the origin of the british - the celts

Author: Pablo Fernández Sierra

Tel.: +49 159 0219 6516

Email: [email protected] 23.8.2014 – 16.09.2015

The origin hypothesis of

The Celtic Britain

Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: [email protected]

1

The origin of the Celtic Britain

Index: 1. Where are the British Celts, the Albion, from? 2. Starting considerations

2.1 The Celtic Leather Ship 2.2 Antiquity of the haplogroup and genetic mutation rate 2.3 The Basque are only in the Iberian Peninsula

3. Relationship between Britain, Brittany and Asturias-Cantabria (north Spain)

4. The Roman References of the Albion 5. Archaeological Reference, The Prince of the Albion 6. The Navia Name 7. Celtic city of Coaña 8. Current genetic Mix in the Celtic northern Spain 9. Conclusion


2

1. Where are the British Celts, the Albion from?

Where are the British from?, where are the Albion from?, according to the genetic studies of the Oxford University, from the Professor Bryan Sykes, the main part of the current people of the British Islands are from the north of Spain,… so, how was this possible? Years after the Celtic tribes with steel arms were in the north of Spain, they constructed small ships with wood and leather to cross the sea, fish and commerce. The Celtic population of Ireland came from the north of Galicia, possibly from A Coruña, but first where the Celtic population of England, where they came from?

2. Starting considerations

2.1 Ship Technology of the old Celtic people An important part of every conquering migration per sea are the ships, and the Celtic ships were a leather ship. A description of the Celtic leather ship is found in the text from Cesar: “Bigger units of this ship concept were used too by the Celtic Veneti in current Bretaña (France) in the battle against Cesar and Rome. The Legio cut the rope of the sail, and the Venetos fleet suffered a massive disaster, and the Gaul-Veneti were conquered after the naval battle of the Golf of Quiberon 56 B.C.. (description from Cesar) “ The naval Battle against the Celtic leather ships of the Veneti of Brittany in France:

Caesar.Bellum Gallico. III.13-14 For their ships were built and equipped after this manner. The keels were somewhat flatter than those of our ships, whereby they could more easily encounter the shallows and the ebbing of the tide: the prows were raised very high, and, in like manner the sterns were adapted to the force of the waves and storms [which they were formed to sustain]. The ships were built wholly of oak, and designed to endure any force and violence, whatever; the benches which were made of planks a foot in breadth, were fastened by iron spikes of the thickness of a man's thumb; the anchors were secured fast by iron chains instead of cables, and for sails they used skins and thin dressed leather. These [were used] either through their want of canvas and their ignorance of its application, or for this reason, which is more probable, that they thought that such storms of the ocean, and such violent gales of wind could not be resisted by sails, nor ships of such great burden be conveniently enough managed by them. The encounter of our fleet with these ships' was of such a nature that


3

our fleet excelled in speed alone, and the plying of the oars; other things, considering the nature of the place [and] the violence of the storms, were more suitable and better adapted on their side; for neither could our ships injure theirs with their beaks (so great was their strength), nor on account of their height was a weapon easily cast up to them; and for the same reason they were less readily locked in by rocks. To this was added, that whenever a storm began to rage and they ran before the wind, they both could weather the storm more easily and have to secure in the shallows, and when left by the tide feared nothing from rocks and shelves: the risk of all which things was much to be dreaded by our ships. Caesar, after taking many of their towns, perceiving that so much labor was spent in vain and that the flight of the enemy could not be prevented on the capture of their towns, and that injury could not be done them, he determined to wait for his fleet. As soon as it came up and was first seen by the enemy, about 220 of their ships, fully equipped and appointed with every kind of [naval] implement, sailed forth from the harbor, and drew up opposite to ours; nor did it appear clear to Brutus, who commanded the fleet, or to the tribunes of the soldiers and the centurions, to whom the several ships were assigned, what to do, or what system of tactics to adopt; for they knew that damage could not be done by their beaks; and that, although turrets were built [on their decks], yet the height of the stems of the barbarian ships exceeded these; so that weapons could not be cast up from [our] lower position with sufficient effect, and those cast by the Gauls fell the more forcibly upon us. One thing provided by our men was of great service, [viz.] sharp hooks inserted into and fastened upon poles, of a form not unlike the hooks used in attacking town walls. When the ropes which fastened the sail-yards to the masts were caught by them and pulled, and our vessel vigorously impelled with the oars, they [the ropes] were severed; and when they were cut away, the yards necessarily fell down; so that as all the hope of the Gallic vessels depended on their sails and rigging, upon these being cut away, the entire management of the ships was taken from them at the same time. The rest of the contest depended on courage; in which our men decidedly had the advantage; and the more so, because the whole action was carried on in the sight of Caesar and the entire army; so that no act, a little more valiant than ordinary, could pass unobserved, for all the hills and higher grounds, from which there was a near prospect of the sea were occupied by our army.

