ReseaRch

Volume 1 | 2011-2012 | 13

roadB treetSScientific

Vipul Vachharajani

(UTRs) and recruit, enhance, or inhibit processing ma-chinery (Kishore et al., 2010).

An emergent property of this sequence-specific target-ing is a varied and combinatorial network of RNA-binding interactions, in which a certain mRNA can have several RBPs bound at once in a dynamic time- and sequence-de-pendent manner. The Post-Transcriptional RNA Operon model posits that these regulatory groups are a basic func-tional unit of expression in most eukaryotes and enable tight control of mRNA processing from transcription to translation (Keene and Tenenbaum, 2002; Keene, 2007). This provides not only a powerful means of interpreting knowledge about these RNA-binding proteins but also a strategy for studying them. A necessary step in under-standing this tight regulatory system, then, is to determine the function of each RBP both in terms of target binding and in the functional context of an RNA operon.

Unlike other RBPs, HuR lacks a well-defined target sequence motif; however, it is known to bind AU-rich ele-ments (AREs) in the 3’UTR of target mRNA. HuR-ARE binding is known to increase the stability of the targets by blocking access to other destabilizing ARE-binding RBPs (Brennan and Steitz, 2001). However, while the cytoplas-mic function of HuR is well-characterized, it is primarily localized in the nucleus, and a nuclear function for HuR remains poorly-defined (Fan and Steitz, 1998). Owing to the ubiquity and high expression of HuR, full character-ization of HuR is critical to a complete picture of post-transcriptional gene regulation in cells (Zhu et al., 2006). The goal of this research was to determine the role of HuR in nuclear pre-mRNA processing.

IntroductionHuR is an RNA-binding protein (RBP) which is high-

ly expressed in all human tissues and shuttles between the nucleus and the cytoplasm (Saunders and Barber, 2003; Tenenbaum et al., 2002; Hinman and Lou, 2008). HuR upregulation is implicated in carcinogenesis and sustained growth of glioma and colon cancer (Dixon et al., 2001; Bolognani et al., 2011; Denkert et al., 2006). Furthermore, autoimmune dysfunction of HuR and other neuronally-expressed Hu-family proteins is linked to neoplastic phe-notypes, highlighting the importance of HuR in regula-tion of gene expression in normal cells (Hinman and Lou, 2008). The ubiquity of and complication associated with deficiency of HuR distinguishes it as a vital protein for all human cells.

Gene expression serves as a vital process in regulation of the cell cycle; specifically, dysfunctional gene regulation is often important in the development of cancer. Therapeutic strategies for cancer that specifically target gene expres-sion patterns, thus, may prove to be extremely effective.

Gene regulation at the messenger RNA (mRNA) level, such as that demonstrated by HuR, has been shown to be a robust and wide-ranging mechanism and thus an in-teresting target to counteract the drastic changes in ex-pression which occur during cancer (Keene, 2007; Kishore et al., 2010). Factors such as RBPs interact with target mRNA molecules, affecting their processing, stability, and cytoplasmic translation, thus controlling patterns of gene expression (Kishore et al., 2010). Often, these proteins recognize and bind highly-conserved and well-defined sequence motifs in the 3’ and 5’ un-translated regions

The RNA-Binding Protein HuR Binds and Stabilizes pre-mRNA in vivo

Abstract: HuR is an RNA-binding protein which is important in normal cell function. Dysregulation of HuR can lead to neoplastic phenotypes and is implicated in carcinogenesis in colon and brain cancer. Because of its ubiquity, HuR is an im-portant target of study both in the context of diseases such as cancer but also in the basic study of RNA regulation. HuR acts in the cytoplasm to prevent degradation of mature mRNA molecules, but HuR’s nuclear function is less well known. Recently, HuR targets which bind only intronic sequences in unspliced RNA have been proposed, which would reveal a HuR function which is distinct from the cytoplasmic one and may be significant in understanding the global cellular function of HuR.t

We used RNA immunoprecipitation to confirm HuR binding to intronic only sequences of the proposed targets. We then used siRNA knockdown of HuR to show a functional effect of the observed binding on pre-mRNA transcript abundance. Our results show a high degree of HuR binding to intronic sequences in the NFATC3 gene, but not to NFATC3 transcripts lacking the putative binding intron. Furthermore, HuR knockdown resulted in a significant decrease in pre-NFATC3 tran-script levels. This indicates that HuR participates in functionally-significant, intron-specific binding, and suggests a complex nuclear function of HuR that may include splicing and splicing-concurrent processes.

ReseaRch

14 | 2011-2012 | Volume 1

roadB treetSScientific

protein.

RNA Extraction, Purification, and Reverse Transcrip-tion

TRIzol, a phenol-based reagent, was used to extract total RNA from the plated cells via a solvent-extraction method (Invitrogen Life Science, 2010). The iScript re-verse transcription kit was used to produce cDNA (Bio-Rad Laboratories, 2000). An additional negative control aliquot of RNA was not treated with reverse transcriptase but still underwent the thermal cycling protocol in the same buffer used in the cDNA reaction. The cDNA ob-tained from both groups was used as a template for the Real Time Quantitative Polymerase Chain Reaction.

