the of biological chemistry vol. 260. no. 9, of may 10, … · the journal of biological chemistry...

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1985 hy The American Society of Biological Chemists, Inc

Vol. 260. No. 9, Issue of May 10, pp. 5580-5587,1985 Printed in U.S.A.

Site-specific Mutagenesis on a Human Initiator Methionine tRNA Gene within a Sequence Conserved in All Eukaryotic Initiator tRNAs and Studies of Its Effects on in Vitro Transcription*

(Received for publication, September 7, 1984)

Harold J. Drabkin and Uttam L. RajBhandary From the Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

We have used oligonucleotide-directed site-specific mutagenesis to generate a mutant human initiator tRNA gene in which the sequence GATCG corresponding to the universal GAUCG found in loop IV of eukaryotic cytoplasmic initiator tRNAs is changed to GTTCG. The mutant tRNA gene has been character- izgd by restriction mapping and by DNA sequencing. We show that this mutation has no effect on in v i tro transcription of the tRNA gene in HeLa cell extracts. Transcripts derived from both the wild type (A54) and the mutant (T54) initiator tRNA genes are processed in vitro to produce mature tRNAs with the correct 5’- and 3”termini. Fingerprint analysis of in vitro transcripts shows that the mutant RNA has the expected nucleotide change. Modified nucleotide composition analyses on the RNAs show that when A54 is changed to U54, the neighboring nucleotide U55 is modified quantitatively to $55 in the in vitro extracts; U54 itself is partially modified to ribo-T. Other modified bases identified in the in v i tro transcripts include m’G, m2G, m7G, D, and mSC.

~ ~~ ~ ~ _ _ _

Two major species of methionine tRNAs are present in all organisms. One of these, the initiator, is used exclusively for initiation of protein synthesis, whereas the other, the elongator, is used for inserting methionine residues a t internal sites in a polypeptide chain (reviewed in Grunberg-Manago and Gros, 1977; Weissbach and Ochoa, 1976; Kozak, 1983). Although both species of methionine tRNAs are aminoacy- lated by the same methionyl-tRNA synthetase, because of their special role initiator tRNAs possess several unique properties which distinguish them from the elongator tRNAs. Thus in eukaryotes the following holds true. 1) Initiator tRNAs form a high specific ternary complex with the initiation factor eIF-2 and GTP. 2) Initiator tRNAs bind directly to the ribosomal “P” site, whereas all other aminoacyl-tRNAs bind to the “A” site. 3) Under normal conditions of protein synthesis, initiator tRNAs are used only for initiation and are excluded from binding to the “A” site on the ribosome and hence from participation in elongation.

Along with these unique properties, all initiator tRNAs possess certain unique sequences and/or structural features not found in most elongator tRNAs. Eukaryotic cytoplasmic

* This work was supported by Grant GM17151 from the National Institutes of Health and by Grant NP114 from the American Cancer Society. During the early phase of this work, H. J. D. was supported by National Research Service Award Grant 1F32 GM 07480 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

initiator tRNAs possess the sequence AUCG’ in loop IV instead of the T$CG found in all other tRNAs (Simsek and RajBhandary, 1972; Simsek et al., 1973; Sprinzl and Gauss, 1984). The extreme conservation of the AUCG among eukaryotic initiator tRNAs suggests that this sequence plays an important role in one or more of the above unique properties of initiator tRNAs.

A direct approach to examine the role of the AUCG sequence in initiator tRNA function would be to generate a mutant tRNA, in which the A of AUCG is changed to U or T, and study the effects of such a change on its properties. Mutants can be generated in two ways, either at the tRNA level or at the level of the tRNA gene. The former approach has been used successfully by Uhlenbeck, Schulman, Grosjean and their co-workers (Uhlenbeck et al., 1982; Schulman et al., 1983; Carbon et al., 1982) to generate mutations in the anti- codon loop of tRNAs. At the tRNA gene level, it is possible to use oligonucleotide-directed site-specific mutagenesis to obtain any desired mutant (Kudo et al., 1981; Temple et al., 1982; Laski et al., 1982). If the mutation has no effects on biosynthesis of the tRNA, the mutant tRNA gene can then be expressed in vivo in order to obtain the desired mutant tRNA (Wallace et al., 1980; Laski et al., 1982).

In this paper, we report on the generation of such a mutation in the human initiator tRNA gene. We show that the mutant tRNA gene is accurately transcribed in a HeLa cell- free extract and that the mutant transcript is processed correctly at both 5‘- and 3“ends. We show further that the presence of U54 in the mutant causes U55 to become modified to $. In addition, some of U54 is modified to ribo-T. The following paper describes the expression and overproduction i n vivo of both the wild type and mutant tRNAs in CV-1 monkey kidney cells.

MATERIALS AND METHODS’

RESULTS

Oligonucleotide-directed Site-specific Mutagenesis of a Hu- man Initiator tRNA Gene-The basic scheme used to generate the A54 to T54 mutation in the human initiator methionine

In all vertebrate initiator tRNAs, the U is not modified, whereas in all plant, starfish, and some other invertebrates, the U is modified to $b.

