the organisation of repetitive dna sequences on human chromosomes with respect to the kinetochore...

Chromosoma (1992) 101:333-341 C H R O M O S O M A �9 Springer-Verlag 1992

The organisation of repetitive D N A sequences on human chromosomes with respect to the kinetochore analysed using a combination of oligonucleotide primers and CREST anticentromere serum

Arthur Mitchell, Peter Jeppesen, Diane Hanratty, and John Gosden

MRC Human Genetics Unit, Western General Hospital, Crewe Road South, Edinburgh EH4 2XU, UK

Received December 27, 1990 / in revised form June 17, 1991 Accepted June 19, 1991 by W.C. Earnshaw

Abstract. The spatial relationship between the families of repetitive DNAs present at the centromeres of human chromosomes and the position of the kinetochore was examined by combining immunocytochemistry with the PRINS oligonucleotide primer extension technique. Het- erochromatic domains were decondensed with 5'-azacytidine to facilitate this study. Using this approach our results clearly show that the alphoid D N A sequences are closely associated with the kinetochore of human chromosomes. Simple-sequence satellite DNAs occupy separate, non-overlapping domains within the centromere. These two major families are separated by a third, relatively low-copy repetitive D N A family, SAU-3A. Pulse-field gel electrophoresis was employed to analyse the centromeric domain of human chromosome no. 9 in more detail and the results although preliminary support the conclusions drawn from the immunocytochemistry/PRINS approach.

Introduction

The centromeric domains of mammalian chromosomes are known to contain families of repeated D N A sequences (Gosden et al. 1975; Vogt 1990). In the mouse, the major and the minor satellite DNAs are present at the centromeres. All of the autosomes contain major satellite D N A sequences, whereas in situ hybridisation data suggest that this may not be the case with the minor satellite (Pietras et al. 1983). The Y chromosome does not contain any major satellite D N A sequences and again it is uncertain whether it contains minor satellite D N A sequences. From the in situ hybridisation studies it is clear that these two families of repeated DNAs occupy separate domains at the centromeres of the mouse chromosomes, with the minor satellite situated closer to the telomere in the acrocentric chromosomes (Joseph et al. 1989) and perhaps closer to the active kinetochore in these chromosomes. The major satellite resides in the

Offprint requests to: A. Mitchell

large domain of heterochromatin at the centromeres of the autosomes and seems to be organised as a single homogeneous array of D N A sequences. Pulse-field gel data have identified blocks of the major satellite in excess of 2000 kb pairs in size (Vissel and Choo 1989). Al- though the long-range organisation of the minor satellite has not been studied in such detail, published data tend to suggest that this also arranged in continuous arrays (Pietras et al. 1983).

In man the organisation of the repetitive D NA families at the centromeres of the chromosomes is more complex than that seen in the mouse. At least four separate families have been identified as residing within this region. The families are the simple-sequence or conventional satellite DNAs, the alphoid and the SAU-3A and HAE3 DNAs (Vogt 1990; Singler 1982; Willard and Waye 1987; Mitchell et al. 1985; Schwarzacher-Robin- son et al. 1988; Agresti et al. 1989; Waye and Willard 1989). The simple-repeat or satellite DNAs are present at the centromeres of some but apparently not all human chromosomes (Gosden et al. 1975). The Y chromosome, for example, contains both satellite 1 and satellite 3 D N A sequences. Chromosome no. 1 contains satellite 2 family members as does chromosome 16 whereas chromosome no. 9 contains members of the satellite 3 DNA family (Gosden et al. 1981). The in situ hybridisation results position these repetitive DNAs at the para-centromeric region within the centromeric domain (Gosden et al. 1981 ; Schwarzacher-Robinson et aL 1988). The alphoid repetitive D N A comprises families of repeats that differ from the conventional satellite DNAs in a number of ways. They are present at the centromeric domains of all the chromosomes in the human genome (Mitchell et al. 1985) and, on the basis of restriction endonuclease digests, chromosome specific profiles can be recognised (Willard and Waye 1987; Beauchamp et al. 1979; Jor- gensen et al. 1986). The SAU3A or fl-satellite DNA sequences and the HAE3 DNAs are restricted to some human chromosomes, notably the centromeric domains of the acrocentric chromosomes (Agresti et al. 1987). In- formation about the long-range organisation of the repeated DNAs at human centromeres is now beginning

334

to emerge. W i t h respect to the a l p h o i d repeats , the evidence ind ica tes t ha t they are o rgan i sed in la rge a r r ays (Wevr ick and W i l l a r d 1989) and do no t a p p e a r to be i n t e r r u p t e d by o the r D N A sequences, e i ther repet i t ive or non- repe t i t i ve in na ture . Some o f the h u m a n c h r o m o - somes con ta in m o r e than one fami ly o f a l p h o i d D N A s . F o r example , Waye et al. (1987) f o u n d tha t c h r o m o s o m e no. 7 con t a ined two separa te famil ies o f a l p h o i d repeats , a l t hough thei r d a t a suggest t ha t these are a r r a n g e d in la rge b locks a n d d o n o t a p p e a r to be in te rspersed wi th each other . Ty le r -Smi th a n d B r o w n (1987) have shown in the case o f the Y c h r o m o s o m e tha t p o l y m o r p h i s m s exist in the long- range s t ruc ture o f the a l p h o i d D N A s , p r e s u m a b l y ref lect ing the evo lu t ion o f these sequences in this c h r o m o s o m e . The long- range o rgan i s a t i on o f the c o n v e n t i o n a l satel l i tes a n d the S A U 3 A a n d H A E 3 families has n o t been well s tudied, a l t h o u g h p r e l i m i n a r y results o f Moyz i s et al. (1987) suggest t ha t the fo rmer m a y occur in large ar rays .

