Gene, 130 (1993) 145-150

0 1993 Elsevier Science Publishers B.V. All rights reserved. 0378-I 119/93/$06.00

GENE 07186

145

The Streptomyces coelicolor glnR gene encodes a protein similar to other bacterial response regulators

(Nitrogen regulation; glutamine synthetase; gInA)

Lewis V. Wray, Jr, and Susan H. Fisher

Department of Microbiology, Boston University School ofMedicine, Boston, MA, 02118. USA

Received by K.F. Chater: 22 January 1993; Accepted: 11 February 1993; Received at publishers: 6 April 1993

SUMMARY

The Streptomyces coelicolor gZnR gene positively regulates the transcription of the glutamine synthetase-encoding

glnA gene. The nucleotide sequence of a 1682-bp DNA segment containing glnR was determined. The deduced amino

acid sequence of the GlnR protein was found to be similar to the sequence of several bacterial response regulators that are known to function as transcriptional activators. Primer extension analysis of gZnR mRNA identified three transcrip- tional start points (tsp) upstream from the glnR coding sequence.

INTRODUCTION

The Streptomyces are commercially important bacteria due to the large number and wide variety of antibiotics and chemotherapeutic agents that they synthesize (Demain et al., 1983). These compounds are produced as secondary metabolites during nutritional limitation (Demain et al., 1983). For instance, the synthesis of acti- norhodin and undecylprodigiosin by S. coelicolor is inhibited by high concentrations of ammonium in the growth medium (Hobbs et al., 1990), indicating that the production of these compounds is regulated in response to nitrogen availability. In spite of many studies, the rela- tionship between the regulation of primary and secondary metabolism remains poorly understood.

Glutamine synthetase (GS) plays a primary role in the assimilation of ammonium during nitrogen limiting con-

Correspondence to: Dr. S. H. Fisher, Department of Microbiology, Boston University School of Medicine, 80 East Concord Street, Boston, MA 02118, USA. Tel. (617)638-5498; Fax (617)638-4286.

Abbreviations: aa, amino acid(s); bp, base pair(s); glnA, GS-encoding structural gene; GS, glutamine synthetase; nt, nucleotide(s); ORF, open

reading frame; P, promoter; S., Streptomyces; tsp, transcription start

point(s).

ditions (Reitzer and Magasanik, 1987). Many bacteria have been found to contain multiple isozymes of GS. The GSI enzyme is a multimeric protein consisting of twelve identical subunits (Reitzer and Magasanik, 1987). In S. coelicolor, GSI activity is regulated by both transcrip- tional and post-translational mechanisms (Fisher and Wray, 1989). Adenylylation of the GSI protein results in a reduction of GSI enzymatic activity. In addition, tran- scription of the GSI structural gene, glnA, is regulated in response to the available nitrogen source. Transcription of the glnA gene requires the product of the glnR gene (Wray et al., 1991).

A second type of GS, GSII, is composed of eight iden- tical subunits and is not regulated by adenylylation. GSII is found in nitrogen-fixing bacteria such as Rhizobium, Bradyrhizobium, and Frankia (Carlson and Chelm, 1986; Edmands et al., 1987; Somerville et al., 1989). DNA encoding a GSII enzyme has been cloned from S. viridoch- romogenes (Behrmann et al., 1990) and S. hygroscopicus (Kumada et al., 1990). Although these genes are expressed when cloned into Streptomyces plasmids, transcription of the chromosomal genes has not been demonstrated. It is unclear whether the GSII enzyme plays any role in ammonium assimilation in Streptomyces species.

