the journal of no. u. s. a. structure, spatial, and ... · the metallothionein-b genes of the sea...

THE JOURNAL OF BIOLOGICAL CHEMISTRY 8 1991 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 266, No. 10. Issue of April 5, pp. 6586-6593, 1991 Printed in U. S. A.

Structure, Spatial, and Temporal Expression of Two Sea Urchin Metallothionein Genes, SpMTB, and SpMTA*

(Received for publication, October 4, 1990)

Martin Nemer$, Ruth D. Thorntone, Elizabeth W. Stuebing, and Patricia Harlowll From the Institute for Cancer Research, Fox Chase Cancer Center, Philadelphia, Pennsylvania 19111

The metallothionein-B genes of the sea urchin Stron- gylocentrotus purpuratus encode a metallothionein (MT) isoform distinguishable from the MTA isoform. The MTB subfamily consists of at least two genes, MTB, and MTB2, and possibly two to three others. The unique MTBl and MTA genes have a high degree of identity but diverge in structural detail and expression. Transcripts of the MTA, MTB,, troponin C Spec 1, and CyIIIa actin genes begin simultaneously to ac- cumulate at an early blastula stage. MTB, mRNA becomes localized in the embryonic gut and oral ectoderm, whereas MTA, Spec 1, and CyIIIa actin mRNAs are spatially restricted to the aboral ectoderm. Several DNA elements are localized at the same positions in the MTB, and MTA genes: these include respective CATA and TATA boxes, two metal response elements, and three distinct upstream DNA elements that are also present, and in the same order, in the Spec 1 gene promoter. A heptameric sequence, element A, is present at two sites each in the Spec 1 and CyIIIa actin genes, five sites in MTA, but only one site in MTB1. Most strikingly, the first intron of MTA contains elements not found in the MTBl introns, including a consensus metal response element, an element A, and the P3A site demonstrated in the CyIIIa actin gene to be linked to the regulation of spatial expression.

Metallothioneins (MTs)’ are small, cysteine-rich proteins comprised largely of heavy metal-binding domains. Two such domains displaying distinctively characteristic cysteine ar- rangements occupy the two halves of all vertebrate MTs (1- 3), and are oppositely situated in the halves of echinoderm MTs (4), apparently due to the evolutionarily switched posi-

Grants HD-04367 (to M. N.), CA-06927 and RR-05539 to I. C. R. *This investigation was supported by Public Health Service

from the National Institutes of Health and by an appropriation from the Commonwealth of Pennsylvania. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accord- ance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M59822.

$ To whom correspondence should be addressed. 5 Postdoctoral trainee supported by National Cancer Institute

Grant CA-09035. Present address: Cardeza Foundation for Hemato- logical Research, Thomas Jefferson University, Philadelphia, PA 19107.

ll Postdoctoral trainee supported by Public Health Service grant CA-09035 from the National Cancer Institute. Present address: DU- pont C. R. & D., Experimental Station E328, Wilmington, DE 19880- 0328.

’ The abbreviations used are: MTs, metallothioneins; MRE, metal response element; kb, kilobase(s); bp, base pair(s); PCR, polymerase chain reaction; UTR, untranslated.

tions of their encoding exons (5). A multiplicity of MT isoforms have been observed in different organisms, ranging from two in the mouse (6) to an array in humans, that are encoded by 14 MT genes (7, 8). Whereas M T isoforms may differ sufficiently to have potentially distinct metal-binding properties (9), distinct functionalities have actually not been demonstrated.

The ubiquitous expression of certain MT genes, such as human MTIA and MTIIa (7, 8, 10) has led to the view that the MTs perform a housekeeping function. Nevertheless, some M T genes appear to be histospecifically restricted in their expression (9, 11-13). In certain cases the restricted expression has been attributed to DNA methylation (9, 11, 14), thus offering a potential mechanism for developmental switching (9). Whereas M T genes are primarily activated through highly conserved metal response elements (MREs) (see Ref. 5), their activities may also be linked to other gene activities through common DNA elements, such as glucocor- ticoid response elements and G boxes (15), and a variety of sites for transcription factors (16), such as Spl, AP-1, or NF- 1 (8, 17). Such linkages of M T genes might also involve various histospecific sets of genes.

