the rbp-jk binding sites within the rta promoter regulate ......the rbp-jk binding sites within the...

The RBP-Jk Binding Sites within the RTA PromoterRegulate KSHV Latent Infection and Cell ProliferationJie Lu1, Subhash C. Verma2, Qiliang Cai1, Abhik Saha1, Richard Kuo Dzeng1, Erle S. Robertson1*

1 Department of Microbiology and Tumor Virology Program of the Abramson Cancer Center, Perelman School of Medicine at the University of Pennsylvania, Philadelphia,

Pennsylvania, United States of America, 2 Department of Microbiology and Immunology, School of Medicine, University of Nevada, Reno, Nevada, United States of

America

Abstract

Kaposi’s sarcoma-associated herpesvirus (KSHV) is tightly linked to at least two lymphoproliferative disorders, primaryeffusion lymphoma (PEL) and multicentric Castleman’s disease (MCD). However, the development of KSHV-mediatedlymphoproliferative disease is not fully understood. Here, we generated two recombinant KSHV viruses deleted for the firstRBP-Jk binding site (RTA1st) and all three RBP-Jk binding sites (RTAall) within the RTA promoter. Our results showed thatRTA1st and RTAall recombinant viruses possess increased viral latency and a decreased capability for lytic replication in HEK293 cells, enhancing colony formation and proliferation of infected cells. Furthermore, recombinant RTA1st and RTAall virusesshowed greater infectivity in human peripheral blood mononuclear cells (PBMCs) relative to wt KSHV. Interestingly, KSHVBAC36 wt, RTA1st and RTAall recombinant viruses infected both T and B cells and all three viruses efficiently infected T and Bcells in a time-dependent manner early after infection. Also, the capability of both RTA1st and RTAall recombinant viruses toinfect CD19+ B cells was significantly enhanced. Surprisingly, RTA1st and RTAall recombinant viruses showed greaterinfectivity for CD3+ T cells up to 7 days. Furthermore, studies in Telomerase-immortalized human umbilical vein endothelial(TIVE) cells infected with KSHV corroborated our data that RTA1st and RTAall recombinant viruses have enhanced ability topersist in latently infected cells with increased proliferation. These recombinant viruses now provide a model to exploreearly stages of primary infection in human PBMCs and development of KSHV-associated lymphoproliferative diseases.

Citation: Lu J, Verma SC, Cai Q, Saha A, Dzeng RK, et al. (2012) The RBP-Jk Binding Sites within the RTA Promoter Regulate KSHV Latent Infection and CellProliferation. PLoS Pathog 8(1): e1002479. doi:10.1371/journal.ppat.1002479

Editor: Blossom Damania, University of North Carolina at Chapel Hill, United States of America

Received August 9, 2011; Accepted November 27, 2011; Published January 12, 2012

Copyright: � 2012 Lu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricteduse, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by public health service grants NCI CA091792, CA072510, and NIDCR DE017338 (to E.S.R.). The funders had no role in studydesign, data collection and analysis, decision to publish, or preparation of the manuscript. E.S.R. is a scholar of the Leukemia and Lymphoma Society of America.S.C.V is supported by an NIH pathway to independence award (K99CA126182).

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

Introduction

Kaposi sarcoma-associated herpesvirus (KSHV, also known as

human herpesvirus 8 [HHV8]) infection is pivotal to the

development of Kaposi sarcoma (KS). KSHV is also strongly

associated with two lymphoproliferative diseases, primary effusion

lymphoma (PEL) and Multicentric Castleman’s disease (MCD)

[1,2]. During its lifespan, KSHV undergoes latent and lytic cycle

replication (reactivation). In comparison to lytic cycle replication,

fewer genes are expressed in latent infection and a number of these

genes are involved in disruption of the cell cycle, and in

maintenance of the viral genome. One of those latent genes is

Latency-associated nuclear antigen (LANA), encoded by KSHV

open reading frame 73 (ORF73), which is critical for persistence of

the viral episome and maintenance of latent infection in KSHV

infected cells [3]. During lytic cycle replication, almost all viral

genes are expressed in a staged temporal manner. The replication

and transcription activator (RTA) is encoded by KSHV ORF50

and plays an essential role in the control of the lytic replication

cycle. RTA can activate KSHV lytic genes including ORF6

(single-stranded DNA-binding, SSB), ORF21 (thymidine kinase,

TS), ORF57 (mRNA transcript accumulation. MTA), ORF59

(polymerase processivity factor, PF-8), ORF 74 (vGPCR), K2

(vIL-6), K5 (MIR-2), K6 (vMIP-1), K8 (k-bZIP), K9 (vIRF), K12

(kaposin), K14(vOX-2) and polyadenylated nuclear (PAN)

through direct binding with high affinity to RTA-responsive

elements (RREs) or in combination with cellular trans-

cription factors, RBP-Jk, Ap-1, C/EBP-a, Oct-1, and Sp1

[4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22]. Recombi-

nant viruses that lack RTA establish latency quite efficiently but

are unable to reactivate [23]. Our earlier studies also suggest that

RTA contributes to the establishment of KSHV latency by

activating LANA expression during the early stages of infection

through the major effector of the Notch signaling pathway,

recombination signal binding protein Jk (RBP-Jk). This mutual

RTA/LANA feedback regulatory mechanism is likely to be a key

event in establishment of KSHV latency and is yet to be

completely elucidated.

RBP-Jk, also named CBF1 or CSL, is a member of the CSL

family (CBF1, Suppressor of Hairless, and Lag) and is the major

downstream effector of the Notch signaling pathway [24,25].

RBP-Jk functions on the target gene by recruiting distinct protein

complexes to the promoter. RTA mimics Notch signaling and can

activate target promoters by binding to the repression domain of

RBP-Jk, thereby activating promoters [17]. In KSHV-infected

cells, RBP-Jk mediates cooperative transactivation of KSHV

genes, ORF57, K-bZIP, ORF6 (SSB), K14 (vGPCR), LANA, K8,

ORF47 and RTA [12,15,17,26,27,28,29]. The KSHV RTA

PLoS Pathogens | www.plospathogens.org 1 January 2012 | Volume 8 | Issue 1 | e1002479

promoter contains four potential RBP-Jk binding sites [30] and

mutation of the first and third RBP-Jk sites within the KSHV

RTA promoter results in approximately 50% repression of RTA

expression in vitro [30].

Understanding the pathogenesis of specific concerns including

Kaposi’s sarcoma has been aided by development of model

systems [31]. It has been difficult to establish lymphoblastoid cell

lines in culture by KSHV, which has slowed the understanding of

the natural mechanism of KSHV-mediated lymphoproliferative

disease. However, the mechanism of differentiation and prolifer-

ation due to EBV infection in B lymphocytes are well documented

[32]. Recently, two groups have shown that KSHV infects a sub-

set of tonsillar B cells driving plasmablast differentiation and

proliferation, and KSHV-encoded viral FLICE-inhibitory protein

(vFLIP) induces B lymphocytes transdifferentiation and tumori-

genesis in an animal model [33,34]. Furthermore, Myoung and

Ganem reported that T and B lymphocytes in primary human

tonsils can be infected by KSHV, with B lymphocytes producing a

substantial amount of infectious virions [35,36]. In contrast to

EBV, transformation and immortalization have not been clearly

observed in KSHV infected B or T cells. KSHV infection of

peripheral blood mononuclear cells (PBMCs) occurs prior to the

onset of KS [37], and KSHV DNA is frequently detected in

immune-deficient patients [38,39,40,41]. In addition, PBMCs of

KSHV infected marmosets support viral infection and replication

[42]. Finally, we recently showed that PBMCs exposed to virions

from BAC36-293 cells can effectively model early infection [43].

Our previous studies showed that mutation of the RTA

promoter in vitro (first and all three RBP-Jk binding sites) led to

significant decreases in RTA activity [30]. RTA is an immediate

early protein that serves as the master switch for viral lytic

replication. The interaction between RTA and RBP-Jk controls

the activation of multiple viral target genes which are absolutely

critical for virus reactivation [17,26,27]. Based on these observa-

tions, we generated two subtly mutated recombinant KSHV

viruses based on BAC36 (wt), RTA1st (deletion of the first RBP-Jkbinding site in the RTA promoter), and RTAall (deletion of all

three RBP-Jk binding sites in the RTA promoter). Our results

show that RTA1st and RTAall recombinant viruses had enhanced

ability to maintain viral latency and decreased capability to drive

lytic replication in infected cells. This resulted in an increase in

cell growth and proliferation. Furthermore, RTA1st and RTAall

recombinant viruses were enhanced in their ability to infect

human PBMCs. Both recombinant viruses infected T and B cells

during primary infection, resulting in increased infectivity during

the early stage of infection. Long-term persistence of the viral

episome in infected cells further confirmed that RTA1st and

RTAall recombinant viruses had a greater ability to maintain

latent infection and enhanced proliferation. Our study provides

specific insights into the contribution of KSHV to its associated

lymphomas.

Materials and Methods

Cells and plasmidsHuman embryonic kidney 293 (HEK 293) cells were main-

tained in Dulbecco’s modified Eagle medium (DMEM) supple-

mented with 5% bovine growth serum. De-indentified Human

peripheral blood mononuclear cells (PBMCs) were obtained from

the University of Pennsylvania CFAR Immunology Core. The

Core maintains an IRB approved protocol in which Declaration of

Helsinki protocols were followed and each donor gave written,

informed consent. Telomerase-immortalized human umbilical

vein endothelial (TIVE) cells were a kind gift from Dr. Rolf

Renne [44]. The wild-type KSHV BACmid, BAC36 wt, was

provided by S. J. Gao (University of Texas, San Antonio, TX).

Kanamycin (Kn) cassette containing plasmid, pL452 was obtained

from the National Cancer Institute Biological Resources Branch.

