thursday, 5 june 2008

Thursday, 5 June 2008

• Problems in sequence analysis• Identification by sequence similarity

Genes Determining Plant-Cyanobacterial Symbioses and Consideration of Blast

This demonstration is best viewed as a slide show,enabling you to simulate a session and make changes

in cursor position more obvious.To do this, click Slide Show on the top tool bar, then View show.

Click anywhere to go on to the next slide

10 mM nitrate 0.1 mM nitrate

Gland development is stimulated by N-limitation

What's special about the gland?

Gland suppressed by presence of fixed N

Plant starved for N makes gland to house cyanobacteria

What genes are specifically

expressed in glands?

Construction of a cDNA library from Gunnera gland

mRNA ends with polyA tails

Use modified polyT to direct synthesis of

DNA copy of mRNAReverse Transcriptase (RT) adds CCC to end.

Add 2nd adapter, using GGG to attach to CCC. Extend cDNA

Construction of a cDNA library from Gunnera gland(Same protocol, but with real sequences)

5'-NNNNNNNNNN ... NNNNNNNNNNAAAAAAAAAAAAAAAAA...-3'3'-TTTTTCTTTTTTCATGGCTGACGCTGAGACGCAACTATGGTGACGAA-5'

Use modified polyT adapter to direct synthesis of DNA copy of mRNA


5'-NNNNNNNNNN ... NNNNNNNNNNAAAAAAAAAAAAAAAAA...-3'3'-TTTTTCTTTTTTCATGGCTGACGCTGAGACGCAACTATGGTGACGAA-5'

Use modified polyT adapter to direct synthesis of DNA copy of mRNA

The adapter can bind to many positions in polyA tail, resulting in variation in number

of T's in cDNA sequence.


5'-NNNNNNNNNN ... NNNNNNNNNNAAAAAAAAAAAAAAAAA...-3' TTTTTCTTTTTTCATGGCTGACGCTGAGACGCAACTATGGTGACGAA-5' 3'-CCCNNNNNNNNNN ... NNNNNNNNNN

Reverse Transcriptase (RT) extends the adapter to the end of the mRNA

and adds CCC to the 3' end.

3'-CCCNNNNNNNNNN ...



5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG

A second adapter is added which (with the help of antibodies to) uses three G's to bind to the three .C's.

CCCNNNNNNNNNN ...



5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG

The cDNA sequence is extended to the left, using the second

adapter as a template.

TTCGTCACCATAGTTGCGTCTCACCGGTAATGCCGG

CCCNNNNNNNNNN ...



5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGNNNNNNNNNN ...

The cDNA sequence is extended to the left, using the second

adapter as a template…

…and then the second cDNA is strand is synthesized left-to-right, using the first cDNA strand as the

template.

TTCGTCACCATAGTTGCGTCTCACCGGTAATGCCGG

CCCNNNNNNNNNN ...



5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGNNNNNNNNNN ... TTCGTCACCATAGTTGCGTCTCACCGGTAATGCCGG

Hundreds to thousands of nucleotides

To give some perspective, the adapters are about 50 nucleotides, while the

mRNA itself can be as large as a couple of thousands of nucleotides.


Of course there are thousands of different mRNA's in a cell, leading to thousands of cDNA's in the library, all

in multiple copies.

Sequencing of cDNA library

Limitations:

- Only from ends

- Only ~400 nt

It would be nice to be able to sequence the cDNA's from end to end, but that's

not presently possible.

Sequencing has its limitations.


Limitations:

- Only from ends

- Only ~400 nt

Solution:

- Break the cDNA

The solution is to break up the cDNA so that there are multiple, overlapping ends from which to sequence. In this way, all the full

length of the cDNA can be sequenced


(1000's of cDNA's)

The broken fragments are read from either end (at random). If there are enough reads, it is possible to use overlaps to

reassemble the original sequence.

Unfortunately, the adapters are also sequenced, and these complicate the assembly process, as they're interpreted as

overlapping sequences, leading to misassembly.

They need to be removed.


(1000's of cDNA's)

Given the number of sequences, the removal process obviously must be automated, but automated processes,

while fast, are often stupid.

We need to check to make sure they worked.

Identifying elements of cDNA library

The assembly process should, in theory, also remove duplicate sequences.


The assembly process should, in theory, also remove duplicate sequences.

In practice, partial duplicates may remain, and it is necessary to keep an eye

out for them.


Predict function directly from sequence

How to go from cDNA sequence to predicted function for the sequences?

You might think that since we can readily predict a protein sequence from a DNA

sequence, it should be possible to predict function as well.



Predict function from sequence similarity

Nope. At present that's impossible.

The best we can do is to compare sequences with sequences from other

organisms where there is experimental evidence as to function.



Predict function from sequence similarityBlast is a tool to do just that, comparing a

given sequence against at database of known sequences.

It is important to understand the mind of Blast. But that is a subject for another time.


1. Determine if primers been removed from sequences.

2. Determine if the library contains duplicates

3. Identify protein sequences similar to those encoded by cDNAs

We've identified many things that need to be done:

4. (plus one extra) Find where in the cDNAs genes begin and end


Go into StaphyloBIKE through the BioBIKE portal(Gunnera isn't a member of the Staphylococcus, of course, but I put the cDNA sequences in that instance of BioBIKE)

RUN-FILE "contig-resources.bike" SHARED(this makes the cDNA sequences available to you as a variable called gunnera-contigs and also provides you with a possibly useful tool

READ-NAMED to extract specific sequences)

These questions are ordinarily answered by high-powered computer types. But you can answer them yourself.

First you need to read in the data.


SEQUENCE-SIMILAR-TOAccesses BLAST, using as targets either internal data

(i.e. gunnera-contigs) or external data (i.e. *GENBANK*)Also used to look for nearly identical sequences,

using the MISMATCHES option.

READING-FRAMES-OF Translates the sequence in all six possible reading frames.

Possibly useful functions:

thursday, 5 june 2008

Documents

cdna library

cdna strand

gunnera gland5nnnnnnnnnn

nnnnnnnnnnthe cdna sequence

modified polyt adapter

gunnera glandmrna

gunnera glandof course

real sequences5nnnnnnnnnn