M T gene expression in Strongylocentrotus purpuratus was shown to be developmentally regulated and to differ in tissue fractions: 0.7-kb MTA mRNA was expressed exclusively in a fraction containing the ectodermal tissues, whereas 0.9-kb MTB mRNA was detected in both ectodermal and endomesodermal fractions (12, 18). While in situ hybridization of a general MT-coding region probe was detected principally in the aboral ectoderm of uninduced embryos (19) whose M T RNA was predominantly MTA, it was not possible until the present study, using a specific MTA probe, to conclude that MTA mRNA expression is restricted to the aboral ectoderm in uninduced embryos and also in embryos induced with heavy metal ions. MTA is thus a member of the histospecific set of several genes that are expressed in this tissue, which includes Spec 1 (20), CyIIIa actin (21), Spec 2 (22), and arylsulfatase (23, 24). Without the in situ utilization of unique MTB genic probes, the contrastingly ubiquitous distribution of 0.9-kb MTB mRNA among tissue fractions (18) could not be further resolved as the expression of a single gene uersus the composite expression of a MTB subfamily of genes. We have now isolated a gene designated MTB, that differs from a previously described MTB cDNA (18) but encodes the same MTB isoform. We have used this gene to develop a unique MTB1 probe to monitor the spatial expression of its encoded mRNA unambiguously. The structure and sequence of the MTBl gene was determined and compared extensively with the previously sequenced MTA gene (GenBank accession no. 30606), in order to establish a basis for evaluating their contrasting patterns of expression.

6586

Sea Urchin Metallothionein Gene Structure and Expression 6587

EXPERIMENTAL PROCEDURES

Embryos and Embryo RNA-Embryos of S. purpuratus were cul- tured in synthetic seawater ( E ) , and pluteus larvae were either fixed with 1% glutaraldehyde for in situ studies (19) or fractionated into ectodermal and endomesodermal tissue fractions (25). Total RNA was extracted from embryos or tissue fractions (12).

Isolation of the Metallothionein-B1 Clone from an S. purpuratus Genomic DNA Library and Its Sequencing-A genomic library was prepared from the sperm DNA of one S. purpuratus male (5). The unamplified library of 1.1 X IO6 plaques yielded 65 clones that hybridized with a probe consisting of the entire coding region of the SpMTA cDNA (4). Twelve of these clones hybridized with probes both for the 5' and 3' regions of a MTB cDNA (18). One of these, XMT144, was further characterized by restriction mapping and sequencing. A HindIII 2.4-kb fragment hybridized to the 5'-MTB region probe, while a HindIII-PstI 1.6-kb fragment hybridized to the 3' region probe (Fig. 1). These fragments were subcloned in pUC18 or pUC19 vectors and sequenced by a modified chain termination procedure (18), using primer oligonucleotides, which hybridized to sequences immediately adjacent to the multilinker site in pUC or to previously determined MT genomic sequences. Problems caused by the secondary structures of G-rich sequences with T7-DNA polymerase were overcome and sequenced through the addition of single- stranded DNA-binding protein (U. s. Biochemical Corp.) at a concentration of 5.0 pg/1.5 pg of single-stranded DNA in a reaction volume of 4.5 pl (26). Nucleotide sequences were analyzed using VAX computer programs (27).

Probes for Hybridization-Labeled probes were either DNA or anti- sense RNA, prepared with templates generated by the polymerase chain reaction (PCR) (28), utilizing oligonucleotides that served as upstream (u) and downstream (d) brackets of regions corresponding to the following probe segments: MT coding region probe spanned u = 8-30 to d = 176-190 of essentially the entire coding region of the MTA cDNA (4); 3'-MTA probe spanned u = 2565-2588 to d = 2830- 2855 of the 3'-untranslated region (3"UTR) of the MTA gene (Fig. 2; numbering corresponds to the MTB, gene); 3'-MTB probe spanned u = 2713-2733 to d = 2864-2885 of the 3'-UTR of the MTB, gene (Fig. 2); 5'-MTB, leader probe spanned u = 2-22 to d = 82-103 of the-MTB, gene (Fig. 2).

To DreDare "'P-labeled. sinele-stranded DNA Drobes, 20 ng of a given PCR-generated segment and 100 pmol of its downstream- bracketing oligonucleotide were incubated with ["'PIdCTP (800 Ci/ mmol, Du Pont-New England Nuclear) together with 20 FM each of dTTP, dGTP, and dATP and 2.5 units of Taq polymerase (Perkin- Elmer Cetus) in 100 pl through 20 cycles (1 cycle = 2 min at 92 "C, 2 min at 45 "C, 2 min at 72 "C). Probes were purified by phenol extraction, ethanol precipitation, and Bio-Gel A1.5 gel-filtration chromatography. Specific activities of probes were 210' dpm/pg DNA. In addition, nick-translated DNA probes were prepared at similar specific activities from mixtures of cDNA clones. These mixtures consisted of MTA cDNA (4) together with either Spec 1 cDNA (described in Ref. 29) or CyIIIa actin (described in Ref. 30 as Spec 4).