The expression of a variety of bacterial genes is con-

GCACGACCACAAACCGTCCCAGGC~T~G~CACGATGAGTTCTCTGCTGCTCCTGACC~CGCCCTCCAGCCGTCGACGGAGGTGCTTCCCGCCCTCGGCCTGCTGCTGCACMCGTA 720 MetSerSerLeuLeuLeuLeuThrAsnAlaLeuGlnProSerThffiluValLeuProAlaLeuGlyLeuLeuLeuHisAsnVaL 28

120

240

360

840 68

960 108

1080 148

1320 228

1680 66

Fig. 1. The nt sequence of the gtnR gene as determined by the dideoxynucieotide chin-te~ination method @anger et al., 1977). Sequencing reactions were performed at ‘70°C using Taq DNA poiymerase and the nt analog 7-de~a-~-deoxyguanosine in order to resolve gel compressions (Innis et al., 1988). The entire sequence of both strands was determined. Locations of the tsp are indicated by the arrowed open circles. The putative - 10 promoter regions are overlined. The deduced aa sequences for the GinR protein and the downstream 66 aa partial ORF are shown below the coding sequences. The underlined sequence located immediatety upstream from the glnR start codon is complementary to the 3’ end of the S. liuiduns 16s RNA (Bibb and Cohen, 1982). The stop codon is denoted by three asterisks. The DNA sequence has been deposited with GenBank (accession No. L03213).

trolled by two-component regulatory systems (Gross et al., 1989; Stock et al., 1989). In general, these systems contain a pair of proteins referred to as sensors and response regulators. The sensor proteins are histidine protein kinases that phosphorylate/dephosphorylate their cognate response regulators in response to environ- mental stimuli. The response regulators typically function as transcriptional activators.

EXPERIMENTAL AND DISCUSSION

(a) Nucleotide sequence of the glnR gene We have previously described the isolation of several

clones that complement glnR mutants (Wray et al., 1991). The nt sequence of this DNA is presented in Fig 1. The G + C content of the DNA sequence is 7 1% and is similar to the G + C composition of Streptomyces DNA (Gladek and Zakrzewska, 1984). Analysis of the sequence revealed the presence of an ORF beginning with the ATG codon at nt position 637 and ending with a TGA stop codon at nt 1438. This ORF is similar to other Streptomyces genes in that the high G f C content results in a codon usage that is biased towards G or C nt at the third position of the codons (Wright and Bibb, 1992). Immediateiy upstream from the start codon is a sequence complemen- tary to the 3’ end of the S. l~#~~~~s 16s RNA (Bibb

and Cohen, 1982) that is likely to serve as the in vivo ribosome-binding site (Shine and Dalgarno, 1976). This ORF would encode a protein of 267 aa with an M, of 28 887.

Previous CompIementation studies demonstrated that the g~nR mutants could be divided into two groups (Wray et al., 1991). Three of the glnR mutants could be restored to a functional state via recombinational repair with a 269-bp ApaI-NcoI DNA fragment. This DNA fragment lies within the glnR ORF (Fig. 2). The second group of glnR mutants was found to contain a DNA rearrange- ment located near the Sal1 site within the 3’ end of this

glnR2, 10, 35 glnR55, 101, 125

O///WY/~ m

+‘@% $ \ \ vq i6” ,c\ ,<+

I I I I 1

I glnR 11

ORF-66

Fig. 2. Diagram and restriction map of the sequenced S. coelicolor glnR region. The boxes at the bottom show the location of the reading frames for the glnR gene and the 66 aa ORF. The cross-hatched bar shows the location of the glnR mutations rescued by recombinational repair with the 269-bp ApaI-NcoI fragment (Wray et al., 1991). The black bar shows the location of the DNA rearrangement in the three other glnR mutants.

ORF (Fig. 2). These results taken 267 aa ORF is the glnR gene.

(b) GlnR aa sequence comparison

together argue that the

A search of the NBRF protein-sequence data bank revealed that the GlnR protein has strong sequence sim- ilarity with several prokaryotic response regulators (Fig. 3). The response regulators have been placed into subgroups on the basis of sequence similarities among their C-terminal domains (Gross et al., 1989; Stock et al.,

147

1989). The GlnR protein belongs to the subgroup which contains the OmpR, VirG, PhoB and ArcA proteins. Expression of the Escherichia coli glnA gene is controlled by the NtrC response regulator (Reitzer and Magasanik, 1987). Interestingly, the GlnR and NtrC proteins belong to different subgroups of response regulators (Gross et al., 1989; Stock et al., 1989).