Portions of this paper (including “Materials and Methods” and Table 1) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are available from the Journal of Biological Chemistry, 9650 Rockville Pike, Bethesda, MD 20814. Request Document No. 84M-2808, cite the authors, and include a check or money order for $2.40 per set of photocopies. Full size photocopies are also included in the microfilm edition of the Journal that is available from Waverly Press.

5580

Site-specific Mutagenesis on a Human Initiator tRNA Gene

FIG. 1. Human initiator tRNA and its gene sequence. Top, cloverleaf model of human initiator tRNA (Gillum et al., 1975) sequence. The vertical arrow indicates the site of the desired A54 +

T54 mutation. Bottom, sequence of the 141-base pair BamHI fragment containing the human initiator tRNA gene (Santos and Zasloff, 1981). Boxed region corresponds to the tRNA sequence. The wauy arrow indicates the putative transcription start site; multiple vertical ar- rows designate the region of transcription termination.

e O H

C A

C - G A - U G - C

p$ :g

5581

G-c G- C

C A C t6A

C A U start I”+

GATCCOGTGAGACCGTGTGCTTGGCAGAA GCAGAGTGGCGCAQCGGAAGCGTGCTGGGCCCATAACCC

termination b C + b b +

AGAGGTCGATGGATCGAAACCATCCTCTGCT GTCCTTTT’TTTTTTTCCCCCCCCGTCTATTTTCCTGAG

Synthetic ol igonudmt ide carrying a mismatch

FIG. 2. Scheme for site-specific mutagenesis of the human initiator tRNA gene using synthetic oligonucleotide, 15 nucleotides long, which contains a single base mismatch at the site of the desired mutation.

MI3 mpf virion DNA carrying coding strand of human tRNA?** ,,/

gene

T C G A T ~ ‘ ’TCGAAAC 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I

~ - TCCAGCTACCTAGCTTTGGTG-

i 31. . . . . . . . . ” 5’ . ; PRIMER TEMPLATE

tRNA gene is shown in Fig. 2. It involves cloning of the tRNA gene into the single-strand phage vector M13mp7 and subse- quent use of the single-strand virion DNA as template for in vitro synthesis of ccc3 DNA (Kudo et al., 1981). A deoxyri- booligonucleotide, 15 nucleotides long, containing a single base mismatch at the A54 position is used as a primer for synthesis of the ccc DNA. After S1 nuclease treatment to remove any DNA molecules containing long single-stranded regions (virion DNA or gapped DNAs containing incompletely elongated DNA molecules), the heteroduplex ccc DNA was purified by agarose gel electrophoresis in the presence of ethidium bromide and was used to transform Escherichia coli JM103 cells. DNA from 90 independent plaques were screened

The abbreviations used are: ccc, covalently closed circular; RF, replicative form.

- ~ ~ _ _

I lionsformotion

of €.cui;

Wild Type Mutant

for the presence of the mutant sequence by hybridization to the mutagenic primer, followed by washing at a successively higher temperature (Wallace et al., 1979; Zoller and Smith, 1982). The single clone which remained hybridized to the mutagenic primer when hybridization to the remaining clones had been washed off was identified as containing the desired mutant sequence (Fig. 3). This conclusion was further con- firmed by restriction analysis of RF DNAs isolated from this clone (loss of Sau3a site (GATC) and gain of an AsuII site (PCGAA)) and finally by DNA sequence analysis. Fig. 4 shows an autoradiograph of a sequencing gel covering the loop IV region of the mutant (T54) and wild type (A54) tRNA genes. Sequence analysis of the entire gene including the 5’- and 3”flanking regions showed no other change in the mutant tRNA gene (data not shown).

5582 Site-specific Mutagenesis o n a Human Initiator tRNA Gene

A54 154 Origin

FIG. 3. Screening of M 1 3 recombinant virion DNAs for the presence of the mutant tRNA gene by hybridization to the mutagenic primer. The temperatures used for washing the nitro- cellulose filter in between autoradiography are indicated. Arrow represents the virion DNA which contains the desired mutation.

T54 G A T C

, A A A C

IG@TC ' A T . C G

I

I

2 3

Xylene cyano1

FIG. 4. DNA-sequencing gel of M13 virion DNAs containing the wild type (A54) and the mutant (T54) human initiator tRNA genes using the dideoxy chain termination method. The circled nucleotide represents the site of mutation.

I n Vitro Transcription of M13 RF DNAs Carrying Mutant and Wild Type Human Initiator tRNA Genes-Our objective in generating the T54 mutation was to use it to isolate a mutant tRNA which carried a specific change within the invariant AUCG' sequence in loop IV of eukaryotic initiator tRNAs. This requires cloning of the mutant tRNA gene in vectors which can be introduced into, and expressed in, mammalian cells. However, the A54 to T54 mutation lies in a region of tRNA genes which is known to effect transcription of tRNA genes in eukaryotes and processing of tRNA precur- sors in both eukaryotes and prokaryotes (reviewed in Hall et al., 1982). Consequently, prior to introducing the mutant and wild type tRNA genes into mammalian cells, we considered it important to investigate whether the mutation had any deleterious effects on either transcription of the mutant tRNA gene or on processing of its transcripts in mammalian cell extracts.

