process where different hormone signaling pathways interact

antagonistically or synergistically to regulate responses to complex and changing environments

(Verhage et al. 2010). There is ample evidence for cross talk among SA, JA and ET signaling

pathways in plant immunity (Leon-Reyes et al. 2009). Cross talk likely minimizes fitness costs

and creates a flexible signaling network that allows the plant to fine-tune its defense response to

the appropriate invaders (Bostock 2005; Thaler et al. 2012;Pieterse and Dicke 2007). In some

instances, JA may collaborate with the SA response pathway to trigger an indirect defense

115

against an insect herbivore as observed in Arabidopsis (van Poecke and Dicke 2002). Walling

(2000) found that phloem-feeding insects may induce both SA and JA dependent pathways.

Simultaneous expression of SA and JA pathways was observed in the Mi-gene mediated

resistance in tomato during aphid feeding (Martinez de Ilarduya et al. 2003). While in tobacco, it

was observed that there was an inverse relationship between endogenous concentrations of SA

and JA (Felton et al. 1999). Exogenous application of SA has been shown to inhibit both JA

synthesis and downstream defenses in tomato (Chandok et al. 2004; Thaler et al. 2010).

Moreover it was shown that ET enhanced the plant response to SA, resulting in the expression of

the SA-responsive marker gene pathogenesis-related-1 (PR-1) (Leon-Reyes et al. 2009). ET can

synergistically or antagonistically interact with JA in the regulation of plant development and

stress responses (O'Donnell et al. 1996; Zhao 2003). Many defense-related genes such as

proteinase inhibitors are regulated via a signaling pathway that requires both ET and JA (Adie et

al. 2007a; Pieterse et al. 1998). In maize, the inhibition of ET biosynthesis or perception

increased herbivore performance and damage in treated plants (Harfouche et al. 2006). However

ethylene acts antagonistically to suppress JA induced expression of nicotine biosynthesis in

tobacco (Rojo et al. 1999; Shoji et al. 2000). Exogenous ethylene application on Arabidopsis

increased the growth rate of the Egyptian cotton worm (Mantelin 2009; Stotz et al. 2000). These

studies on the interaction of plant hormones frequently show different impacts on plant defense,

but some of the differences may be attributed to varied methodologies, treatments, etc.

Furthermore, the interaction of plant hormones in defense depends on the specific plant-

herbivore system studied.

Tomato has been a primary model system for elucidating induced defenses and their

signaling pathways against herbivores, yet most of the research has focused on signaling and

116

rapidly-induced defenses in leaves (Melotto et al. 2008). Considerably less study has focused on

systemic induction and the induction of defenses that require days to weeks to generations for

expression (Rasmann et al. 2011; Tian et al. 2012a). In this study, we used tomato mutants and

application of hormones to dissect the interactions of JA and ethylene that regulate plant

systemic defense to a chewing herbivore, Helicoverpa zea. We used the tomato never ripe (Nr)

mutant, which is impaired in ethylene-mediated plant response and the def1 mutant which is

deficient in JA biosynthesis to study the hormone interactions. We used a combination of insect

bioassay, defense gene expression, and plant hormone analysis to identify the key interactions

between JA and ethylene.

Materials and Methods

Plant materials and insects

Tomato (Lycopersicon esculentum) seeds of the def1 mutant and wild type Castlemart

(CM) were kindly provided by Dr. Gregg Howe (Michigan State University). Seeds for the Nr

mutant (accession number LA3001) and the wild type Rutgers (RU, accession number LA1090)

were obtained from the Tomato Genetics Resource Center (University of California, Davis). All

the plants were grown in Metromix 400 potting mix (Griffin Greenhouse & Nursery Supplies

Tewksbury, MA) in a greenhouse at Pennsylvania State University, University Park, PA, USA).

The greenhouse was maintained on a 16-h photoperiod (Peiffer and Felton 2005). Tomato

fruitworm (Helicoverpa zea) eggs were purchased from BioServ (Frenchtown, NJ) and were

reared on a wheat germ and casein-based artificial diet (Chippendale 1970) with ingredients from

Bioserv.

Plant treatments

117

To compare the effect of exogenous hormones on plant defense, tomato plants were

sprayed with 2.5mM methyl jasmonate (MeJA) in 0.8% ethanol or 3mM ethephon (2-

chloroethylphosphonic acid, CEPA, Sigma, St. Louis, MO, USA) at the four-leaf-stage. The

treated plants were allowed to grow in the greenhouse for another two weeks after treatment.

Two weeks after the spray treatments, the plant height was measured to compare how the

exogenous hormones affected plant growth. Two leaf discs from the top fully expanded leaf

were cut from each side of the mid-vein. Glandular trichome numbers were counted under a light

microscope on each leaf disc. The density of trichomes was calculated as the number per

disc/cm2.

To compare how plant hormones regulate the wounding response, two weeks after

treatment, the newly emerged leaves on treated tomato plants were mechanically wounded by

punching two ¼ inch diameter holes along the mid-vein of the terminal leaflet. Twenty-four

hours after the wounding treatment, the wounded leaf was used for RNA extraction and gene

expression assay.

To examine the effect of hormone treatment on seedling growth, we surface sterilized

seeds and allowed them to germinate on agar plates with 100µM MeJA or 100µg/L ethephon in

Murashige and Skoog (MS) medium (Sigma, St. Louis, USA). One week later, we compared

seedling growth by measuring the hyopocotyl and root length. Also we collected the seedlings to

compare the effect of hormone treatment on defense gene expression.

Insect Bioassays

To determine if the hormones directly affected fruitworm growth, we used an artificial

diet bioassay. Based on diet weight, 100µg/g MeJA or 100µg/g ethephon was added on the diet

118

surface. After twenty minutes of drying, one neonate larva was placed in each cup. A total of

thirty larvae were tested per treatment.

Detached leaf bioassays were conducted to compare how different plant treatments

affected insect growth. Newly hatched H. zea larvae were reared on artificial diet for one day

before transfer to the bioassay cups. A detached newly emerged leaf from plants was used for the

bioassay. The treated leaves were put in a standard 1 oz. cup (BioServ, Frenchtown, NJ) with 2%

agar on the bottom to maintain moisture. Insects were kept at 27º C, with a 16:8 L:D photoperiod

in an incubator. Thirty insects were used for each treatment. After five days, larval weights were

recorded to the nearest 0.1 mg.

A choice test with MS medium grown seedling was conducted to compare how different

treatments affect larval choice. The control and two treated seedlings were placed in the edge of

a 150x15mm petri-dish and fifteen first instar larvae were placed in the center. All experiments

were repeated three times. After 24 hours, we compared the number of caterpillars on each

seedling.

RNA extraction and quantification analysis

To extract RNA, 100 mg leaf sample for each replicate was homogenized in liquid

nitrogen and total RNA was purified with a RNeasy Plus Mini-kit (Qiagen,Valencia, CA, USA).

High Capacity Transcription kit (Applied Biosystems, Foster City, CA) was used for cDNA

synthesis. All quantitative RT-PCR (qRT-PCR) reactions used Power SYBR Green PCR Master

Mix and ran on 7500 Fast Real-Time PCR system (Applied Biosystems) following standard

protocols (10 min at 95ºC, with 40 cycles of 15s at 95ºC and 60s at 60ºC). The ubiquitin gene

was used as the housekeeping gene to normalize 2−ΔΔC(T) (Rotenberg et al. 2006).

119

Plant hormone analysis

Plant hormone levels were determined two weeks after JA or ethephon treatment. To

measure hormones, 100 mg of newly emerged leaves were collected to into FastPrep® tubes

(Qbiogene, Carlsbad, CA) containing 1 g of Zirmil beads (1.1 mm; Saint-Gobain ZirPro,

Mountainside, NJ), and frozen at -80° C until processing. The new emerged leaf would not have

been directly exposed to the hormone treatments.

To extract and detect JA and SA, we used a previously described method (Tooker and De

Moraes, 2005) which was modified slightly from (Schmelz et al. 2003). Briefly, we derivatised

the carboxylic acid to its methyl ester, which was isolated using vapor phase extraction and

analyzed by GC-MS with isobutane chemical ionization using selected-ion monitoring.