The C-terminal region of the VirG and OmpR proteins have been shown to contain a DNA-binding domain (Roitsch et al., 1990; Tsung et al., 1989). The PhoB and

GlnR

PhoP

CutR

AfsQl

DwR

VirG

60 70 80 90 100 110

. .

GLnR

PhoP

CutR

Afsal

OvN

VirG

LLRSTGLS

PLRaPKLM

KIVELGMP

4:

RIRRTDPL

RLRSaSNP

G L ElflV R NHA A K SD I [P I I I IIS G D R L E E T D K VMA

120 130 140 150 160

GLnR

PhoP

CUR

AfsQl

‘-PR

VirG RVRPNVV

170 180 190 200 210 220

GlnR

PhoP

CutR

AfsPl

anpR

Vi rG

EES

EPL

DEA

DMR

RHAILIE LkjLlT R a

AEaMDR

STPFTR

RND

KGE

E FD

VSD RVEG

VVVG l-l

RIVG II

Fig. 3. Alignment of aa 1-221 from the deduced sequence of the GlnR protein with similar regions of other response regulators: Bacillus subtilis PhoP aa 2-236 (Seki et al., 1987), Streptomyces lividans CutR aa 1-217 (Tseng and Chen, 1991), Streptomyces coelicolor AfsQl aa l-223 (Ishizuka et al., 1992), Escherichia coli OmpR aa 4-234 (Comeau et al., 1985) and Agrobacterium tumefaciens VirG aa 22-255 (Melchers et al., 1986). Only aa residues identical or similar to aa in the GlnR protein are boxed. Groups of similar aa are: LVI, AG, ST, DE, RK. The position of the conserved Asp5” is indicated by a star. Asng and Asp98 in GlnR are indicated by diamonds. These positions correspond to the locations of the conserved Asp and Lys residues found in most other response regulator proteins (Stock et al., 1989).

148

OmpR proteins activate transcription of their target genes at promoters transcribed by the major form of RNA polymerase holoenzyme (Makino et al., 1988; Tsung et al., 1990). The glnA promoter is similar to other positively regulated promoters in that it has significant sequence homology with the - 10 consensus sequence but not with the -35 consensus sequence for vegetative Streptomyces promoters (Fisher and Wray, 1989; Strohl, 1992). Taken together, these observations suggest that the GlnR protein is a DNA-binding protein and that it may be directly responsible for activating transcription of the glnA gene. It is also possible that the GlnR protein may indirectly control glnA expression by way of an interme- diate regulatory gene.

Sequence comparisons of many response regulators have revealed the presence of three highly conserved aa residues (Stock et al., 1989). Two of these aa are not conserved in the GlnR protein sequence (Fig. 3). The GlnR protein contains Asn9 instead of Asp, and Asp98 instead of Lys. The AspSo within the GlnR protein corres- ponds to the conserved Asp that is the site of phosphory- lation of the VirG protein (Jin et al., 1990). Interestingly, the Caulobacter crescentus FlbD response regulator lacks the same two conserved residues as the GlnR protein (Ramakrishnan and Newton, 1990).

In general, the genes encoding a pair of sensor and response regulator proteins are located adjacent to one another (Stock et al., 1989). Analysis of the ORFs located both upstream and downstream from the glnR gene did not reveal any protein sequences with similarity to any known sensor proteins. Therefore, if the GlnR protein is phosphorylated by a sensor kinase, the gene for this pro- tein must be located at a different location on the S. coeIicolor genome.

It has been recently demonstrated that the CheB, CheY and NtrC response regulator proteins can be phosphory- lated in vitro by small molecules that contain high-energy phosphoryl groups (Feng et al., 1992; Lukat et al., 1992). Moreover, in vivo studies have suggested that acetyl phosphate may modulate the activity of the PhoB and NtrC proteins (Feng et al., 1992; Wanner and Wilmes- Riesenberg, 1992). This raises the possibility that the activity of the GlnR protein may be modulated in vivo in response to some metabolic intermediate such as acetyl phosphate or carbamyl phosphate.