The r e l a t ionsh ip be tween the func t iona l k ine tocho re and the D N A a n d p ro t e in sequences tha t reside wi th in the cen t romer i c d o m a i n s has, unt i l recent ly , r e m a i n e d obscure . Ac t ive k ine tochores con t a in p ro t e ins tha t are an t igenic to sera f rom pa t i en t s exh ib i t ing the C R E S T va r i an t o f s c l e rode rma ( E a r n s h a w and Ro th f i e ld 1985). C R E S T pa t i en t sera have been shown to c o n t a i n ant i - bod ies t h a t reac t wi th three m a j o r h u m a n c h r o m o s o m a l an t igens t e r m e d C E N P - A , C E N P - B , and C E N P - C . These are t h o u g h t to s u r r o u n d the k ine tocho re p la te (P lu ta et al. 1990). Ind i rec t evidence in the m o u s e suggests t ha t the m i n o r satel l i te is close to the k i n e t o c h o r e (Joseph et al. 1989; W o n g and R a t t n e r 1988) a n d in man , s imi lar exper imen t s have led to the conc lus ion tha t the a l p h o i d D N A s are also close to the act ive k i n e t o c h o r e (A le ixandre et al. 1987). In m a n m o r e d i rec t evidence has emerged recent ly f rom the w o r k o f M a s u m o t o et al. (1989). They showed tha t a 17-mer sequence p resen t in a mix o f c loned a lpho id repea t s r eac ted specif ical ly wi th the C E N P - B c h r o m o s o m a l pro te in . This 17-mer is no t f o u n d in all a l p h o i d c loned sequences b u t in te res t ing ly i t is p resen t in some m o u s e m i n o r satel l i te D N A clones.

The a im o f the p resen t s tudy was to examine the r e l a t ionsh ip be tween the repet i t ive D N A s f o u n d wi th in the cen t romer i c d o m a i n s o f some o f the h u m a n c h r o m o - somes and the pos i t i on o f the k i n e t o c h o r e as local ized by i m m u n o f l u o r e s c e n c e us ing C R E S T a u t o i m m u n e sera. To a l low a be t te r analys is to t ake p lace we used 5 ' -azacy- t id ine to decondense the h e t e r o c h r o m a t i c d o m a i n s on cer ta in h u m a n c h r o m o s o m e s (Schmid et al. 1983). The P R I N S p r imer ex tens ion m e t h o d (Koch et al. 1989) was used to loca te the pos i t i on o f specific o l igonuc leo t ides h o m o l o g o u s to the repet i t ive D N A s unde r s tudy, In the case o f c h r o m o s o m e no. 9, pulse- f ie ld gel e lec t rophores i s was a lso e m p l o y e d to charac te r i se the cen t romer i c do- m a i n in m o r e detai l .

Materials and methods

Imrnunofluorescent labelling o f eentromeres. Lymphocyte culture both in the presence and absence of 5'-azacytidine and preparation

of metaphase chromosome spreads were as described elsewhere (Jeppesen et al. 1991). The human chromosomes affected by 5'- azacytidine are chromosomes l, 9, 15 and 16 (i.e. the human chromosomes containing heterochromatin; under the experimental con- ditions used the heterochromatin in the long arm of the human Y chromosome is unaffected by 5'-azacytidine). For localization of kinetochores, indirect immunofluorescence using an autoimmune CREST patient anti-centromere serum as primary antibody was carried out essentially as described (Jeppesen et al. 1991). Slides were incubated for 1 h at room temperature with 40 gl of a 1/100 dilution of CREST serum in KCM containing 10% (v/v) normal rabbit serum. After washing three times with KCM, slides were incubated for 30 min at room temperature with 40 gl of a 1/20 dilution of fluorescein isothiocyanate (FITC)-conjugated rabbit anti-hm'nan IgG (Dako), also in KCM + 10% normal rabbit serum, then washed three times with KCM and fixed with formaldehyde as described previously. The CREST patient serum was a gift from Prof. G. Nuki, Rheumatology Unit, Northern General Hospital, Edinburgh.