Celtic river transport. The Golden Boat from Broighter Hord. I century BC


4

Reconstruction of an ancient Irish currach. Currach made of wicker work and covered with 3 cow hides. It is capable of carrying 10 people

Currach- boat with a wooden frame, over which animal skins or hides were once stretched.Currachs could reach the size of larger -- 15 to 20 metres long and cargo capacity of 5-10 tones and perhaps four to five metres in beam. We know this because in the winter curraghs were often turned upside-down, placed on a low stone foundation wall and lashed down tightly with ropes, to form shelters for the crew. There are many boats-shaped foundations of this size in Britain, especially in Scotland and the northern isles.

The Breogán, a reconstruction of a Celtic leather ship in Galicia, Spain.


5

Archaeology Museum of Castillo de San Antón de A Coruña (Spain), reconstruction: Celtic leather boat of the north of Spain (El Breogán).

Small leather ship in Estaca de Bares Test of a Celtic leather ship in Borna, Spain Reference: “Naves celtas”. Reflexiones en torno a las primeras embarcaciones cubiertas con `piel de buey. Logroño, 2008. 72 p. : il. cor ; 21 cm. ISBN 978‐84‐612‐3902‐3


6

2.2 Antiquity of the haplogroup and genetic mutation rate

The Haplogroup antiquity is in doubt, due to the different mutation rates (reproductive cycles, diseases and mutagens, different haplogroup mutation rates,…), resulting sometimes in huge time differences. Therefore, we are going to leave out the mutation time of the different Haplogroup as an assessment in doubt.

I copy the next references about the Haplogroup antiquity dating conflict: However debate has swung to and fro over the dating of haplogroups. Geneticists in recent years have often used Zhivotovsky’s evolutionary effective dating method for Y-DNA, which adjusts the calculated pedigree (genealogical) mutation rate, since in some populations the latter produced unexpectedly late dates.17L.A. Zhivotovsky et al., The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time, American Journal of Human Genetics, vol. 74 (2004), pp. 50–61; L. A. Zhivotovsky, Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size, Molecular Biology and Evolution, vol. 23, no. 12 (2006), pp. 2268-2270. Unfortunately, this ad-hoc adjustment seems generally misapplied, producing dating estimates two or three times too old. For example Marcin Woźniak and colleagues point out that the pedigree mutation rate for R1a1a1g [M458] is more consistent with the archaeological record for the Slavs.18M. Woźniak et al., Similarities and distinctions in a Y Chromosome gene pool of Western Slavs, American Journal of Physical Anthropology, vol. 142, no. 4 (2010), pp. 540-548. A study of the Caucasus region found that genealogical estimates gave a good fit with the linguistic and archaeological dates, while the evolutionary effective rates fell far outside them.19O. Balanovsky et al., Parallel Evolution of Genes and Languages in the Caucasus Region, Molecular Biology and Evolution, published online ahead of print 13 May 2011. Another approach is directly genealogical. Bothsurnames and Y-DNA haplogroups are passed down in the male line. A group of men with a surname of the same origin should have a common ancestor at the time of surname development. One study found that they mainly did, using a mutation rate similar to the genealogical rather than the evolutionary.20T.E. King and M.A. Jobling, Founders, drift, and infidelity: the relationship between Y chromosome diversity and patrilineal surnames, Molecular Biology and Evolution, vol. 26, no. 5 (May 2009), pp.1093-1102. However, problems with the pedigree rate remain. Dating estimates will vary according to which microsatellite loci are used, since some mutate faster than others. New approaches take this factor into account, but are only very recently reaching publication.21G. B. J. Busby and C. Capelli, Microsatellite choice and Y chromosome variation: attempting to select the best STRs to date human Y chromosome lineages, paper read at the European Human Genetics Conference at Amsterdam May 28 – 31 2011; G. B. J. Busby et. al., The peopling of Europe and the cautionary tale of Y chromosome lineage R-M269, Proceedings of the Royal Society B: Biological Sciences, published online before print, August 24, 2011; C. Burgarella and M. Navascués, Mutation rate estimates for 110 Y-chromosome STRs combining population and father–son pair data,European Journal of Human Genetics, vol. 19 (2011), pp. 70–75; W. Shi et al., A worldwide survey of human male demographic history based on Y-SNP and Y-STR data from the HGDP-CEPH populations, Molecular Biology and Evolution, vol. 27, no. 2 (2010), pp. 385-393. Attempts to calibrate the human mtDNA clock are no less controversial.22B. M. Henn et al., Characterizing the time dependency of human mitochondrial DNA mutation rate estimates, Molecular Biology and Evolution, vol. 26 (2009), no. 1, pp. 217-230; Endicott et al., Evaluating the mitochondrial timescale of human evolution, Trends in Ecology and Evolution vol. 24, no. 9 (2009), pp. 515-521; S. Rosset et al., Maximum-likelihood estimation of site-specific mutation rates in human mitochondrial DNA from partial phylogenetic classification, Genetics, vol. 180 (November 2008), pp. 1511–1524; M.P. Cox,