FIG. 5. Autoradiogram of [~+~~P]GTP-labeled RNA transcripts derived from wild type (A54) and mutant (T54) human initiator tRNA genes in a HeLa cell-free system as analyzed on a 10% polyacrylamide gel. Band 1 , primary transcript; bands 2 and 3, matured transcript.

Fig. 5 shows a polyacrylamide gel analysis of a typical transcription of the wild type and mutant tRNA gene using HeLa extracts. Two major transcripts are seen; the predomi- nant one of about 89 nucleotides (band l), which is most likely the primary transcript (see below), and a second smaller species of about 75 nucleotides (band 2), which corresponds to the human initiator tRNA matured at both 5'- and 3'- ends. A third species, designated band 3, has a fingerprint pattern identical to that of band 2 and most likely represents a conformer of the band 2 species. Thus, the T54 mutant tRNA gene is transcriptionally active, and, furthermore, it appears that the mutant transcript is processed in much the same way as the wild type transcript.

TI RNase Fingerprint Analysis of in Vitro Transcripts-To characterize the tRNAs made in the in uitro extract more thoroughly, [a-32P]GTP- or [a-32P]UTP-labeled transcripts were digested with RNase T1, and the digests were analyzed by fingerprinting. A comparison of various fingerprints allows the following conclusions. 1. The fingerprints (Fig. 6) of [a-

Site-specific Mutagenesis on a Human Initiator tRNA Gene 5583

1

2

_""" * CUAG +

AACAG

A 5 4 .Precursor

13

i l

*' a

T54 , Precursor

* e * 16

CUAG UJICG

0 e

FIG. 6. Fingerprint of oligonucleotides present in T1 RNase digests of [~r-~~PIGTP-labeled in vitro transcripts of wild type (A54) and mutant (T54) human initiator tRNA genes.

32P]GTP-labeled precursor RNAs have two oligonucleotides not found in the mature RNAs: AACAG, which is the 5'-end extension, and CUAG, which is derived from the 3'-end extension (see Fig. 1). The spot corresponding to CUAG in the A54 precursor co-migrates with the AUCG present in the A54 transcripts. However, it is clearly seen in digests of T54 precursor, which lacks AUCG. 2. The presence of pAGp in the T1 RNase fingerprints of the [c~-~~P]GTP-labeled mature RNAs (Fig. 6) shows that 5'-end processing is correct in both wild type and mutant transcripts (Fig. 1). 3. Similarly, the presence of CUACCAoH in the T1 RNase fingerprints of [a- :32P]UTP-labeled mature transcripts (Fig. 7) and the absence of CUAG shows that 3'-end processing also occurred correctly in both wild type and mutant transcripts (Fig. 1). 4. Finally, comparison of fingerprints of the mutant (T54) transcripts with those of the corresponding wild type (A54) transcripts shows that the only difference between them is the expected absence of AUCG in the mutant and the presence, instead, of U$CG.

The above results clearly demonstrate ( a ) that both wild type and mutant tRNA genes are transcribed, ( b ) that their transcripts are accurately processed at both 5'- and 3'-ends, and (c) that the mutant transcript has the expected base change.

Modified Base Composition Analysis of the in Vitro Tran- scripts-To investigate which of the possible base modifications are introduced in uitro, the matured transcripts labeled with [a-"PIGTP and [c~-~'P]UTP were completely digested with either T2 RNase or nuclease P1, and the digests were analyzed by two-dimensional thin-layer chromatography (Nishimura, 1972). Fig. 8 shows the results obtained for the mutant transcripts; except where noted, the results for the wild type transcripts are identical.

The cell-free system is capable of introducing several base modifications: m7G, m'G, m2G, D, $, m5C, and ribo-T. Al- though most modifications occur only partially, the modification of U55 to $55 is complete.

5584 Site-specific Mutagenesis on a Human Initiator tRNA Gene

1 A 5 4 , Precursor T54, Precursor

CUAG

AUCG +

\

FIG. 7. Fingerprint of oligonucleotides present in T1 RNase digests of [c~-~~P]UTP-labeled in vitro transcripts of wild type (A54) and mutant (T54) human initiator tRNA genes.

Fig. 8A shows the presence of two modified nucleotides, m’G and m5C, in T2 RNase digests of [ ~ ~ ~ P J G T P - l a b e l e d RNA. (The presence of pAp in the T2 RNase digest is consistent with the fact that the RNA has the mature 5’-end.) Fig. 8B shows a T2 RNase digest of [~x-~~P]UTP-labeled material. Since the sequence UU occurs only once in the RNA, and only in the mutant, the presence of radioactive Up, derived from nearest neighbor transfer, provides further con- firmation on the presence of the mutation. As expected, radioactive Up is not seen in a corresponding digest of [a-32P] UTP-labeled wild type RNA (not shown). Small amounts of radioactivity are found in m7Gp as well as in ribo-Tp. The radioactive ribo-Tp must originate from U54 by nearest neighbor transfer from U55.