(c) Identification of glnR tsp Reverse transcriptase primer extension experiments of

glnR mRNA provided evidence for three tsp upstream from the glnR coding sequence (Fig. 4). The PI and P3 promoters had transcripts with unique 5’ ends while the P2 promoter had transcripts that were located at three adjacent nt. The P3 and P2 promoters have -10 regions

1234ACGT

P3-

P2 -

Pl -

Fig. 4. Identification of the 5’ ends of glnR mRNA. Cell growth, RNA extraction and primer extension experiments were performed as described by Fisher and Wray (1989). The oligodeoxynucleotide primer was complementary to nt 550-569 in Fig. I. Lanes A, C, G, T are sequencing reactions using the same oligodeoxynucleotide primer. RNA was isolated from the following S. co&color strains grown in BSS mini- mal medium (Fisher and Wray, 1989) containing glucose as a carbon source and the indicated nitrogen sources: lanes (1) 51508, nitrate; (2) 51508, aspartate-glutamine; (3) FS2 (glnRZj, aspartate-glutamine; (4) FSlO (gInRIO), aspartate-glutamine. The isolation of the ghR mutants FS2 and FSlO from strain J1508 is described in Wray et al. (1991).

that match 3 of the 6 nt in the consensus sequence for Streptomyces vegetative promoters (Strohl, 1992) but do not have any strong similarity with the - 35 region con- sensus sequence (Fig. 1). In contrast, the PI promoter lacks homology with both promoter consensus sequences (Fig. 1). Although these experiments do not rule out the possibility that the PI and P2 transcripts result from degradation of the P3 transcript, it is not uncommon for Streptomyces genes to have multiple promoters (Strohl, 1992). Similar levels of the three different transcripts were observed with RNA isolated from cultures grown with either nitrate or aspartate and glutamine as nitrogen sources (Fig. 4, lanes 1 and 2). There is no difference in the level of glnA transcription in cells grown on these nitrogen sources (Fisher and Wray, 1989). All three pro- moters are active in the glnR2 and glnRl0 mutant strains (Fig. 4, lanes 3 and 4). This argues that expression of the glnR gene is not autogenously regulated.

149

(d) Downstream ORF with sequence similarity to the fuc repressor superfamily

Immediately downstream from the gEnR gene are 66 codons of a truncated ORF (Fig. 1). Because the third position of the codons within this ORF is strongly biased towards G and C (like Streptomyces genes; Wright and Bibb, 1992), this ORF is likely to encode a protein. A potential -10 promoter sequence is located 6 nt upstream from the putative GTG start codon (Fig. 1). This suggests that this gene may be transcribed and translated from the same nt, as has been reported for a number of other Streptomyces genes (Strohl, 1992). The aa sequence of this ORF has strong sequence similarity with the proteins in the lac repressor superfamily (Weickert and Adhya, 1992). It is not known if this protein plays any role in nitrogen regulation in S. coelicolor.

(e) Conclusions (1) The glnR gene product of Streptomyces coelicolor

A3(2) is a member of the sub-family of response regulator proteins which includes OmpR, VirG, PhoB and ArcA.

(2) GlnR differs from other response regulators at cer- tain highly conserved residues.

(3) The glnR gene is not closely adjacent to a gene for a cognate sensor protein, though it is close to a gene specifying a LacI repressor-like protein.

(4) Transcription of glnR appears to be from three pro- moters, two of which have - 10 regions somewhat similar to that of the major class of bacterial promoters.

ACKNOWLEDGEMENTS

We would like to thank Alex Ninfa for his helpful dis- cussions. This work was supported by Public Health Service research grant ROl-AI23 168 from the National Institutes of Health.

REFERENCES

Behrmann, I., Hillermann, D., Ptihler, A. Strauch, E. and Wohlleben,

W.: Overexpression of Streptomyces uiridochromogenes gene (glnll) encoding a glutamine synthetase similar to those of eucaryotes con-

fers resistance against the antibiotic phosphinothricyl-alanyl-

alanine. J. Bacterial. 172 (1990) 532665334.

Bibb, M.J. and Cohen, S.N.: Gene expression in Streptomyces: construc-

tion and application of promoter-probe plasmids in Streptomyces liuidans. Mol. Gen. Genet. 187 (1982) 265-277.