Statistical Analysis

Data were analyzed using general linear models for analysis of variance (ANOVA) where

appropriate with post-hoc comparison of means using the Fisher-LSD means separation

(MiniTab Software, State College, PA).

Results

Hormone application with ethephon and MeJA affect tomato growth

To examine how MeJA and ethephon affect plant growth, plant height was measured two

weeks after treatments. The def1 and Nr mutant without hormone treatment grew normally

during this period and did not show any growth reduction compared to their respective wild type

plants. MeJA/ ethephon treatments exhibited significant changes on tomato growth. Compared

to the untreated plants, plant height in the Nr mutant was reduced 12.5 % by MeJA treatment and

31.0% by the ethephon treatment. While def1 mutant plant height was reduced 34.5 % and 69.2

120

% by each treatment respectively. Although Nr mutant displays reduced ethylene sensitivity, the

ethephon treatment still reduced growth. Both wild type plants showed significantly reduced

plant growth after the treatment. After ethephon treatment, the height of RU and CM plants were

reduced by 54.1% and 52.3% respectively. The MeJA treatment reduced the height by 22.6%

and 26.1% on both RU and CM plants (Fig. 1A, F=97.48, p<0.01.).

When MeJA and ethephon were both added to MS medium plates at same time, the

seedling growth was significantly affected by the treatment. Compared to control seedlings, both

MeJA and ethephon significantly reduced hypocotyls length and root growth (Fig. 1 B; F=28.73,

p<0.001and C; F=7.01, p<0.001).

Trichome production regulated by hormone application

A striking reduction in type VI glandular trichome density was observed on JA deficient

def1 mutant compared to the wild type CM trichome number (Fig. 2A; F=27.18, p<0.01). The

trichome numbers on the def1 mutant were 40.9% less than on CM. While the trichome numbers

on the Nr mutant did not show significant differences compared to wild type Rutgers (RU) plants

(Fig. 2B; F=0.15, p=0.696).

The MeJA and ethephon showed different effects on trichome production. The trichome

density on both mutants and wild type plants was significantly increased by MeJA treatment.

The def1 and CM showed a 67.5% and 71.4% increase respectively. The trichome density on Nr

and RU was increased by 81.6% and 71.5% compared to the untreated control. Conversely the

trichome density on ET-treated plants was decreased from 6.5%-27%, but with no significant

reduction compared to the untreated mutants and wild type plants (Fig 2 A, B.). These results

are consistent with a previous study where MeJA induced trichomes on new growth leaves and

confirms that JA plays important role in trichome formation (Boughton et al. 2005). The effects

121

of ethylene on trichome production have shown different results from previous studies, but may

be to due to differences in application time, concentration or different hosts (Gibson 2003; Plett

et al. 2009).

Hormone application and systemic resistance against H. zea

While various studies have shown that elicitors such as JA and ET regulate plant defense

to insect feeding (Adie et al. 2007a; Ankala et al. 2009), we determined if the elicitors had any

direct effects on the insect. MeJA or ethephon in diet did not directly affect larval growth rate

over a five-day feeding period (Fig. 3A; F=0.23, p=0.799).

We then tested the growth of larvae on the ethylene and JA mutants. The bioassays with

leaves from Nr mutant and RU wild type plants showed that H. zea growth was not significantly

different between the two genotypes (Fig. 3B; F=9.42, p<0.01). However, the growth of H. zea

significantly increased on the def1 mutant compared to its wild type CM (Fig. 3B). To assess

how JA and ET treatments of plants affected insect growth, the new growth leaves were removed

for bioassay. The results showed that treatment of plants with ethephon significantly increased

caterpillar growth on both mutants and wild type plants compared to control plants (Fig. 3B).

Because a small amount of ethanol is added to dissolve MeJA, we also used an ethanol control

treatment; nevertheless MeJA significantly reduced the caterpillar growth compared with the

ethanol treatment in all the mutants and wild type plants (Fig. 3C; F=17.91, p<0.01). The choice

test with MS medium grown seedlings showed ethephon treatment seedlings were more

attractive to first instar larvae than MeJA and control treatment (Fig. 3D; F=29.88, p<0.01).

MeJA and ethephon treatment effects on plant gene expression

122

Proteinase inhibitors (e.g., PIN2) are known to act as defensive proteins against insects

by affecting their larval nutrition (Ryan et al. 1986; Wasternack et al. 2006). The PIN2 defense

gene is mainly regulated by JA, which syntheses via the octadecanoid pathway (Howe 2004).

Our results showed there were no difference in the constitutive expression of PIN2 between the

Nr mutant and its wild type RU. While in the def1 PIN2 expression was significantly lower

compared to its wild type CM leaves as expected (Fig. 4A; F=8.19, p<0.01).

To investigate the roles of ET and JA in defense gene expression, we compared PIN2

expression on systemic leaves after ethephon or MeJA treatment. PIN2 expression on Nr mutant

was not significantly reduced after the ethephon treatment compared with untreated plants;

however the wild type plants showed significant reduction after the ethephon treatment.

Ethephon treatment on CM plants also significantly reduced PIN2 expression, but in the case of

the def1 mutant, the steady state levels of PIN2 are already very low and were not further

reduced by ethephon treatment. In general, the ethephon significantly reduced PIN2 expression

on systemic leaves of wild type genotypes. Compared to control ethanol treatments, MeJA

treatments significantly induced PIN2 expression in both mutants and wild types. After MeJA

spray, the PIN2 expression for the def1 mutant was not significantly different from the treated

wild type CM plants (Fig. 4B, F=0.15, p=0.929), indicating that this mutant is still responsive to

JA as expected.

After 7 days growth on MS medium, whole seedlings were collected for analysis of

PIN2 gene expression. The results showed the same trend of PIN2 expression on MS medium as

the treatment with ethephon significantly reduced PIN2 expression (Fig. 5A; F=6.49, p<0.01).

The PIN2 expression on MS medium with MeJA treatment was significantly induced compared

with the control seedlings. The expression of PIN2 was significantly lower than MeJA alone

123

treatment when both elicitors were added in the medium, (Fig. 5B, F=9.87, p<0.01). This

indicates that as expected, JA plays important role in PIN2 induction; however, ET negatively

regulates PIN2 expression through an antagonistic interaction.

In addition to PIN2 expression, we also examined PPOF, ERF1 and PR1 expression in

the MS medium grown seedlings. Polyphenol oxidase (PPOF) plays a defensive role in plant

defense against insects (Bi et al. 1997; Felton et al. 1989; Thipyapong and Steffens 1996). The

results in this study showed that PPOF expression was also significantly decreased by ethephon

treatment, while highly induced by MeJA treatment. Thus ethephon negatively regulated PPOF

expression in a manner similar to PIN2 (Fig. 5C, D).

Previous study showed multiple tomato PR proteins and their corresponding mRNAs are

regulated by salicylic acid and ethylene treatment (Vankan et al. 1995). The ERF1 gene which

play important role in stress response is regulated by ethylene (Nakano et al. 2006; Onate-

Sanchez et al. 2007). Our results showed significant induction of ERF1 and PR1 by ethephon on

def1 mutant and wild type seedlings. The Nr mutant, which is semi-dominant ethylene

insensitive, showed no significantly induction of ERF1 and PR1 expression compared to control.

The wild type RU showed significantly induction of both genes (Fig. 5E, F, G, H). These results

are consistent with a previous study indicating that ethylene and SA positively regulate ERF1

and PR1 expression (Berrocal-Lobo et al. 2002; Huang et al. 2005). MeJA treatment did not

significantly induce either gene, while MeJA and ethephon together produced similar results as

ethephon alone. These results confirmed that ERF1 and PR1 gene are up regulated by ethylene.

JA but not ethylene is required for PIN2 wound-induced expression

124

Because PIN2 is a well-characterized wounding response gene in tomato, we used this as

marker to compare the wounding response in different mutants and after different hormone

treatments. We compared the PIN2 gene expression 24 h after wounding. RNA from untreated

leaves of the wild type RU was used as a reference level to calculate the relative PIN2 expression

across other treatments. The Nr mutant, which has partially reduced ethylene response, showed

significantly greater PIN2 induction after mechanical wounding compared to the wild type RU

plants. The def1 mutant, which lacks a functional octadecanoid pathway, did not show significant

PIN2 induction upon wounding. Its wild type CM showed a significant wounding response

compared to control untreated plants (Fig. 6A; F=23.19, p<0.01).