Alternatively, the PCR segments were utilized as templates to generate derivative DNA segments with an SP6 promoter sequence attached. The PCR segment was used as a template with the original upstream oligonucleotide and with a downstream oligonucleotide

ATTTAGGTGACACTATAGAATAG3'. This approach was analo- modified by the addition of the promoter for SP6 polymerase, 5'

L I

FIG. 1. Sequencing strategy. The SpMTB, gene, with its 5' region on the right, is represented in 100-bp segments and shown with several markers: the transcription start site (+l), as ascertained below (Fig. 3 ) , the four exons (in boxes), and the restriction sites, HindIII ( H ) , HinfI (Hf), HincII ( H c ) , PstI ( P ) , ScaI ( S c ) , SphI (Sp), XhoI ( X ) , XbaI (Xb). In addition, EcoRI sites were located 1.3 kb further 5' and 3 kb further 3'. Line lengths are proportional to the extent of sequencing of individual regions and arrowheads indicate their orientation.

gous to the reported inclusion of a T7 promoter sequence in one of the primer oligonucleotides (31). In this case 200 ng of template were incubated under the same conditions as above, except that 20 pM dCTP replaced the labeled dCTP, and 100 nmol of each bracketing oligonucleotide were used for 50 of the above cycles. To generate an anti-sense RNA probe, 100-200 ng of the PCR segment containing a terminal SP6 promoter were incubated with 100-200 pmol of labeled UTP, 7 nmol each of unlabeled ATP, CTP, and GTP, and 2.5 units of SP6 polymerase under conditions specified by the manufacturer (Promega). The labeled probes were purified as above. UTP was labeled with '*P (410 Ci/mmol, Amersham Corp.), 3H (40 Ci/mmol, ICN), or 3sS (1,320 Ci/mmol, Du Pont-New England Nuclear). The 35S-labeled probes were maintained in 10-100 mM dithiothreitol throughout the procedure.

Southern and Northern Blot Analyses-Genomic DNA prepared from sperm of individual males (32) was digested to completion with restriction endonucleases and electrophoresed on 0.7% agarose gels prior to blotting onto nylon (Hybond) filters (33). RNA was electrophoresed in 1.2% agarose gels in formaldehyde (34) and blotted onto nylon filters. In each case the filters were baked in uacuo, incubated in prehybridization medium, then hybridized with DNA or anti-sense RNA probes bearing a total of 1-5 X lo7 dpm 32P (18). Northern blots were washed either in 1 X SSC (standard sodium citrate) at 55 "C (low stringency) or in 0.3 x SSC at 65 "C (high stringency), and Southern blots in either 0.5 X SSC at 50 "C (low stringency) or 0.3 X SSC at 65 "C (high stringency).

Quantification of mRNAs-The fraction of the transcripts of the MTB subfamily that was MTB, was measured by comparing the amount of hybridization using the specific 5'-MTB1 probe with that using the 3'-MTB probe, the latter representing the entire MTB subfamily. These probes could be expected to hybridize with similar efficiencies, since their respective %CG, 35 and 34%, and size differences, 103 and 173 nucleotides, predict a difference of <3 "C in the T,,, of their RNA-RNA duplexes (35, 36). Quantification of hybrids was by direct measurement of radioactivity in the RNA band cut from the Northern blot. The developmental time course of change in absolute amounts of MTA transcripts/embryo was determined by hybridizing mixtures of probes for MT and either CyIIIa actin (30) or Spec 1 (29), nick-translated to the same specific activity, as described above. The distinct 0.7-kb MTA and 1.5-kb Spec 1 or 1.8- kb CyIIIa actin RNA bands in each lane of a developmental Northern blot were quantified by microdensitometry. The number of molecules/ embryo of MTA mRNA was calculated from the value for CyIIIa actin mRNA of 0.9 X lo5 transcripts/20-h blastula, obtained by Lee et al. (37). In turn, the abundance of MTB transcripts was estimated on the basis of previous measurements that placed their level at 10% of the MTA RNA level (18). An estimation of the number of specific MTB, transcripts was made from its calculated fraction of the MTB subfamily of transcripts. The developmental profile of MTB, mRNA was determined by hybridization of the specific 5'-MTBI probe to RNA slot blots.