P R I N S reaeton. PRINS (primed in situ) labelling of chromosomes was carried out following the method described by Koch et al. (1989) as modified by Gosden et al. (in press). Essentially, designed oligonucleotides were hybridized to denatured chromosomal DNA and then extended with DNA polymerase with labelled deoxynuc- leoside triphosphates. In the current experiments 300 pmol of each of the oligonucleotides was used, and Bio-11-dUTP [5-[N-(N-bio- tinyl-e-aminocaproyl)-3-aminoally 1]-2'-deoxyuridine 5'-triphosphate] (Sigma) replaced thymidine triphosphate in the nucleoside triphosphate mix allowing detection of the incorporated Bio-tl- dUTP molecules to be made (see below). Native chromosomes were cross-linked with 4% formaldehyde following the CREST reaction (see above). This was an important step to stabilise prepa- rations for the subsequent PRINS reaction. The CREST FITC signal was stable for several weeks when chromosomes were fixed in this manner. However it was found necessary to partially reverse formaldehyde cross-linking immediately before the PRINS reaction in order to enhance the PRINS signal. The slide containing the chromosomes was dipped into 0.1 M NaOH for a time determined

b y the oligonucleotide used (see below). Following this treatment it was also found necessary to remove some of the basic histones to optimise the PRINS reaction. Presumably the histones prevent access of the polymerase enzyme to the underlying DNA sequences. Therefore, after the alkaline treatment, we dipped the slide briefly into 0.01 M Tris pH 7.4 and then 3:1 methanol:acetic acid for 2 min. The latter step was repeated twice before the slides were air dried.

The oligonucleotides used in these experiments were prepared using the Applied Biosystems DNA Synthesizer Model 381A, and they represented members of the alphoid, the simple-sequence sateI- lite 3 DNA family and the SAU-3A family (we will use the original classification of Agresti et al. 1987 rather than nomenclature suggested by Waye and Willard 1989). Oligonucleotides nos. 405 and 407 with sequences of AAAGAAGCTTTCTGAGAAACTG- CTTAGTGT and GTATCCTAAAAACTTAATTTGTGATGT- GTGCA respectively represented conserved regions of alphoid clones taken from published data (Mitchell et al. 1985; Koch et al. 1989). Oligonucleotides nos. 266 and 267 represent the simple-sequence satellite 3 DNA family with sequences of (CCATT), where n=7 and CCATTCCATTGGGGTTGATTCCACTCCATCC- CATT respectively. Both were derived from the sequence of a sub- clone of Lambda 6 (Mitchell et al. 1986; A. Mitchell unpublished), the latter oligonucleotide being a diverged repeat of the pentamer CCATT. Oligonucleotides nos. 435, 527 and 561 were from the published data of Waye and Willard (1989). Oligonucleotide 435 was derived from the consensus sequence, the others were from a diverged region within this family (see the table in Waye and Willard 1989). Oligonucleotide 435 had the sequence AGTGCAGAGATATGTCACAATGCCCC, 527 was TCCAA- AGCCCATGTAGGCCGAGCCAAGACAAGAGT and 561 was GTACTAATGTCCCATGTAGTCACTGCCTAGACAAG.

335

For the PRINS reaction the slides had a brief alkaline treatment as outlined above. The alphoid oligo nucleotides gave the best results after a 30 s alkali treatment, the satellite 3 oligonucleotides required times of 2 to 3 rain whereas in the case of the SAU-3A oligonucleotides a brief period of 15 s was all that was required. The different times may reflect how labile the different sequences are to alkali or how tightly cross-linked they are to the chromosomal proteins. Dipping the slides in the methanol: acetic acid mix alone was not sufficient for a strong PRINS signal.

The Bio-11-dUTP incorporated during the polymerase reaction was visualised using a Texas-Red conjugated avidin complex (Vec- tor Labs). Briefly, the slides were dipped in 4 x SSC, 0.05% Triton X-100. (1 x SSC is 0.15 M NaC1, 0.015 M sodium citrate.) Excess fluid was removed before the above solution plus 5% non-fat milk was used as a blocking agent for 5 rain at room temperature. Excess liquid was shaken off and a 1 : 500 dilution of the Texas-Red conjugated avidin in the blocking solution was added for 30 min at 37 ~ C. The slides were finally washed in the 4 x SSC, 0.05% Triton solution and allowed to air-dry. We did not experience any increase in signal using more layers of the Texas-Red conjugated avidin complex. Finally the chromosomal DNA was stained using Hoechst 33258 at a concentration of 0.5 p.g/ml. Photography was carried out using a Leitz Ortholux-2 microscope utilising filters A, I 2/3 and N2 to detect the fluorescent signal of the Hoechst, FITC and Texas-Red fluorochromes respectively. Kodak T-Max 400 film was used and antifade PBS mountant AF3 (Citiftuor).

Pulse-field gel electrophores&. This was carried out on DNA prepared from a somatic cell hybrid containing a human chromosome no. 9 on a Chinese hamster background. The somatic cell hybrid CF11~4 contains an 9/X translocation (Mohandas et al. 1979). DNA plugs were prepared as described (Bickmore et al. 1989) and stored at 4 ~ C. Electrophoresis was carried out in 0.5 x TBE buffer (TBE is 89 mM Tris-base, 89 mM boric acid, 3.2 mM disodium EDTA adjusted to pH 8.3) at 4~ using 1% agar gels for 60 h at 5.2-V/cm and a pulse time of 70 s. The gels were transferred to Hybond nitrocellulose (Amersham International) using the modified (Wahl et al. 1979) technique of Southern (1975).