Carlson, T.A. and Chelm, B.K.: Apparent eukaryotic origin of glutamine

synthetase II from the bacterium Bradyrhizobium japonicum. Nature

322 (1986) 5688570.

Comeau, D.E., Ikenaka, K., Tsung, K. and Inouye, M.: Primary charac-

terization of the protein products of the Escherichia coli ompB locus: structure and regulation of synthesis of the OmpR and EnvZ pro-

teins. J. Bacterial. 164 (1985) 578-584.

Demain, A.L., Aharonowitz, Y. and Martin, J.-F.: Metabolic control of

secondary biosynthetic pathways. In: Vining, L. (Ed.), Biochemistry

and Genetic Regulation of Commercially Important Antibiotics.

Addison-Wesley, Reading, MA, 1983, pp. 49-72.

Edmands, J., Noridge, N.A. and Benson, D.R.: The actinorhizal root-

nodule symbiot Frankia sp. strain CpIl has two glutamine synthe-

tases. Proc. Nat]. Acad. Sci. USA (1987) 6126-6130.

Feng, J., Atkinson, M.R., McCleary, W., Stock, J.B., Wanner, B.L.,

Ninfa, A.J.: Role of phosphorylated metabolic intermediates in the

regulation of glutamine synthetase synthesis in Escherichia coli.

J. Bacterial. 174 (1992) 6061-6070.

Fisher, S.H. and Wray. L.V.: Regulation of glutamine synthetase in

Streptomyces coelicolor. J. Bacterial. 171 (1989) 2378-2383.

Giadek, A. and Zakrzewska, J.: Genome size of Streptomyces. FEMS

Microbial. Lett. 24 (1984) 73-76.

Gross, R., Arico, B. and Rappuoli, R.: Families of bacterial signal-

transducing proteins. Mol. Microbial. 3 (1989) 1661-1667.

Hobbs, G., Frazer, C.M., Gardner, D.C., Flett, F. and Oliver, S.G.:

Pigmented antibiotic production by Streptomyces coelicolor A3(2):

kinetics and the influence of nutrients. J. Gen. Microbial. 136 (1990)

229 l-2296.

Innis, M.A., Myambo, K.B., Gelfand, D.H. and Brow, M.A.D.: DNA

sequencing with Thermus aquaticus DNA polymerase and direct

sequencing of polymerase chain reaction-amplified DNA. Proc.

Nat]. Acad. Sci. USA 85 (1988) 9436-9440.

Ishizuka, H., Horinouchi, S., Kieser, H.M., Hopwood, D.A. and Beppu,

T.: A putative two-component regulatory system involved in second-

ary metabolism in Streptomyces spp. J. Bacterial. 174 (1992)

7585-7594.

Jin, S., Prusti, R.K., Roitsch, T., Ankenbauer, R.G. and Nester, E.W.:

Phosphorylation of the VirG protein of Agrobacterium tumefaciens by the autophosphorylated VirA protein: essential role in biological

activity of VirG. J. Bacterial. I72 (1990) 494554950.

Kumada, Y., Takano, E., Nagaoka, K. and Thompson, C.J.:

Streptomyces hygroscopicus has two glutamine synthetase genes.

J. Bacterial. 172 (1990) 5343-5351.

Lukat, G.S., McCleary, W.R., Stock, A.M. and Stock, J.B.:

Phosphorylation of bacterial response regulator proteins by low

molecular weight phospho-donors. Proc. Nat]. Acad. Sci. USA 89

(1992) 718-722.

Makino, K., Shinagawa, H., Amemura, M., Kimura, S. and Nakata, A.:

Regulation of the phosphate regulon of Escherichia coli: activation

of pstS transcription by PhoB protein in vitro. J. Mol. Biol. 203

(1988) 85-95.

Melchers, L.S., Thompson, D.V, Idler, K.B., Schilperoort, R.A. and

Hooykaas, P.J.J.: Nucleotide sequence of the virulence gene uiFC of

the Agrobacterium tumefaciens octopine Ti plasmid: significant

homology between virG and the regulatory genes ompR, phoB and

dye of E. co/i. Nucleic Acids Res. 14 (1986) 993339942.