To investigate the effect of ethephon and MeJA on the systemic wounding response,

plants were sprayed as previously described. After two weeks, the 5th

leaf on plants was

wounded as previous described. Twenty-four hours after mechanical wounding, the PIN2

expression was compared with RU untreated plants. The results showed after ethephon treatment,

the plants still showed a wounding response with induced PIN2 expression compared to

untreated plants. The def1 mutant had still lower PIN2 expression compared to CM plants (Fig.

6B; F=9.78, p<0.01). After MeJA spray the plants showed a normal wounding response. The

PIN2 gene expression on both Nr and def1 mutants and wild type plants was significantly

increased compared to the untreated plants, but no difference among mutants and wild type

plants was observed (Fig. 6C; F=2.10, p<0.179). In this study, the ERF1 gene did not show any

induction upon wounding in both mutants and wild type plants although def1 mutant showed

high ERF1 expression (Fig. 6D; F=110.92, p<0.01) . PR1 gene was up-regulated by mechanical

wounding on def1 mutant, but no induction was observed on the Nr mutant and two wild type

plants (Fig. 6F; F=97.65, p<0.01).

125

Plant hormones in systemic leaves

To understand how the cross interaction of JA and ET affects plant hormones, we

quantified SA and JA on the systemic leaves two weeks after treatment. After ethephon

treatment, the SA levels in the Nr mutant systemic leaves increased 2.6 times compared to the

control plants (Table 2). Wild type RU plants showed a 6.4 fold increase compared to the

control. After ethephon treatment, the SA levels in both the def1 mutant and wild type CM plants

increased ca. 10-fold compared to control plants. While the MeJA treatment did not significantly

increase SA levels in both mutants and wild type systemic leaves. Expectedly, the JA quantity

was significantly increased on systemic leaves compared to ethanol treatment after MeJA

treatment. The ethanol treatment did not show any effect on JA levels. JA levels in the systemic

leaves of the Nr and def1 mutants showed no significant decrease after ethephon treatment;

however, in the RU plants, JA was reduced after ethephon treatment compared to control plants.

However, JA in CM plants was not reduced by ethephon treatment (Table 2).

Discussion

The plant hormones SA, JA and ET are known to play the important signaling roles in

local and systemic plant defense insect herbivores (Howe 2004; Onkokesung et al. 2010).

Among them, JA signaling plays a prominent role in promoting plant defense responses to many

herbivores (Bodenhausen and Reymond 2007; Cooper and Goggin 2005; McConn et al. 1997).

Other hormones such as SA and ET may interact with JA in regulating plant defense (Adie et al.

2007a; Beckers and Spoel 2006; Campos et al. 2009; Wasternack et al. 2006). Both positive and

negative effects of ET on JA regulated responses have been observed (O'Donnell et al. 1996;

Stotz et al. 2000).

126

Our results confirm the role of JA in defense against the caterpillar H. zea. Caterpillar

growth was significantly increased on the def1 mutant compared with the wild type plants.

Pretreatment of tomato plants with MeJA significantly decreased H. zea growth on both mutants

and wild type plants. The MeJA treatment rescued def1 mutant resulting in increased resistance

to the insect herbivore. Larval growth on the Nr mutant was not affected compared to the wild

type plants, but pretreatment with ethephon compromised resistance to H. zea in both Nr and

wild type plants. This antagonistic interaction has also been reported in other plants such as a

previous study showing that pretreatment of Arabidopsis with ethephon, elevated susceptibility

to generalist insects including the Egyptian cotton worm (Stotz et al. 2000). Ethylene negatively

regulated local expression of lectin GS-II in Griffonia simplicifolia, which inhibited insect

growth and development (Zhu-Salzman et al. 1998). Ethylene also negatively regulates JA-

induced nicotine biosynthesis and reduced direct plant defenses (Kahl et al. 2000). In contrast

maize blocking ethylene synthesis and perception in maize resulted in plants more susceptible to

caterpillar feeding (Harfouche et al. 2006; Ankala et al. 2009). These studies suggest that the role

and outcome of ET in defense may depend on the specific plant-herbivore system being studied.

Glandular trichomes are an important component of the defended phenotype of many

plants. Trichome density is regulated by jasmonates, brassinosteroids and ethylene (Boughton et

al. 2005; Campos et al. 2009; Tian et al. 2012). JA plays a positive role in glandular trichome

induction in different plant species (Peiffer et al. 2009; Rasmann et al. 2012; Traw and Bergelson

2003; van Schie et al. 2007). In this study, the def1 mutant with JA deficiency showed

significantly trichome reduction compared to its wild type CM plants; while the Nr mutant did

not show any trichome reduction compared to wild type RU plants although the ethylene

perception was partially blocked. JA significantly induced glandular trichomes on systemic

127

leaves, while ethylene did not affect tomato glandular trichome density. There are different

reports on ET function in regulating trichome formation; for example in Arabidopsis ET inhibits

trichome formation on stems and leaves (Gibson 2003), while another study showed ET

positively regulated plant cell division and increased trichome initiation and development

(Kazama et al. 2004). Exogenous application of ET has been found to increase the branch

number in cucumber trichomes and increased ethylene synthesis has been correlated with

trichome branching (Plett et al. 2009b). Differences in these studies may be due to specific plant

species or differences in application rates and timing. Ethylene may regulate non-glandular

trichome branching, but we did not examine its possible effect on these trichomes.

Plants respond to wounding or insect herbivory by activating a series of wound-

responsive defensive genes (Baldwin et al. 2001; Bergey et al. 1999; Chen et al. 2004; Heinrich

et al. 2011). Jasmonates are recognized as essential signals in this process (Gfeller et al. 2010).

As expected, we observed lower expression of PIN2 in the def1 mutant compared to CM plants.

Wounding did not induce significant PIN2 expression in the def1 mutant compared to wild type

CM plants. Nr, which is an ethylene insensitive mutant, showed normal constitutive and wound-

induced PIN2 expression as the wild type RU plants. This confirmed that JA, but not ET is

required for the wounding response. The wounding response in systemic leaves was also

affected by ethephon and MeJA treatment. Not surprisingly, the MeJA treatment restored the

def1 mutant to a normal wounding response. The ethephon treatment decreased the wound-

inducible PIN2 gene expression in systemic leaves. Similar study also found ethylene treatment

reduced proteinase inhibitor 1(PIN1) gene expression in tomato (Diaz et al. 2002).

However a synergistic interaction of ET and JA in the regulation of proteinase inhibitor

genes has been shown in some instances (Adie et al. 2007b; O’donnell et al. 1996). Our study

128

showed MeJA application induced PIN2 gene expression in systemic leaves, while ethephon

treatment decreased PIN2 gene expression in these leaves. The assays conducted with seedlings

grown on MS medium showed the same trend of PIN2 gene expression as the spray treatment.

Polyphenol oxidase F (PPOF) was similarly up-regulated by MeJA treatment and down-

regulated by ethephon treatment. Thus our results contradict some of these previous reports

indicating that wound-induced PIN2 gene expression depends on both JA and ET (O’donnell et

al. 1996). In those experiments, specific inhibitors or elicitors, which regulate ET on plants,

were applied to leaves and gene expression on local leaves was quantified after wounding,

whereas in our study we focused on PIN2 expression in systemic leaves. Also in some cases the

methods were different: in our study we used 3 mM ethephon spray on the plants, whereas some

previous studies incubated plants in gas tight chambers with ethylene for a short time before

wounding plants. The method of gene expression analysis may also have affected the results; in

our study, we used quantitative RT-PCR to quantify the gene expression change upon treatment

rather than northern blots or semi-quantitative RT-PCR.