Southern hybridization. Hybridization to the pulse-field gel was carried out using the alphoid clone, p82H, (Mitchell et al. 1985) and the simple-sequence satellite 3 clone, Lambda 6 (Mitchell et al. 1986). Both probes were labelled with high specific activity 32p dCTP (Amersham International) by the nick-translation procedure (Rigby et al. 1977) to specific activities in excess of 108 dpm/gg. Prehybridization was in the presence of denatured, sonicated, salm- on sperm DNA (200 Ixg/ml), 4 x SSC, 2x Denhardt (Denhardt 1966) and 0.1% SDS at 68 ~ C. Hybridization in the presence of the radiolabelled, heat denatured probes was for 16 h at 68~ in the same mix. Post-hybridization washes were with 2 x SSC, 0.1% SDS at 68 ~ C. Filters were exposed to Kodak XAR-5 film using intensifiers at --70 ~ C.

Results

The immunof luorescent labelling observed using C R E S T serum on native ch romosomes was the typical pat tern which has been associated with the kinetochore, tha t is, two discrete dots at each centromere (Fig. 1 a). This is true even where he te rochromat ic domains have been decondensed (see ar rows in Fig. 1 b). On some rare occasions the kinetochores are seen to be separated f rom one another (Fig. lc) . Here it can be seen that the C R E S T serum is reacting with antigenic determinants located apparent ly within the decondensed chromat in (arrowed in Fig. 1 d). In other instances (not shown), we noted that the posi t ion o f the k ine tochore (located

by C R E S T serum) varied in posi t ion relative to the decondensed ch romat in in different examples o f the same ch romosome , suggesting to us tha t the k ine tochore is sur rounded by chromat in tha t can be decondensed by 5'-azacytidine. In no case did we see a diffuse signal with CREST.

The P R I N S reaction with ol igonucleotide 405 (al- pho id family) is shown in Fig. 2a. In this par t icular metaphase the major i ty o f the ch romosomes are labelled at their centromeres. The posi t ion o f the k inetochore is shown in Fig. 2b using C R E S T serum on the same metaphase. It is clear tha t the two signals can be super- imposed one on top o f the other. Figure 2c shows the Hoechs t 33258 staining profile for this par t icular recta- phase. A similar result was obta ined with ol igonucleotide 407. Regardless o f the degree o f decondensa t ion o f the sur rounding chromat in the signals f rom the alphoid oligonucleotides were compact , never diffuse, and always coincident with the C R E S T immunof luorescence (arrowed in Fig. 2a).

Figure 3 a shows the results obta ined using oligonucleotide 266 (satellite 3 family) as the probe. The posi t ion o f the k inetochore is shown in Fig. 3 b and in this in- stance the signal f rom the P R I N S react ion using oligonucleotide 266 does no t coincide with the C R E S T signal. In Fig. 3b the fluorescence f rom the P R I N S react ion is s t rong enough to be seen in the F I T C channel. A gap between the k ine tochore and the simple-sequence D N A family is clearly visible (arrowed in Fig. 3a-c) . Staining with Hoechs t 33258 demonst ra tes the decondensed chromat in on the h u m a n no. 9 c h r o m o s o m e (arrowed in Fig. 3c). C h r o m o s o m e 9 was identified using the methyl g r een /DAPI (4', 6-diamidino-2-phenylindole) procedure o f D o n l o n and Magenis (1983) (not shown). A similar result was obta ined using ol igonucleotide 267. A l though bo th simple-sequence oligonucleotides were present t h r o u g h o u t the decondensed chromat in we noted that in some instances Hoechs t 33258 staining suggested that this domain was no t homogeneous (see the non -homogeneous decondensed ch romat in o f c h ro mo - some no. 9 in Fig. I a). Differential decondensa t ion o f this ch romat in suggests tha t the D N A sequence organisation m a y well be more complex than that suggested on the basis o f the ra ther simple ancestral pentameric repeat sequence (Prosser et al. 1986; Gosden et al. in press).

Prel iminary experiments with oligonucleotides 435, 527 and 561 (SAU-3A family) gave differing results when tested on convent ional me thano l : ace t i c acid fixed c h r o m o s o m e preparat ions. Both 435 and 561 labelled the h u m a n acrocentr ic chromosomes , c h r o m s o m e no. 1 infrequently and c h r o m o s o m e no. 9 rarely (unpublished). Oligonucleot ide 527 labelled all o f these ch romosomes. Differences o f this type have been noted by Gos- den et al. (in press). Figure 4 a shows the results obta ined with the P R I N S react ion using ol igonucleotide 527. A no. 9 and a small acrocentr ic c h r o m o s o m e are bo th labelled (arrowed in Fig. 4a). The posi t ion o f the kinetochore as shown by C R E S T is seen in Fig. 4b. Wi th bo th these ch romosomes the signal f rom ol igonucleot ide 527 is close to the C R E S T signal, a l though they do no t su-