Fig. 8, C and D, shows analysis of [cI-~’P]GTP- and [cx-~’P] UTP-labeled transcripts digested with nuclease P1. Since nuclease P1 cleaves RNA to give nucleoside 5’-monophos- phates, all base modifications on G and U can be detected. It can be seen that m7G, m2G, mlG, D, ribo-T, and IC, are made by the cell-free system. While most of the modifications are partial, modification of U55 to 4555 is complete, as evidenced by its intensity (Fig. 80) and by the finding that upon nuclease P1 digestion of the oligonucleotide U$CG present in a T1 RNase digest, virtually all of the radioactivity was in p45.

Similar analysis on precursor RNA species for m7G, T, and I) shows that the precursor species are modified to the same extent as the mature-sized RNAs (data not shown).

DISCUSSION

We have used oligonucleotide-directed site-specific mutagenesis to generate a human initiator tRNA gene in which

the ATCG sequence common to all eukaryotic initiator tRNA genes has been changed to TTCG. The mutant initiator tRNA gene is transcribed, and its transcript is correctly processed at 5’- and 3’-ends in vitro in a HeLa cell extract. Fingerprint analyses show that the mutant transcript differs from the wild type only in having the sequence U+CG in place of AUCG. These results suggested that the mutant initiator tRNA gene would be expressed in vivo to produce the mutant tRNA.

The mutation A54 to T54 lies in a region known to be important for transcription of eukaryotic tRNA genes (reviewed in Hall et al., 1982; see also DeFranco et al., 1980; Hofstetter et al., 1981). In eukaryotic tRNA genes, the pro- moter elements are mostly intragenic and consist of two major blocks of sequences, Box A and Box B, which are mostly conserved. Box A, the 5’-conserved region, has the consensus sequence, TGGCNNAGTNGG, and corresponds to the D stem and loop of tRNAs (Rich and RajBhandary, 1976), whereas Box B, the 3’-conserved region, has the consensus sequence GGTTCGANNCC and corresponds. to the T+CG stem and loop of tRNAs. Mutations within these conserved sequences of Box A and Box B affect transcription (Koski et al., 1980; Allison et al., 1983; Traboni et al., 1984). However, the quantitative effect of a change at a specific position in Box B depends upon the particular tRNA gene under study. These findings have led to the notion that the effect of changes of individual nucleotides within Box B on transcription may be influenced by the overall context in which they appear (Sprague et al., 1980; Dingermann et al., 1982; Cilberto


A.

C

T2 Digestion B.

PI Digestion

D.

FIG. 8. Modified nucleotide composition analyses on mature transcripts of the T54 mutant human initiator tRNA gene. Transcripts were labeled either with [cY-~*P]GTP ( A and C) or with [N-”P]UTP ( B and D ) and analyzed by digestion with T2 RNase (A and B ) or with nuclease P I (C and D) .

et al., 1982; Johnson and Raymond, 1984). Although it is not known whether the same transcriptional factor(s) recognize both initiator and elongator tRNA genes, the effect of context could also explain why all eukaryotic initiator tRNA genes and a Bombyx mori alanine tRNA gene which contain A54 instead of the highly conserved T54 in the consensus are transcriptionally active, and yet the change of T54 to A54 on a proline tRNA gene of Caenorhabditis elegans essentially abolishes its transcription (Traboni et al., 1984).

Our finding that the change of A54 to T54 in the human initiator tRNA gene has little deleterious effect on its transcription is understandable since the mutation increases the homology of the tRNA gene with the Box B consensus sequence.

The finding that the T54 mutant precursor is correctly processed i n vitro to yield mature tRNA implies that the mutation has no major effect on the overall three-dimensional structure of the human initiator tRNA (McClain, 1977; Zas- loff et al., 1982; Allison et al., 1983; Kudo et al., 1981). All tRNAs contain 5 base pairs in the T$CG stem and 7 nucleotides in the T$CG loop (Rich and RajBhandary, 1976). A key tertiary interaction in the T$CG loop of tRNA involves a reversed Hoogsteen base pair between the nucleotide a t position 54 (almost always a T) and position 58 (always A or m’A). I t is possible that a change of A54 to T54 at the beginning of the T$CG loop in the human initiator tRNA facilitates such an interaction. On the other hand, because the human initiator tRNA has A60 at the end of the T$CG loop, unlike other tRNAs which always have a pyrimidine a t position 60, an alternate structure in the mutant involving a Watson-Crick base pair between T54 and A60 is also possible (Jank et al., 1977). Such an alternative structure would extend the T$CG stem t.o 6 base pairs instead of the usual 5 and destabilize the three-dimensional interactions either within

the T$CG loop itself and/or between the T$CG loop and the D loop, crucial for maintaining tRNA structure. The accurate processing of the T54 mutant precursor RNA suggests that under the conditions used for in vitro transcription and processing, the precursor with the “correct” three-dimensional structure predominates over any alternate structure. This is also consistent with the fact that while T54 (or U54) and A60 are rarely ever found in the same tRNA, tRNA”“’ from several mammalian sources does contain U54 and A60 in the T$CG loop (Sprinzl and Gauss, 1984).