7

Accuracy of molecular dating with the rho statistic: deviations from coalescent expectations under a range of demographic models, Human Biology, vol. 80, no 4 (2008), pp.335-357; C.D. Millar et al., Mutation and evolutionary rates in Adélie Penguins from the Antarctic, PLoS Genetics vol. 4, no. 10 (October 2008). To cap the confusion, a recent study found substantial variance in sex-specific mutation rates between families,23D.F. Conrad et al., Variation in genome-wide mutation rates within and between human families, Nature Genetics, Published online 12 June 2011 ahead of print.throwing a cloud of doubt over all dating estimates. Summary, man mutation is variable and very affected by “colonization events”, women-mitochondrial mutation rate is higher and more stable, as its expansion: Zhivotovsky LA, Underhill PA, Feldman MW. Within a Y chromosome haplogroup defined by unique event mutations, variation in microsatellites can accumulate due to their rapid mutation. Estimates based on pedigrees for the Y chromosome microsatellite mutation rate are 3 or more times greater than the same estimates from evolutionary considerations. We show by simulation that the haplogroups that survive the stochastic processes of drift and extinction accumulate microsatellite variation at a lower rate than predicted from corresponding pedigree estimates; in particular, under constant the total population size, the accumulated variance is on average 3-to-4 times smaller. The current El R1b1b2 is supposed now to appear between 3000-6000 B.C.

2.3 The R1b in Europe

The first groups of R1b were found in the 2000-3000 b.C. with the bronze expansion from the East with the bulk of the R1a group. These individuals were isolated individuals in every group found. The R1b, dominant haplogroup in Western Europe can be separated in main groups:

• R1b German (R1b1a2a1a1 (M405/S21/U106) (S21 German, especially in northern Germany, and no S28 is in north Germany)),

• The Celtic/Atlantique Europe (including north Spain) (R1b1a2a1a2f (L21/S145),). A descendent is the R1b1a2a1a2f2 (M222 in Ireland)

• R1b1a2a1a2d (S28/U152) Celtic Italy/France/South Germany Celts • DF 27 Basque and Iberian-Mediterranean • the R1b Basque (R1b1c4 (old R1b1a2a2c) (M153) only Basque Land in Spain and

France and R1b1c6 (R1b1a2a2d) 19% of Basque land) and As father of this lanes are:

• The R1b1b2 is probably from Western Turkey. • The R1b1a1 is to the east, the Hazara of Pakistan 32% (mixture with Mongol and

Turk during Ghengis Khan invasion) (Askenazi) (Jazar is Hun-Arian origin) (Hun-o/Hün-nü in Yue, until 93 d.C. attack of China; black Hun due to the mix with Chinese) (The Mongol-C haplogroup occupied the place mixing with the remaining Arian women) (current Kazakhstan is C-haplogroup, the Mongol expansion under Genghis Khan). The last Arian Empire norther of China was the Yua-Yuan/JU-JU/Juan Juan/RuanRuan (now called Rouran) destroyed by Qi and Zhou China in 552 a.C., and allow the expansion of a small subjugated tribe, the Göktürks (Q haplogroup) (Turk origin).