RNA Immunoprecipitation and Quantitative PCR (RIP-PCR)

RNA Immunoprecipitation (RIP) is a technique in which mRNA bound to an immunoprecipitated RBP is processed via qPCR, microarray, or direct sequencing so as to evaluate the transcripts to which it is bound. The procedure performed here utilized RT-qPCR to measure amounts of bound target mRNA. RIP was performed as previously described (Keene et al., 2006). Briefly, both nuclear and whole-cell lysates were prepared using gentle lysis in Polysome Lysis Buffer at 4 degrees C, so as to pre-serve RNPs. The lysates were immunoprecipitated using anti-HuR 3A2 antibody on sepharose protein A beads (Sigma-Aldrich). A background control was obtained us-ing normal mouse serum (NMS) instead of 3A2. Western Blotting was used on total, supernatant, and immunopre-cipitated fractions of the lysates to determine enrichment for HuR. RNA was extracted from total and immuno-precipitated fractions of the lysates, and RT-qPCR per-formed on the fractions to determine enrichment of target RNAs. The presence of an enriched RNA species in the immunoprecipitate indicates a HuR target.

PCR Primer Design and RT-qPCRPCR primers for target genes were designed using the

online Primer BLAST tool from the National Center for Biotechnology Information (NCBI), as well as the online ExonPrimer tool. Primer BLAST determines oligonucle-otide sequences in both the forward and reverse strands that correspond to a unique RNA product, utilizing the NCBI Basic Local Alignment Search Tool (BLAST) to determine specificity (Altschul et al., 1990; Rozen and Skaletsky, 2000). ExonPrimer, originally designed to pro-duce DNA primers which amplify entire exons, produces amplicons which are also appropriate for pre-mRNA am-plification. Separate primers were generated to recognize the pre-mRNA and mature mRNA products as follows: The pre-mRNA primers were designed to generate a product that spanned at least one exon-intron junction, so that a controlled product would only be formed by an un-

HuR’s global function has been evaluated in recent studies, which used the novel Photoactivatable Ribonu-cleoside Cross-Linking and Immunoprecipitation (PAR-CLIP) technique to determine the binding sites of HuR across the set of transcribed RNA (Hafner et al., 2010). Surprisingly, using PAR-CLIP, binding sites in intronic sequences were found, suggesting that HuR not only targets mature mRNA through the 3’ UTR but also im-mature pre-mRNA (Mukherjee et al., 2011; Lebedeva et al., 2011). This project investigated these intronic binding sites further.

In this report, we evaluated the possibility of un-spliced mRNA targeting by the vital RNA-binding protein HuR through RNA immunoprecipitation and quantitative Polymerase Chain Reaction, and used siRNA knockdown of HuR to determine HuR-related functional effects on pre-mRNA.

Materials and MethodsWe used RNA immunoprecipitation to confirm HuR

binding to intronic sequences in pre-mRNA and HuR siRNA knockdown to evaluate functional effects of HuR on target transcript abundance. Quantitative PCR was used to determine transcript levels during each of these procedures.

Once functional HuR binding was confirmed, a GFP splicing reporter assay using the pGint plasmid reporter construct was used to more directly look at intronic se-quence-dependent effects. Also, a 4-thiouridine incorpo-ration assay was used to investigate HuR-mediated effects on the splicing rates of target pre-mRNAs.

Cell CultureHuman Embryonic Kidney 293T cells (HEK293,

ATCC), the same cell line used by Mukherjee et al, were used for HuR knockdown and RNA extraction (Mukher-jee et al., 2011). Cells were cultured in Dulbecco’s Modi-fied Eagle’s Medium (Gibco) at 37 degrees C and 5% CO2. For knockdowns, cells were cultured in 6-well plates, and for RNA immunoprecipitation (RIP), cells were cultured in 15-cm culture plates.

siRNA Knockdown of HuRAnti-HuR siRNA (Applied BioSystems) was trans-

fected into HEK293T cells using Lipofectamine reagent. Briefly, the siRNA was added to Lipofectamine and the resulting mixture was used to treat 3 wells of a 6-well plate. The cells were incubated for 72 hours before harvesting to allow full knockdown and degradation of latent HuR present (Invitrogen Life Science, 2006). A negative con-trol group treated in the same manner with random, non-specific siRNA (Applied Biosystems) was cultured in the remaining 3 wells. Reduced levels of HuR transcript in the knockdown cells, as determined from RT-qPCR, were used as confirmation of successful knockdown of HuR

ReseaRch

Volume 1 | 2011-2012 | 15

roadB treetSScientific

in expression of that transcript between mock knockdown and knockdown (LFC). This fold change can then be cal-culated by evaluating 2LFC. This gives knockdown expres-sion as a fraction of mock knockdown expression.