Modified nucleoside composition analysis of the in vitro transcript shows that the HeLa cell-free system can introduce most, if not all, of the modifications found in the initiator tRNA. The wild type human initiator tRNA (Gillum et al., 1975) contains seven different modified nucleosides. Since only transcripts labeled with [a-32P]GTP and [a-32P]UTP were used in these analyses, only five out of these seven modified nucleotides could have been detected. All five of these modifications (mlG, m2G, m7G, m5C, and D) were in fact found, although the i n vitro modifications occurred only partially. Basically similar results were reported by Koski and Clarkson (1982), who analyzed transcription of a Xenopus laevis initiator tRNA gene in a homologous cell-free extract.

Two additional modified nucleotides were identified in the T54 mutant. When A54 is changed to U54, the U54 is modified to T54 and U55 is modified to $55. Although modification of U54 to T54 occurs only partially i n vitro, modification of the neighboring U55 to $55 is quantitative. This suggests that lack of modification of U55 to $55 in the human initiator tRNA is most likely due to a stringent requirement of the human pseudouridylating enzyme that the nucleotide adjacent to U55 on the 5’-side be U or T. Although fungal and vertebrate initiator tRNAs all contain U55 in the sequence AUCG in loop IV, plant, protozoan, crustacean, and echinoderm initiator tRNAs contain $ instead of U in the same sequence (Sprinzl and Gauss, 1984). This would suggest either that the latter contain an additional enzyme for pseudouridylation of U55 in initiator tRNAs or that their enzymes have less stringent requirements concerning their nearest neighbor compared to the fungal and vertebrate systems. Parentheti- cally, our finding that the change of a single base in a tRNA gene affects significantly the modification pattern of the tRNA product opens up the possibility of using site-specific mutagenesis and cell-free transcription systems to analyze the substrate requirements for various tRNA-modifying enzymes.

Finally, the successful transcription and processing in vitro of the T54 mutant human initiator tRNA gene in a homologous system suggests that it should be possible to express the tRNA gene i n vivo and isolate mutant tRNA in quantities sufficient for i n vitro functional studies. The following paper (Drabkin and RajBhandary, 1985) describes the expression of the mutant tRNA gene in CV-1 cells.

Acknowledgments-We thank Dr. M. Zasloff for kindly providing us with a clone of the human initiator tRNA gene used in this study and Dr. B. Gentile, a postdoctoral associate in the laboratory of Dr. H. G. Khorana, for synthesis of the oligonucleotide primer used in this work. We also thank M. Esteve of Dr. P. Sharp’s laboratory for providing HeLa cells and M. Marden for careful preparation of the manuscript.

REFERENCES Allison, D. S., Goh, S. H., and Hall, B. D. (1983) Cell 34, 655-664 Beaucage, S. L., and Caruthers, M. H. (1981) Tetrahedron Lett. 22,

Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523 Carbon, R., Haumont, E., De Henau, S., Keith, G., and Grosjean, H.

1859-1862

5586 Site-specific Mutagenesis on a Human Initiator tRNA Gene (1982) Nucleic Acids Res. 1 0 , 3715-3732

Proc. Natl. Acad. Sci. U. S. A. 7 3 , 1195-1199 Cilberto, G., Castagnoli, L., Melton, D. H., and Cortese, R. (1982)

Dagert, M., and Ehrlich, S. D. (1979) Gene 6 , 23-28 DeFranco, D., Schmidt, O., and Soll, D. (1980) Proc. Natl. Acad. Sci.

Dingermann, T., Burke, D. J., Sharp, S., Schaack, J., and SOH, D.

Drabkin, H. J., and RajBhandary, U. L. (1985) J. Biol. Chem. 260,

Gillum, A. M., Roe, B. A,, Anandaraj, M. P. J . S., and RajBhandary,

Grunberg-Manago, M., and Gros, F. (1977) Prog. Nucleic Acid Res.

Hall, B. D., Clarkson, S. G., and Tocchini-Valentini, G. (1982) Cell

Hofstetter, H., Kressman, A., and Birnstiel, M. (1981) Cell 24, 273-

Jank, P., Riesner, D., and Gross, H. J . (1977) Nucleic Acids Res. 5 4 ,

Johnson, J . D., and Raymond, G. J. (1984) J. Biol. Chem. 259,5990-

Johnson, R. A., and Walseth, T. E. (1979) Adu. Cyclic Nucleotide Res.

Koski, R. A,, and Clarkson, S. G. (1982) J. Biol. Chem. 257, 4514-

Koski, R. A., Clarkson, S. G., Kurjan, J., Hall, B. D., and Smith, M.

Kozak, M. (1983) Microbiol. Reu. 47, 1-45 Kudo, I., Leineweber, M., and RajBhandary, U. L. (1981) Proc. Natl.