Construction of KSHV mutants with in RTA promoter,BAC36-RTA1st and BAC36 RTAall within the RTA promoter

Mutagenesis of BAC36 was performed using the Red

Recombination method as described previously [45]. The primers

used were BAC 36-RTA1st, the forward PCR primer 59- caaaa-

ctgtgtttagtagcaacacaccctggcgagcccagctgtcgaggcCAATTCCGAT-

CATATTCAATAACCCTTAAT -39 (target sequence is low-

cased), and the reverse primer, 59- tttgagaagcatctttagagagcta-

gaggcttccgtccccaatttcagtaAGAACTAGTGGATCCCCTCGAG-

GGACCTA -39 were used to amplify a Kan resistance cassette

(underlined sequence is Kan cassette primer) flanked by BAC

sequences (genomic position 69057 and 69171, NC_009333);

BAC 36-RTAall, the forward PCR primer 59- caaaactgtgtttagtag-

caacacaccctggcgagcccagctgtcgaggcCAATTCCGATCATATTC-

AATAACCCTTAAT -39 (target sequence is low-cased), and the

reverse primer, 59- atggcgacgtgcactactcgggacccccgcgcaccccggca-

tatggagtaAGAACTAGTGGATCCCCTCGAGGGACCTA -39

were used to amplify a Kan resistance cassette (low-cased sequence

is Kan cassette primer) flanked by BAC sequences (genomic

position 69057 and 70417, NC_009333). The Kan cassette flanked

with 50bp KSHV genomic sequence was electroporated into

EL350 containing BAC36 at 1.75kV, and the resulting colonies

plated on Kanamycin (50 mg/ml) and chloramphenicol (25 mg/

ml) double selection plates followed by incubation at 30uC. BAC

plasmid DNA was isolated from 10-ml overnight cultures by the

alkaline lysis procedure and characterized by restriction enzyme

analysis followed by Southern blot analysis. The transformed

single colonies were induced with 10% L (+) arabinose (Sigma-

Aldrich, Inc., St. Louis, MO) for 1h, then plated to Chloram-

phenicol and Kanamycin selection plates, separately. The

resulting single colonies on Chloramphenicol plates were inocu-

lated in 10-ml of LB with chloramphenicol overnight at 30uC.

Small-scale DNA isolation was performed to characterize the

DNA of specific mutants, followed by Southern blot analysis. All

the clones were confirmed by DNA sequencing using the

University of Pennsylvania Perelman School of Medicine sequenc-

ing core. Large preparations of KSHV BAC plasmids were

obtained from 500-ml E. coli cultures with the Qiagen Large

Author Summary

Kaposi’s sarcoma-associated herpesvirus (KSHV) is tightlylinked to at least two lymphoproliferative disorders,primary effusion lymphoma (PEL) and multicentric Castle-man’s disease (MCD). The life cycle of KSHV consists oflatent and lytic phase. RTA is the master switch for virallytic replication. In this study, we first show thatrecombinant viruses deleted for the RBP-Jk sites withinthe RTA promoter have a decreased capability for lyticreplication, and thus enhanced colony formation andproliferation of infected cells. Interestingly, the recombi-nant viruses show greater infectivity in human peripheralblood mononuclear cells (PBMCs). The recombinant virusesalso infected CD19+ B cells and CD3+ T cells with increasedefficiency in a time-dependent manner and now provide amodel which can be used to explore the early stages ofprimary infection in human PBMCs, as well as thedevelopment of KSHV-associated lymphoproliferative dis-eases.

Enhanced KSHV Latent Infection and Proliferation


construct kit (Qiagen, Inc., Valencia, CA) according to manufac-

turer instructions.

Southern blot and junction PCR analysisThe DNA probe used for Southern blot hybridizations was

amplified as a 1.4-kb fragment (corresponding to the RBP-Jk locus

of RTA promoter) with the KSHV genome as the template and

primer set forward: 59-ATGCAGCGGGGTGAGCCTGCCTC-

CAGCC-39, and reverse, 59-TTGCAGAATACTGGACAA-

CAGCGCGTCG-39. Purified KSHV BAC plasmid DNA was

digested with XhoI and resolved on 0.65% agarose gels in 0.5X

Tris-borate-EDTA buffer for 14 to 18 h at 40 V. DNA fragments

were visualized by ethidium bromide staining, denatured, and

transferred to Zeta-Probe GT genomic tested blotting membranes

(Bio-Rad Inc, Hercules, CA). DNA probes were radiolabeled with

[a-32P] dCTP with the NEBlot (New England Biolabs, Inc.,

Ipswich, MA). Prehybridization was performed at 63uC for 1 h in

hybridization buffer (7% sodium dodecyl sulfate, 10% polyethyl-

ene glycol, 1.5X SSPE [1X SSPE is 0.18 M NaCl, 10 mM

NaPO4, and 1 mM EDTA, pH 7.7]). DNA blots were hybridized

with radiolabeled probes in the same solution at 63uC for about

7 h. Blots were washed twice for 15 min with 2X SSC (1x SSC is

0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl

sulfate and twice for 30 min with 0.1X SSC-0.1% sodium dodecyl

sulfate at 63uC. Blots were exposed to a Phosphoimager plate

(Molecular Dynamics, Inc. Sunnyvale, CA) overnight at room

temperature followed by scanning with the Typhoon 9200 (GE

Healthcare Inc., Piscataway, NJ).

Junction PCRs were performed to identify the expected

deletions. The primers used were RTA1st (genomic position

69010 to 69291, NC_009333) 59 TCCCAGCCAAGTCCCTC-

GTG 39 and 59 GTCCCACTGCTGCGATCCAG 39; RTAall,

(genomic position 69010 to 70537, NC_009333) 59 TCCCAGC-

CAAGTCCCTCGTG 39 and 59 GCCCGGATACGCGCA-

CATGC 39.

Reconstitution of recombinant viruses, virus inductionand determination of virus copies

Purified Bac36 DNAs were transfected into 293 cells via CaPO4

method. Hygromycin B (150 ng/ml) was then added for selection

24 h after transfection. Three weeks after selection, homogenous

populations of GFP-positive cells harboring KSHV Bac36 DNAs

were obtained. Butyric Acid at a final concentration of 3 mM and

TPA (Sigma) at 20 ng/ml was used for lytic induction. Cell

suspensions were centrifuged at 3000 rpm for 20 min and the

supernatant was filtered through a 0.45 mm cellulose acetate filter.

The viral particles were concentrated by ultracentrifugation at

70,000xg at 4uC and stored at 280uC.

Infection of PBMCs and TIVE cells with recombinant KSHVvirions

Infection of PBMCs were performed as described previously

[43]. In brief, 1x107 were infected by incubation with virus

suspension in 1ml of RPMI 1640 (with 10% FBS) medium in the

presence of Polybrene at a final concentration 5 ng/ml (Sigma,

Marborough, MA) and incubated for 4 h in 37uC. Cells were

centrifuged for 5min at 1500rpm, the supernatant discarded,

pelleted cells were washed by fresh RPMI medium for 2 times and

resuspended in fresh RPMI 1640 (10% FBS) medium in 6-well

plates and culture at 5% CO2, 37uC humidified incubator.

TIVE cells were cultured in 12-well plates to 60% confluence in

Medium 199 supplemented with 20% FBS, 200 mM L-glutamine,

5 mg/ml Penicillin/Streptomycin(P/S) and 10 mg/ml Endothelial

cell growth supplement from bovine neural tissue. Concentrated

viruses were added to the supernatant in the presence of Polybrene

(4 mg/ml) and spun at 2,500 rpm for 1 h at room temperature. The

supernatants were removed and washed twice and then incubated

with fresh medium. GFP expression was used to monitor infection

under fluorescence microscope (Olympus Inc., Melville, NY).

Extraction and determination of intracellular andextracellular viral DNAs

For quantitation of intracellular viral DNA, cells were harvested

and washed twice with 1xPBS to remove the residual viruses. Cells

were incubated by HMW buffer (10mM Tris-HCl pH 8.0,

150mM NaCl, 10mM EDTA, 0.5% SDS) for 2 hrs at 55uC.

0.5 mg/ml proteinase K was added and incubated at 37uCovernight with subsequent extraction in phenol/chloroform/

isopropanol. Viral DNA was treated with RNase, then precipitated

and resuspended in water. Extracellular viral DNA was extracted

from culture supernatants as essentially described previously

[35,43]. In brief, virions were pelleted down at 70,000xg for 2

hrs at 4uC and resuspended. Cellular DNAs and free viral DNAs

were removed by treatment with DNase I at 37uC for 1,2 hrs.

Virion DNA was treated with HMW buffer for 20 minutes.

Lysates were treated with proteinase K overnight at 37uC with

subsequent extraction with phenol/chloroform/isopropanol. In-

tracellular and extracellular viral DNAs were quantitated by real-

time DNA PCR for TR (59 GGCTCCCCCAAACAGGCTCA 39,

and 59 GGGGGACCCCGGGCAGCGAG 39). GAPDH and

BAC36 DNAs were the standards for intracellular and extracel-

lular viral DNAs, respectively.

Quantitation of KSHV RNATotal RNA from infected PBMCs were extracted by using

TRIzol (Invitrogen, Inc., Carlsbad, CA) and 1 mg DNase-treated

total RNA were used to generate cDNA using the High capacity

RNA-to-cDNA kit (Applied Biosystems Inc., Foster City, CA)

according to manufacturer’s instructions. RT-qPCR was performed

on a StepOnePlus Real-Time PCR System (Applied Biosystems Inc,

Carlsbad, CA) or Opticon 2 Real-Time PCR System. The reactions

were carried out in a 96-well plate at 95uC for 10 min, followed by

35 cycles at 95uC for 30 s, 51uC for 30 s and then 72uC for 40 s.