The ethylene response factor 1 (ERF1) acts as a positive regulator of JA and ET signaling

and has been shown to play an important role in mediating defense responses in Arabidopsis

(Lorenzo et al. 2003). The expressions of ERF1 and the SA-regulated PR1 genes in the MS

media-grown seedlings were not significantly induced by MeJA treatment, but were significantly

induced by ethephon treatment. We did not find ERF1 to be induced by our method of

mechanical wounding in both tested plants. The def1 mutant showed high constitutive ERF1

expression compared with wild type plants. Over all in this study, the ethephon treatment

induced ERF1 expression and decreased the PIN2 wounding response. This reduction is

consistent with a previous report that ERF1 represses wound-responsive PDF1.2 gene in

129

Arabidopsis (Lorenzo et al. 2003). PR1 transcripts are regulated by high levels of SA and

pathogen attack in tomato plants (Tornero et al. 1997), but the effect of wounding on PR1

expression was not previously reported. In this study, the Nr mutant and wild type plants did not

show PR1 induction by mechanical wounding, while this gene was induced by wounding in the

def1 mutant. Because the def1 mutant is deficient of JA biosynthesis, the lack of JA as a negative

SA regulator may explain the induction of PR1. This current study is consistent with previous

studies of ERF1 and PR1genes that were shown to be up regulated by ethylene response (Cole et

al. 2004; Lorenzo et al. 2003).

Significant progress has been made in identifying the key components and understanding

the interactive roles of SA, JA and ET in plant responses (Abe et al. 2011; Kniskern et al. 2007;

Leon-Reyes et al. 2009). In this study, we showed that ethephon treatments significantly

increased SA levels in systemic leaves and decreased JA levels in systemic leaves. Significant

ERF1 and PR1 gene induction was observed when SA levels were increased by ethephon

treatment. Our results confirm that the JA pathway plays the main role in plant defense against

H. zea. JA positively regulated PIN2 gene expression and glandular trichome density, but ET

positively regulated SA biosynthesis and response with the induction of ERF1 and PR1 gene

expression. Whereas ET frequently interacts synergistically with JA to mediate insect resistance

in some plant species, we found that ET inhibited induced resistance against the tomato

fruitworm through decreasing the JA response as observed by decreased PIN2 and PPOF gene

expression and insect bioassays.

130

Table 1. Primers used for real-time PCR assays of relative expression

Primer

name

Gene Name/ Accession number Primer sequence (5'-3’)

PIN2 Wound inducible proteinase inhibitor 2

/ K03291

GGA TTT AGC GGA CTT CCT TCT G

ATG CCA AGG CTT GTA CTA GAG AAT G

PPOF Polyphenol oxidase

/z12837

ACT TTC ACG CGG TAA GGG TTA CGA

ATG TGG ACA GGA TGT GGA ACG AGT

PR1 Pathogenesis related gene1

/NM 001247429

GTC CCC AGC TGT TTG ATT GG

TTG GAT TCG GTC CTA TGA CAT G

ERF1 Ethylene response factor1

/EU395634

AATGGAATTAGGGTTTGGTTAGGAA

GACCAAGGACCCCTCATTGA

Ubi Ubiquitin

/ X58253

GCC AAG ATC CAG GAC AAG GA

GCT GCT TTC CGG CGA AA

131

Table2 Salicylic acid and JA affected by MeJA and Ethephon

132

Salicylic acid (ng/gm fresh weight) JA(ng/gm fresh weight)

Control Ethephon EtOH MeJA Control Ethephon EtOH MeJA

Nr 11.33±2.27cd 29.83±7.67b 10.70±2.32cd 9.58±2.95cd 23.76±1.94c 15.25±4.12c 21.50±1.61c 283.63±45.26b

RU 12.54±3.92c 73.95±8.14a 8.64±2.76d 15.80±1.09c 20.34±2.88c 8.70±1.78c 19.98±2.12c 278.59±32.32b

def1 6.32±2.85d 66.97±11.36a 9.41±1.23cd 10.28±3.58cd 11.13±1.14c 6.44±1.87c 12.38±1.31c 384.62±43.67a

CM 8.90±1.38d 67.72±13.02a 7.22±2.21d 12.71±4.57c 19.17±4.32c 7.28±2.24c 19.37±2.39c 490.62±51.78a

133

FIGURE LEGENDS

Fig. 1. Tomato growth affected by MeJA and ethephon treatment. A.) MeJA and ethephon

reduce tomato height B.) Wild type RU seedling growth by different treatment C.) Hypocotyl

length was affected by different treatment D.) Root length of different mutant and affected by

ethephon, MeJA and combined treatment. Each data point represents the mean±SE of twenty

plants. Means followed by different letters are significantly different at P= 0.05.

Fig. 2. MeJA and ethephon treatment induce trichome number on systemic leaves. A.)

Glandular trichome number on Nr mutant and its wild type leave and affected by ethephon and

MeJA treatment. B.) Glandular trichome number on def1 mutant and its wild type CM leaves

and affected by ethephon and MeJA. Each data point represents the mean±SE of twenty leaves.

Means followed by different letters are significantly different at P= 0.05.

Fig. 3. MeJA and Ethephon affect H. zea growth and neonates’ choice A.) Artificial diet with

MeJA and Ethephon didn’t affect insect growth B.) Ethephon treated leaves increase H. zea

growth C.) MeJA treated leaves reduce H. zea growth. Each data point represents the mean±SE

of thiry insects. Means followed by different letters are significantly different at P= 0.05.

Fig. 4. Chemical elicitors spray affects gene expression A.) PIN2 expression on leaves was

reduced by ethephon treatment B.) PIN2 expression was highly induced by MeJA spray

treatment. Each data point represents the mean±SE of three replicates. Means followed by

different letters are significantly different at P= 0.05.

Fig. 5. MS medium grown seedlings gene expression affected by elicitor treatment A,B) PIN2

gene expression affected by ethephon and MeJA. C,D) PPOF expression affected by treatment.

E,F) PR1 expression, G,H) ERF1 expression. Each data point represents the mean±SE of three

replicates. Means followed by different letters are significantly different at P= 0.05.

Fig. 6. Gene expression affected by wounding A) PIN2 expression by wounding on control

plants B) PIN2 expression by wounding on ethephon treated plants. C) PIN2 expression by

wounding on MeJA treated plants. D) ERF1 expression not induced by wounding. E) PR1

expression by wounding. Each data point represents the mean±SE of three replicates. Means

followed by different letters are significantly different at P= 0.05.

134

135

136

137

138

Fig. 5.

138

Fig. 6.

139

Reference

Abe H, Tomitaka Y, Shimoda T, Seo S, Sakurai T, Kugimiya S, Tsuda S, Kobayashi M (2011)

Antagonistic plant defense system regulated by phytohormones assists interactions

among vector insect, thrips, and a tospovirus. Plant and Cell Physiology 10:1093

Adie B, Chico JM, Rubio-Somoza I, Solano R (2007a) Modulation of plant defenses by

ethylene. Journal of Plant Growth Regulation 26: 160-177

Adie B, Pérez-Pérez J, Pérez-Pérez MM, Godoy M, Sánchez-Serrano J-J, Schmelz EA,

Solano R (2007b) ABA is an essential signal for plant resistance to pathogens affecting

JA biosynthesis and the activation of defenses in Arabidopsis. The Plant Cell 19: 1665-

1681

Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores

and plant fitness. Ecology 80: 1713-1723

Ament K, Kant MR, Sabelis MW, Haring MA, Schuurink RC (2004) Jasmonic acid is a key

regulator of spider mite-induced volatile Terpenoid and methyl salicylate emission in

tomato. Plant Physiol. 135: 2025-2037

An LZ, Xu XF, Tang HG, Zhang MX, Hou ZD, Liu YH, Zhao ZG, Feng HY, Xu SJ, Wang XL

(2006) Ethylene production and 1-aminocyclopropane-1-carboxylate (ACC) synthase

gene expression in tomato (Lycopersicon esculentum Mill.) leaves under enhanced UV-B

radiation. Journal of Integrative Plant Biology 48: 1190-1196

Ankala A, Luthe DS, Williams WP and Wilkinson (2009) Integration of ethylene and jasmonic

acid signaling pathways in the expression of maize defense protein Mir 1-CP. Molecular

Plant-Microbe Interactions 22:1555-1564

Baldwin IT, Halitschke R, Kessler A, Schittko U (2001) Merging molecular and ecological

approaches in plant-insect interactions. Current Opinion in Plant Biology 4: 351-358

Beckers GJM, Spoel SH (2006) Fine-tuning plant defence signalling: Salicylate versus

jasmonate. Plant Biology 8: 1-10

Bergey DR, Orozco-Cardenas M, de Moura DS, Ryan CA (1999) A wound- and systemin-

inducible polygalacturonase in tomato leaves. Proc Natl Acad Sci USA 96: 1756-1760

Berrocal-Lobo M, Molina A, Solano R (2002) Constitutive expression of ETHYLENE-

RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi.