The fold enrichment of each RIP target was determined using ΔΔCt, controlling 3A2-bound IP by NMS-bound IP. An example calculation is shown in Table 1 for NFATC3.

GapDH NFATC3 LFDGAPDH LFC 2-LFC

KD 21.21 23.46 2.25 -1.56 0.33915Ctrl 18.83 19.52 0.69

Table 2: Example calculation of remaining transcript frac-tion using the ΔΔCt method. Data shown is for NFATC3 transcript.

Molecular Cloning of Fluorescent Protein Reporter Plasmids

A GFP splicing reporter assay was performed using plasmid constructs as follows (Bonano et al., 2007). The pGint and pRint plasmid systems were used to compare splicing efficiency for three putative intronic HuR binding sites. Briefly, intronic sequences spanning the HuR bind-ing sites for NFATC3, CCDC58, and CTCF were ampli-fied via PCR and ligated into the pGEM-T vector sys-tem (Promega). The sequence was then further amplified in chemically-competent E. coli DH5-α cells. The inserts were cut from pGEM-T with ApaI and SalI restriction enzymes (New England Biolabs) and blunted with DNA Polymerase I Klenow Fragment (NEB).

The pGint and pRint plasmids, which each contain Green Fluorescent Protein and dsRED coding sequences interrupted by a spliceable multiple cloning site, were also cut

RT-qPCR was performed using the Roche LightCycler device on the cDNA with the following protocol: dena-turing at 95° degrees C, annealing at 60° C for 7 seconds (s), extension at 72° C for 30 s, and fluorescence measure-ment at 78° C.

RT-qPCR Data AnalysisChanges in transcript levels were quantified through

ΔΔCt analysis as follows (Livak and Schmittgen, 2001). RT-qPCR produces a threshold cycle (Ct) value for each sample, which is the point at which amplicon level is in-creasing maximally. This value is directly correlated with the amount of starting transcript in the sample.

Because each PCR cycle approximately doubles the amount of amplicon, the threshold cycle can be expressed as Ct ≈ log2(kn), where k is some constant related to repli-cation efficiency and fluorophore fluorescence and n is the amount of starting transcript. Each RNA sample was also probed for a housekeeping gene GAPDH, whose expres-sion is not believed to change between treatments. This gene is used to normalize the transcript numbers to ac-count for cell-to-cell and plate-to-plate variations. Thus, the Ct value for each measured transcript was subtracted from the measured Ct for the GAPDH to yield the loga-rithm base 2 of a value proportional to the fold difference in expression over GAPDH (LFDGAPDH) as follows:

LFDGAPDH = Ct(target) - Ct(GAPDH) = log2(k )

The LFDGAPDH for each transcript under mock knock-down was then subtracted from that of the knockdown sample to yield the logarithm base 2 of the fold change

spliced RNA template. The mature mRNA primers were designed to create a product spanning at least one exon-exon junction, so that a product of specified size would only be generated by a properly-spliced (i.e. mature) mRNA template. Product size was kept to a maximum of 250 bp, so as to maintain acceptable qPCR efficiency. The primers are depicted in Table 1:

Forward ReverseHuR CCTGTTCAGCAGCATTGGTGAAGT TTCAGCGTGTTGATCGCTCTCTCTGAPDH AGCCTCCCGCTTCGCTCTCT CCAGGCGCCCAATACGACCABactin GGCACCCAGCACAATGAAGATCAA ACTCGTCATACTCCTGCTTGCTGAMDM2 GTACCTACTGATGGTGCTGTAACC AGCAATGGCTTTGGTCTAACB2M AGATGTCTCGCTCCGTGGCCTTA TGTCGGATGGATGAAACCCAGACAH1A GGAGAAGAACAACAGCCGCAT TTGAGCTTGAAGGAACCCGAGH4B GGATAACATCCAAGGCATCACC CGCCACGAGTCTCCTCATAAATpre-NFATC3 AGCCATGGGAAGGGAAATGTCTGA TTGGAAACCCAAGGTCCAAGGAGApre-CTCF TTGACTGTCTCTGGACCGCTATCT CTGTTGCTGGCAAAGAAGAGCACANFATC3 TATGAAACTGAAGGTAGCCGAGGG TTGGCTTGCAGTAGCGACTGTCTTCTCF AGATGCGCTAGTGGACAGATTGCT TTTCGGACTCCTCCACAATGGCTT

Table 1. RT-qPCR Primers used in analysis of putative intronic HuR targets.

ReseaRch

16 | 2011-2012 | Volume 1

roadB treetSScientific

To determine if HuR binds pre-mRNAs in the cell, we performed RIP on HEK293 cells, and measured enrich-ment of bound targets using RT-qPCR. We used Western Blotting to confirm enriched pulldown of HuR in the IP. As shown in Figure 2, we achieved significant HuR en-richment.