The differences of cycle threshold values (CT) between the samples

(DCT) were calculated after standardization by GAPDH and

converted to fold changes using one of the samples as a standard (1-

fold). The primers used were LANA: 59 CATACGAACTC-

CAGGTCTGTG 39, 59 GGTGGAAGAGCCCATAATCT 39;

RTA: 59 CAGACGGTGTCAGTCAAGGC 39, 59 ACATGA-

CGTCAGGAAAGAGC 39; GAPDH 59 GGTCTACATGGCA-

ACTGT GA 39, 59 ACGACCACTTTGTCAAGCTC 39. All the

reactions were run in triplicates.

ImmunostainingCells were applied to a slide well and fixed with 4%

paraformaldehyde with 0.1% Triton X-100, and blocked with

10% BSA. Cells were then incubated with a primary antibody

(Mouse anti-LANA), and specific signals were detected with a

secondary antibody conjugated with Alexa Fluor 594 (Invitrogen,

Carlsbad, CA). The cells were counterstained with 49, 69-diamidino-

2-phenylindole (DAPI). Images were observed and recorded with a

Fluoview FV300 microscope (Olympus Inc., Melville, NY).

Colony formation and growth assayBAC36 wt, BAC RTA1st and BAC RTAall transfected 293

cells were selected for 3-4 weeks with Hygromycin B. 300 stably



transformed 293 cells were seeded in 6 cm Petri dish in DMEM

supplemented with 10% FBS, Hygromycin B (150 ng/ml) and

Difco Noble Agar (BD, Franklin Lakes, NJ) (0.5%). After 2 weeks

of growth, the colony were monitored and photographed under

fluorescence microscope (Olympus Inc., Melville, NY). The plates

were scanned by Typhoon 9200 for GFP signals and the colony

number was quantitated using the Odyssey V3.0 software.

Flow cytometryBAC36 wt, BAC RTA1st and BAC RTAall stably transfected

293 cells were harvested and fixed in 1% paraformaldehyde for

30–60 min. The fixed cells were washed twice by 1XPBS and

analyzed using on FACSCalibur based on GFP signals.

Infected PBMCs cells were stained essentially as described

previously [46,47]. Briefly, PBMCs were harvested and washed at

1dpi, 2dpi, 4dpi and 7dpi. T cells and B cells were detected by

using the APC conjugated anti-CD3 and PercpCy 5.5 conjugated

anti-CD19 mAbs (BD Biosciences, San Jose, CA). GFP signals

were used to monitor KSHV positive cells. Data were acquired on

FACSCalibur equipped with CellQuest Pro software and analyzed

using FlowJo software.

StatisticsData are shown as mean values with standard errors of the

means (SEM). The significance of differences in the mean values

was evaluated by 2-tailed Student’s t test. P,0.05 was considered

statistically significant.

Results

Generation of recombinant KSHV viruses deleted for RBP-Jk binding sites within the RTA promoter (RTA1st andRTAall)

Our previous studies showed that RTA contributes to

establishment of KSHV latency by activating LANA expression

during the early stages of infection via RBP-Jk, the major effector

of the Notch signaling pathway [28]. The activity of the RTA

promoter was reduced about 40% in the truncations of first RBP-

Jk and all three RBP-Jk binding site within RTA promoter

compared to the wt promoter [30]. To investigate the roles of the

RBP-Jk binding sites in the RTA promoter, we constructed two

KSHV recombinant viruses, BAC RTA1st with a deletion of the

first RBP-Jk binding site and RTAall with deletion of all three

RBP-Jk binding sites. BAC36 wt carries the full KSHV genome, a

GFP tag, and a eukaryotic resistance gene, hygromycin [48].

Infectious KSHV can be reconstituted by transfection of BAC36

wt DNA into 293 cells [48]. Using the BAC36 wt as a template, we

designed PCR primers so that the RBP-Jk binding sites in the

RTA promoter were removed from the genome. Fig. 1A and B

shows a schematic for the generation of the recombinant BAC

RTA1st and RTAall using PCR primers that integrated the

Kanamycin resistance gene (Neo: the neo cassette is resistant to

Neomycin or Kanamycin in prokaryotes) and two loxP sites from

plasmid pL452 into the BAC36 genome, replacing the RBP-Jkbinding sites of the RTA promoter. LoxP is the substrate sequence

of Cre recombinase, so the insert fragment between two loxP sites

(including neo cassette) can be subsequently removed by

expressing Cre recombinase after induction by L-arabinose [49].

A PCR product containing Neor flanked by loxP sites and two

fragments of 50-bp KSHV sequences from the two ends of the

RBP-Jk site in the RTA promoter was generated using pL452

plasmid as a template. This PCR product was transfected into

BAC36 wt-E.coli 350 to remove the RBP-Jk site in the RTA

promoter after homologous recombination and Cre-mediated

excision of Neor. The resulting BAC recombinants were screened

and analyzed on 0.65% agarose and subsequently by southern blot

analysis to show that the RBP-Jk binding site in the RTA

promoter was removed from the KSHV genome (Fig. 1A and C).

Digestion of the BAC36 wt DNA with XhoI generated one

12584kb fragment at the RBP-Jk binding site in the RTA

promoter. For BAC RTA1st, replacement of the RBP-Jk binding

site with the Kan cassette changes the two fragment sizes to

9486bp and 4973bp. After induction, the fragment between two

loxP sites was removed, so the smaller fragment (4973b) shifted in

size to 3176kb, indicating removal of Kan cassette. Southern blot

showed the presence of a 5kb band before induction and a unique

3kb band in recombinant BAC RTA1st when hybridized with a

probe within the RBP-Jk binding site (Fig. 1A and C). To further

confirm whether the altered digestion pattern of the BAC mutants

was the result of the expected recombination, we carried out

junction PCR by using the primers designed at the recombination

site showing that the junction bands in the BAC RTA1st shifted

based on the presence of the remaining loxP site and XhoI site

(Fig. 1D). Similarly, For BAC RTAall, replacement of the RBP-Jkbinding sites with the Kanamycin cassette changes the two

fragment sizes to 8240bp and 4973bp. After induction, the

fragment between two loxP sites was removed, so the smaller

fragment (4972b) shifted in size to 3176kb - indicating removal of

the Kan cassette. Southern blot showed the presence of a 5kb band

before induction and a unique 3kb band in the recombinant BAC

RTAall when hybridized with a probe within the RBP-Jk binding

site (Fig. 1B and E). Junction PCR showed that the junction bands

in the BAC RTAall shifted based on the presence of the remaining

loxP site and XhoI site (Fig. 1F). Finally, the PCR products were

sequenced to confirm the expected mutation.

BAC RTA1st and RTAall recombinant KSHV stable 293 cellshad a decreased capability for lytic replication

To reconstitute recombinant viruses, we transfected BAC36 wt,

RTA1st and RTAall DNAs into 293 cells. The transfection

efficiencies were monitored by the fluorescence microscopy. GFP

positive cells were detected after 24–48h post-transfection (data

not shown). Positive cells were enriched by hygromycin selection,

generating 293 cell lines bearing BAC36 wt, RTA1st and RTAall

(Fig. 2A). Subsequently, the cells were fixed and immunostained

against LANA to confirm that BAC 36 wt and RTA1st and RTAall

stable cell lines harbored the KSHV genome (Fig. 2B). Similar

levels of GFP positive signals and LANA staining were observed

for all three stably transfected cell lines generated due to

hygromycin selection.

To ensure that both RTA1st and RTAall stable cells were able to

produce recombinant viruses after lytic reactivation, the cells were

treated with TPA and butyric acid to induce lytic reactivation.

Whole cell lysates were prepared from the uninduced and induced

cells at 24, 48, 72 hours post induction (hpi), and the expression of

LANA and RTA were analyzed by western blot analysis using the

corresponding specific antibodies. The results showed that LANA

expression exhibits a slight decrease after induction in BAC36 wt-

293 cells at 48 and 72 hpi as more cells switch to lytic replication.

However, there was no obvious difference in RTA1st and RTAall-

293 cells (Fig. 3A). This may be due to the fact that more cells were

infected with RBP-Jk mutant viruses in latent phase with higher

levels of LANA. In the wild type, RTA expression was not affected

thus most of the viral genome copies underwent lytic reactivation

thereby expression of latent protein, LANA diminished over time.

This is further evident by the levels of RTA, which increased, in a

time dependent manner after induction with TPA and butyric

acid, in wt BAC36-293 cells (Fig. 3A). Notably, though RTA



Figure 1. Generation of two recombinant KSHV BACmids with deletion of RBP-Jk sites in the RTA promoter. (A) Schematic diagramshowing generation of BAC RTA1st, a recombinant BAC36 with first RBP-Jk site deletion in the RTA promoter (B) Schematic diagram showinggeneration of BAC RTAall, a recombinant BAC 36 with deletion of first, 2nd and 3rd RBP-Jk site in the RTA promoter. (C) Ethidium bromide-stained geland southern blots with BAC36 wt (lane 1) and the mutated BACmid, RTA1st (Unfloxed, lane 2) and RTA1st (floxed, lane 3), cleaved with XhoI. (D) PCRanalysis for Bac36 wt and RTA1st recombinant virus at the junction of deletion of RBP-Jk site within RTA promoter. (E) Ethidium bromide-stained gel



expression was increased in a time-dependent manner after

induction in all cell lines, the levels of RTA expression in RTA1st

and RTAall-293 was much lower than seen in BAC36 wt-293 cells.