Ramakrishnan, G. and Newton, A.: FlbD of Caulobacter crescentus is

a homologue of the NtrC (NR,) protein and activates &‘-dependent

flagellar gene promoters. Proc. Nat]. Acad. Sci. USA 87 (1990)

2369-2373.

Reitzer, L.J. and Magasanik, B.: Ammonium assimilation and the bio-

synthesis of glutamine, glutamate, aspartate, asparagine, L-alanine

and o-alanine. In: Neidhart, F. C., Ingraham, J. L., Low, K. B.,

Magasanik, B., Schaechter, M. and Umbarger, H. E. (Eds.),

Escherichia coli and Salmonella typhimurium. Cellular and Molecular

Biology, American Society for Microbiology, Washington DC, 1987,

pp. 302-320.

Roitsch, T., Wang, H., Jin, S., and Nester, E.W.: Mutational analysis of

the VirG protein, a transcriptional activator of Agrobacterium tumef aciens virulence genes. J. Bacterial. 172 (1990) 6054-6060.

Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-

terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977)

5463-5467.

150

Seki, T., Yoshikawa, H., Takahashi, H. and Saito, H.: Cloning and nucleotide sequence of phoP, the regulatory gene for alkaline phos- phatase and phosphodiesterase in Bacillus subtilis. J. Bacterial. 169 (1987) 2913-2916.

Shine, J. and Dalgarno. L.: Determinant of cistron specificity in bacterial ribosomes. Nature 254 (1976) 34-38.

Somerville, J.E., Shatters, R.G. and Kahn, M.L.: Isolation, characteriza- tion, and complementation of Rhizobium meliloti 104Al4 mutants that lack glutamine synthetase II activity. J. Bacterial. 171 (1989) 5079-5086.

Strohl, W.R.: Compilation and analysis of DNA sequences associated with apparent Streptomyces promoters. Nucleic Acids Res. 20 (1992) 961-974.

Stock, J.B., Ninfa, A.J. and Stock, A.M.: Protein phosphorylation and regulation of adaptive responses in bacteria. Microbial. Rev. 53 (1989) 450-490.

Tseng, T.-C. and Chen, C.W.: A cloned ompR-like gene of Streptomyces

liuidans 66 suppresses defective melC1, a putative copper-transfer gene. Mol. Microbial. 5 (1991) 1187-l 196.

Tsung, K., Brissette, R. and Inouye, M.: Identification of the DNA- binding domain of the OmpR protein required for transcriptional activation of the ompF and ompC genes of Escherichia co/i by in vivo DNA footprinting. J. Biol. Chem. 264 (1989) 10104-10109.

Tsung, K., Brissette, R. and Inouye, M.: Enhancement of RNA polymer- ase binding to promoters by a transcriptional activator, OmpR, in

Escherichia coli: its positive and negative effects on transcription. Proc. Natl. Acad. Sci. USA 87 (1990) 5940-5944.

Wanner, B.L. and Wilmes-Riesenberg, M.R.: Involvement of phospho- transacetylase, acetate kinase, and acetyl phosphate synthesis in control of the phosphate regulon in Escherichia co/i. J. Bacterial. 174 (1992) 2124-2130.

Weickert, M. and Adhya, S.: A family of bacterial regulators homolo- gous to Gal and Lac repressors. J. Biol. Chem. 267 (1992) 15869-15874.

Wray Jr., L.V., Atkinson, M.R. and Fisher, S.H.: identification and cloning of the glnR locus which is required for transcription of the gin.4 gene in Streptomyces coelicolor A3(2). J. Bacterial. 173 (1991) 7351-7360.

Wray Jr., L.V., and Fisher, S.H. Cloning and nucleotide sequence of the Streptomyces coelicolor gene encoding glutamine synthetase. Gene.. 71 (1988) 247-256.

Wright, F. and Bibb, M.J.: Codon usage in the G + C-rich Streptomyces

genome. Gene 113 (1992) 55-65.