Figure 2. Western Blot on immunoprecipitates (IPs). Lanes in order from left to right: 1) Whole-cell (WC) lysate with Normal Mouse Serum (NMS); 2) WC with 3A2 anti-HuR antibody; 3) Nuclear lysate with NMS; 4) Nuclear lysate with 3A2. The presence of HuR bands (indicated in figure) in the two 3A2 IPs and simultaneous absence from NMS IPs indicates successful enrichment of HuR.

As shown in Figure 3, we found fold enrichments > 300 for the putatively-bound pre-NFATC3 transcript, as compared to <5-fold enrichments for the established non-Hu targets of Histone H1A, Histone H4B, and β2M. The enrichments of pre-NFATC3 are comparable to the established positive control transcripts of β-actin, HuR, and MDM2, demonstrating significant HuR targeting of NFATC3 pre-mRNA.

Therefore, the mRNA enrichments we demonstrate are likely due to HuR association. As shown in Figure 4, the mature, spliced form of CTCF and NFATC3 transcripts did not demonstrate enrichment in HuR RIP distinct from the negative controls, indicating that these mature transcripts are not HuR targets. PCR primers for mature transcripts are often designed to span an intron so as to only amplify mature levels; the mature primers used here were more deliberately designed to span putatively HuR-bound introns, thus ensuring that the transcript which they amplify do not contain the putative binding site. This suggests that the presence of the bound intron is necessary for HuR binding, and thus that HuR can preferentially target pre-mRNA.

HuR Binding has a Functional Effect on Pre-mRNA Abundance

HuR binding to the pre-mRNA form of NFATC3 exclusively suggests that HuR affects the transcript in a functional manner. To determine if HuR binding of pre-mRNA had a legitimate functional effect on pre-mRNA abundance, we performed siRNA knockdown of HuR in HEK293 cells and measured NFATC3 and CTCF

with ApaI and blunted. The cut pGint and pRint were dephosphorylated with Calf Intestinal Phosphatase (Pro-mega) to prevent vector-vector ligation. Finally, each in-tronic HuR-binding sequence was ligated into both pGint and pRint via blunt-ended ligation with T7 DNA ligase (NEB). The resulting final plasmid construct is depicted in Figure 1.

Figure 1. Schematic plasmid map of pGint and pRint. Brief-ly, DNA sequences flanking the putative HuR binding site in each gene were amplified via qPCR, blunted with DNA Pol I Klenow Fragment, and ligated into the pGint vector. pGint contains a Kanamycin . pGint contains a kanamycin resistance gene, while pRint contains an ampicillin resis-tance gene (Bonano et al., 2007).

Metabolic RNA Labeling4-thio-uridine (4sU) was used as to label RNA in a pre-

mRNA processing assay, as described previously (Rabani et al., 2011). Briefly, HEK293 cells under knockdown or mock knockdown conditions were exposed to growth me-dium with 0.2 μm 4sU (Sigma) for a period of 30 minutes. RNA was extracted with TRIzol reagent and reacted with EZ-link HPDP-Biotin (Thermo Scientific) to bind to the sulfhydryl group present on the 4sU. The RNA was then tumbled for 30 minutes with streptavidin magnetic Dyna-beads (Invitrogen). Biotinylated RNA was then magneti-cally precipitated and the biotin linkage cleaved with 50 mM DTT. The resulting supernatant (non-biotinylated) and precipitate (biotinylated) fractions were analyzed via qPCR and compared to the total RNA (before separa-tion). Because the labeled RNA was necessarily synthe-sized within the 30 minute labeling period, the ratio of labeled transcript to total transcript was taken as a relative synthesis rate. When applied to the mature pre-mRNA primers, this represents a relative processing rate of the HuR-bound intron.

Results

Pre-mRNA Species are Highly Enriched in HuR RIP, but Mature Forms of Intronic-Only Targets are not

ReseaRch

Volume 1 | 2011-2012 | 17

roadB treetSScientific

Fold Enrichment in RIP-qPCR (mature mRNA)

HuRBac

tinMDM2

mature

NFATC3

mature

CTCFB2M H1A H4B

0

200

400

600

800

1000LegendLegend

Figure 4

Whole Cell

Nuclear

Figure 4. Enrichment in RNA immunoprecipitation of mature transcripts. Fold enrichment of each target transcript is shown. HuR through MDM2 are positive controls; B2M through H4B are negative controls. Neither of mature NFATC3 or mature CTCF showed significant enrichment, and so neither are HuR targets.

Fold Enrichment in RIP-qPCR

Transcript

Fold

Enr

ichm

ent

HuRBac

tinMDM2

pre-NFATC3

pre-CTCF

B2M H1A H4B

0

200

400

600

800

1000Whole CellNuclear

Figure 3

Figure 3. Enrichment in RNA immunoprecipitation for probed mRNA transcripts. Fold enrichment of each tar-get transcript is shown. HuR through MDM2 are positive controls; B2M through H4B are negative controls. Pre-NFATC3 showed enrichment comparable to the positive controls and so is a HuR target. Pre-CTCF is not highly enriched and so is not a HuR target.