This suggests that RTA expression was reduced in RTA1st and

RTAall-293 cells (Fig. 3A). In addition, the viruses were collected

from supernatant of the induced BAC36 wt, RTA1st and RTAall-

293 cells and quantitated for virion particles by quantitative PCR

analysis. The results showed that RTA1st and RTAall-293 cells

produced fewer KSHV genomes, suggesting a decrease in virion

production post-induction (Fig. 3B). This confirms our hypothesis

that deletion of the RBP-Jk binding sites in the RTA promoter of

KSHV results in an attenuated lytic cycle and thus decreased viral

progeny. Furthermore, total DNA was extracted from BAC36 wt,

RTA1st and RTAall-293 cells. Intracellular viral DNA levels were

determined by quantitative PCR analysis standardized by

GAPDH. The result showed that RTA1st and RTAall-293 cells

had a greater number of viral copies compared to BAC36 wt-293

cells, further indicating that RTA1st and RTAall deficient viruses

exhibited a decrease in lytic capability although the genome copy

numbers were greater (Fig. 3C).

RTA1st and RTAall recombinant KSHV showed enhancedlatency and promoted cell growth and proliferation of293 cells

BAC36 wt, RTA1st and RTAall are recombinant KSHV viruses

harboring a GFP marker which allows us to track viral genome

stability in 293 cells. Furthermore, RTA1st and RTAall 293 cells

possessed higher intracellular viral DNA copies than BAC36 wt-

293 cells. We postulated that both of them should have increased

GFP signals. Flow cytometry was performed based on GFP signals

for BAC36 wt, RTA1st and RTAall -293 cells. Interestingly,

RTA1st and RTAall-293 cells showed approximately 78% and

93% GFP fluorescence intensity, respectively. However, only 41%

GFP fluorescence intensity was seen for BAC36 wt-293 cells

(Fig 4A, B) and pellets from collected RTA1st and RTAall-293 cells

also had a more intense green color based on visual inspection

when compared to BAC36 wt-293 cells (data not shown).

KSHV is a known human oncovirus and is associated with

cellular transformation [31,50,51]. Therefore we wanted to

determine the proliferation rate for BAC36 wt, RTA1st and

RTAall-293 cells. Cells were starved in DMEM with 0.1% FBS

overnight. Next day, media were replaced with DMEM

supplemented with 5% FBS. Cells were cultured for 24 hrs and

harvested for analysis by flow cytometer. Interestingly, RTA1st and

RTAall-293 cells had a higher percentage of cells (55.7% and

59.4%) comparing to BAC36 wt-293 (51.8%) in G1 phase which

was consistant after multiple repeats (Fig. 4C). These results

suggested that RTA1st and RTAall recombinant viruses can

promote cell growth and proliferation in the infected cells. In

addition, cells harboring more viral genome copies should have an

enhanced capability for driving cell growth. Therefore we tested

this hypothesis with a colony formation assay. The colonies were

photographed using fluorescence microscopy and scanned by a

Typhoon 9200 system based on GFP signals. Surprisingly, the

average size of hygromycin-resistant colonies for RTA1st and

RTAall-293 cells was distinctively bigger (almost double) relative to

BAC36 wt-293 cells (Fig. 4D), indicating that RTA1st and RTAall

recombinant viruses possess enhanced capability for cell growth.

Furthermore, GFP positive colonies were scanned and quantitat-

ed. The results also showed that RTA1st and RTAall-293 cells

showed a 1.8 and 2.4 fold increase in total colonies in comparison

to BAC36 wt-293 (Fig. 4E, F), providing further evidence that

mutation of the RBP-Jk sites enhanced KSHV latent infection and

so promoted cell growth and proliferation.

RTA1st and RTAall recombinant viruses have enhancedlatent infection in human peripheral blood mononuclearcells (PBMCs)

KSHV infection is strongly linked to two lymphoproliferative

diseases, referred to as PEL and MCD [1,2]. Infection of PBMCs

with KSHV can provide greater insights into initiation and

development of KSHV associated lymphomagenesis. KSHV can

infect many cell types, including epithelial cells, keratinocytes,

endothelial cells and PBMCs which are permissive cells with

varying degrees of infectivity [36,44,52]. Previous studies show

that determination of GFP signals can be effectively used to

monitor the efficiency by which KSHV BAC36 infects PBMCs

[43]. Our investigation shows that mutations of the RTA

promoter, specifically the RBP-Jk cognate sequences, results in

reduced RTA expression as well as reduced RTA-mediated auto-

activation of its promoter [30]. Here, we have now developed a

BAC system to further explore the feedback regulation of RTA by

LANA. As described previously, GFP signals were monitored by

green fluorescence from the infected PBMCs [43]. We concen-

trated BAC36 wt, RTA1st and RTAall viruses from TPA and

Butyric acid treated-293 cells. The concentrated viruses were used

to infect PMBCs and the infected cells were monitored at 1, 2, 4

and 7 days post infection (dpi). The expected result was that virion

particles from both BAC36 wt and recombinant viruses would be

detected as GFP signals were seen by 2dpi (Fig. 5A). Infected

PBMCs were collected at 1, 2, 4 and 7dpi and total DNA was

extracted as indicated in materials and methods. Viral DNA levels

were determined by real-time PCR normalized to endogenous

GAPDH. As indicated by GFP signals, viral copies of BAC36 wt

showed a time-dependent manner increase in viral DNA, and the

viral DNA copies of RTA1st and RTAall recombinant viruses had a

similar level at 1 and 2 dpi (Fig. 5B). However, genome copies of

RTA1st and RTAall recombinant viruses showed a significant

increase in infected PBMCs above that of BAC36 wt at 1dpi, 2dpi,

4dpi and 7dpi, suggesting that more latent viral genomes were

tethered to the host genome (Fig. 5B). Extracellular viral DNAs

were collected from infected supernatants and quantitated by

using KSHV TR primer set. In contrast, viral DNA levels of

RTA1st and RTAall recombinant viruses were decreased in

comparison to BAC36 wt from 1dpi to 7dpi, indicating that the

lytic cycle of the recombinant viruses was not as robust. These data

further support our pervious results showing that RTA1st and

RTAall recombinant viruses exhibited an enhanced latent infection

phenotype and a reduced capability for lytic replication in this

system (Fig 5C).

RTA1st and RTAall recombinant viruses have reducedcapability for inducing lytic replication after primaryinfection

LANA and RTA are viral encoded molecular switches for latent

and lytic phases in KSHV infection. We wanted to determine the

mRNA levels of RTA and LANA during primary infection.

and southern blots with BAC36 wt (lane 1) and the mutated BACmid, RTAall (Unfloxed, lane 2) and RTAall (floxed, lane 3), cleaved with XhoI. (F) PCRanalysis for BAC36 wt and RTA1st recombinant virus at the junction of deletion of RBP-Jk sites within RTA promoter. DNA fragments were sequencedand confirmed the mutation.doi:10.1371/journal.ppat.1002479.g001



Figure 2. Transfection of 293 cells with BAC36 wt, BAC RTA1st and BAC RTAall DNAs. (A) Cells were transfected with BAC36 wt, BAC RTA1st

and BAC RTAall DNAs. GFP expression levels were monitored by fluorescent microscopy 2 days after transfection, and the transfected cells were splitand selected with Hygromycin B. The hygromycin-resistant cells were pooled and passed three to four times. The homogenous population of GFP-positive cells harboring KSHV wild-type and mutant genomes were obtained. (B). Immunofluorescence analysis for LANA in BAC36-293 BAC RTA1st-293 and BAC RTAall-293 cells.doi:10.1371/journal.ppat.1002479.g002



Immunofluorescence assays showed that LANA signals were

detected in BAC36 wt, RTA1st and RTAall infected PBMCs at 1

dpi, 2 dpi, 4 dpi and 7dpi indicating a successful infection (Fig. 6A).

DNase treated total RNA from infected PBMCs at 1 dpi, 2 dpi, 4

dpi and 7dpi were used to generate cDNA and signals of RTA and

LANA transcripts quantitated by real-time PCR. The results

showed that LANA expression from BAC36 wt infected PBMCs

increased in a time-dependent manner. Furthermore, RTA1st and

RTAall recombinant viruses infected PBMCs showed higher

LANA mRNA expression from 1 dpi to 7dpi, indicating that

deletion of the RBP-Jk cognate sequences within the RTA

promoter can result in greater stringency for latent infection

(Fig. 6B). Additionally, mRNA of RTA was also analyzed and

showed a peak at 2dpi in BAC36 wt and recombinant viruses

(Fig. 6C), perhaps promoting lytic infection at an early stage [47].

However, compared to BAC36 wt, RT-PCR results from RTA

mRNA showed lower levels in RTA1st and RTAall infected

PBMCs from 1 dpi to 7dpi with almost no significant change with

RTAall recombinant virus (Fig. 6C). This suggests that deletion of

the RBP-Jk cognate sequences in the promoter led to a dramatic

loss in the ability of the recombinant viruses to induce lytic cycle

activation, and as a result more tightly maintain latent infection

(Fig 6C). Furthermore, KSHV ORF6 which encodes the single-

stranded DNA (ssDNA) binding protein and is tightly associated

with DNA replication, showed increased expression in RTA1st and

RTAall infected PBMCs compared to BAC36 wt infected PBMCs

(Fig 7A). This suggests that KSHV replication is actively engaged

although latent infection is more stringent (Fig 7A). ORF49

encoded by KSHV lies adjacent to and is transcribed in the

opposite orientation to RTA. It also co-operates with RTA to

activate KSHV lytic cycle [53]. We also monitored the activity of

ORF49, which cooperates with RTA during lytic replication

through activation of several lytic promoters containing AP-1 sites

[53]. The mRNA level was initially higher for recombinant viruses

at 1dpi (Fig 7B). However, at 4dpi and 7dpi, the ORF49 transcript

levels for the recombinants were much lower than BAC36 wt with

RTAall greater than 2-fold less at 4dpi. By 7dpi, both RTA1st and

RTAall were further depressed compared to BAC36 wt to about 3-

fold (Fig. 7B). This suggests that active lytic replication of KSHV

was dramatically reduced by 7dpi with a greater propensity for

Figure 3. Comparisons of effect on deletion of RBP-Jk sites within RTA promoter in KSHV lytic life cycle. (A) Comparison of levels of viralgene expression of BAC36 wt, RTA1st and RTAall recombinant viruses in 293 cells. Western blot for RTA and LANA at 0, 24, 48, 72 hours lytic inductionof BAC36 wt, RTA1st and RTAall stable 293 cell lines in the presence of Butyrate acid and TPA. The same blot was also reprobed with anti-GAPDHantibody to ensure equal loading of each sample. RD: relative density. (B) Detection of intracellular KSHV viral genome copies using TR primer inBAC36 wt-293, RTA1st-293 and RTAall-293 cells induced by Butyrate acid and TPA. (C) Detection of extracellular KSHV progeny virion production usingTR primer in the supernatant of BAC36 wt-293, RTA1st-293 and RTAall-293 induced by Butyrate acid and TPA. *P,0.05; **P,0.01; ***P,0.001 byStudent’s t test.doi:10.1371/journal.ppat.1002479.g003



maintaining latency. We then investigated changes in the K8 and

K9 transcript levels. The early lytic protein K8 [54], showed a

general increase in transcript levels over the 7 day period.