336

Fig. 1. a, e The position of the kinetochore in human metaphase chromosomes as defined by CREST serum and detected with fluorescein isothiocyanate (FITC)-labelled second antibody, b, d The same metaphases stained with Hoechst 33258. The a r r o w

points to a chromosome (no. 9) with decondensed centromefic chromatin. Note the different position of the FITC signal relative to the decondensed chromatin. Bar represents 10/am

perimpose suggesting that on these chromosomes this repetitive D N A family occupies a region within the centromere that is also close to, but separate from, the alphoid repeats. Figure 4c shows the Hoechst 33258 staining of the metaphase spread in Fig. 4 a, b (note the decondensed chromatin in the no. 9 chromosome). A similar situation is seen with the acrocentric chromosomes. Figure 5a illustrates this with an acrocentric chromosome (possibly no. 14) using oligonucleotide 527. In Fig. 5b the position in CREST signal is shown and Fig. 5c shows the Hoechst 33258 staining for this particular metaphase spread.

Using the C F l l - 4 cell hybrid we determined (with Hae3) the basic repeat unit for the alphoid D N A sequences of chromosome no. 9. The results (unpublished) show the dimer to be the smallest repeat unit detected. Figure 6 a shows an autoradiograph of a pulse-field gel when the alphoid clone p82H (Mitchell et al. 1985) is

used as the radiolabelled probe to a filter containing C F l l - 4 D N A digested with different restriction enzymes. A complex series of bands up to I Mb in size can be found depending upon the restriction enzyme used. (The sizes shown in this figure are those deter- nfined for the alphoid repeats when CFI1-4 DNA is digested with ScaI; lane 1, Fig. 6 a). The same filter was challenged, after removal of the alphoid label, with the simple-sequence satellite 3 D N A probe (Fig. 6b). One can see with ScaI, for example (lane 1, Fig. 6 a, b), that both repeat families give bands with similar sizes ranging from 27 up to 470 kb. However with Hae3 (lane 2, Fig. 6 a) the alphoid D N A sequences are digested to sizes below the resolution of the gel. In contrast, the simple- sequence satellite DNA probe (lane 2, Fig. 6b) with D N A digested with this enzyme gives a complex series of bands ranging in size from 120 to greater than 470 kb, whereas lanes 3 (PvuI) and 4 (MluI) in Fig. 6a show

337

Fig. 2. a In situ labelling of human metaphase chromosomes using oligonucleotide 405 (alphoid) as a primer in the PRINS reaction. b The position of the kinetochore on the same metaphase as defined by CREST serum (see legend to Fig. 1). c The same metaphase stained with Hoechst 33258. The a r r o w shows a chromosome (possibly no. 9) with decondensed centromeric chromatin and lying clear of the rest of the chromosomes in this spread. Bar represents 10 I.tm

Fig. 3. a In situ labelling of metaphase chromosomes using oligonucleotide 266 (satellite 3) as a primer in the PRINS reaction, b The position of the kinetoehore on the same metaphase as defined by CREST serum (see legend to Fig. 1). e The same metaphase stained with Hoechst 33258. The a r r o w h e a d shows a no. 9 chromosome with decondensed centromeric chromatin. Note that in b the Texas- red signal is strong enough to be seen in the FITC channel and shows a space between the kinetochore and the simple-sequence DNA family. Bar represents 10 ~tm

338

Fig. 4. a In situ labelling of human metaphase chromosomes using oligonucleotide 527 (SAU-3A family) as a primer in the PRINS reaction, b The position of the kinetochore on the same metaphase as defined by CREST serum, c The same metaphase stained with Hoechst 33258. The large arrow points to a no. 9 chromosome with decondensed centromeric chromatin. The small arrow shows an acrocentric chromosome (not identified). In this figure the decondensed chromatin of chromosome no. 9 is overlain by a second chromosome. Bar represents 10 I-tm

Fig. 5a-e. The details are the same as Fig. 4a-c. In this figure an acrocentric chromosome (not identified) is illustrated. Bar represents 10 gm

that bo th enzymes leave the a lphoid D N A sequences in tact bu t cleave the s imple-sequence satellite 3 D N A family in to f ragments of sizes below the reso lu t ion of the gel. This da ta is consis tent with the P R I N S evidence that the a lphoid and satellite 3 D N A repeats occur on different blocks, and are no t interspersed with each other.

339

Fig. 6. a Hybridization of the alphoid clone, p82H, to CFll-4 hybrid DNA digested with the following restriction endonucleases: lane 1, ScaI; 2, Hae3; 3, PvuI, 4, MluI. bAs in a except that after removal of the p82H signal the filter was hybridised with a satellite 3 DNA probe. The molecular sizes are from the alphoid arrays using ScaI digestion and calculated from lambda size markers (not shown)

Discussion

Regardless of the degree of decondensation of centromeric chromatin when cells were grown in the presence of 5'-azacytidine, the kinetochores as located by CREST serum remained as compact structures. This is in agreement with the results of Haaf and Schmid (1990). In some cells it was noted that for a given chromosome, the kinetochore position in relation to the chromosome arms and to decondensed chromatin was different from the majority of examples. One possible explanation for this observation is that the chromosomal proteins recognised by the CREST serum are embedded within chromatin affected by 5'-azacytidine. Interruption of the normal procedure of chromatin condensation at different times during the cell cycle by 5'-azacytidine could lead to a situation where chromatin proximal or distal to these proteins could be decondensed to differing de- grees. This mechanism could lead to the results observed in the present studies. If this is correct then it implies that other D N A sequences outside the domain normally considered to be heterochromatic undergo decondensation when cells are grown in the presence of 5'-azacytidine.