Laski, F. A., Belagaje, R., RajBhandary, U. L., and Sharp, P. A. (1982)

U. S. A. 77,3365-3368

(1982) J. Biol. Chem. 2 5 7 , 14738-14744

5588-5595

U. L. (1975) Cell 6 , 407-413

Mol. Biol. 20, 209-284

2 9 , 3 - 5

285

2009-2020

5994

10,135-167

4521

(1980) Cell 2 2 , 415-425

Acad. Sci. U. S. A. 78, 4753-4758

Proc. Natl. Acad. Sci. U. S. A. 7 9 , 5813-5817

Mattuchi, M. D., and Caruthers, M. H. (1981) J. Am. Chem. Sac.

Maxam, A. M., and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U. S. A.

McClain, W. (1977) Accts. Chem. Res. 1 0 , 418-424 Messing, J., Crea, R., and Seeburg, P. H. (1981) Nucleic Acids Res.

Nishimura, S. (1972) Prog. Nucleic Acid Res. Mol. Biol. 1 2 , 49-85 Rich, A., and RajBhandary, U. L. (1976) Annu. Reu. Biochem. 4 5 ,

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad.

Santos, T., and Zasloff, M. (1981) Cell 2 3 , 699-709 Schulman, L. H., Pelka, H., and Susani, M. (1983) Nucleic Acids Res.

Silberklane. M.. Gillum. A. M.. and RaiBhandarv. U. L. 11979)

1 0 3 , 3185-3191

74,560-564

9,309-321

805-860

Sci. U. S. A. 7 4 , 5463-5467

11,1439-1455

Methods-Enzymol. 59,'58-109 ' * . . .

Simsek. M.. and RaiBhandarv. U. L. (1972) Biochern. Bio~hvs. Res. " . Commun.' 49, 508-511

L. (1973) Proc. Natl. Acad. Sci. U. S. A. 7 0 , 1041-1045

. . . "

Simsek, M., Ziegenmeyer, J., Heckman, J. E., and RajBhandary, U.

Sprague, K. U., Larson, D., and Morton, D. (1980) Cell 2 2 , 171-178 Sprinzl, M., and Gauss, D. H. (1984) Nucleic Acids Res. 12, rl-r57 Temple, G. F., Dozy, A. M., Roy, K. L., and Kan, Y. W. (1982) Nature

Traboni, C., Ciliberto, G., and Cortese, R. (1984) Cell 3 6 , 179-187 Uhlenbeck, 0. C., Lowary, P. T., and Wittenberg, W. L. (1982) Nucleic

Wallace, R. B., Shaffer, J., Murphy, R. F., Bonner, J., Hirose, T., and

Wallace, R. B., Johnson, P. F., Tanake, S., Schold, M., Itakura, K.,

Weissbach, H., and Ochoa, S. (1976) Annu. Reu. Biochem. 4 5 , 191-

Zasloff, M., Rosenberg, M., and Santos, T. (1982) Nature 300,81-84 Zoller, M. J., and Smith, M. (1982) Nucleic Acids Res. 10,6487-6500

96,537-540

Acids Res. 10, 3341-3352

Itakura, K. (1979) Nucleic Acids Res. 6, 3543-3557

and Abelson, J. (1980) Science 2 0 9 , 1396-1400

216


Materials and Methods

~nlymes: AII restrlcrmn enzymes were Obtalned from elther Bethesda Research

T40NA llgase, and T4 polynucleotlde klnase were purchased from Bethesda Re- Laboratories or New England Blolabs. The large fragment of DNA PolYmeraSe,

S I nuclease was obtalned from Miles Laboratorles. AIuII was from A. DeWaard. search Laboratorles. T1 and T2 RNases. and nuclease P1 were from Calblochem.

Stare Unlverslty of Lelden. Holland.

Labeled and unlabeled nucleotrdes: h3'PI-dTTP, l.32PI-rGTP, and [a32Pl-1UTP were obtalned from amersham. IzSTPI-ATP was syntheslred as described by

were obtalned from P-L Blochemlcals, except ATP, whlch was PYIchaSed from Johnson and Walseth 119791. Unlabeled deoxynvcleotrdes and ribonucleotldes

Sigma.

Vectors and plasmids: The hwnan lnltlator t R N A gene contained 0" a l4lbP BamHI fragment cloned l n r ~ pBR322 was a klnd qlft of M. Zasloff (Santos and Zasloff, 19821. The seqvence IS shown I" flgure 1. The BamHI fragment was

nated H13A54. All 25 of the zndependent recombinants Screened contalned the cloned lntu the B a r n 1 51te Of Ml3mpl I M e s s ~ n g . et al., 1981). and 1 s deslq-

B a n 3 1 fragment I" the same orrentatlon, vlrh the transcribed strand belnq

present on the VirlOn DNA.

Slngle-strand viral DNA was prepared by phenol-chloroform extraction Of polyethylene glycol IPEG1-precrpltated v l r l o n s from one liter cultures, and the further puriEled by alkalrne-sucrose gradlent centrlfugatlon PrlOr to Its use m site-speclfic muragenesxs (Kudo, et 8.1.. 19811.