Figure 5

Transcript

% T

rans

crip

t rem

aini

ng

HuRBac

tin

pre-NFATC3

pre-CTCF

0%

50%

100%

Remaining Transcript after Knockdown

Figure 5: Differences in un-spliced transcript abundance between HuR knockdown and mock knockdown. Fraction of transcript remaining after HuR knockdown is shown. Bars depict mean +/- standard error; decrease in HuR level serves as knockdown confirmation while Bactin is a positive control which is negatively affected by HuR knockdown. Pre-NFATC3 shows fold change distinct from 1, so is functionally affected by HuR. Pre-CTCF has a fold change not distinct from 1, so is not functionally affected by HuR.

Figure 5. Differences in un-spliced transcript abundance between HuR knockdown and mock knockdown. Frac-tion of transcript remaining after HuR knockdown is shown. Bars depict mean +/- standard error; decrease in HuR level serves as knockdown confirmation while Bactin is a positive control which is negatively affected by HuR knockdown. Pre-NFATC3 shows fold change distinct from 1, so is functionally affected by HuR. Pre-CTCF has a fold change not distinct from 1, so is not functionally affected by HuR.

Figure 5

Rem aining M ature T ransc rip t after Kn ock down

Tr anscr ipt

% T

ran

scri

pt

rem

ain

ing

HuR

Bactin

NFATC3

CTCF0

100

200

Figure 6: Differences in spliced transcript abundance between HuR knockdown and mock knockdown. Fraction of transcript remaining after HuR knockdown is shown. Bars depict mean +/- standard error; HuR serves as knockdown confirmation while Bactin is a positive control. Neither of NFATC3 or CTCF show significant decrease in transcript levels.

Figure 6. Differences in spliced transcript abundance between HuR knockdown and mock knockdown. Frac-tion of transcript remaining after HuR knockdown is shown. Bars depict mean +/- standard error; HuR serves as knockdown confirmation while Bactin is a positive control. Neither of NFATC3 or CTCF show significant decrease in transcript levels.

ReseaRch

18 | 2011-2012 | Volume 1

roadB treetSScientifictranscript levels. As shown in Figure 4, HuR was knocked

down 70% at the transcript level. This was also accompanied by significant decreases in transcript abundance for the putative-intronic-only targets of pre-NFATC3. Pre-CTCF remained at approximately control levels, while β-actin, the positive con-trol, decreased in abundance. Because the fraction of remaining transcript after knockdown is different from 1 by more than 1 standard error, we can say that these results are legitimate and indicative of a functional effect of HuR binding on the transcript abundance of these target pre-mRNA.

As mentioned, HuR regulates many steps of mRNA pro-cessing, including binding to mature transcripts. To determine if HuR could also bind mature versions of the pre-mRNA tar-gets, we also measured mature mRNA abundance of putative in-tronic targets in the knockdown. Unlike the pre-mRNA, the fold change in transcript abundance for these targets was not distinct from 1, as shown in Figure 5. While the sample size used is 3, the data as presented do not allow us to reject the null hypothesis that HuR has no effect on mature transcript levels.

Discussion

We demonstrate HuR targeting of exclusively intronic se-quence elements in pre-mRNA in human cells. We also show that HuR has a functional effect on stability of targets with ex-clusively intronic-only binding sites through the analysis of rep-resentative transcripts.

The PAR-CLIP study predicted intronic-only binding sites. A goal of the present study was to investigate these intronic sites; however, until further validation of the relatively-new PAR-CLIP technique is completed, it was difficult to use these data as confir-mation of HuR binding to pre-mRNA. As such, it was necessary to confirm that functional intronic binding sites of HuR exist through RIP-PCR. Fold enrichments of pre-NFATC3 in the RIP were comparable to those of β-actin, considered to be a very strong HuR target, thus we can further conclude that HuR can bind NFATC3 pre-mRNA stably. Pre-CTCF a predicted HuR target by the PAR-CLIP, was not enriched in the RIP, confirm-ing the possibility of noise in that target prediction technique and highlighting the importance of confirmation of PAR-CLIP results.

Mature mRNAs lacking the introns for which the only bind-ing sites were predicted were not enriched in the RIP. The fact that the primers used to identify mature species of NFATC3 and CTCF were targeted to span a putatively-bound intron suggests that there is no interaction between the mature transcript and HuR, and furthermore, that the interaction observed with the pre-mRNA is because of sequence elements in the putatively-bound intron. This provides strong evidence for HuR pre-mRNA targeting of intronic cis-elements by a process which is indepen-dent of mature targeting.

To determine if HuR pre-mRNA binding has functional bio-logical relevance, the effect of HuR knockdown on pre-mRNA levels was further assayed by quantitative PCR. HuR knockdown was accompanied by significant fold changes (different from 1) in transcript abundance of pre-NFATC3, indicating that HuR affects stability at the level of pre-mRNA via exclusive binding to intronic sequences.