Plant J 29: 23-32

Bi JL, Murphy JB, Felton GW (1997) Antinutritive and oxidative components as mechanisms of

induced resistance in cotton to Helicoverpa zea. J. Chem. Ecol. 23: 97-117

Bodenhausen N, Reymond P (2007) Signaling pathways controlling induced resistance to

insect herbivores in Arabidopsis. Molecular Plant-Microbe Interactions 20: 1406-1420

Bostock RM (2005) Signal crosstalk and induced resistance: Straddling the line between cost

and benefit. Annual Review of Phytopathology 43: 545-580

Boughton AJ, Hoover K, Felton GW (2005) Methyl jasmonate application induces increased

densities of glandular trichomes on tomato, Lycopersicon esculentum. Journal of

Chemical Ecology 31: 2211-2216

Browse J (2009) Jasmonate passes muster: A receptor and targets for the defense hormone.

Annual Review of Plant Biology 60: 183-205

Campos ML, de Almeida M, Rossi ML, Martinelli AP, Litholdo CG, Figueira A, Rampelotti-

140

Ferreira FT, Vendramim JD, Benedito VA, Peres LEP (2009) Brassinosteroids interact

negatively with jasmonates in the formation of anti-herbivory traits in tomato. Journal of

Experimental Botany 60: 4346-4360

Chandok MR, Ekengren SK, Martin GB, Klessig DF (2004) Suppression of pathogen-inducible

NO synthase (iNOS) activity in tomato increases susceptibility to Pseudomonas syringae.

Proc Natl Acad Sci USA 101: 8239-8244

Chen H, McCaig BC, Melotto M, He SY, Howe GA (2004) Regulation of plant arginase by

wounding, jasmonate, and the phytotoxin coronatine. J Biol Chem 279: 45998-46007

Chippendale GM (1970) Metamorphic changes in fat body proteins of the southwestern corn

borer, Diatraea grandiosella. Journal of Insect Physiology 16: 1057-1068

Cole AB, Kiraly L, Lane LC, Wiggins BE, Ross K, Schoelz JE (2004) Temporal expression of

PR-1 and enhanced mature plant resistance to virus infection is controlled by a single

dominant gene in a new Nicotiana hybrid. Mol Plant Microbe Interact 17: 976-985

Cooper WR, Goggin FL (2005) Effects of jasmonate-induced defenses in tomato on the potato

aphid, Macrosiphum euphorbiae. Entomologia Experimentalis et Applicata 115: 107-115

Diaz J, ten Have A, van Kan JAL (2002) The role of ethylene and wound signaling in

resistance of tomato to Botrytis cinerea. Plant Physiol. 129: 1341-1351

Duffey SS (1986) Plant glandular trichomes: their partial role in defence against insects. In:

Juniper BE, Southwood TE (eds) Insects and the plant surface Arnold, London, England,

pp 151-172

Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant reactions.

Trends in plant science 17: 250-259

Fan J, Hill L, Crooks C, Doerner P, Lamb C (2009) Abscisic acid has a key role in modulating

diverse plant-pathogen interactions. Plant Physiol 150: 1750-1761

Felton GW, Broadway RM, Duffey SS (1989) Inactivation of protease inhibitor activity by

plant-derived quinones complications for host-plant resistance against noctuid herbivores.

Journal of Insect Physiology 981–990

Felton GW, Korth KL, Bi JL, Wesley SV, Huhman DV, Mathews MC, Murphy JB, Lamb C,

Dixon RA (1999) Inverse relationship between systemic resistance of plants to

microorganisms and to insect herbivory. Current Biology 9: 317-320.

Gfeller A, Liechti R, Farmer EE (2010) Arabidopsis jasmonate signaling pathway. Sci Signal 3:

cm3

Gibson S (2003) Ethylene inhibits trichome formation on stems and brancing on leaves.

International conference. 14: 501707200

Halitschke R, Stenberg JA, Kessler D, Kessler A, Baldwin IT (2008) Shared signals - 'alarm

calls' from plants increase apparency to herbivores and their enemies in nature. Ecology

Letters 11: 24-34

Harfouche AL, Shivaji R, Stocker R, Williams PW, Luthe DS (2006) Ethylene signaling

mediates a maize defense response to insect herbivory. Molecular Plant-Microbe

Interactions 19: 189-199

Heinrich M, Baldwin IT, Wu J (2011) Two mitogen-activated protein kinase kinases, MKK1

and MEK2, are involved in wounding- and specialist lepidopteran herbivore Manduca

sexta-induced responses in Nicotiana attenuata. Journal of Experimental Botany 62:

4355-4365.

Horgan FG, Quiring DT, Lagnaoui A, Pelletier Y (2009) Effects of altitude of origin on

trichome-mediated anti-herbivore resistance in wild Andean potatoes. Flora 204: 49-62

141

Howe GA (2004) Jasmonates as signals in the wound response. Journal of Plant Growth

Regulation 23: 223-237

Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annual Review of Plant

Biology 59: 41-66

Huang Z, Yeakley JM, Garcia EW, Holdridge JD, Fan JB, Whitham SA (2005) Salicylic acid-

dependent expression of host genes in compatible Arabidopsis-virus interactions. Plant

Physiol 137: 1147-1159

Kahl J, Siemens DH, Aerts RJ, Gabler R, KA hnemann F, Preston CA, Baldwin IT (2000)

Herbivore-induced ethylene suppresses a direct defense but not a putative indirect

defense against an adapted herbivore. Planta 210: 336-342

Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010) Distortion of trichome morphology by

the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental

Botany 61: 1053-1064

Kazama H, Dan H, Imaseki H, Wasteneys GO (2004) Transient exposure to ethylene stimulates

cell division and alters the fate and polarity of hypocotyl epidermal cells. Plant

Physiology 1614-1623

Kessler A, Halitschke R, Poveda K (2011) Herbivory-mediated pollinator limitation: negative

impacts of induced volatiles on plant-pollinator interactions. Ecology 92: 1769-1780

Kniskern JM, Traw MB, Bergelson J (2007) Salicylic acid and jasmonic acid signaling defense

pathways reduce natural bacterial diversity on Arabidopsis thaliana. Molecular Plant-

Microbe Interactions 20: 1512-1522

Koiwa H, Shade RE, Zhu-Salzman K, Subramanian L, Murdock LL, Nielsen SS, Bressan RA,

Hasegawa PM (1998) Phage display selection can differentiate insecticidal activity of

soybean cystatins. Plant Journal 14: 371-379

Leon-Reyes A, Spoel SH, De Lange ES, Abe H, Kobayashi M, Tsuda S, Millenaar FF,

Welschen RAM, Ritsema T, Pieterse CMJ (2009) Ethylene modulates the role of NPR1

in cross-talk between salicylate and jasmonate signaling. Plant Physiol.108.133926

Li L, Zhao YF, McCaig BC, Wingerd BA, Wang JH, Whalon ME, Pichersky E, Howe GA

(2004) The tomato homolog of CORONATINE-INSENSITIVE1 is required for the

maternal control of seed maturation, jasmonate-signaled defense responses, and glandular

trichome development. Plant Cell 16: 126-143

Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE

FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense.

The Plant Cell 15: 165-178

Mantelin S, Kishor KB, Isgouhi K (2009) Ethylene contributes to potato aphid susceptibility in a

compatible tomato host. New Phytologist 444–456

Martinez de Ilarduya O, Xie Q, Kaloshian I (2003) Aphid-induced defense responses in Mi-1-

mediated compatible and incompatible tomato interactions. Mol Plant Microbe Interact

16: 699-708

McConn M, Creelman RA, Bell E, Mullet JE, Browse J (1997) Jasmonate is essential for insect

defense Arabidopsis. Proc Natl Acad Sci USA 94: 5473-5477

Melotto M, Mecey C, Niu Y, Chung HS, Katsir L, Yao J, Zeng WQ, Thines B, Staswick P,

Browse J, Howe GA, He SY (2008) A critical role of two positively charged amino acids

in the Jas motif of Arabidopsis JAZ proteins in mediating coronatine- and jasmonoyl

isoleucine-dependent interactions with the COI1F-box protein. Plant Journal 55: 979-988

Navarro L (2006) A plant miRNA contributes to antibacterial resistance by repressing auxin

142

signaling. Science 312: 436-439

Nakano T, Suzuki K, Fujimura T, Shinshi H (2006). Genome-wide analysis of the ERF gene

family in Arabidopsis and rice. Plant Physiology 2006;140:411-432.