However, the levels of K8 transcripts for RTA1st and RTAall were

generally lower than that of the BAC36 wt virus (Fig 7C).

Interestingly, ORF K9 which encodes for vIRF, a homolog to

members of the interferon (IFN) regulatory factor (IRF) and

important for regulating intracellular interferon signal transduc-

tion [55], increased dramatically by 2 days, with BAC36 wt

continuing to increase in K9 transcript levels. At 7 days all viruses

showed a drastic reduction in K9 transcript levels (Fig. 7D). These

results suggest a level of regulation of these transcripts which is

important for controlling latent infection in KSHV.

RTA1st and RTAall recombinant viruses showed enhancedability to infect T and B cells during primary infection

Human PBMCs contains lymphoid cells consisting of both T

and B cells. The results above showed that RTA1st and RTAall

recombinant viruses have an enhanced propensity for latent

infection during the early stages of in vitro infection. Recently,

Myoung and Ganem showed that 20–40% T and 4%–5% B cells

from human tonsillar cultures can be infected [36]. However, only

B cells support viral replication and produce progeny. Here, we

are interested in the ability of KSHV to infect T and B cells from

PBMCs during early infection. APC–conjugated anti-CD3 and

PercpCy 5.5-conjugated anti-CD19 mAbs were used to detect

infected T and B cells, respectively. GFP signals were used to

detect KSHV-positive cells. Our results showed that GFP positive

T cells were detected as early as 1 dpi (Fig 8A). The GFP positive

T cells infected by BAC36 wt virus was slightly changed relative to

RTA1st and RTAall recombinant viruses. At 2 dpi, the proportion

of GFP+ CD3+ T cells was 1.65%, 1.86% and 1.64%,

respectively. The percentage of GFP+ CD3+ T cells infected by

BAC36 wt, RTA1st and RTAall recombinant viruses were

increased to 1.68%, 3.32% and 3.7% at 4 dpi, respectively. At 7

dpi, T cells were infected continuously in a time-dependent

manner and the proportion of GFP+ CD3+ T cells were 3.98%

and 4.48% for RTA1st and RTAall relative to 2.04% for BAC36 wt

(Fig 8A). These results further confirms that T cells were infected

and that mutation of RBP-Jk sites within RTA promoter can result

in an increase in T cell infection as determined by GFP signals.

We then investigated the response of B cells exposed to KSHV.

At 1 dpi the percentage of GFP+ CD19+ B cells were 0.48% for

BAC36 wt, 0.72% for RTA1st and 0.79% RTAall recombinant

viruses (Fig 8B). The next day, the proportion of GFP+ CD19+ B

cells increased to 1.77% for BAC36 wt, 1.75% for RTA1st and

1.74 % RTAall. At 4 dpi, the percentage of GFP+ CD19+ B cells

further increased to 2.03% for BAC36 wt, 2.49% for RTA1st and

2.51% RTAall, and at 7dpi, the GFP+ CD19+ B was similar to

that at 4dpi suggesting that little or no further increase in B cell

infection was seen. Furthermore, RTA1st and RTAall recombinant

viruses infected B cells (2.13% and 2.47%) show a consistently

higher rate of infection compared to BAC36 wt infected B cells

(2.05%) (Fig 8B). This suggests that PBMCs were continually

infected over the 7day period. Interestingly, GFP+ CD3+ T cells

had a higher rate of infection compared to GFP+ CD19+ B cells

from the BAC36 wt infected PBMCs (Fig 8C). Importantly,

RTA1st and RTAall recombinant viruses possessed a higher

infectivity compared to BAC36 wt virus for both infected T and

B cells (Fig 8D). The overall amount of the GFP positive cells

showed a definite increase in a time-dependent manner (Fig 8E).

This further supports our previous data showing increased

fluorescent signal from 2dpi to 7dpi. In general when compared

to BAC36 wt, RTA1st and RTAall recombinant viruses infected

PBMCs showed more GFP-positive cells, suggesting an increased

ability for infection and maintenance of the KSHV genome within

the first 7days after infection (Fig 8E).

RTA1st and RTAall recombinant viruses showed anincreased capability for infection and proliferation inlong-term-infected telomerase-immortalized endothelialcells

Typically, infected PBMCs stopped clumping and most cells

begin to die after 7 dpi. In our experiments, no transformation

and/or immortalization was observed in infected PBMCs in vitro

during the 7-day period. Thus it was difficult to monitor the effect

of long-term infection of RTA1st and RTAall recombinant viruses.

Here, we used recently developed telomerase-immortalized

endothelial cells (TIVE) to monitor the ability of RTA1st and

RTAall recombinant viruses to infect TIVE cells [44]. TIVE cells

were infected with BAC36 wt, RTA1st and RTAall recombinant

viruses as indicated in the materials and methods. GFP signals

confirmed latent infection by BAC36 wt, RTA1st and RTAall

viruses and photographs were taken at 1 week post-infection (wpi),

2wpi and 4wpi (Fig. 9A). We determined the copy number of

KSHV genomes in infected TIVE as a measure of the persistence

of the genomes. Total DNAs were extracted from BAC36 wt,

RTA1st and RTAall recombinant viruses infected TIVE cells at 1,

2, 4wpi. Intracellular viral DNAs were determined by a

quantitative PCR analysis standardized by GAPDH. The result

showed that copy numbers of BAC36 wt, RTA1st and RTAall

recombinant viruses were a slightly lower at 4wpi compared to 1

and 2wpi suggesting a possible loss of KSHV genome due to

genome tethering instability. This phenomenon was also seen in

BCBL-1-derived cell-free virus infected TIVE cells [44]. However,

RTA1st and RTAall recombinant viruses maintained a similar copy

number in the infected TIVE cells and infection levels were

consistently greater than the BAC36 wt infected TIVE cells at 1 to

4wpi (Fig. 9B). These results further indicated that RTA1st and

RTAall recombinant viruses exhibited a decrease in lytic

capability. Previous studies showed that KSHV long-term-infected

telomerase-immortalized endothelial cells exhibit a significant

increase in number of cells in the S phase [44]. Here, we cultured

infected TIVE cells for 4 weeks, harvested, fixed and stained them

with propidium iodide. Flow cytometry analysis showed that the

RTA1st and RTAall infected TIVE cells had an increased S phase

population (29.4% and 32.1%), relative to BAC36 wt (25%) at

1wpi. Therefore, the recombinant viruses infected cells showed an

enhanced capability to proliferate (Fig 9C). Similar patterns were

seen at 2wpi and 4wpi where RTA1st and RTAall all exhibited

Figure 4. Comparison of cell growth and proliferation for WT, RTA1st and RTAall -293 cells. (A) BAC36 wt, RTA1st and RTAall transfected 293cells selected for 3–4 weeks were assayed by FACS analysis based on GFP signals. (B) Relative GFP density in the BAC36 wt, BAC RTA1st and BAC RTAall

transformed 293 cells. (C) BAC36 wt, RTA1st and RTAall-293 cells were starved in DMEM with 0.1% FBS for overnight. Next day, media were replacedwith DMEM supplement with 5% FBS. Cells were cultured for 24 hrs and harvested for analysis by flow cytometer. (D) 293 cells transfected withBAC36 wt, BAC RTA1st and BAC RTAall viruses were selected with Hygromycin for a 4-week selection, cells were seed on the plates. Colony weremonitored and photographed under fluorescence microscopy after growth for two weeks. (E) The plates were scanned by Typhoon 9200 based onGFP signals. (F) The colony number was quantized using odyssey V 3.0.doi:10.1371/journal.ppat.1002479.g004



increased S phase populations, further supporting our previous

hypothesis that RTA1st and RTAall recombinant viruses can

increase cell proliferation in TIVE cells.

Discussion

KSHV RTA is an immediate early protein (IE) that initiates

KSHV lytic reactivation from latent infection. It can directly or

indirectly stimulate the transcription of a cluster of lytic genes as a

transcription factor through binding to specific promoter sequenc-

es. RTA is a key regulator for KSHV reactivation because its

expression is sufficient to activate the entire lytic cycle. Therefore

understanding the regulation of RTA is to provide a better clue

related to KSHV infection and tumorigenicity. RTA-deficient

viruses are able to establish latency but are unable to reactivate

[23]. Here, in an effort to explore KSHV latency and reactivation

we generated two recombinant viruses which possess different

latency and reactivation profiles compared to BAC36 wt. They

Figure 5. Comparisons of relative infectivity for BAC36 wt, RTA1st and RTAall recombinant viruses. (A) PBMCs were infected by KSHVBAC36 wt, RTA1st and RTAall viruses with equally loading. GFP expression was monitored under a fluorescent microscope after 2dpi, 4dpi and 7dpi. (B)Intracellular KSHV viral genome copies were measured by a real-time PCR with primers to TR at 1 dpi, 2 dpi, 4 dpi and 7 dpi. (C) Extracellular KSHVprogeny virion progenies were analyzed by a real-time PCR with primers to TR at 1 dpi, 2 dpi, 4 dpi and 7 dpi. Dpi, days post infection. *P,0.05;**P,0.01; ***P,0.001 by Student’s t test.doi:10.1371/journal.ppat.1002479.g005



serve as important reagents which allow us to examine the early-

stages of KSHV infection. This provides a model with which to

understand the development of KSHV-associated lymphoprolif-

erative diseases.