We did not demonstrate a fold change of mature tran-script upon knockdown which was distinct from 1, which suggests that HuR has no effect on these transcripts. However, because pre-mRNA are generally associated with higher turnover in the cell (Zeisel et al., 2011), it is possible that the small fold change in mature levels can be attributed to the relatively lower turnover rates of a reservoir of highly-abundant mature transcripts existing in the cell throughout the knockdown period. We must perform more knockdown procedures to confirm these results. If our results are repeatable, these possibilities can be validated through direct measurement of turnover rates in a 4-thiouridine incorporation assay (see “Future Work” section).

Pre-mRNA abundance is governed by the efficiencies of processes such as transcription, splicing, and degrada-tion. The observed effect on abundance would then be ex-pected to modulate the effective rates of one or more of these processes. While a known function of HuR is cyto-plasmic stability through direct inhibition of RNA degra-dation, it seems unlikely that this established cytoplasmic function extends to the nuclear world as well, given that splicing-independent degradation likely contributes very little to total rates of pre-mRNA depletion (Zeisel et al., 2011). However, it is possible that if HuR plays a major role in stabilizing pre-mRNA independently of splicing, the negligible contribution observed by Zeisel et al. may be because of this stabilization effect, and that HuR de-pletion causes pre-mRNA degradation to be non-trivial. Thus, it is possible that HuR has an effect on direct pre-mRNA stabilization.

Apart from pre-mRNA degradation, a significant ef-fect such as the one shown here may be due to HuR-re-lated interactions during the process of splicing, involving either the process of splicing itself or mis-splicing-medi-ated decay. HuR has been implicated in various alternative exon-inclusion events, in which it either blocks or recruits components of the splicing machinery (Wang et al., 2010; Izquierdo, 2010). Interestingly, the putatively-bound in-trons surveyed here were constitutively spliced, that is, all known isoforms of the transcripts coded by the gene con-tained the flanking exons, meaning that alternative inclu-sion is not an issue. The fact that intronic binding sites in constitutively-spliced introns can be confirmed and functionally proven suggests a broader function of HuR than even alternative splicing (Zhang et al., 1998). Thus, the role of HuR in splicing-related processes remains to be determined. Presumably, since increased levels of HuR result in increased levels of pre-mRNA present, HuR is important for proper splicing of the target, possibly in the role of a splicing factor.

RNA surveillance can provide an explanation for the pre-mRNA abundance response of NFATC3 to HuR. Aberrant splicing can result in degradation pathways linked to the RNA surveillance machinery, which pre-vents error-containing mRNA from translation (Lareau et al., 2007; Zhang et al., 1998; Milligan et al., 2005). If HuR is in fact a splicing factor, these RNA surveillance

ReseaRch

Volume 1 | 2011-2012 | 19

roadB treetSScientific

would allow us to accumulate lists of similarly-regu-lated intronic target transcripts, revealing functional simi-larities among the target genes. A comparison of function between intronic and 3’UTR targets could expand the post-transcriptional RNA operon hypothesis to encom-pass coordinated regulation of pre-mRNA by RBPs; it is possible that splicing targets of HuR define a nuclear RNA operon. Furthermore, intronic targets of HuR may provide additional insight into the role of HuR in disease. ReferencesAltschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. Journal of molecular biology 215, 403–410. Available at: http://www.ncbi.nlm.nih.gov/pubmed/2231712 [Accessed August 1, 2011].Bio-Rad Laboratories (2000). iScript TM cDNA Synthesis Kit. 1–2.Bolognani, F., Gallani, A.-I., Sokol, L., Baskin, D. S., and Meisner-Kober, N. (2011). mRNA stability alterations mediated by HuR are necessary to sustain the fast growth of glioma cells. Journal of neuro-oncology. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21935689 [Accessed September 25, 2011].Bonano, V. I., Oltean, S., and Garcia-Blanco, M. a (2007). A proto-col for imaging alternative splicing regulation in vivo using fluores-cence reporters in transgenic mice. Nature protocols 2, 2166–2181. Available at: http://www.ncbi.nlm.nih.gov/pubmed/17853873 [Ac-cessed September 6, 2011].Brennan, C. M., and Steitz, J. a (2001). HuR and mRNA stability. Cellular and molecular life sciences : CMLS 58, 266–277. Available at: http://www.ncbi.nlm.nih.gov/pubmed/11289308.Denkert, C., Koch, I., von Keyserlingk, N., Noske, A., Niesporek, S., Dietel, M., and Weichert, W. (2006). Expression of the ELAV-like protein HuR in human colon cancer: association with tumor stage and cyclooxygenase-2. Modern pathology : an official jour-nal of the United States and Canadian Academy of Pathology, Inc 19, 1261–1269. Available at: http://www.ncbi.nlm.nih.gov/pubmed/16799479 [Accessed September 5, 2011].Dixon, D. A., Tolley, N. D., King, P. H., Nabors, L. B., Mcintyre, T. M., Zimmerman, G. A., and Prescott, S. M. (2001). Altered expres-sion of the mRNA stability factor HuR promotes cyclooxygenase-2 expression in colon cancer cells. Cell 108, 1657–1665.Fan, X. C., and Steitz, J. a (1998). Overexpression of HuR, a nu-clear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. The EMBO journal 17, 3448–3460. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1170681&tool=pmcentrez&rendertype=abstract.Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M., Jungkamp, A.-C., Mun-schauer, M., et al. (2010). Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell 141, 129–141. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2861495&tool=pmcentrez&rendertype=abstract [Accessed June 17, 2011].Hinman, M., and Lou, H. (2008). Diverse molecular func-tions of Hu proteins. Cellular and molecular life sciences 65, 3168–3181. Available at: http://www.springerlink.com/index/54H3W5358HQ14706.pdf [Accessed June 22, 2011].

