1.Master thesis @ BioBix

2. What the f*#@$k are we working on (aka, TOPICS): Smallstuff does matter Doestranslation start at ATG? Nucleartranslation, ay caramba? (R)Evolutionary Huntepigenetics for imprinted loci Cardiovascularepigenomics 3. Small stuff does matter Canonical bio-active peptides: -cleaved from precursor-signal peptide @ N-terminus-secretory pathway!Micropeptides:-translated directly from sORF-lacking signal sequence-released in cytoplasmPolaris: 3 peptides: 8, 9, 36 AA Rotundifolia4: 1 peptide: 53 AAEnod40: 2 peptides: 12 and 24 AATarsal-less/pri: 4 peptides: 11 and 32 AA 4. Small stuff does matterMus musculus(common house mouse)Build discovery strategyExtrapolate strategy160 Mbp Examples for validation are availablemodelsystemsL2 and L3 type larvae Embryonic stages between 10-16h 3 Gbpbetween 8 and 12 days past coitus (dpc) samples 5. Small stuff does matter(Crapp J. et al., BMC Genomics, 2013) 6. Does translation start at ATG? Mass spectrometryNGS: RNA-seq 7. Does translation start at ATG? 8. (1)(3)(4)Does translation start at ATG? (1) Generation of cell extracts in which ribosomes have been faithfully halted along the mRNA they are translating in vivo (2) Nuclease digestion of RNAs that are not protected by the ribosome followed by recovery of the ribosome-protected mRNA fragments(2)(3)Quantitative conversion of the protected RNA fragments into a DNA library (4)That can be analyzed by deep sequencing(Ingolia N. et al., Nature Protocols, 2012)(Ingolia N. et al., Cell, 2011) - Harringtonine - Lactimidomycin (LTM) (Lee S. et al., PNAS, 2012) (Fritch C. et al., Gen. Research, 2012) - Puromycin! causes ribosome accumulation at translation initiation site (TIS) 9. Does translation start at ATG? (1) 65% of transcripts contain more than 1 detectable TIS (mESC) (16% 4) --> Complexity of Proteome (2) N-terminal truncations and/or extensionsAlternate reading frames (internal out-of-frame), alternative splice isoformsuORFs (regulation downstream initiation)! (3) Often @ near-cognate initiation sites n =13.454(Ingolia N. et al., Cell, 2011) 10. Nuclear translation, ay caramba? 11. (R)Evolutionary epigenetics 12. (R)Evolutionary epigenetics 13. Hunt for imprinted lociDNA-(hydroxy)methylatieChIP-seq 14. Cardiovascular epigenomics(TTAGGG)n' 15. Cardiovascular epigenomics 16. Where can you help out? Bioinformatics:1.tool/pipeline development 2.data analysis/integration (computational genomics) 3.algorithm development Technological 4.aspects: NGS and MS xxx-seq, (replace xxx with MBD/RNA/RIBO/RRBS/ CHIP) or Mass Spectrometry 17. Where can you help out? Example: Bioinformatics, tool/pipeline development - Use RIBO-seq translation synthesis products as search space for MS/MS based proteomics/peptidomics- Construct a user-friendly, robust and fast pipeline to do the conversion- Both scripting based and implementation in Galaxy-P 18. Where can you help out? Example: Bioinformatics, tool/pipeline development 19. Example: Bioinformatics, tool/pipeline developmentResults: (1) 45 LC runs resulting in 68.523 MS/MS spectra (2) Different translation product typesRibo-seqN-terminomics259$16$ 4$1$ 3$1556$n =13.454n =1.835(Menschaert G. et al., Mol & Cell Prot, 2013) 20. Example: Bioinformatics, tool/pipeline development (3) Start codon: both cognate and near-cognate1.0ACG0.0GTGGCA A C GC TTA CG T1.0probabilitybits2.0T0.5G TGGA ACCG AGTACC 0.0 TGT TCT C A5Kozakmo(f:[A/G]CCatgG[notT] Based on new N-term-ext and uORF identicationsTC A5WebLogo 3.3WebLogo 3.3(4) Example: HDGF_MOUSE (n-term-ext, near-cognate start site) GTGGTGTTGHDGF(hsa) stomach&skin&spleen&heart&kidney&intes*ne&lung&46# 40#kDa# 38#kDa# 36.5#kDa#HDGF(mmu)(V)AAPELASGAGIEAGAAR (|)||||| || ||||||| (V)AAPELGPGATIEAGAARliver&tes*s&GCCGTGTGTTGCCCACCGCGCCCGGCCCTGTCCGA GCGGCGCGCGGGCGCAGACGCCGTGGCTGCCCCGG AGCTCGCGTCGGGGGCCGGCATCGAGGCGGGGGCC GCGCGAGGGCCGGAGCGCAGCGGCGCCGCAACCGC CGCACGCGCAAACTTGGGCTCGCGCTTCCCGGCTC GGCGCGGAGCCCGGGGCGCCCGCGGCCCCGCCATG TCGCGATCCAACCGGCAGAbrain&uc008ptc.1muscle&ATG32#HDGF%(Menschaert G. et al., Mol & Cell Prot, 2013) 21. (International) collaborations: VIB(Medical Proteomics Group: ribosome proling and MS) VITO(Mass Spectrometry: small stuff) NXTGNT Asklepios(UGent sequencing facility) study investigators group Weissmanlab, Feny lab (US: ribosome proling, cancer proteogenomics, MS) 22. More info @: where are we: www.biobix.be general info on the lab topics online, your input ? www.nucleotides2networks.be whereare we physically: Building A, 2nd oor, Room 004symposium, 29th of November: Bridging the gap between two omics worlds, transcriptomics and proteomics invitation will follow/be posted on the biobix.be Mini