The combination of the PRINS technique with the CREST immunological reaction has proved to be extremely useful in positioning the centromeric repetitive D NA families in relation to the kinetochore and to each other. In this study we found that the alphoid D N A sequences are located in an identical position to the kine-

tochore, as localised by CREST serum. It is, however, still not clear what relationship exists between the centromeric proteins detected by the CREST serum, the alphoid DNAs, and the functional kinetochore. Recent- ly, Masumoto et al. (1989) found that a 17-mer present within some cloned alphoid sequences complexed to the Mr 80,000 CENP-B protein, which is one of the proteins recognised by CREST sera (Pluta et al. 1990). This particular sequence is also present in other cloned alphoid DNAs, for example, the p82H sequence of Mitchell et al. (1985). This result, together with the present data, suggests a tight linkage between the proteins recognised by CREST sera and these repeated D N A sequences. The minor satellite D N A sequence in the mouse genome (Pie- tras et al. 1983) may in some ways be analogous to the alphoid D N A sequences of man in that they too appear to be close to the kinetochore (Joseph et al. 1989; Wong and Rattner 1988). The possibility exists, however, that this may not be the case with all M u s species (Wong et al. 1990). Pluta et al. (1990) now favour the model of the CREST antigenic proteins surrounding the kinetochore plate instead of being an integral component of it. If this indeed turns out to be the case then the alphoid sequences and their associated proteins may play a structural role in supporting the kinetochore plate.

In the chromosomes that contain the SAU-3A DNA sequences our results show clearly that these sequences occupy an area within the centromeric domain that is close to both the alphoid family of D N A sequences and to the chromosomal proteins recognised by CREST. Un- like the result for the alphoid sequences, the SAU-3A PRINS signal does not superimpose exactly on the CREST FITC fluorescence, and does not exhibit a dou- ble dot appearance. Rather, it appears as a condensed region immediately adjacent to the kinetochore as seen in the acrocentric chromosome (cf. Fig. 5 a), and, in the case of chromosome no. 9, between the kinetochore and the satellite 3 domain (see Fig. 4). Earlier work (Waye and Willard 1989) suggested that the SAU-3A sequences were present within the heterochromatin. We would be more precise and place this family on the boundary of what would cytologically be defined as the paracentro- meric heterochromatin between the chromatin containing the alphoid D N A sequences and that containing the simple-sequence satellite DNA. Our data is in close agreement with that of Doneda et al. (1989) who, using a breakpoint within the heterochromatin of chromosome no. 1, were able to order the alphoid and SAU-3A families on this particular chromosome. With the simple- sequence satellite 3 D N A oligonucleotides we show that this family of D N A repeats occupies in most instances the entire decondensed heterochromatin domain on chromosome no. 9. This confirms our previous findings (Mitchell et al. 1986) and extends them by relating the position of this repeated D N A family to the kinetochore. Decondensation of the heterochromatic regions in other chromosomes such as nos. 16 and 1 can be attributed to sequences related to the CCATT pentamer repeat of the simple-sequence satellite 3 D N A family (Prosser et al. 1986). The fact that exposing cells to different

340

agents induces similar responses, i.e. decondensation of heterochromatin, has led us to suggest (Jeppesen et al. 1991) that loss of a protein or proteins may be responsi- ble for this phenomenon. For example, a possible candi- date could be the high mobili ty group I chromosomal proteins ( H G M - I ) known to complex to the minor groove in relatively A + T rich D N A sequences (Reeves and Nissen 1990). This is the region thought to be re- sponsible for the binding properties of netropsin, distamycin A and Hoechst 33258. However, the fact that the P R I N S signals f rom both the alphoid and SAU-3A D N A sequences remain compact regardless of the degree of chromat in decondensation, and that chromosomes containing related D N A sequences, such as the Y chromosome (Haa f et al. 1989), behave differently when cells are subjected to agents giving rise to decondensation of chromatin, imply that more than one group of proteins may be involved.

The sizes of the arrays found with ScaI were similar for both the alphoid and satellite 3 D N A families. On this result alone, therefore, one might argue in favour of interspersion of these two repetitive D N A families. However, the evidence f rom digestion with the other three restriction enzymes strongly argues against D N A sequence interspersion of these two D N A families. PvuI and MluI both cleave the simple-sequence satellite D N A into sizes below the resolution of the gel but leave the alphoid D N A intact. With Hae3 the opposite is true. Here the alphoid D N A sequences are cleaved into fragments below the resolution of the gel whereas the satellite D N A sequences give fragment sizes similar to those found with ScaI. The pulse-field gel experiments using the CF11-4 hybrid cell line therefore support the PRINS evidence that bo th the alphoid and simple-sequence satellite 3 D N A s occupy non-overlapping regions within the centromeric domain of the human no. 9 chromosome. With ScaI the alphoid arrays were similar in size to that found for other human chromosomes (Warbur- ton and Willard 1990).