RTA is an IE protein and its expression is also affected by other

viral or cellular factors. For example, RTA up-regulates its own

expression through interaction with the CCAAT/enhancer

binding protein alpha(C/EBPa) at its promoter [20,56]. Further-

more, RTA can down-regulate its ability for activating specific

viral promoters by cooperating with the viral protein b-Zip, an

early protein encoded by ORF K8 [57,58]. Our previous studies

showed that loss of one of those sites can potentially affect the

Figure 6. Quantitative analysis of KSHV BAC36 wt, RTA1st and BAC RTAall recombinant viruses infected PBMCs at 1dpi, 2dpi, 4dpiand 7dpi. (A) Immunofluorescence assay for PBMCs infected by KSHV BAC36 wt, RTA1st and RTAall recombinant viruses at 2 dpi, 4 dpi and 7 dpi.Uninfected and infected PBMCs at 2 dpi, 4 dpi and 7 dpi were stained for LANA protein expression. PBMCs expressed GFP, indicating the presence ofviral genome. (B, C). Quantitative analysis for determination of latent and lytic infection in PMBC cells infected by KSHV BAC36 wt, RTA1st and RTAall

recombinant viruses. Total RNAs were extracted, treated with DNase I, and reverse transcribed to cDNA after 1 dpi, 2 dpi, 4 dpi and 7dpi. QuantitativeReal-time PCR analysis with the primers for LANA and RTA was performed using StepOnePlus Real-Time PCR System. Error bars indicate standarddeviations from three separate experiments.doi:10.1371/journal.ppat.1002479.g006



overall regulation of all four RBP-Jk sites within the RTA

promoter [30]. Importantly, the observation that RTA1st and

RTAall recombinant viruses enhance latency and can promote cell

growth in 293 cells caused us to further investigate these mutations

during early infection.

Many human cancers are associated with tumor viruses [59]

and many are detected in PBMCs. Human papillomavirus (HPV)

DNA has been found as an episomal form in PBMCs, but no

transcripts are detected [60,61]. Recent studies showed that

PBMCs of haematuric cattle are additional reservoir of bovine

papillomavirus type 2 [62]. Though Hepatitis C virus (HCV) is

detected in PBMCs of infected individuals, infected PBMCs are

not observed in co-culture with cell culture systems producing

HCV virions. This implicates additional reservoirs for the virus

and allows for PBMCs infection [63]. However, Polyomavirus BK

(BKV), one of the tumor viruses associated with nephropathy in

renal allografts, elicits a BKV-specific proliferative response in the

PBMCs of healthy individuals and bone marrow transplant

recipients [64,65]. Another human tumor virus, John Cunning-

ham virus (JCV) is detectable in the PMBCs of immunoimpaired

and healthy individuals [66]. The well studied EBV infects B

lymphocytes and induces their differentiation, proliferation [32].

Furthermore, PBMCs infected EBV lead to immortalization and

transformation of B cells [47]. However, the mechanism by which

KSHV infects and transforms B cells is not fully understood. Thus,

the development of lymphoproliferative diseases which include

primary effusion lymphoma and multicentric Castleman’s disease

is yet to be fully understood. Recently, PBMCs from marmosets

orally and intravenously infected with rKSHV.219, showed the

presence of the viral genome and LANA expression [42].

Additionally, T and B cells isolated from primary human tonsillar

cells were shown to be infected by KSHV virions, although more

T cells were infected. However, these infections were abortive

without further lytic infection [35,36]. Other T cells types from

human PBMCs can support KSHV infection [67,68,69]. Similar

patterns were observed showing that both T and B cells from

human PBMCs are effectively infected up to 7 days, suggesting

that KSHV has a different mode of infection compared EBV

infection. Obviously, many more T cells were infected in a time-

dependent manner, perhaps due to the large population of T cells

or a receptor on T cells not highly expressed in B cells. At 4 and 7

dpi, T cells were infected up to 4.48%, over 2 times the percentage

of B cells infected. This phenomenon was also seen in KSHV

infected tonsillar cells, though the life span of infected cells was

Figure 7. Quantitative analysis of ORF 49, ORF6, K8 and K9 expression in KSHV infected PBMCs at 1dpi, 2dpi, 4dpi and 7dpi. TotalRNAs were prepared and transcribed to cDNA and the qRT-PCR analysis with the primers for (A) ORF 49, (B) ORF6, (C) K8 and (D) K9 was performedusing the Power SYBR green PCR master mix with GAPDH as control. Error bars indicate standard deviations from three separate experiments.doi:10.1371/journal.ppat.1002479.g007



Figure 8. FACS analysis of T cells, B cells and GFP-positive cells in BAC36 wt, RTA1st and RTAall recombinant viruses infected PBMCs.(A, B) KSHV BAC36 wt, RTA1st and RTAall viruses infected PBMCs were harvested at 1dpi, 2dpi, 4dpi and 7dpi. T cells and B cells were detected by usingthe APC–conjugated anti-CD3 and PercpCy 5.5 -conjugated anti-CD19 mAbs. GFP signals were monitored KSHV positive cells. Data were acquired onFACSCalibur equipped with CellQuest Pro software and analyzed using FlowJo software. (C) KSHV infected T cells (CD3+ GFP+). (D) KSHV infected Bcells (CD19+ GFP+). (E) Total KSHV infected PBMC cells (GFP +). *P,0.05; **P,0.01; ***P,0.001 by Student’s t test (N = 9).doi:10.1371/journal.ppat.1002479.g008



short [36]. This pattern was similar to transformed 293 cells in that

RTA1st and RTAall recombinant viruses still enhanced population

of T cells in PBMCs, suggesting that infected T cells may be

latently infected. Our data also showed that the percentage of

CD19 + GFP+ B cells was increased from 1dpi to 7dpi.

Unexpectedly, B cell infection boosted the proliferation of infected

cells in a time-dependent manner, though T cells are likely to

suppress lytic replication of infected B cells. It may be the case that

B cells are undergoing lytic cycle replication, releasing progeny

which reinfect both T cells and B cells as there was a general

increase in lytic cycle gene expression within 2dpi. The population

of infected B cells began to decrease at 7dpi, though the number of

infected T cells had peaked. As HIV infection may reduce the

CD4+ T cell counts, KSHV infected T cells may maintain a fine

balance in overall T cell population as well as promote cell

proliferation and immortalization for B cells. Another possibility is

that certain subpopulations of cells were significantly overactive

and may restrict B cell proliferation. Recently, Myoung and

Ganem showed that T cells from infected primary human tonsillar

lymphoid cells by KSHV did not support proper viral transcrip-

tion and did not produce infectious virus. However, activated T

cells may promote or stabilize latency of KSHV infected B cells

[35,36]. Interestingly, we did not see proliferation of B cells but the

percentage of infected B cells was decreased at 7dpi. Therefore we

think other restrictive signals are involved in controlling latency of

infected B cells, and so transformation for B cells was suppressed.

After 7days post-infection, most cells died and no immortalization

was observed. One reasonable explanation is that B cells can

provide same paracrine signal activities to T cells but infected T

cells may lack the ability to receive these signals from B cells, thus

losing their proliferative capability. However, B cells may have a

central role in infection and proliferation of PBMCs. After 7dpi,

the efficiency of infection of B cells was decreased which led to a

dramatic reduction in proliferation of the KSHV infected PBMCs.

Did the presence of more T cells which were continuously infected

destroy the population balance of PBMCs? Do B cells drive

essential signaling important for T cells proliferation? These

questions merit further investigation. In addition, GFP positive

signals showed that more cells were infected in a time-dependent

manner. We ruled out the possibility that TPA may have caused

this effect in infected T and B cells, as a side-by-side comparison

between BAC36 wt, RTA1st and RTAall recombinant viruses

strongly supported our conclusion [70]. We clearly showed that

RTA1st and RTAall viruses infected total GFP-positive B and T

cells showed a prominent increase relative to BAC36 wt in PBMCs

up to 7dpi. These results further support our hypothesis that

mutation of RBP-Jk in the RTA promoter can enhance KSHV

latent infection of both of B and T cells in PBMCs during primary

infection.

The expression of total mRNA from infected PBMCs provides

additional information and further reinforces the pattern of

KSHV infection. RTA1st and RTAall recombinant viruses showed

a decrease in K8 expression, though the down-regulation was not

necessarily as strong as in B cells infected with RTA-deficient virus

[23]. However, this is reasonable because neither RTA1st nor

RTAall recombinant viruses abrogated viral lytic capabilities.

RTA1st and RTAall recombinant viruses up-regulated KSHV

ORF6 (SSB, single-stranded DNA binding protein) indicating that

viral DNA replication is active in infected PBMCs. LANA

expression was also up-regulated, suggesting a more tightly latent

infection due to the action of LANA on RBP-Jk. ORF 49

expression was down-regulated in RTA1st and RTAall recombi-

nant viruses infected PBMCs, suggesting that these recombinant

viruses may in part lose their lytic capability. Interestingly, the

mRNA levels of ORF K8 which is a direct target of RTA [71], was

significantly decreased in RTA1st and RTAall recombinant viruses

infected PBMCs, strongly suggesting that the two recombinant

viruses possess a reduced capability for lytic replication during

primary infection. Overall, these data further supports our

hypothesis that recombinant RTA1st and RTAall viruses are

enhanced in their ability to maintain latency after infection of

primary cells.