pathways may provide a mechanism for the observed decrease in transcript abundance of pre-mRNAs fol-lowing HuR knockdown. This possibility is currently being evaluated in the in vivo splicing assay and the 4-thiouridine depletion assay.

The Exon-Junction Complex (EJC) provides one potential means by which pre-mRNA interactions can affect mature mRNA interactions. The EJC is a multi-subunit complex deposited at exon junctions during splicing which is thought to be involved in downstream processing events such as nuclear export and ultimately translation (Tange et al., 2004). EJC-associated factors have also been shown to induce RNA-surveillance-me-diated decay (Wagner and Lykke-Andersen, 2002). Be-cause HuR seems to be bound to mRNAs which have only intronic cis-elements throughout the processing steps, even including mature processing, it is possible that HuR could be involved in EJC deposition or EJC-mediated interactions.

In summary, we have demonstrated functional, pref-erential targeting of unspliced NFATC3 mRNA by the RNA-binding protein HuR. Our results provide insight into the nuclear function of HuR, which is predomi-nantly nuclear, and provide a new avenue of study in

Future WorkWe demonstrate a functional targeting effect of the

RNA-binding protein HuR on un-spliced pre-mRNA, which suggests that HuR regulates processing steps in pre-mRNA. Our results corroborate existing literature and provide further insight into the nature of HuR-pre-mRNA interactions.Functional and Mechanistic Determination

While our results demonstrate the importance of HuR during processes before and concurrent with splicing, the exact role of HuR in splicing itself must be confirmed. We propose to accomplish this through a parallel 4-thiouridine incorporation assay and GFP splicing reporter assay.

Future studies would also investigate possible mech-anisms for HuR-mediated modulation of splicing. Binding assays such as co-immunoprecipitation and gel mobility shift would allow for determining interaction of HuR with specific components of the splicing ma-chinery, including the Exon Junction Complex and the spliceosome.

Functional Analysis of Target TranscriptsWe have implemented a system for confirming the

targets predicted by PAR-CLIP. Once more such in-tronic targets are confirmed through both RIP and HuR knockdown, comprehensive analysis of these targets genome-wide would provide insight into HuR’s func-tional role within the context of normal cell function as well. For example, characterization of environmental ef-fects such as oxidative stress on HuR intronic targeting

ReseaRch

20 | 2011-2012 | Volume 1

roadB treetSScientific

365–386.Saunders, L. R., and Barber, G. N. (2003). The dsRNA binding protein family: critical roles, diverse cellular functions. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology 17, 961–983. Available at: http://www.ncbi.nlm.nih.gov/pubmed/12773480.Tange, T. Ø., Nott, A., and Moore, M. J. (2004). The ever-increasing complexities of the exon junction complex. Current opinion in cell biology 16, 279–284. Available at: http://www.ncbi.nlm.nih.gov/pubmed/15145352.Tenenbaum, S. a, Lager, P. J., Carson, C. C., and Keene, J. D. (2002). Ribonomics: identifying mRNA subsets in mRNP complexes using antibodies to RNA-binding proteins and genomic arrays. Methods (San Diego, Calif.) 26, 191–198. Available at: http://www.ncbi.nlm.nih.gov/pubmed/12054896.Wagner, E., and Lykke-Andersen, J. (2002). mRNA surveillance: the perfect persist. Journal of cell science 115, 3033–3038. Available at: http://www.ncbi.nlm.nih.gov/pubmed/12118059.Wang, H., Molfenter, J., Zhu, H., and Lou, H. (2010). Promotion of exon 6 inclusion in HuD pre-mRNA by Hu protein family mem-bers. Nucleic acids research 38, 3760–3770. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2887941&tool=pmcentrez&rendertype=abstract [Accessed June 22, 2011].Zeisel, A., Köstler, W. J., Molotski, N., Tsai, J. M., Krauthgamer, R., Jacob-Hirsch, J., Rechavi, G., Soen, Y., Jung, S., Yarden, Y., et al. (2011). Coupled pre-mRNA and mRNA dynamics unveil op-erational strategies underlying transcriptional responses to stimuli. Molecular Systems Biology 7. Available at: http://www.nature.com/doifinder/10.1038/msb.2011.62 [Accessed September 14, 2011].Zhang, J., Sun, X., Qian, Y., and Maquat, L. E. (1998). Intron func-tion in the nonsense-mediated decay of beta-globin mRNA: indica-tions that pre-mRNA splicing in the nucleus can influence mRNA translation in the cytoplasm. RNA (New York, N.Y.) 4, 801–815. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1369660&tool=pmcentrez&rendertype=abstract.Zhu, H., Hasman, R. A., Barron, V. A., Luo, G., and Lou, H. (2006). A nuclear function of Hu proteins as neuron-specific al-ternative RNA processing regulators. Molecular biology of the cell 17, 5105. Available at: http://www.molbiolcell.org/cgi/content/ab-stract/17/12/5105 [Accessed June 22, 2011].

