the most important insight from watson & crick’s structure for dna was that genetic information is...

Download The most important insight from Watson & Crick’s structure for DNA was that genetic information is digitally encoded by lucky happenstance the genetics

If you can't read please download the document

Upload: eustace-lucas

Post on 25-Dec-2015

216 views

Category:

Documents


1 download

TRANSCRIPT

  • Slide 1
  • the most important insight from Watson & Cricks structure for DNA was that genetic information is digitally encoded by lucky happenstance the genetics revolution has coincided with a revolution in our ability to process digital information 1953
  • Slide 2
  • computational algorithms to find and align DNA sequences Smith-Waterman is the ideal; BLAST is faster but less sensitive; the compromises continue with nextgen algorithms (e.g. SOAP) Query 554 TGGGGCTGGCAACAACTGGGCCAAAGGCCACTACACGGAGGGAGCCGAGCTGATCGAGAA 613 ||| || || || ||||||||||| ||||||||||| ||||||||||||||| |||| Sbjct 3095150 TGGAGCCGGGAATAACTGGGCCAAGGGCCACTACACAGAGGGAGCCGAGCTGGTCGACTC 3095091 Query 614 TGTCCTAGAGGTGGTGAGGCACGAGAGT--GAGAGCTGTGACTGCCTGCAGGGCTTCCAG 671 ||||| || ||||||||| | | |||| |||||||||||||| || |||||||||||| Sbjct 3095090 GGTCCTGGATGTGGTGAGG-AAG-GAGTCAGAGAGCTGTGACTGTCTCCAGGGCTTCCAG 3095033 Query 672 ATCG-TCCACTCCCTGGGCGGG-GGCACAGGCTCCGGGATGGGCACTCTGCTCATGAACA 729 | | |||||| ||||| ||| ||||| || |||||||||||||| |||||||| | || Sbjct 3095032 CT-GACCCACTCTCTGGG-GGGCGGCACGGGGTCCGGGATGGGCACCCTGCTCATCAGCA 3094975 Query 730 AGATTAGAGAGGAGTACCCGGACCGGATCATGAATTCCTTCAGCGTCATGCCTTCTCCCA 789 |||| | || |||||||| ||||| |||||||| |||||||||||||||| || |||| Sbjct 3094974 AGATCCGGGAAGAGTACCCAGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCA 3094915 Query 790 AGGTGTCGGACACGGTGGTGGAGCCCTACAACGCGGTTCTGTCTATCCACCAGCTGATTG 849 ||||||| |||||||||||||||||||||||||| || ||| ||||||||||| | | Sbjct 3094914 AGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACCCTCTCTGTCCACCAGCTGGTGG 3094855
  • Slide 3
  • presidential announcement for sequencing of the human genome one year before its publication 26 Jun 2000: Craig Venter, Bill Clinton, Francis Collins CeleraIHGSC
  • Slide 4
  • open access has been official policy since 1996 Bermuda Rules UCSCs browser (US) http://genome.ucsc.edu/cgi-bin/hgTracks?org=human Ensembls contigView (UK) http://www.ensembl.org/Homo_sapiens/Location/View?r=X:151073054 -151383976 NCBIs mapViewer (US) http://www.ncbi.nlm.nih.gov/mapview/maps.cgi?taxid=9606&CHR=X& BEG=151073054&END=151383976 Natures human genome http://www.nature.com/nature/supplements/collections/humangenome/ index.html
  • Slide 5
  • 2001: parameters for shotgun sequencing of the human genome 500-bp sequence read