• The R1b1a2a* is in Iran 10%, the Asirian 29%,… • The R1b1a2a1a2 (P312) is the common father of the Atlantic, Ibero, Italo. The

German S21 and the P312 are “son” of the R1b1a2a1a. According to Myres et al(2010) R-P312* is found highest in Iberia and Southern France.


8

• R1b1a2a1a2b (M153) origin of the “Basque” haplogroup and from the Mediterranean of the Iberian Peninsula.

• R1b1a2a1a (L11/S127, L52, L151, P310/S129, P311/S128) Common father of the German and Celtic R1 haplogroup in Europe.

2.3 The Basque are only in the Iberian Peninsula

In opposition to the hypothesis of Oppenheimer, the Basque genomic group, which includes the “M153 T->A 427 ttactgataatgccatattgttttg ttctcagacaccaatggtcct” (R1b1c4 aka M153) is only found in the Iberian Peninsula and Basque land, and mainly in the Basque population. The absence of this Basque genetic mark in the British Islands is proof of the Basque remaining only in the Iberian Peninsula and Basque land in France. As a reference, I copy the next extract:

R1b1c4 aka M153 John McEwan 3rd June 2006 (typo revision 23 October 2006) Background M153 is a SNP that defines subclade R1b1c4 in the ISOGG 2006 http://isogg.org/tree/ISOGG_HapgrpR.html Technical details The SNP was described by Underhill et al (2000) as M153 T->A 427 ttactgataatgccatattgttttg ttctcagacaccaatggtcct Using May 2006 Golden Path and in silico PCR the following sequence was obtained from Yq11.222. Attempts to retrieve it from DbSNP were unsuccessful and it most likely does not have a dbSNP accession. The mutation was manually annotated below. The T allele is ancestral. >chrY:20165716-20166174 459bp TTACTGATAATGCCATATTGTTTTG TTCTCAGACACCAATGGTCCT TTACTGATAATGCCATATTGTTTTGgcttaatatcaggctaagtaaccac agtattctgatttaaaaaaaaacatactagagagcaagtttattgacaaa tctttaggaacttcaggtacagcatatgatttctgaactatgtgtgtaaa taaggttttgtttattcaaatttaacacagggtagtctgtgtatgccttc cgatttgatagctctaataaaacactttaatagtaccatatcaaataaat tttatcatcatcgattttcttcttaatatgaaataacacatatttgtgat ttttctaagagtcaaaatctcaaaaatcattttaggtataaaatataccc cgaaagttttattttattccattttataattaatctgacttggaaagggg aaaaaagctcaaagggtatgtgaaca[t/a]ttcattaagatAGGACCATTGGT GTCTGAGAA Occurrence It was first described by Underhill et al (2000) where it was found in 7 people all Basques. Bosch et al. (2001) described a further derived individual, Flores et al.


9

(2004) 6 individuals, Paracchini et al. (2003) 5 “Latino” individuals, Vallone and Butler (2004) 1 “Caucasian” and Alonso et al. (2005) 18 individuals. In total 38 people have been identified as derived for this SNP to date. Further details are shown in a summary page of R1b SNP papers. Alonso et al. (2005) also tested 5 STR markers and Bosch et al. (2001) 8 STR markers. Unfortunately Alonso et al. (2005) does not provide the haplogroup for individual STR results, but Bosch et al (2001) did, and the modal values they reported are shown below. No difference from the R1b modal was observed. In summary M153 positive or derived individuals have been described in at least 6 studies. It has only been reported in the Iberian Peninsula or in people whose origin was almost certainly descendants from that region. Its STR modal is the same as R1b. Table 1. Modal values of R1b and R1b1c4 (M153) in FTDNA order and convention

haplogroup N DYS393 DYS390 DYS19 DYS391 DYS388 DYS389i DYS392 DYS389ii R1b 13 24 14 11 12 13 13 29 R1b1c4 6 13 24 14 11 12 13 13 29