In Situ Hybridization with Specific MTA and MTB, Probes- Sections of paraffin-embedded, glutaraldehyde-fixed pluteus larvae, which had been incubated for 4 h with or without 0.5 mM cadmium acetate, were treated essentially as described by Angerer et al. (191, except as modified by Wilkinson et al. (38), by changing treatment with proteinase K to 20 pg/ml for 10 min at 22 "C. The sections on slides were incubated under siliconized coverslips in 50% formamide, 5 X SSC, 1 X Denhardt, 10% dextran sulfate together with probe in a volume of 80 pl at 50 "C for 16 h. Slides were washed extensively in 5 X SSC at 50 "C, in 5 X SSC with 50% formamide at 37 "C, then at the indicated stringency wash prior to treatment with RNase A (20 pg/ml at 37 "C). The 280-nucleotide MTA 3'-UTR probe, labeled with 3H (4 X lo7 dpm/pg), was used at 0.4 pg/ml. The stringency wash for the MTA 3'-UTR probe was 0.25 X SSC, 35% formamide at 37 "C. Slides were overlaid with Kodak NTB2 photographic emulsion and exposed for 7 weeks before developing. A "H-labeled, MTB 3'-UTR probe was similarly prepared and utilized under similar conditions. Since MTB, RNA was substantially lower in abundance, the 103-nucleotide, "S-labeled 5'-MTB, leader probe was labeled with 35S (8 X 10' dpm/pg) and used at 0.5 pg/ml. The slides in this case were kept in 100 mM dithiothreitol, except for the RNase digestion step, and the stringency wash was 2 X SSC and 35% formamide at 60 "C. Slides were developed after 4 weeks of exposure to photographic emulsion.

SI Nuclease Protection Analysis of RNA-A 0.95-kb HindIII-XhoI fragment in the proximal 5'-flanking region of XMT144 (Fig. 1) was end-labeled with [y-3'P]ATP using T4 polynucleotide kinase (U. S.

6588 Sea Urchin Metallothionein Gene Structure and Expression Biochemical Corp.), then digested with Hinfl to produce a 625-bp fragment for SI nuclease protection analysis (39). Total RNA (40 f ig) was hybridized with this denatured, end-labeled DNA fragment, and treated with 50 units of S1 nuclease (Bethesda Research Laboratories) in 300 g1 at 24 "C for 30 min. The mixture was analyzed on an 8 M urea, 7% polyacrylamide sequencing gel. Parallel sequencing reactions performed with the HindIII-XhoI DNA fragment employed an end- labeled 20-base oligonucleotide primer whose 5' end was complemen- tary to, and extended one nucleotide beyond, the XhoI cut site. Thus, the fragment ladder was one base ahead of register with the S1- protected fragments.

RESULTS

Structure and Sequence of the MTB, Gene-The SpMTBl genomic clone XMT144 was identified by hybridization with a 3'-cDNA probe shown previously to detect the 0.9-kb MTB mRNA, but not the 0.7-kb MTA mRNA (18). The sequence (Fig. 2) of MTB1, compared with the previously described MTA and MTBz cDNAs (4,18) and the positions of GT/AG intron junctions revealed a 4-exon structure similar to that of the MTA gene (5). The first three exons contain coding regions, while the fourth exon is entirely noncoding. As in

MTA, the introns of MTB, are larger than those in vertebrate MT genes. The MTB, introns are 736, 764, and 690 bp, compared to 1,120,1,085, and 550 bp for MTA.

S1 nuclease protection experiments indicated a prominent transcription start site (+1) at the A within a 5'TCACC3' sequence, 110-bp 5' of the translation start codon, and minor start sites of diminishing band intensity with increasing distance from the A (Fig. 3). Although a multiplicity of start sites is not unusual among MT genes (similar patterns having been observed for SpMTA (5) and for human MT genes (9) the heterogenity in these assays could be due to either RNA degradation or steric hindrance by the mRNA cap structure. The establishment of the start site enabled us to ascertain that the 110-nucleotide MTB, and the 2105-nucleotide MTB, (18) 5' leader sequences were only 65% identical, diverging at 28 positions, including 14 substitutions, three 1-bp deletions, a 3-bp deletion, and a 12-bp deletion (Fig. 2). Moreover, the MTB2 cDNA contained 10 nucleotides in its 5' leader that were not in the transcribed leader of MTB1, but corresponded to 10 nucleotides immediately 5' of its start site (-1 to -10

C A C C G C G A A ~ A G G T T G T C T ~ G C T C G T G C C ~ A T A C G T G G T ~ T G T T T A C C T I T T T G T ~ A T C T ~ G W \ G T ~ C A ~ ~ ~ C C C G A A T T T ~ A C C M T T T ~ ~ ~ ~ ~ 45 """T""""-C"""""""A"""""""""""""""""-A"-T-A""""T"""""""" """""""- C---C---AG-GTTT

Bmh +I

fDlp -CAG""""""G""""C"TC""- "C" ""