O’Donnell PJ, Calvert C, Atzorn R, Wasternack C, Leyser HMO, Bowles DJ (1996) Ethylene as

a signal mediating the wound response of tomato plants. Science 274: 1914-1917

Onate-Sanchez L, Anderson JP, Young J, Singh KB (2007). AtERF14, a member of the ERF

family of transcription factors plays a nonredundant role in plant defense. Plant Physiol.

143: 400-409.

Onkokesung N, Galis I, von Dahl CC, Matsuoka K, Saluz H-P, Baldwin IT (2010) Jasmonic

acid and ethylene modulate local responses to wounding and simulated herbivory in

Nicotiana attenuata leaves. Plant Physiol. 153: 785-798

Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary

glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113

Peiffer M, Tooker JF, Luthe DS, Felton GW (2009) Plants on early alert: glandular trichomes as

sensors for insect herbivores. New Phytologist 184: 644-656

Pieterse CM, van Wees SC, van Pelt JA, Knoester M, Laan R, Gerrits H, Weisbeek PJ, van

Loon LC (1998) A novel signaling pathway controlling induced systemic resistance in

Arabidopsis. The Plant Cell 10: 1571-1580

Pieterse CMJ, Dicke M (2007) Plant interactions with microbes and insects: from molecular

mechanisms to ecology. Trends in Plant Science 12: 564-569

Plett JM, Mathur J, Regan S (2009) Ethylene receptor ETR2 controls trichome branching by

regulating microtubule assembly in Arabidopsis thaliana. Journal of Experimental Botany

60: 3923-3933

Rasmann S, De Vos M, Casteel CL, Tian DL, Halitschke R, Sun JY, Agrawal AA, Felton GW,

Jander G (2011) Herbivory in the previous generation primes plants for enhanced insect

resistance. Plant Physiol. 158(2):854-63

Reymond P, Weber H, Damond M, Farmer EE (2000) Differential gene expression in response

to mechanical wounding and insect feeding in Arabidopsis. The Plant Cell 12: 707-720

Rojo E, León J, Sánchez-Serrano JJ (1999) Cross-talk between wound signalling pathways

determines local versus systemic gene expression in Arabidopsis thaliana. The Plant

Journal 20: 135-142

Ryan CA, An G, Thornburg RW, Lee J, Fox E, Pearce G (1986) Activation of plant defense

genes by wound signals. Journal of Cellular Biochemistry: 3-3

Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H, Tumlinson JH,

3rd (2003) Simultaneous analysis of phytohormones, phytotoxins, and volatile organic

compounds in plants. Proc Natl Acad Sci U S A 100: 10552-10557

Shoji T, Nakajima K, Hashimoto T (2000) Ethylene Suppresses jasmonate-induced gene

expression in nicotine biosynthesis. Plant and Cell Physiology 41: 1072-1076

Stotz HU, Pittendrigh BR, Kroymann J, Weniger K, Fritsche J, Bauke A, Mitchell-Olds T (2000)

Induced plant defense responses against chewing insects. Ethylene signaling reduces

resistance of Arabidopsis against Egyptian cotton worm but not diamondback moth. Plant

Physiol 124: 1007-1017

Tian D, Peiffer M, Shoemaker E, Tooker J, Haubruge E, Francis F, Luthe DS, Felton GW

(2012a) Salivary Glucose Oxidase from Caterpillars Mediates the Induction of Rapid and

Delayed-Induced Defenses in the Tomato Plant. PLoS ONE 7: e36168

Tian D, Tooker J, Peiffer M, Chung S, Felton G (2012b) Role of trichomes in defense against

143

herbivores: comparison of herbivore response to woolly and hairless trichome mutants in

tomato (Solanum lycopersicum). Planta: 1-14

Thaler JS, Agrawal AA, Halitschke R (2010) Salicylate-mediated interactions between

pathogens and herbivores. Ecology 91: 1075-1082

Thaler JS, Humphrey PT, Whiteman NK (2012) Evolution of jasmonate and salicylate signal

Cross-talk. Trends in plant science 17: 260-270

Thipyapong P, Steffens JC (1996) Defensive role of polyphenol oxidases against Pseudomonas

syringae pv tomato. Plant Physiology 111: 791-791

Tooker, JF. and De Moraes CM. 2005. Jasmonate in lepidopteran eggs and neonates. J. Chem.

Ecol. 31: 2753-2759.

Tornero P, Gadea J, Conejero V, Vera P (1997) Two PR-1 genes from tomato are differentially

regulated and reveal a novel mode of expression for a pathogenesis-related gene during

the hypersensitive response and development. Mol Plant Microbe Interact 10: 624-634

Traw MB, Bergelson J (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin

on induction of trichomes in Arabidopsis. Plant Physiology 133: 1367-1375

van Poecke RMP, Dicke M (2002) Induced parasitoid attraction by Arabidopsis thaliana:

involvement of the octadecanoid and the salicylic acid pathway. Journal of Experimental

Botany 53: 1793-1799

van Schie CCN, Haring MA, Schuurink RC (2007) Tomato linalool synthase is induced in

trichomes by jasmonic acid. Plant Molecular Biology 64: 251-263

Vankan JAL, Cozijnsen T, Danhash N, Dewit P (1995) Induction of tomato stress protein

mRNAs by ethephon, 2,6-dichloroisonicotinic acid and salicylate. Plant Molecular

Biology 27: 1205-1213

Vera P, Conejero V (1990) Effect of ethephon on protein degradation and the accumulation of

`pathogenesis-related' (PR) proteins in tomato leaf discs. Plant Physiology 92: 227-233

Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant Immunity: It’s the hormones talking,

but what do they say? Plant Physiology 154: 536-540

Wasternack C, Stenzel I, Hause B, Hause G, Kutter C, Maucher H, Neumerkel J, Feussner I,

Miersch O (2006) The wound response in tomato - role of jasmonic acid. Journal of Plant

Physiology 163: 297-306

Yang SF, Hoffman NE (1984) Ethylene biosynthesis and its regulation in higher plants.

Annual Review of Plant Physiology 35: 155-189

Yasuda M, Nakashita H, Hasegawa S, Nishioka M, Arai Y, Uramoto M, Yamaguchi I, Yoshida

S (2003) N-cyanomethyl-2-chloroisonicotinamide induces systemic acquired resistance

in arabidopsis without salicylic acid accumulation. Biosci Biotechnol Biochem 67: 322-

328

Zhang L, Jia C, Liu L, Zhang Z, Li C, Wang Q (2011) The involvement of jasmonates and

ethylene in Alternaria alternata f. sp. lycopersici toxin-induced tomato cell death. Journal

of Experimental Botany 62: 5405-5418

Zhang Y, Xu S, Ding P, Wang D, Cheng YT, He J, Gao M, Xu F, Li Y, Zhu Z, Li X, Zhang Y

(2010) Control of salicylic acid synthesis and systemic acquired resistance by two

members of a plant-specific family of transcription factors. Proc Natl Acad Sci USA 107:

18220-18225

Zhao Y (2003) Virulence systems of Pseudomonassyringae pv. tomato promote bacterial speck

disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36: 485-499

Zhu-Salzman K, Salzman RA, Koiwa H, Murdock LL, Bressan RA, Hasegawa PM (1998)

144

Ethylene negatively regulates local expression of plant defense lectin genes. Physiologia

Plantarum 104: 365-372

Zsogon A, Lambais MR, Benedito VA, Figueira AVD, Peres LEP (2008) Reduced arbuscular

mycorrhizal colonization in tomato ethylene mutants. Scientia Agricola 65: 259-267

145

Appendix: Herbivory in the previous generation primes tomato for induced defense

Introduction

As sessile organisms, plants have evolved diverse strategies to continuously adjust their

responses to a broad range of abiotic and biotic stresses including herbivore challenges. The

mechanisms of induced plant defense have been well studied (Ryan et al. 1986; Walling 2000;

Wasternack et al. 2006). To avoid the herbivore attack, plants must immediately respond to the

challenges with various defense strategies (Green and Ryan 1972). Among the strategies, the

synthesis of the secondary metabolites in plants is a powerful chemical weapon because they

often function as toxins to inhibit the herbivore's nutrition and growth (Lawrence et al. 2008;

Maffei et al. 2007). Besides these chemicals weapons, plants also attract predators and

parasitoids of the herbivore through the release of volatile organic compounds (VOCs) (Arimura

et al. 2005). Trichomes are an example of physical defenses and may be inducible in some plants

such as tomato (Kang et al. 2010). Transgenerational plant defense means the offspring’s defense

traits are acquired by the adult parent; in other words the adaptation of the maternal effects

responding to the environment can improve the fitness and immunity traits of the offspring.