Another extract:

…to state the irish, welsh, and basque are closely or especially related is not true, as two have their own group-specific SNP, and certain historical regions within wales have unusually high frequency of E3b Hg.. and are not at all related, while the welsh R population does NOT share the basque / irish SNP's.. Basque= R / SNP M153/H102 Ireland(and irish-invaded western scotland) = R SNP M222 Wales = no M153, little M222, pockets of lots of E3b (with conflicting ancestral SNP's it is totally inaccurate.. WRONG... to claim they are more closely related than other R populations..although this claim they are closer genetically to one another would SEEM logical, the current SNP information disproves the claim) "Data obtained by "A Y Chromosome Census of The British Isles" show that the highest levels of E3b were found in areas with a known history of Roman settlement. In addition to Southwell, these include Uttoxeter in the midlands, Dorchester and Faversham in southern England, and towns in Wales, like Llangefni and Llanidloes, where the Romans established forts and mined for gold and lead."…

2.4 How was it possible?, the expansion force

A main drive in the expansion over other human groups are the technological-military supremacy (iron was better, was abundant and cheaper). In this proposal the R1b expansion is recent and due to the Iron use, and the Celtic expansion of the “P312” was due to the improved Iron production technique, the “Celts” (Atlantic/Gaul) used a “mining” system cooking the mud of the marsh of that colder age, and that method was learnt from the Celtic by the German and Rome, and that was a Celtic expansion limit to the south, and the reason behind the lost of the Iron-rich Basque Land. This R1b Expansion was the European equivalent to the Bantu expansion in Africa.


10

3. Relationship between Britain, Brittany and Asturias-Cantabria (northern Spain) Due to the support of the celt from Gaul and Britain the Celtic Asturias and Cantabria resists the Roman pressure until 19 b.B., and there was a close contact until the Middle Age (even an hypothesis of the origin of the initial Hero Pelayo-Pelagius starter of the Spanish “Reconquista is in Britain, other are from Asturias or Visigoth”. After the Galia-France conquer, Cesar and Augusto conquered the remaining Celtic from north of Spain (Asturias and Cantabria), owners of two (Cangas de Narcea and Las Medulas) of the 4 gold mines in Rome Empire between 29 and 19 b..C. As an example of the roman efforts to conquer Asturias and Cantabria:

“Sub occasu pacata erat fere omnis Hispania, nisi quam Pyrenaei desinentis scopulis inhaerentem citerior adluebat Oceanus. Hic duae validissimae gentes, Cantabri et Astures, inmunes imperii agitabant” (Lucio Anneo Floro) Augusto conquered Asturias and Cantabria with 80.000 soldiers: against Cantabria: the Legio IV Macedonica, the Legio I Augusta, the Legio II Augusta, the Legio IX Hispana, the Legio XX Valeria Vitrix (by sea, embarked), and the support of the Ala Augusta, Ala Parthorum, Cohors IV Thracum equitana and Ala II Thracum ciuium Romanorum; against Asturias: Legio VI Vitrix, Legio X Gemina, Legio V Alaudae, Ala II Gallorum and Cohors IV Gallorum. (For comparison: Only 60.000 soldiers were sent to conquer Germania)

4. The Roman and classical references of the Albion in Asturias The roman Gaius Plinius Secundus (Pliny the Elder) name the Albion Celtic tribe in west Asturias (in Asturias: Albiones, cibarcos and egobarros), around Navia river ,Coaña, Pendía,…. In the Albion territory were the cities of Cariaca and Castro de Chao de Samartin too. http://www.parquehistorico.org/historia.php The Greek Ptolomey called in the “Geographic tables” the Navia River as the Albion river. Ptolomey used the Albion name for the British Islands too, and it is the oldest name for the British Islands.

Albion is Albain in Irish Albion is Alban in Welsh Albion is Alba in Scottisch Gaelic for Scotland


11

5. Archaeological Reference, The Prince of the Albion During the Roman times it was wrote a text in stone, recently found near Vegadeo in Asturias (near Coaña and Navia river):

«XP NICER CLUTOSI Ɔ CARIACA PRINCIPIS ALBIONUM AN LXXV HIC S EST»,

Nicer, (son) of Clutoso (of the castro/fortified city) of Cariaca, (of the House) Prince of the Albion, of 75 years old, lies here.