~ ~ ~ t g ~ g c E t t t ~ a t c a t i t t c a g t g a a i c c t a a a a a t ~ a a a p t g c c t c c t a g - t a a t t ~ ~ g g a t t t t t ~ t a c t a ~ a g t i t t t ~ ~ a c ~ ~ & g ~ t t t t a a a ~ ~ ~ t t t a t a ~ a t t c a t a g a ~ a a a a a APpGlyThrCySCysGlyLysCysSerA

t t t t t g g t t t t t t t t t t t g g g g ~ g g g g g ~ t c t g a c a a a a a t ~ t t g ~ ~ a g c ~ ~ a a ~ t a c a g g t c t ~ t a t g ~ t t t q t c a g g g ~ g a t ~ t g a a t t t c a c a t c t c c t a g g t t t t a t t g t t g t t g t c a c c t a t t a a a t t a t t t t a a a a a t c a c t g a t t g t t c a a t t g c t c ~ t g c q t t t t t i t a a t t t c t t i ~ t a c t c t c a i ~ t a ~ ~ t g g g t g c ~ g g c t t ~ ~ a t g t ~ ~ g a c ~ a a a t g g c a ~ ~ g a t t ~ t t t ~ g c t ~ a a t ~ t E a a t ~ t t c t g & t g t a c ~ g g t ~ t ~ ~ ~ t g t t t & t t t t g t t t t t t g t t t

t t t a t t t t t t t t t t t t t t t q g g ~ g g g g g t t g ~ a r t t t t c c a t g t ~ t g ~ ~ t a a a t g a g g g g c ~ ~ ~ g a c ~ ~ a t t g t g c c ~ ~ t t a t ~ t a t c c t g c t g t g t a g t c t a c a t g a a a g a g a a a t g c a g t t a t a c c a a c a a t a q a g t a g a g a c a t t t c a a g c t t a a g g a a a a g g a t g t t ~ a ~ ~ a t a g t t t a a a ~ c a t g t t t a t ~ t c ~ t t t t c c t g g t g a a t t t t g g g t ~ g c ~ a a g t g a a t t g g g c a c a a a t g t g t g c c t g c a c a t a t a t a t a c a t a t a t a t a c a t a t a t a t a t a t a t a t a t a t t t t

t g a t ; t g a t g t t a t E a c t t g g t t t ~ t t t t a t t t g i c c a c a g ~ ~ ~ ~ ~ ~ ~ . &Tw

~ g ~ g a g t t t t t a ~ t a a t g t t c t i g g c t a t a a a ~ a ~ ~ g t t t g c ~ ~ g t c ~ t ~ a t ~ g ~ t ~ t t ~ c ~ ~ g g t t t g ~ ~ q ~ g t a ~ g ~ ~ t g i ~ ~ ~ c g t g c a E t g c a t ~ ~ a t ~ g ~ ~ c t t ~ t g ~ t t t a g ~ t c c i t g t g t c t g a E a t a t c r t t t a ~ c t a g a g g c a a a g t t t t a a t g t g t t a t t t a t g ~ g g g c t ~ t g t t t c a ~ ~ t g t t ~ t t g ~ ~ ~ g a g ~ t g g t ~ ~ a ~ g t t t a g c t t t g ~ t a c t t c t g t t a a g g a a t t g t g t c t a g t t t a a a a a a c t c c t c t c c t g c a t g a a t t t c a t t a g g a c a g c a a c t 9 9 t g c g t a g t a c t t t c a a t t a a a g ~ g a ~ t t ~ t g c t a a t g t t a t ~ t g t a ~ ~ c t a ~ ~ a g a ~ t ~ t g t ~ ~ a ~ t ~ t c c g g a g c g g ~ t c t ~ ~ t a t g ~ a a t g a a a t g g a ~ ~ ~ a t t g t c a a t g a a t c a a t t t g a a t a t t g a t c t a a t g t t c a t t a a a a t ~ t ~ t a a ~ ~ a a g g c c a ~ t t ~ g ~ a a a t c t t t g c ~ ~ g t t ~ t g ~ ~ a a t ~ t g t ~ t a g a ~ ~ t ~ c ~ t g t ~ t t t c a t g a c t t t t g t a t ~ t t t t t t t c a a c a a c c g g a a c a a a t t c a t t g a c t a t t t c t ~ g t t t t c a t g t t t t t t c g t a c a a a t a t t t t

c a a g ~ a t t t t g t t t i t c t c t c c g t & t c t ~ t t t c t i t t c t a c a g ~ ~ ~ A+""

~nAlaAlaCysLysThrCy~AlaAspGlyCysThrCysGlySerGlyCysSerCysThrGluGlyAsnCysProCYsEnd

~ . r u -------------------A-------------------------------------- -----------------------------A----------T-------- yD """""""""-T"""""""""""""""""""""""""""""""""""""""- """"

r a b " n r n u r z i A d a + - & m ' ia"" - - - " "_ - T-- "-G"""- --T-----T------C-G---A----AG---A-------------------------C----A-T---T--------T--------- """"""""""""""""A""- """T""-A""G~""""""""""""""""""""""""""""""""""""""""""""-- ~n.r..".*ria..*"l+cMATrTui """""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""-"---"