Several studies have examined the contribution of maternal stress to offspring’s phenotype and

fitness (Agrawal 2001; Slaughter et al. 2011).

Tomato (Solanum lycopersicum), as a model to study plant defense, had been

extensively studied (Arimura et al. 2005; Liechti et al. 2006; Wasternack et al. 2006). To test

whether the progeny of tomato plants exposed to herbivory or MeJA treated are more resistant to

herbivores than those of undamaged naïve plants. We used Micro-Tom tomato and Helicoverpa

146

zea (H. zea) as a model to study whether insect fed or MeJA treatment could produce the

progeny, which have more resistance.

Materials and methods

Plants and insects

Tomato seeds (cv. micro-tom , originally purchased from Tomato Growers Supply Co,

Fort Myers, FL.) were grown as described (Peiffer and Felton 2005), in Metromix 400 potting

mix (Griffin Greenhouse & Nursery Supplies Tewksbury, MA) in greenhouse at Penn State

University, University Park, PA, USA). The greenhouse was maintained on a 16-h photoperiod.

For all induction experiments, plants were maintained in the greenhouse under 800W Super

Spectrum lights (Sunlight Supply Co., Vancouver, WA). The H. zea eggs were purchased from

BioServ (Frenchtown, NJ) and reared on a wheat germ and casein-based artificial diet

(Chippendale 1970) with ingredients from Bioserv in the Entomology Department, Penn State

University (University Park PA, USA).

Tomato leaf and fruit induced defense by MeJA

To compare the long term induced defense MeJA on leaf and fruit. When plants have

small fruits, we use 2.5mM MeJA in 0.8% ethanol spray on tomato plants. The control is no

spray and spray with 0.8% ethanol. After 10 days spray took the leaves and fruit stages for

bioassay. Neonates fed on artificial diet for one day and then transfer on the leaf to feed for 6

days in the cup. Compare the insect weight by precision balance.

At same time 50mg leaves and fruits were separately sampled for polyphenol oxidase

(PPO) assay and 100mg tissue for gene expression assay. PPO assay was followed by Felton

(1992) described. Briefly described as grind tissue in liquid nitrogen and immediately extract by

0.1M KPO4 with 5% PVPP, sit on ice for 5minutes and centrifuge at 4 ºC for 10minutes.

147

Immediately measure the absorbance at 450nm of the reaction with 5µl sample and 200µl 3M

caffeic acid. The activity was expressed as OD/min/mg tissue.

Transgenerational induced defense

Previous studies showed insects feeding or mechanical damage induced the plant defense.

To investigate the effect of parent plants treatment on next generational defense, we challenged

the parent plants with H. zea fed, mechanical wound or MeJA treatment. Six week old plants

(flower stage/fruit) were challenged by 4th

instar H. zea randomly feeding for three days or

mechanically wound small fruit. 2.5mM MeJA sprayed on plants as MeJA treatment. Harvest

damaged or sprayed fruits and get seeds for F1 seeding trichome, bioassay and wounding

response experiments. Neonates fed on artificial diet for one day and then transfer on the leaf to

feed for 4 days in the cup. Compare the insect weight by precision balance.

When seedling had 4 fully expanded leaves, glandular trichomes were count on the upper

side of the 4th

leaf. Two leaf disks (0.6 cm diameter) were punched out beside the mid-vein.

Numbers of type VI trichomes were counted using a dissecting scope. We mechanically wound

the 4th

leaf to compare the defensive response in the next generation plants. After 24 hours

wound, the leaf were sampled for RNA extraction and quantitative RT- PCR.

Results and Discussion

The inducible defenses are regulated by plant hormones (Berger and Altmann 2000; Erb

et al. 2009), such as jasmonic acid (JA), which is rapidly synthesized from a fatty acid precursor

following herbivore attack. JA regulated defenses play a key role in the induction of plant

defenses against chewing herbivores. Exogenous application of MeJA also induces a series of

defense responses (Singh et al. 2008). In tomato, JA-response proteins include proteinase

inhibitor 2 (PIN2) and polyphenol oxidase (PPO) (Angelini et al. 2008; Wasternack et al. 2006).

148

It has been shown that their induced gene expression is correlated with enhanced abundance of

their protein products, which inhibit insect growth. In this experiment, two weeks after we

sprayed plants with 2.5mM MeJA at the flowering/ green fruit stage, the bioassay with leaves

and fruits showed significantly reduced H. zea growth compared to control plants (F=31.41,

p<0.01) (Fig. 1a). MeJA treatment significantly induced polyphenol oxidase (PPO) activity

compared with the control plants on both leaves and fruits (Fig. 1b). Gene expression of PIN2

showed that the MeJA could induce the expression on both leaves and fruits (Fig. 1c). It is

confirmed that the induced protein activity and gene expression is correlated with enhanced

abundance of their protein products, which inhibit insect growth.

Transgenerational plant defense means that the offspring’s immunity traits are acquired

by the adult parent; in other words the adaptation of the maternal effects responding to the

environment can improve the fitness and immunity traits of the offspring. Several studies have

examined the contribution of maternal stress to offspring’s phenotype and fitness. Agrawal and

colleagues used wild radish (Raphanus raphanistrum L. brassicacease) and insect herbivory as

model to examine induced defenses in next generation, and they found insect feeding on the

maternal wild radish caused progeny to be more resistant than progeny from unfed wild radish

(Agrawal 1999). Field experiments showed that plants exposed to herbivory in the early season

had 60% higher relative fitness than un-exposed controls (Agrawal 1999). In some instances, the

offspring of the damaged plants showed higher numbers of trichomes compared to the offspring

from their undamaged parents (Agrawal 2001). A similar phenomenon was also observed in the

progeny of yellow monkey flower, Mimulus guttatus, when the parents were exposed to

herbivores (Holeski 2007). Transgenerational induction of high trichome density could confer a

149

selective advantage, if offspring are likely to experience the same herbivore pressure as their

parents.

In this study, after plants were challenged by insects or MeJA treatment, the plants were

allowed to continue growth and produce seeds for the next generation (F1). These seeds were

planted to test their response to insect feeding. At the 4th

leaf stage, the 4th

leaves were used to do

bioassays with neonates to identify the inherited increase in herbivore resistance. All three

treatment decreased growth of H. zea on the progeny of treated tomato plants by about 40%

relative to controls (Fig. 2a, F=11.269, p<0.001). Preliminary experiments also showed that the

small amount of ethanol used to dissolve MeJA for elicitation experiments has no subsequent

herbivory.

At 4th

leaf stage, the top fully expanded leaf glandular trichomes were counted using a

dissecting microscope. The result showed the glandular trichomes number on the progeny of

parent plants treated with MeJA or H. zea feeding, increased significantly compared to untreated

plants (Fig. 2b F=6.61, p<0.001). These results were consistent with the previous study on wild

radish and monkey flower. Both studies provide strong evidence that transgenerational defense

can be induced by herbivory or MeJA treatment.

In another experiment to determine if MeJA could prime F1 plants to respond more

rapidly to wounding, at the 4th

leaf stage, mechanical wounded the 4th

leaf on F1 plants whose

parents were treated with MeJA. Twenty-four hours after wounding, the wounded leaf was

assayed for the expression of proteinase inhibitor 2 (PIN2) using quantitative Reverse

Transcription PCR (qRT-PCR). The wounded leaf from the MeJA treatment showed the highest

level of PIN2 expression and was significantly higher than all other treatments (Fig. 2c). These

results indicate that the induced transgenerational defense is likely to result from a combination

150

of increased trichome density and more potent defensive responses to herbivore or wounding.