(Another photo: http://www.nicer.es/bitacora/curiosidades/el-nombre-de-nicer/ The Stone is in the http://www.museoarqueologicodeasturias.com/ )

6. The Navia Name Navia is a Celtic word, the same as Navy, and it is related to a navigable river or it is related to a fleet, a Navy. Navigable rivers were common on the coast of Portugal, Spain and France, and the name Navy-Navia was not used to those rivers and places. Navia is navigable 6 km (like Nalón, Miño, Bidasoa, Nervión, río Pas, Deva, Besaya, Eo (cerca de Navia),Eume, Masma, río Grande do Porto, Mandeo, Tambre, Ulla, Verdugo, Lérez,… in north Spain) . Navia has an old Shipbuilding tradition. In the opposite a big fleet, a Navy, can be a good reason to remember a special place with that name. The conquering feet, the conquering Navy of the Albion, with Celtic soldiers from all the north of Spain (Galicia, Asturias and Cantabria) were joined in Navia river around the 500 b.C./VI century B.C., near the important Celtic city of Coaña in the Albion territory in Asturias.


12

7. Celtic city of Coaña The important Celtic city of Coaña (Castro de Coaña) near Navia.

Coaña, a city of the Albion in Asturias. Near Coaña is the “playa del barco” . (beach of the ship)

History of Coaña http://www.parquehistorico.org/historia.php http://www.spain.info/es/que-quieres/arte/monumentos/asturias/castro_de_coana_parque_historico_del_navia.html http://www.spain.info/es/reportajes/parque_historico_del_navia_ha_escogido_ya_su_historia.html

The research of Coaña as a pre-Roman Castro-City before century IV b.C., with coincidence with the iron arrival to the British Islands, and before the “Broch” construction (200-390 b.C.). Reference:

http://www.solociencia.com/noticias/0801/23135903.htm

Using C14 the construction of the Celtic hot spring building is dated in the IV century before Christ, therefore the Castro (Celtic city) is of an earlier time. C14 detection was realized in the Beta Analytics Lab in Florida, USA. The archaeologist Ángel Villa and Alfonso Menendez Granda lead the field works.


13

8. Current genetic Mix in the Celtic northern Spain

Since the Celtic age in the Celtic north Spain (Galicia, Asturias and Cantabria), there was a considerable genetic mix. There was the Roman Conquer, the Suebi in Galicia and the Conquest of the Visigoths (Asturias and Cantabria in 588 a.C.), the short conquer of Galicia per the Muslims, the “Reconquista” beginning in Asturias and Cantabria, the “high population density politic” and “integration” of the Asturias Kingdom. For example, Alfonso II, the first pilgrim to Santiago de Compostela, rescued Christians from the Muslim slavery, increasing the Asturias population, he rescued people from different parts of the Muslim territory, from the Gothic Fields (main Goth population area in Spain in the Visigoth time, in the current “Ribera del Duero”), and even the captured Vikings during the raids to northern Spain were integrated into the Asturias population. The normal genetic mix between regions of a country was already in the XIX century reinforced with an intensive immigration to Asturias from other provinces of Spain as one of the old industrial provinces of Spain (Asturias, Basque Land, Catalonia and Madrid).

9. Conclusion

The British has their main origin in the north Celtic Spain (Galicia, Asturias and Cantabria), the oldest tribe name in England is “the Albion”, a name recorded in Roman times to the Celtic tribes around the Navia river. The name Navia to a river has the only meaning of a reference to a big fleet (as a lot of other rivers in the area are navigable too), and then the Navia river is a probable starting point for a big conquering fleet from the north Spain to the British Islands. And even there is geological evidence of the British and Asturian “Albion” tribe name around the Navia and around the important Celtic fortified city of Coaña.

I leave again the text found on Stone in Asturias (Spain), near Coaña and Navia:

Nicer, (son) of Clutoso (of the fortified city) of Cariaca, Prince of the Albion, of 75 years old, lies here.