Plasmld and M13 repllcatlve form I R F ) DNA were routlnely prepared by a scaled-up version of the method descrlbed by Blrnbolm and DOly 119791. followed by ethldlum bromLde/CsCl gradlent centrlfugatlon.

Slte-speciflc mutagenesis on a human lnltlator tRNA gene

Synthenlr of prlmer oligonucleotlde- The pentadeca-deoxyribonUcleotide TCGATCGTTCGMC containing a s lngle base mlsmatch at A54 was Synthesized by

ruthers, 1 9 8 1 ) by B . Gentile. After removal Of protecting groups. the oligo- the phosphoramldlte method IHatteuCci and Caruthers. 1981; Beaucage and Ca-

nucleotide was labeled vlth 32P at ~ t s 5"end and Its sequence was confinned by two-dmensional homochromatoqraphlc analysls of a partlal nuclease el dl- gear (Silberklanq, et al., 19791.

ollgonvcleotide acted as a Specific prlmer for synthesis O f covalently closed clrcular lcccl DNA, wlthln the human tRNA gene insert in MllA54 was Obtained

przmer oligonucleotlde using M13A54 as a template was Carrled out in the In two ways: ill DNA plymerase I catalyzed elongation of 5"32P-labeled

presence or absence of T4DNA 11gase (figure 2 1 . The 32P-DNA wag then treated with E a ~ I and Lhe Elle of 32P-labeled Oligonucleotides released was deter- mined by gel electrophoresis. A major radioactively labeled bands were, as expected, 66 nucleotides I" the absence Of DNA ligase. and 141 nucleotides when DNA llgase was present during Incubation. I21 Use of the same oligonucleotide primer for the dldeoxy-chain termination method Of DNA sequencing Isanger, et al., 19771 gave a readable sequence beginning at the expected re- g lon vlthln the human inltlaror tRNA gene (data not shown).

SpecLficltY of prLmlng- In preliminary experiments. evldence that the

Synthesis Of ccc DNA- Conditions of ccc DNA synthesis were essentially as described In Zoller and Smlrh 119821 with same modifications: Tyo micro-

ylated prrmer I" a volume of 20ul of 20mH Trls HC1 pH 7.5, lolnn MgCI2, 5 0 M

grams (lpmalel Of M13A54 virion DNA were annealed wlth 90 pmles of phosphor-

NaC1. and IM dlthlothrextol. The annealing mixture was heated to l00OC for 90 seconds. quickly cooled to 25OC. and further lncubated at 25OC for 30 mln- U t e s . An equal volume of 2 0 m Trls HC1 pH 7.5. l O M HgC12. l O m H dlthlothrei-

long vlth 10 Unlts of the large fragment of DNA polymerase I , and 2.5 unxts t01. 1mH each of dCTP, dGTP. dATP, and dTTP, and 1mH ATP, was then added, a-

of TI-DNA Ilgale. 40uCl of [?2P)-dTTP was Included as a tracer and the mixture was lncubated at 25OC for 4 hours.

vlth 250mH NaCl. 30mH Na Acetate pH 4.5, 1mM ZnC12, 58 glycerol. 25ug of E.coll tRNA (Boehrlnger Mannhelm). and 0.02 unit of SI nuclease were added. and the mixture was incubated at 37OC for 30 mlnutes. The amount Of carrier, S1 nuclease, and tlme of incvbatlon Was previously deterrnlned to be able

phenal/CHC13 extractron, the DNA In the aqueous layer vas recovered by ethan- to completely d l q e s t 2..g of vlrlon DNA WlthoUt nrcklnq ccc DNA. After

01 preclpltatlan, and electrophoresed I" law meltlng agarose (Bethesda Re- search Laboratorlesl ln the presence of l . q / m l ethldlvrn bromide.

Purlficatlon of ccc DNA- The above reactlon mlxture was diluted 10-fold

The agarose gel slice corresponding to covalently closed circular DNA was exclsed, melted at 65OC. and extracted wlrh an equal volume of phenol Saturated vlth O . I M Trls HC1, pH 8 . 3 . The orqanlc phase and Interphase were extracted twice more wrth phenol. and three times wlth ether. The material recovered after ethanol preclpltatlon in the presence of 5 , ,q of car- rler E.coll t R N A was used for rransformatlon.

ly as descrlbed by Dagert and Ehrllch (19791. After transformatlon, one ml of 2YT media was added, and cells incubated at 37OC far 20 minutes. Phage released during the lncubatlon were separated from cells by a brlef centrlfu- q a t r o n , and plated on JHlO3.