Though PBMCs were effectively infected, long-term infection of

B and T cells was not supported. RTA1st and RTAall recombinant

viruses showed on increase in genome copies in long-term-infected

TIVE cells providing evidence that mutation of the RBP-Jk sites

within the RTA promoter enhanced KSHV latent infection and

induces the proliferative capability of the infected primary cells.

In conclusion, we have now experimentally shown that KSHV

recombinant viruses with mutated RBP-Jk sites within the RTA

promoter possess an enhanced ability to maintain latent infection

in transformed-293 cells as well as PBMCs during early infection.

Our studies further confirm and define our previously published

data which showed the effects on truncation of the RTA promoter

and has important implications regarding the development of

KSHV-associated lymphoproliferative disease. These recombinant

viruses now provide a model which can be used to explore the

early stages of primary infection in human PBMCs as well as the

development of KSHV-associated lymphoproliferative diseases.

Acknowledgments

We thank Dr. Shou-Jiang Gao (University of Texas) for the BAC36

KSHV-GFP BACmid and Dr. Rolf Renne (University of Florida) and

Michael Lagunoff (University of Washington) for the telomerase-immor-

talized human umbilical vein endothelial (TIVE) cells. We also thank Dr.

Sabyasachi Haldar for assistance in generation of RTAall recombinant

virus.

Author Contributions

Conceived and designed the experiments: JL SCV ESR. Performed the

experiments: JL QC RKD. Analyzed the data: JL SCV. Contributed

reagents/materials/analysis tools: AS. Wrote the paper: JL ESR.

References

1. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM (1995) Kaposi’s

sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-

cavity-based lymphomas. N Engl J Med 332: 1186–1191.

2. Soulier J, Grollet L, Oksenhendler E, Cacoub P, Cazals-Hatem D, et al. (1995)

Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in multicentric

Castleman’s disease. Blood 86: 1276–1280.

Figure 9. Analysis of KSHV BAC36 wt, RTA1st and RTAall recombinant viruses infected TIVE cells at 1, 2 and 4 weeks post infection(wpi). (A) TIVE cells were infected with concentrated KSHV BAC36 wt, RTA1st and RTAall recombinant viruses as described in materials and methods.GFP expression was used to monitor infection under fluorescence microscope at 1, 2 and 4 wpi. (B) Intracellular KSHV viral genome copies weremeasured by a real-time PCR with primers to TR at 1, 2 and 4 wpi. (C) Flow cytometer was performed for KSHV wt, RTA1st and RTAall recombinantviruses infected TIVE cells at 1, 2 and 4wpi. Wpi, week post-infection. *P,0.05; **P,0.01; ***P,0.001 by Student’s t test.doi:10.1371/journal.ppat.1002479.g009



3. Hu J, Garber AC, Renne R (2002) The latency-associated nuclear antigen of

Kaposi’s sarcoma-associated herpesvirus supports latent DNA replication individing cells. J Virol 76: 11677–11687.

4. Chang PJ, Shedd D, Gradoville L, Cho MS, Chen LW, et al. (2002) Open

reading frame 50 protein of Kaposi’s sarcoma-associated herpesvirus directlyactivates the viral PAN and K12 genes by binding to related response elements.

J Virol 76: 3168–3178.

5. Chang PJ, Shedd D, Miller G (2005) Two subclasses of Kaposi’s sarcoma-

associated herpesvirus lytic cycle promoters distinguished by open reading frame50 mutant proteins that are deficient in binding to DNA. J Virol 79: 8750–8763.

6. Chen J, Ueda K, Sakakibara S, Okuno T, Yamanishi K (2000) Transcriptional

regulation of the Kaposi’s sarcoma-associated herpesvirus viral interferonregulatory factor gene. J Virol 74: 8623–8634.

7. Deng H, Song MJ, Chu JT, Sun R (2002) Transcriptional regulation of the

interleukin-6 gene of human herpesvirus 8 (Kaposi’s sarcoma-associated

herpesvirus). J Virol 76: 8252–8264.

8. Deng H, Young A, Sun R (2000) Auto-activation of the rta gene of humanherpesvirus-8/Kaposi’s sarcoma-associated herpesvirus. J Gen Virol 81:

3043–3048.

9. Haque M, Chen J, Ueda K, Mori Y, Nakano K, et al. (2000) Identification andanalysis of the K5 gene of Kaposi’s sarcoma-associated herpesvirus. J Virol 74:

2867–2875.

10. Jeong J, Papin J, Dittmer D (2001) Differential regulation of the overlapping

Kaposi’s sarcoma-associated herpesvirus vGCR (orf74) and LANA (orf73)promoters. J Virol 75: 1798–1807.

11. Liu Y, Cao Y, Liang D, Gao Y, Xia T, et al. (2008) Kaposi’s sarcoma-associated

herpesvirus RTA activates the processivity factor ORF59 through interactionwith RBP-Jkappa and a cis-acting RTA responsive element. Virology 380:

264–275.

12. Lukac DM, Garibyan L, Kirshner JR, Palmeri D, Ganem D (2001) DNAbinding by Kaposi’s sarcoma-associated herpesvirus lytic switch protein is

necessary for transcriptional activation of two viral delayed early promoters.

J Virol 75: 6786–6799.

13. Lukac DM, Kirshner JR, Ganem D (1999) Transcriptional activation by theproduct of open reading frame 50 of Kaposi’s sarcoma-associated herpesvirus is

required for lytic viral reactivation in B cells. J Virol 73: 9348–9361.

14. Song MJ, Brown HJ, Wu TT, Sun R (2001) Transcription activation ofpolyadenylated nuclear rna by rta in human herpesvirus 8/Kaposi’s sarcoma-

associated herpesvirus. J Virol 75: 3129–3140.

15. Wang Y, Yuan Y (2007) Essential role of RBP-Jkappa in activation of the K8

delayed-early promoter of Kaposi’s sarcoma-associated herpesvirus by ORF50/RTA. Virology 359: 19–27.

16. Zhang L, Chiu J, Lin JC (1998) Activation of human herpesvirus 8 (HHV-8)

thymidine kinase (TK) TATAA-less promoter by HHV-8 ORF50 gene productis SP1 dependent. DNA Cell Biol 17: 735–742.

17. Liang Y, Chang J, Lynch SJ, Lukac DM, Ganem D (2002) The lytic switch

protein of KSHV activates gene expression via functional interaction with RBP-

Jkappa (CSL), the target of the Notch signaling pathway. Genes Dev 16:1977–1989.

18. Liao W, Tang Y, Kuo YL, Liu BY, Xu CJ, et al. (2003) Kaposi’s sarcoma-

associated herpesvirus/human herpesvirus 8 transcriptional activator Rta is anoligomeric DNA-binding protein that interacts with tandem arrays of phased A/

T-trinucleotide motifs. J Virol 77: 9399–9411.

19. Wang SE, Wu FY, Chen H, Shamay M, Zheng Q, et al. (2004) Early activation

of the Kaposi’s sarcoma-associated herpesvirus RTA, RAP, and MTApromoters by the tetradecanoyl phorbol acetate-induced AP1 pathway. J Virol

78: 4248–4267.

20. Wang SE, Wu FY, Fujimuro M, Zong J, Hayward SD, et al. (2003) Role ofCCAAT/enhancer-binding protein alpha (C/EBPalpha) in activation of the

Kaposi’s sarcoma-associated herpesvirus (KSHV) lytic-cycle replication-associ-

ated protein (RAP) promoter in cooperation with the KSHV replication andtranscription activator (RTA) and RAP. J Virol 77: 600–623.

21. Song MJ, Deng H, Sun R (2003) Comparative study of regulation of RTA-

responsive genes in Kaposi’s sarcoma-associated herpesvirus/human herpesvirus8. J Virol 77: 9451–9462.

22. Sakakibara S, Ueda K, Chen J, Okuno T, Yamanishi K (2001) Octamer-binding

sequence is a key element for the autoregulation of Kaposi’s sarcoma-associated

herpesvirus ORF50/Lyta gene expression. J Virol 75: 6894–6900.

23. Xu Y, AuCoin DP, Huete AR, Cei SA, Hanson LJ, et al. (2005) A Kaposi’ssarcoma-associated herpesvirus/human herpesvirus 8 ORF50 deletion mutant is

defective for reactivation of latent virus and DNA replication. J Virol 79:3479–3487.

24. Lai EC (2002) Keeping a good pathway down: transcriptional repression of

Notch pathway target genes by CSL proteins. EMBO Rep 3: 840–845.

25. Mumm JS, Kopan R (2000) Notch signaling: from the outside in. Dev Biol 228:

151–165.

26. Liang Y, Ganem D (2003) Lytic but not latent infection by Kaposi’s sarcoma-associated herpesvirus requires host CSL protein, the mediator of Notch

signaling. Proc Natl Acad Sci U S A 100: 8490–8495.

27. Liang Y, Ganem D (2004) RBP-J (CSL) is essential for activation of the K14/vGPCR promoter of Kaposi’s sarcoma-associated herpesvirus by the lytic switch

protein RTA. J Virol 78: 6818–6826.

28. Lan K, Kuppers DA, Verma SC, Sharma N, Murakami M, et al. (2005)

Induction of Kaposi’s sarcoma-associated herpesvirus latency-associated nuclear

antigen by the lytic transactivator RTA: a novel mechanism for establishment oflatency. J Virol 79: 7453–7465.

29. Chang PJ, Boonsiri J, Wang SS, Chen LY, Miller G (2010) Binding of RBP-

Jkappa (CSL) protein to the promoter of the Kaposi’s sarcoma-associatedherpesvirus ORF47 (gL) gene is a critical but not sufficient determinant of

transactivation by ORF50 protein. Virology 398: 38–48.

30. Lan K, Kuppers DA, Robertson ES (2005) Kaposi’s sarcoma-associated

herpesvirus reactivation is regulated by interaction of latency-associated nuclear

antigen with recombination signal sequence-binding protein Jkappa, the majordownstream effector of the Notch signaling pathway. J Virol 79: 3468–3478.