Invitrogen Life Science (2006). Lipofectamine TM 2000. Available at: http://tools.invitrogen.com/content/sfs/manuals/lipofectamine2000_man.pdf.Invitrogen Life Science (2010). TRIzol ® Reagent. Available at: http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf.Izquierdo, J. M. (2010). Cell-specific regulation of Fas exon 6 splicing mediated by Hu antigen R. Biochemical and biophysical research com-munications 402, 324–328. Available at: http://www.ncbi.nlm.nih.gov/pubmed/20951677 [Accessed June 22, 2011].Keene, J. D. (2007). RNA regulons: coordination of post-transcriptional events. Nature reviews. Genetics 8, 533–543. Available at: http://www.ncbi.nlm.nih.gov/pubmed/17572691 [Accessed July 15, 2010].Keene, J. D., Komisarow, J. M., and Friedersdorf, M. B. (2006). RIP-Chip: the isolation and identification of mRNAs, microRNAs and protein com-ponents of ribonucleoprotein complexes from cell extracts. Nature protocols 1, 302–307. Available at: http://www.ncbi.nlm.nih.gov/pubmed/17406249 [Accessed July 17, 2011].Keene, J. D., and Tenenbaum, S. a (2002). Eukaryotic mRNPs may repre-sent posttranscriptional operons. Molecular cell 9, 1161–1167. Available at: http://www.ncbi.nlm.nih.gov/pubmed/12086614.Kishore, S., Luber, S., and Zavolan, M. (2010). Deciphering the role of RNA-binding proteins in the post-transcriptional control of gene expres-sion. Briefings in functional genomics 9, 391–404. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3080770&tool=pmcentrez&rendertype=abstract [Accessed June 22, 2011].Lareau, L., Brooks, A., and Soergel, D. (2007). The coupling of alterna-tive splicing and nonsense-mediated mRNA decay. In Alternative Splicing in the Postgenomic Era, pp. 190–211. Available at: http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.67.3130&amp;rep=rep1&amp;type=pdf [Accessed July 5, 2011].Lebedeva, S., Jens, M., Theil, K., Schwanhäusser, B., Selbach, M., Landthal-er, M., and Rajewsky, N. (2011). Transcriptome-wide Analysis of Regula-tory Interactions of the RNA-Binding Protein HuR. Molecular cell, 1–13. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21723171 [Accessed July 5, 2011].Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expres-sion data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.) 25, 402–408. Available at: http://www.ncbi.nlm.nih.gov/pubmed/11846609 [Accessed July 15, 2011].Milligan, L., Torchet, C., Allmang, C., Shipman, T., and Tollervey, D. (2005). A nuclear surveillance pathway for mRNAs with defective polyadenylation. Molecular and cellular biology 25, 9996–10004. Available at: http://mcb.asm.org/cgi/content/abstract/25/22/9996 [Accessed July 15, 2011].Mukherjee, N., Corcoran, D. L., Nusbaum, J. D., Reid, D. W., Georgiev, S., Hafner, M., Ascano, M., Tuschl, T., Ohler, U., and Keene, J. D. (2011). Integrative Regulatory Mapping Indicates that the RNA-Binding Protein HuR Couples Pre-mRNA Processing and mRNA Stability. Molecular Cell 43, 1–13. Available at: http://dx.doi.org/10.1016/j.molcel.2011.06.007.Rabani, M., Levin, J. Z., Fan, L., Adiconis, X., Raychowdhury, R., Garber, M., Gnirke, A., Nusbaum, C., Hacohen, N., Friedman, N., et al. (2011). Metabolic labeling of RNA uncovers principles of RNA production and degradation dynamics in mammalian cells. Nature biotechnology 29, 436–442. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3114636&tool=pmcentrez&rendertype=abstract [Accessed July 15, 2011].Rozen, S., and Skaletsky, H. (2000). Primer3 on the WWW for General Users and for Biologist Programmers. Methods in Molecular Biology 132,