"_ """""-CA"T""-T"G"""""T""""""""""""""-~"""~"" """"

-Lenmmn+ - ~ ~ ~ - - = ~ ~ ~ ~ ~ ~ ~ ~ A T T C A ~ T A T G G G T T G ~ T T A T T T T C T ~ T T A T G A T T T ~

"""""""""" --~-------------A------------------------------------------------A--A---------A--- AAAAA _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ CATGTGG--A---C-----G---G-A----------G-----------AR------G-TC----.-------I\--T---------AA--A

FIG. 2. The nucleotide sequence of SpMTBI. Introns (in lowercase letters) were identified by their GT/AG boundaries and exons (in bold, uppercase) were confirmed by alignment with the MTBz cDNA sequence (18). The transcription start site (+I) was ascertained by S1 nuclease protection assay (Fig. 3). Emphasized DNA elements include a CATA box at -27 to -23, MRE sequence a at -46 to -53 and b at -144 to -151, as well as elements shared with the SpMTA and Spec 1 genes, A (-215 to -221), 1 (-316 to -324), 2 (-425 to -431), and 3 (-624 to -631) (Ref. 5). To indicate regions that might serve as discriminating probes or as potential regulatory regions, we have aligned the MTB, gene sequence (first row) with 5"flanking and untranslated, as well as 3'-untranslated, sequences of the MTA gene (5) and MTBz cDNA (18) in the second and third rows, respectively.

1095

1995 2145 2295 2 4 5

2395

2740

2890


A T T 7 C

C A-

C A

0

O A T C 1 2 3 4 5

FIG. 3. Transcription start site determined by S1 nuclease protection. The assay described under "Experimental Procedures" was performed with total RNA from the mesoendodermal (lanes I and 3) or ectodermal (lunes 2 and 4 ) tissue fractions of control (lanes I and 2) or Cd(1I)-induced (lanes 3 and 4 ) pluteus larvae. Lane 5 was tRNA. A 20-base oligonucleotide used in parallel sequencing reactions extended one nucleotide beyond the Hindlll-XhoI DNA fragment (Fig. 1) used to generate the S1-protected fragments, thus accounting for the one base out of register between the SI-protected fragments and the ladder. The illustrated mRNA sequence is the reverse complement of the actual sequence determined.

of MTB,). Thus, the MTB, cDNA would appear to represent the transcript of a different member of the MTB subfamily, rather than an unusually divergent allele of MTB,. The predicted amino acid sequence of MTBI, shown in Fig. 2, is identical to that shown previously (18) to be encoded by the MTB, cDNA but is distinguishable from the previously described MTA isoform (4) through 10 amino acid substitutions and one insertion. Moreover, the encoding nucleotide sequences of MTB, and MTB, differ by only one synonymous nucleotide substitution. The 3'-UTRs (Fig. 2) of the MTB, gene and the MTB, cDNA are 98% identical, differing by only eight substitutions and three deletions, and contain, wholly within the fourth exon, a 92-bp, highly repetitive sequence, absent from MTA and apparently characteristic of an MTB subfamily (18).

The 5"flanking region of MTB, contains two 8-bp elements (at -46 and -144, respectively, in Fig. 2) that are identical to two similarly positioned elements in MTA. These DNA elements are demonstrated MREs in MTA (5) and are likely to have similar MRE functionality in MTBI. While a TATA box is present at position -27 in MTA, this same position in MTB, is occupied by a CATA box. Such distinctions have been noted among human M T genes; e.g the CATA in human MTIa (10) compared to the TATA in hMTIb (11) and hMTIIa (40). However, the rarity of CATA box occurrence is indicated by a survey of 168 eukaryotic genes (41), which showed that 56% contained TATA while only 8% contained CATA. Ap- parently absent from this 0.7-kb upstream region of both genes are G boxes and binding sites for such transcription factors as Spl, AP-1, or NF-1, that might support basal level transcription (8, 15-17). Features of the MTB, and MTA genes are further compared under "Discussion."

The MTA gene (5) is clearly distinguishable in its coding and 3'-UTR sequences from the MTB, gene (Fig. 2) and the MTBz cDNA (18), and in its 5' leader from MTB,; however, the 79-bp leader of MTA is 84% identical to a region of the 5' leader of the MTB, cDNA by virtue of only five substitutions, single deletions of nine and three nucleotides, and two deletions each of one and two nucleotides (Fig. 2). Conse- quently, probes based on the 3'-UTR sequences will not readily distinguish MTBl from MTB, but can distinguish

MTA from MTB genes and transcripts. Conversely, probes based on the 5' leader sequences will be marginally effective in distinguishing MTA from MTB, but readily distinguish MTB, from MTA and MTB,.