The results presented here indicate that, where present, the SAU-3A family of D N A sequences separates two large domains containing different families of repetitive DNAs. Agresti et al. (1989) detected the presence of yet another D N A family, the HAE3 family. Their results showed that one recombinant phage contained at least three separate repeated DNAs. Fine degree interspersion of this nature cannot be excluded although our data suggest that, where present, each family occupies on the whole non-overlapping domains. I t remains to be seen whether the organisation implied by the P R I N S technique for chromosomes 1, 9 and the acro- centrics can be applied to the other chromosomes in the human genome. That is, will it be the general rule that D N A families of relatively low copy number repeats exist in separate domains of chromat in containing large arrays of highly repetitive DNAs? I f this turns out to be the case then the complexity of the centromeric domains in mammal ian chromosomes will be greater than hitherto believed.

The ability to order the families of repetitive D N A sequences relative to physical structures such as the kine-

tochore may prove useful in the task of sequencing through centromeric domains in, for example, the human genome mapping project. We also feel that the combination of immunocytochemist ry and the PRINS primer extension procedure will be a fruitful approach in the alignment of other D N A sequences with chromosomal antigens as more examples of the latter become available for research purposes.

Acknowledgements. We thank H. John Evans for critical reading of the manuscript. Doreen Chambers is thanked for making the DNA oligonucleotides used in this study. The photographic depart- ment of the Unit is thanked for the production of the figures.

References

Agresti A, Rainabli G, Lobbiani A, Magnani I, DiLernia R, Mene- veri R, Siccardi AG, Ginelli E (1987) Chromosomal location by in situ hybridization of the human Sau3A family of DNA repeats. Hum Genet 75 : 326-332

Agresti A, Meneveri R, Siccardi AG, Marozzi A, Corneo G, Gaudi S, Ginelli E (1989) Linkage in human heterochromatin between highly divergent Sau3A repeats and a new family of repeated DNA sequences (HaeIII family). J Mol Biol 205:625-631

Aleixandre C, Miller DA, Mitchell AR, Warburton DA, Gersen SL, Disteche C, Miller OJ (1987) p82H identifies sequences at every human centromere. Hum Genet 77 : 46-50

Beauchamp RS, Mitchell AR, Buckland RA, Bostock CJ (1979) Specific arrangements of human satellite III DNA sequences in human chromosomes. Chromosoma 71:153-166

Bickmore WA, Maule JC, van Heyningen V, Porteous DJ (1989) Long-range structure of H-ras 1-selected transgenomes. Somat- ic Cell Mol Genet 15:229 235

Denhardt DT (1966) A membrane filter technique for the detection of complementary DNA. Biochem Biophys Res Commun 23 : 641-646

Doneda L, Ginelli E, Agresti A, Larizza L (1989) In situ hybridization analysis of Interstitial C-heterochromatin in marker chromosomes of two human melanomas. Cancer Res 49:433-438

Donlon TA, Magenis RE (1983) Methyl green is a substitute for distamycin A in the formation of distamcyin A/DAPI C-bands. Hum Genet 65:144-146

Earnshaw WC, Rothfield N (1985) Identification of a family of human centromere proteins using autoimmune sera from pa- tients with scleroderma. Chromosoma 91:313-321

Gosden JR, Mitchell AR, Buckland RA, Clayton RP, Evans HJ (1975) The location of four human satellite DNAs on human chromosomes. Exp Cell Res 92:148-158

Gosden JR, Lawrie SS, Cooke HJ (1981) A cloned repeated DNA sequences in human chromosome heteromorphisms. Cytogenet Cell Genet 29 : 32-39

Haaf T, Schmid M (1990) Kinetochore formation in experimentally undercondensed chromosomes. Hum Genet 84:535-538

Haaf T, Feichtinger W, Guttenbach M, Sanchez L, Muller CR, Schmid M (1989) Berenil-induced undercondensation in human heterochromatin. Cytogenet Cell Genet 50: 2%33

Jeppesen P, Mitchell A, Turner B, Perry P (1992) Antibodies to defined histone epitopes revealed variations in chromatin con- formation and underacetylation of centric heterochromatin in human metaphase chromosomes. Chromosoma 101:322-332

Jorgensen AL, Bostock CJ, Bak AL (1986) Chromosome-specific subfamilies within human alphoid repetitive DNA. J Mol Biol 187:185 196

Joseph A, Mitchell AR, Miller OJ (1989) The organization of the mouse satellite DNA at centromeres. Exp Cell Res 183:494-500

Koch JE, Kolvraa S, Petersen KB, Gregersen N, Bolund L (1989) Oligonucleotide-priming methods for the chromosome-specific