Use of ccc DNA ln transformatlon- Transformatlon of J M 1 0 3 was e s s e n t i a l -

of the phages for the desired mutant was performed by Using the l""ta'3e"ic

primer as a hybridlration probe. as described by Wallace. et a l . 11979). and

by Zoller and Smlth (19821.

screening of the progeny phages for the T54 mutation- Inltlal SCree"l"q

pelleted at 1O.Oooxq for 10 minutes. The phage pellet was dissolved ~n 25 11 of 10- Trxs HC1 pH J . 4 , l O m M NaCl. 1mH EDTA, and 5 - 1 was applled onto a dry n l t r 0 ~ e l l ~ 1 0 ~ e fllter IHllllpore HATFI. The fllter was baked a t 80°C for two hours 9. The fllrer was prehybrldlzed far 30 minutes at 65OC In

0.02% each of bovine serum albumln, polyvinyl pyrolldlne, and Flcalll, 0.1% 6x SSC llx= 0.15M NaCl, 0.0015M Na Cltrate pH7.01. 5x Denhardts Iolutlon ilx=

SDS. and Was then rinsed once in 6x SSC at 25OC.

one ml overnight cultures of phage-lnfected cells from 90 plaques Yere

The fllters were Incubated at 25'C for two hours vlth about I O 6 cpm of 5'-32P-labeled prlmer IspeclfIc dCtlVlry of 3000 Cl/mole, IO7 cpm/.gl In

6x SSC, 5X Denhardts. The filters were then washed tWlce for 5 minutes vlth 50ml of 6 x SSC at 25OC. 3OoC. 37OC. 46OC. and 52OC. vlrh autoradlography at -lOoc wlrh a Dupont Liqhtnlng Plus mtenslfylng screen I" between each wash. It 1s lrnportant that the same fllter be carrled through the washes so that at the various temperatures, any differences I" the lntenslty of hybrtdliatlon signals due to dlfferent amounts of phage DNA rather than single-base mls- matches can be taken into account. Phage which gave strong hybrldlratlon slgnals at 46OC were further analyzed for the presence Of the mutatLon by dlgestlon of the corresponding repllcatlve form DNA by the restrlctlon enzyme AsuII Ithe deslred mutation Introduces an Asull ~ltei M13mp7 has no

&suII s l t e l . and by sequencing of the phage DNA uslng the dideoxy-chaln terminatmq method Isanger, et al, 1977).

In vitro transcription of DNA5 carrylng the mutant or wild type human initiator rRNA genes

DNA. lOvl Hela cell extract prepared according to Koskl , et al. (19801. and The incubation mixture 120;ll contalned 0.2-0.5.9 of M13 recombinant R I

mole), 5mH MgCI2, 8mH creatine phosphate. 20mn ~ e p e s p~ 7.9. and 10mM KCI. 400uM each Of ATP, CTP, and UTP, 403M GTP, 5-10 C1 of 1?2Pl-GTP 1400Ci/m-

Incubations were 2 hours at 30°C. For flnqerprlnr analysls of fll transcripts. the speclflc actlvity was Increased 5-fold, and the IeaCtlOn volume increased 2-fold. Incubations uslng [a32Pl-~TP were essenrlally the

same except that GTP was at 400rM. and UTP was at 40.1M. The reactions then were processed essentially as descrlbed by Koskl, et al. (19801. The E vitro transcr-lpts were analyzed by electrophoresis on 10% polyacrylamide

EDTA, at 500 Volts until the xy lene cyenole marker dye had mlgrared about 26 (acrylamlde: bisacrylmide, 19:11-7M urea in 90mH Tr~s-bordte pH 8 . 3 , 4mM

Cm (cd 15 hours). The transcripts were located by autoradiography. The desired bands were exc16ed. and the RNAs extracted and recovered eesentlally as described in Maxam and Gllbere 119771.

Analysis Of in vitro transcripts

sentially as described by Silberklang, et a l . 119791. Total T2 RNase and TI RNase dlgestlon of RNA and flngerprlnt analy51s were performed e l -

nuclease P1 digestLon was done according to Silberklang. et a l . 119791. and digests analyzed by two-dimensional rhln layer chromatography INIShlmura, 19721.

Table 1 Sequence of ollgonculeatldes present I" flngerprints of TI-RNase digests (Pigs. 6 and 71.

Spot Identity Present rn RNA labeled wlth Z-"P-

coments

or UTp

1 2 3

4

5

6.3

6b

7 8

9 loa lob 11

12 12'

I4 1 3

15

16

17

b

d

G

AG CG

CAG CXAG CUG UCG

UmlG UG bUG AUCG CUAG CCCAUAACCCAG

lililiCCAUCCUCUG m'MCCAUCCUCUG

AACAG

PAGP Um1Gm2G U -CG CUACt!AOH UCCUOH

"CCUUUOH UCCUUO"

UCCUUUUOH

+ +

+ + + +

t -

+ - + + t -

t -

+ - + + + + + + + +

+ I

+ +

+ - t -

t -

+ + - + - + - + - +

U partlally modified to D c partlally modifled to m 5 C

partlally modlfled to m2G

present in A54 only 3'-end of precursor

A58 nor modifled to mlA 5'-end of precursor

partlally resistant to Tl-RNase 5"end of mature tRNA

present I" T54 only 3'-end of mature rwii 3"end of precursor

the of biological chemistry vol. 260. no. 9, of may 10, … · the journal of biological chemistry...

Documents