Southern blots of genomic DNA from two individuals ( a and b ) hybridized with a general coding region probe revealed nine and six major bands, respectively, as well as three weakly- detected bands for each (Fig. 4). Considering the generally high degree of polymorphism encountered among sea urchin genes (42.43) and the possibility of HindIII or EcoRI sites in the regions of the uncharacterized M T genes spanned by the probes, we estimate an upper limit of six S. purpuratuq M T genes/haploid genome. An MTA 3'-UTR probe detected a single one of these bands in both individuals, thereby estab- lishing this 3'-MTA probe as an unambiguous detector of the unique MTA gene. A probe consisting of the counterpart 3'- UTR region of MTB (derived from MTR,) failed to detect the MTA band, but did detect six and four bands, respectively, in the two individuals, and thus did not distinguish among an apparent MTB-like subclass. The 3' probes thus define a MTB subfamily of genes that comprise the bulk (possibly four members) of the MT gene family. The 4.8-kb band seen in individual a corresponds to the HindIII-EcoRI fragment indicated for MTB, in Fig. 1. A probe from the 5' leader sequence of MTB, detected single restriction fragments not corresponding to bands hybridizing with the 3' probe. In hybridizing to only one band (corresponding to the 2.25-kb HindIII fragment in Fig. 1) in the case of the two individuals of Fig. 4, and of two other individuals not shown, this 5' leader probe proved to be an unambiguous detector of the unique MTB, gene.

Expression of M T B , and MTA mRNAs in Pluteus Tissue Fractions-Two probes derived from the 5' and 3' regions of the MTB, gene, one from the 3'-UTR of the MTA gene, and the other from the coding region were used to elucidate the expression of mRNAs encoded by members of the MT gene family. The coding region probe, detecting transcripb of all M T genes, indicated the global distribution of the 0.7-kb MTA and 0.9-kb MTB mRNAs in the pluteus ectodermal and mesoendodermal tissue fractions (Fig. 5 A ) . The ectoderm expressed predominantly 0.7-kb RNA with some 0.9-kb RNA, whereas the mesoendoderm contained predominantly 0.9-kb RNA and only slightly detectable 0.7-kb RNA. The 3'-MTA probe showed that the 0.7-kb MTA mRNA was exclusively ectodermal. The 3'-MTB probe, which represented a multiplicity of, and probably all, MTB-like genes, indicated that

a b rb 1 2 3 4 1 2 3 4

94 66.

4 4

2.3. 2 0.

14

I 0.

0 9-

FIG. 4. Gel blots of restriction digesta of genomic DNA. Blots of sperm DNA from separate individual adult males ( a and h) . which were digested with Hindlll and KcoHI then electrophoresed, were probed successively with 3'-MTA at high ntringency (lanes I ), R coding region probe (lanes 2). :%'-MTR at low stringency (lanes 3 ) . and 5'-MTR, at high stringency (lanes 4 ) . The same gel blot was used for each successive hybridimtion, except that lane 4 (individual b) was a different blot. Markers are fragments of Hindlll-digented X and HaeIII-digested 6x174.

6590 Sea Urchin Metallothionein Gene Structure and Expression

L FIG. 5. Expression of transcripts of the MTA and MTB,

genes and the MTB subfamily. A, mesoendodermal and ectodermal tissue fractions of pluteus larvae. Total RNA (7 pgllane) was extracted from the ectodermal (lanes 1,3,5, 7,9) or mesoendodermal (lanes 2, 4, 6, 8, IO) tissue fractions of pluteus larvae, which had been incubated in the absence (lanes 1-8) or the presence of 500 p M cadmium acetate (lanes 9 and IO). Northern blots were hybridized a t high stringency with the coding region probe (lanes I and 2 ) . 3’- MTA (lanes 3 and 4 ) , 3’-MTB (lanes 5 and 6 ) , or 5‘-MTBI (lanes 7- IO). The resolved 0.9-kb MTB mRNA and 0.7-kb MTA mRNA have been described previously (18). R, the amount of MTB, mRNA relative to the total MTB-subfamily transcripts. Total RNA (10 pg/ lane) from unfertilized eggs (lanes I and 2 ) . 6-h cleaving embryos (lanes 3 and 4 ) , 20-h mesenchyme blastulae (lanes 5 and 6 ) , and 60- h pluteus larvae (lanes 7 and 8) was hybridized with 5’-MTBl probe (lanes 1, 3, 5, 7) or an equimolar mixture of 5’-MTBI and 3’-MTB probes (lanes 2, 4, 6, 8). The fraction of MTB, mRNA relative to total MTB-subfamily transcript was estimated from incorporations measured directly in each band, corrected for differences in the number of labeled residues in each probe (e.g. MTB, fraction = ( l a n e I ] + [lane 2 - lane I]).