341

labelling of alpha satellite D N A in situ. Chromosoma 98:259- 265

Masumoto H, Masukata H, Muro Y, Nozaki N, Okazaki T (1989) A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol 109:1963-1973

Mitchell AR, Gosden JR, Miller DA (1985) A cloned sequence, p82H, of the alphoid repeated DNA family found at the centromeres of all human chromosome. Chromosoma 92:369 377

Mitchell AR, Ambros P, McBeath S, Chandley AC (1986) Molecu- lar hybridization to meiotic chromosomes in man reveals sequence arrangement on the No 9 chromosome and provides clues to the nature of "parameres". Cytogenet Cell Genet 41 : 89 95

Mohandas T, Sparkes RS, Sparkes MC, Shulkin JD, Toomey KE, Funderburk SJ (1979) Regional localization of human gene loci on chromosome 9 : Studies of somatic cell cell hybrids containing human translocation. Am J Hum Genet 31 : 586-600

Moyzis RK, Albright KL, Bartholdi MF, Cram LS, Deaven LL, Hildebrand CE, Joste NE, Longmire JL, Meyne J, Schwar- zacher-Robinson T (1987) Human chromosome-specific repetitive DNA sequences: Novel markers for genetic analysis. Chro- mosoma 95:375-386

Pietras DF, Bennet KL, Siracusa LD, Woodworth-Gutai M, Chap- man VM, Gross KW, Kane-Hass C, Hastie ND (1983) Con- struction of a small Mus musculus repetitive DNA library: identification of a new satellite sequence in Mus musculus. Nucleic Acids Res 11 : 6965 6983

Pluta AF, Cooke CA, Earnshaw WC (1990) Structure of the human centromere at metaphase. Trends Biochem Sci 15:181 185

Prosser J, Frommer M, Paul C, Vincent PC (1986) Sequence rela- tionships of three human satellite DNAs. J Mol Biol 187:145- 155

Reeves R, Nissen MS (1990) The A.T-DNA-binding domain of mammalian high mobility group I chromosomal proteins. J Biol Chem 265:8573-8582

Rigby PWJ, Dieckmann M, Berg RC (1977) Labelling deoxyribo- nucleic acid to a high specific activity in vitro by nick translation with DNA polymerase I. J Mol Biol 113:237-251

Schmid M, Grunert D, Haaf T, Engel W (1983) A direct demon- stration of somatically paired heterochromatin of human chromosomes. Cytogenet Cell Genet 36:554-561

Schwarzacher-Robinson T, Cram LS, Meyne J, Moyzis RK (1988) Characterization of human heterochromatin by in situ hybrid-

ization with satellite DNA clones. Cytogenet Cell Genet 47:192-196

Singer MF (1982) Highly repetitive sequences in mammalian ge- homes. Int Rev Cytol 76:67-112

Southern EM (1975) Detection of specific sequences among D N A fragments separated by gel electrophoresis. J Mol Biol 98 : 503- 517

Tyler-Smith C, Brown WRA (1987) Structure of the major block of alphoid satellite DNA on the human Y chromosome. J Mol Biol 195 : 457~470

Vissel B, Choo KH (1989) Mouse major (7) satellite D N A is highly conserved and organized into extremely long tandem arrays: implications for recombination between nonhomologous chromosomes. Genomics 5:407-414

Vogt P (1990) Potential genetic functions of tandem repeated DNA sequence blocks in the human genome are based on a highly conserved 'chromatin folding code'. Hum Genet 84:301-336

Wahl GM, Stern M, Stark GR (1979) Efficient transfer of large DNA fragments from agarose gels to diazobenzyloxymethyl- paper and rapid hybridization by using dextran sulphate. Proc Natl Acad Sci USA 76:3683 3687

Warburton PE, Willard HF (1990) Genomic analysis of sequence variation in tandemly repeated DNA. J Mol Biol 216:3-16

Waye JS, Willard HF (1989) Human fl satellite: Genomic organization and sequence definition of a class of highly repetitive tandem DNA. Proc Natl Acad Sci USA 86:6250 6254

Waye JS, England SB, Willard HF (1987) Genomic organization of alpha satellite DNA on human chromosome 7: Evidence for two distinct alphoid domains on a single chromosome. Mol Cell Biol 7 : 349-356

Wevrick R, Willard HF (1989) Long-range organization of tandem arrays of c~ satellite D N A at the centromeres of human chromosomes : High frequency array-length polymorphism and meiotic stability. Proc Natl Acad Sci USA 86 : 9394-9398

Willard HF, Waye JS (1987) Hierarchical order in chromosome- specific human alpha satellite DNA. Trends Genet 3:192-198

Wong AKC, Rattner JB (1988) Sequence organization and cytolog- ical localization of the minor satellite of mouse. Nucleic Acids Res 16:11645-11661

Wong AKC, Biddle FG, Rattner JB (1990) The chromosomal dis- tribution of the major and minor satellite is not conserved in the genus Mus. Chromosoma 99:190 195

the organisation of repetitive dna sequences on human chromosomes with respect to the kinetochore...

Documents