31. Mesri EA, Cesarman E, Boshoff C (2010) Kaposi’s sarcoma and its associatedherpesvirus. Nat Rev Cancer 10: 707–719.

32. Alfieri C, Birkenbach M, Kieff E (1991) Early events in Epstein-Barr virus

infection of human B lymphocytes. Virology 181: 595–608.

33. Ballon G, Chen K, Perez R, Tam W, Cesarman E (2011) Kaposi sarcoma

herpesvirus (KSHV) vFLIP oncoprotein induces B cell transdifferentiation andtumorigenesis in mice. J Clin Invest 121: 1141–1153.

34. Hassman LM, Ellison TJ, Kedes DH (2011) KSHV infects a subset of human

tonsillar B cells, driving proliferation and plasmablast differentiation. J ClinInvest 121: 752–768.

35. Myoung J, Ganem D (2011) Active lytic infection of human primary tonsillar B

cells by KSHV and its noncytolytic control by activated CD4+ T cells. J ClinInvest 121: 1130–1140.

36. Myoung J, Ganem D (2011) Infection of primary human tonsillar lymphoid cellsby KSHV reveals frequent but abortive infection of T cells. Virology 413: 1–11.

37. Moore PS, Kingsley LA, Holmberg SD, Spira T, Gupta P, et al. (1996) Kaposi’s

sarcoma-associated herpesvirus infection prior to onset of Kaposi’s sarcoma.AIDS 10: 175–180.

38. Camera Pierrotti L, Masami Sumita L, Santos Freire W, Hehl Caiaffa Filho H,de Souza VA (2000) Detection of human herpesvirus 8 DNA and antibodies to

latent nuclear and lytic-phase antigens in serial samples from aids patients with

Kaposi’s sarcoma. J Clin Virol 16: 247–251.

39. Cattani P, Capuano M, Lesnoni La Parola I, Guido R, Santangelo R, et al.

(1998) Human herpesvirus 8 in Italian HIV-seronegative patients with Kaposisarcoma. Arch Dermatol 134: 695–699.

40. Zhu B, Chen Y, Xie Y, Wu N, Shendu J, et al. (2008) Kaposi’s sarcoma-

associated herpesvirus (KSHV) infection: endemic strains and cladograms fromimmunodeficient patients in China. J Clin Virol 42: 7–12.

41. Polstra AM, Goudsmit J, Cornelissen M (2003) Latent and lytic HHV-8 mRNA

expression in PBMCs and Kaposi’s sarcoma skin biopsies of AIDS Kaposi’ssarcoma patients. J Med Virol 70: 624–627.

42. Chang H, Wachtman LM, Pearson CB, Lee JS, Lee HR, et al. (2009) Non-human primate model of Kaposi’s sarcoma-associated herpesvirus infection.

PLoS Pathog 5: e1000606.

43. Lu J, Verma SC, Cai Q, Robertson ES (2011) The single RBP-J{kappa} Sitewithin the LANA promoter is crucial for establishing KSHV latency during

primary infection. J Virol 85: 6148–6161.

44. An FQ, Folarin HM, Compitello N, Roth J, Gerson SL, et al. (2006) Long-term-

infected telomerase-immortalized endothelial cells: a model for Kaposi’s

sarcoma-associated herpesvirus latency in vitro and in vivo. J Virol 80:4833–4846.

45. Xu Y, Rodriguez-Huete A, Pari GS (2006) Evaluation of the lytic origins ofreplication of Kaposi’s sarcoma-associated virus/human herpesvirus 8 in the

context of the viral genome. J Virol 80: 9905–9909.

46. Cai Q, Verma SC, Choi JY, Ma M, Robertson ES (2010) Kaposi’s sarcoma-associated herpesvirus inhibits interleukin-4-mediated STAT6 phosphorylation

to regulate apoptosis and maintain latency. J Virol 84: 11134–11144.

47. Halder S, Murakami M, Verma SC, Kumar P, Yi F, et al. (2009) Early events

associated with infection of Epstein-Barr virus infection of primary B-cells. PLoS

One 4: e7214.

48. Zhou FC, Zhang YJ, Deng JH, Wang XP, Pan HY, et al. (2002) Efficient

infection by a recombinant Kaposi’s sarcoma-associated herpesvirus cloned in abacterial artificial chromosome: application for genetic analysis. J Virol 76:

6185–6196.

49. Liu P, Jenkins NA, Copeland NG (2003) A highly efficient recombineering-basedmethod for generating conditional knockout mutations. Genome Res 13:

476–484.

50. Cesarman E (2011) Gammaherpesvirus and lymphoproliferative disorders inimmunocompromised patients. Cancer Lett 305: 163–174.

51. Wen KW, Damania B (2010) Kaposi sarcoma-associated herpesvirus (KSHV):molecular biology and oncogenesis. Cancer Lett 289: 140–150.

52. Bechtel JT, Liang Y, Hvidding J, Ganem D (2003) Host range of Kaposi’s

sarcoma-associated herpesvirus in cultured cells. J Virol 77: 6474–6481.

53. Gonzalez CM, Wong EL, Bowser BS, Hong GK, Kenney S, et al. (2006)

Identification and characterization of the Orf49 protein of Kaposi’s sarcoma-associated herpesvirus. J Virol 80: 3062–3070.

54. Hwang S, Gwack Y, Byun H, Lim C, Choe J (2001) The Kaposi’s sarcoma-

associated herpesvirus K8 protein interacts with CREB-binding protein (CBP)and represses CBP-mediated transcription. J Virol 75: 9509–9516.

55. Moore PS, Boshoff C, Weiss RA, Chang Y (1996) Molecular mimicry of humancytokine and cytokine response pathway genes by KSHV. Science 274:

1739–1744.

56. Wang SE, Wu FY, Yu Y, Hayward GS (2003) CCAAT/enhancer-bindingprotein-alpha is induced during the early stages of Kaposi’s sarcoma-associated



herpesvirus (KSHV) lytic cycle reactivation and together with the KSHV

replication and transcription activator (RTA) cooperatively stimulates the viralRTA, MTA, and PAN promoters. J Virol 77: 9590–9612.

57. Izumiya Y, Lin SF, Ellison T, Chen LY, Izumiya C, et al. (2003) Kaposi’s

sarcoma-associated herpesvirus K-bZIP is a coregulator of K-Rta: physicalassociation and promoter-dependent transcriptional repression. J Virol 77:

1441–1451.58. Liao W, Tang Y, Lin SF, Kung HJ, Giam CZ (2003) K-bZIP of Kaposi’s

sarcoma-associated herpesvirus/human herpesvirus 8 (KSHV/HHV-8) binds

KSHV/HHV-8 Rta and represses Rta-mediated transactivation. J Virol 77:3809–3815.

59. Damania B (2007) DNA tumor viruses and human cancer. Trends Microbiol 15:38–44.

60. Roperto S, Brun R, Paolini F, Urraro C, Russo V, et al. (2008) Detection ofbovine papillomavirus type 2 in the peripheral blood of cattle with urinary

bladder tumours: possible biological role. J Gen Virol 89: 3027–3033.

61. Bodaghi S, Wood LV, Roby G, Ryder C, Steinberg SM, et al. (2005) Couldhuman papillomaviruses be spread through blood? J Clin Microbiol 43:

5428–5434.62. Roperto S, Comazzi S, Ciusani E, Paolini F, Borzacchiello G, et al. (2011)

Peripheral blood mononuclear cells are additional sites of productive infection of

bovine papillomavirus type 2. J Gen Virol 92: 1787–1794.63. Marukian S, Jones CT, Andrus L, Evans MJ, Ritola KD, et al. (2008) Cell

culture-produced hepatitis C virus does not infect peripheral blood mononuclearcells. Hepatology 48: 1843–1850.

64. Drummond JE, Shah KV, Saral R, Santos GW, Donnenberg AD (1987) BK

virus specific humoral and cell mediated immunity in allogeneic bone marrow

transplant (BMT) recipients. J Med Virol 23: 331–344.

65. Drummond JE, Shah KV, Donnenberg AD (1985) Cell-mediated immune

responses to BK virus in normal individuals. J Med Virol 17: 237–247.

66. Dorries K, Sbiera S, Drews K, Arendt G, Eggers C, et al. (2003) Association of

human polyomavirus JC with peripheral blood of immunoimpaired and healthy

individuals. J Neurovirol 9 Suppl 1: 81–87.

67. Sirianni MC, Vincenzi L, Topino S, Scala E, Angeloni A, et al. (1997) Human

herpesvirus 8 DNA sequences in CD8+ T cells. J Infect Dis 176: 541.

68. Harrington WJ, Jr., Bagasra O, Sosa CE, Bobroski LE, Baum M, et al. (1996)

Human herpesvirus type 8 DNA sequences in cell-free plasma and mononuclear

cells of Kaposi’s sarcoma patients. J Infect Dis 174: 1101–1105.

69. Boshoff C, Whitby D, Hatziioannou T, Fisher C, van der Walt J, et al. (1995)

Kaposi’s-sarcoma-associated herpesvirus in HIV-negative Kaposi’s sarcoma.

Lancet 345: 1043–1044.

70. Myoung J, Ganem D (2011) Generation of a doxycycline-inducible KSHV

producer cell line of endothelial origin: Maintenance of tight latency with

efficient reactivation upon induction. J Virol Methods 174: 12–21.

71. Bu W, Palmeri D, Krishnan R, Marin R, Aris VM, et al. (2008) Identification of

direct transcriptional targets of the Kaposi’s sarcoma-associated herpesvirus Rta

lytic switch protein by conditional nuclear localization. J Virol 82: 10709–10723.



the rbp-jk binding sites within the rta promoter regulate ......the rbp-jk binding sites within the...

Documents