These results are consistent with recent work (Luna et al. 2011; Slaughter et al. 2011)

demonstrated a similar transgenerational resistance phenomena in response to priming-inducing

by plant pathogens, salicylic acid (SA) or beta-aminobutyric acid (BABA). Both of these

findings demonstrate that the induced defense can be transmitted to following generation.

Transgenerational defense is heritable, transient and potentially regulated by epigenetic

modifications, while the short-term induced defense is reversible when the stress is removed.

Taken together, transgenerational stress immunity may provide a novel and useful tool for crop

management and protection (Rasmann et al. 2012).

151

Figure 1 . Induced defense by MeJA on leaf and fruits a) No-choice bioassay of H. zea

growth affected by MeJA on leaf and fruits. b) PPO activity affect by MeJA treatment c) PIN2

expression affected by MeJA treatment on leaf d) PIN2 expression affected by MeJA treatment

on fruit

152

Figure 2. Transgenerational resistance in tomato a) Helicoverpa zea growth on tomatoes

originating from parents that were either left undamaged (control) or subjected to caterpillar

feeding, MeJA treatment, or mechanical damage. b) Trichome production on F1 tomato leaves.

Trichomes were counted on the upper side of fully expanded 4th

leaf. Plants were originating

from parents that were left undamaged (open bars) or subject to H. zea feeding, MeJA

application or mechanical damage (black bars).c) Effect of wounding on PIN2 gene expression

F1 plants. The parent plants of F1 treated with MeJA. PIN2 measured 24 h after wounding

damage.

153

Reference

Agrawal AA (1999) Induced responses to herbivory in wild radish: effects on several herbivores

and plant fitness. Ecology 80: 1713-1723

Agrawal AA (2001) Transgenerational consequences of plant responses to herbivory: An

adaptive maternal effect? The American naturalist 157: 555-569

Angelini R, Tisi A, Rea G, Chen MM, Botta M, Federico R, Cona A (2008) Involvement of

polyamine oxidase in wound healing. Plant Physiology 146: 162-177

Arimura G-i, Kost C, Boland W (2005) Herbivore-induced, indirect plant defences. Biochim.

Biophys. Acta (BBA) - Mol. Cell Biol. Lipids 1734: 91-111

Berger D, Altmann T (2000) A subtilisin-like serine protease involved in the regulation of

stomatal density and distribution in Arabidopsis thaliana. Genes Dev. 14: 1119

Chippendale G (1970) Development of artificial diets for rearing the Angoumois grain moth.

J.Economic Entomology 63: 844-848

Erb M, Flors V, Karlen D, de Lange E, Planchamp C, D'Alessandro M, Turlings TCJ, Ton J

(2009) Signal signature of aboveground-induced resistance upon belowground herbivory

in maize. Plant Journal 59: 292-302

Green TR, Ryan CA (1972) Wound-induced proteinase inhibitor in plant leaves: a possible

defense mechanism against insects. Science 175: 776-777

Holeski LM (2007) Within and between generation phenotypic plasticity in trichome density of

Mimulus guttatus. Journal of Evolutionary Biology 20: 2092-2100

Kang JH, Shi F, Jones AD, Marks MD, Howe GA (2010) Distortion of trichome morphology

by the hairless mutation of tomato affects leaf surface chemistry. Journal of Experimental

Botany 61: 1053-1064

Lawrence SD, Novak NG, Ju CJT, Cooke JEK (2008) Examining the molecular interaction

between potato (Solanum tuberosum) and Colorado potato beetle Leptinotarsa

decemlineata. Botany-Botanique 86: 1080-1091

Liechti R, Gfeller A, Farmer EE (2006) Jasmonate Signaling Pathway. Sci. STKE 2006: cm2-

Luna E, Bruce TJA, Roberts MR, Flors V, Ton J (2011) Next Generation Systemic Acquired

Resistance. Plant Physiology

Maffei ME, Mithofer A, Boland W (2007) Insects feeding on plants: Rapid signals and responses

preceding the induction of phytochemical release. Phytochemistry 68: 2946-2959

Peiffer M, Felton GW (2005) The host plant as a factor in the synthesis and secretion of salivary

glucose oxidase in larval Helicoverpa zea. Arch. Insect Biochem. Physiol. 58: 106-113

Ryan CA, An G, Thornburg RW, Lee J, Fox E, Pearce G (1986) Activation of Plant Defense

Genes by Wound Signals. Journal of Cellular Biochemistry: 3-3

Slaughter A, Daniel X, Flors V, Luna E, Hohn B, Mauch-Mani B (2011) Descendants of primed

Arabidopsis plants exhibit resistance to biotic stress. Plant Physiology

Walling LL (2000) The Myriad Plant Responses to Herbivores. Journal of Plant Growth

Regulation 19: 195-216.

Wasternack C, Stenzel I, Hause B, Hause G, Kutter C, Maucher H, Neumerkel J, Feussner I,

Miersch O (2006) The wound response in tomato - role of jasmonic acid. Journal of Plant

Physiology 163: 297-306

VITA

DONGLAN TIAN

PhD Candidate, Entomology department

501 ASI building, Pennsylvania State University, University Park, PA 16802

Voice: 814-863-2871; Fax: 814-865-3048

E-mail:dut3@psu.edu

Professional Preparation

China Agricultural University Agronomy B.S. 1996

University of Illinois at Urbana-Champaign Plant pathology M.S. 2003

Pennsylvania State University Entomology Ph.D. 2012

Appointment

Pennsylvania State University

Ph.D. Research in

Entomology

2006-2012

Pennsylvania State University

Research technician in Plant

Biology

2003-2006

University of Illinois at Urbana-Champaign M.S. Research in Plant

Pathology

2001-2003

Plant Protection Institute, China Academy of

Agricultural Sciences

Research assistant in Plant

Pathology

1996-2001

Publication 1. Tian D, Peiffer M and Felton GW (2012) Herbivore Effector Triggered Immunity? Salivary Glucose

Oxidase Mediates the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant. Plos

one April 2012 | Volume 7 | Issue 4 | e36168

2. Tian D, Tooker J, Peiffer M and Felton GW (2012) Role of Trichomes in Defense against

Herbivores: Comparison of Herbivore Response to hl and woolly Mutants in Tomato (Solanum

lycopersicum) Planta :1-14

3. Tian, D, Peiffer M and Felton GW (2012) Roles of Ethylene and Jasmonate on Tomato (Solanum

lycopersicum) Systemic Induced Defense to Helicoverpa zea (Planta, Submitted)

4. Rasmann S, Vos M, Tian D, Felton GW and Jander G (2012) Transgenerational resistance against

insect herbivory requires jasmonates and siRNA synthesis. Plant physiology pp.111.187831

5. Felton GW, Chung S, Hernandez MGE, Louis J and Tian D (2012) Herbivore oral secretions are the

first line of protection against plant induced defense. Annual Plant Reviews

6. Zahn ML, Ma X, Naomi S, Tian D, and Ma H (2010) Comparative transcriptomics among major

shoot organs of the basal eudicot Eschscholzia californica: a reference for comparison with core

eudicots and basal angiosperms. Genome Biology 11:R101

7. Babadoost M, Tian D and Islam SZ and Pavon C (2008) Challenges and Options in Managing

Phytophthora Blight (Phytophthora capsici ) of Cucurbits. Proceedings of IXth Eucarpia p399-406.

8. Naomi A, Leebens MJ, Zahn ML, Tian D, Ma H and dePamphilis C (2006) Behind the Scenes:

Planning a Multi-species microarray experiment. Chance. Vol 19, No 3. P27-38.

9. Babadoost M, Islam SZ, Tian D and Pavon C (2005) Phytophthora Blight (Phytophthora capsici) of

Pepper in Illinois Occurrence and Management. Second World Pepper Convention, Mexico.p6-12.

10. Tian D and Babadoost M (2004) Host range of Phytophthora capsici from pumpkin and

pathogenicity of isolates. Plant Diseases. 88:485 - 489.

11. Tian D and Babadoost M (2003) Analysis genetic variability among isolates of P. capsici using ITS,

ISSR and AFLP techniques. Phytopathology. 93:S84.