the transcripts of this MTB subset were all 0.9 kb and were expressed in both tissue fractions, but more prominently in the mesoendodermal than ectodermal fraction. The 5’ leader probe of MTB,, representing a single gene, showed that the transcripts of this gene were 0.9 kb and displayed the same tissue distribution as members of the MTB subset as a whole, revealed by the 3’-MTB probe. Heavy metal ion induction increased the expression of MTB, mRNA with a higher level in the ectoderm than mesoendoderm. This tissue distribution was the same as that observed through the use of S1 protection of the 5‘ leader region of the MTBI gene (Fig. 3).

Percentage of MTB Subfamily Transcripts as MTB, rnRNA-The fraction of the MTB subfamily of transcripts represented by MTB, mRNA was determined from the molar ratio of hybridized 5‘-MTB1 and 3’-MTB probes (Fig. 5B). The 3’ probe hybridizes with all members of the MTB subfamily, while the 5’ probe hybridizes only with MTB1. Quantification of bands, hybridized with the 5’ probe (odd numbered lanes), and with both probes (even numbered lanes) revealed a significant developmental change in the percentage of the MTB subfamily represented by MTBI. The value was -5% in the unfertilized egg and cleavage stages (lanes 1-4) but increased to 16 and 18%. respectively, in the mesenchyme blastula and pluteus stages (lanes 5-8). It is apparent that the embryonically synthesized MTB transcripts differ from the maternal population of MTB transcripts insofar as they are enriched in MTBI.

Developmental Time Course of MT mRNA Expression- The levels of the different M T mRNAs were measured during the period of development to the 24-h blastula stage, and compared with those of other RNAs, known to begin their accumulation in the 10-12 h early blastula (30, 44, 45). De-

velopmental Northern blots were hybridized with mixtures of M T coding region and either Spec 1 (Fig. 6A) or CyIIIa actin (Fig. 6B) probes, to obtain the amount of 0.7-kb MTA mRNA relative to either of these other RNAs a t each developmental stage (the 0.9-kb MTB RNA, a t %o the MTA level (181, was not significantly detected in these autoradiograms). Accu- mulation of each of these RNAs began at the 10-12-h blastula stage (Fig. 6C) . We estimated the absolute amounts of the MTA and Spec 1 mRNAs from the value of 0.9 x lo5 of CyIIIa actin transcripts obtained by Lee et al. (37) for the 20-h blastula. On this basis, the MTA mRNA rose from -2 X 10‘ transcripts/egg to -2 x 10” transcripts/20-h blastula. The MTBl transcripts could be estimated to be a t a considerably lower level of abundance: Since the MTB subfamily of transcripts are at I/IO the MTA level (18), and the respective maternal and embryonic MTB, transcripts are a t approximately 5 and 20% of the MTB subfamily transcripts, MTB, mRNA can be estimated a t -10’ transcripts/egg and -lo’/ 20-h blastula. These low levels of abundance precluded direct normalization with high abundance RNAs such as Spec 1 and CyIIIa actin. However, the developmental profile of MTB, mRNA was determined by hybridization of the 5’-MTBI probe with a series of RNA slot blots (Fig. 6C) and the approximate amounts estimated in relationship to total MTB (Fig. 5B) and to MTA mRNA (18). It can be concluded that the accumulation of MTB, and MTA mRNAs begins simultaneously with that of the Spec 1 and CyIIIa actin mRNAs. We have also noted (data not shown) that accumulation of the MTB subfamily transcripts, as gauged by the 3’-MTB probe, also begins at the 10-12-h blastula stage, and when embryos are incubated in a high concentration of ZnSO. (0.5 mM) from 1-h postfertilization on induction of the accumulation of either MTA or MTB mRNA does not become evident until this same blastula stage. Thus, if the activation of transcription of the MT genes accounts for the developmental

FIG. 6. Early developmental profile of MTA and MTB mRNAs. From embryos at the indicated stages postfertilization, 5 pg of total RNA on Northern blots were hybridized with a mixture of M T coding region probe and either Spec I ( A ) or Cyllla actin ( R ) probe, and 12 pg of total RNA were hybridized in slot blots with 5 ’ - MTB, probe (C). Microdensitometric tracing of each lane was performed to assess the relative amounts of the 0.7-kb MTA mRNA and either the 1.5-kb Spec 1 or the 1.8-kb CyIIIa actin RNA. These amounts were normalized to the profile of the 0.7-kh MTA mRNA and the absolute amounts calculated on the basis of the previously determined level of CyIIIa actin mRNA at 20 h (37). and plotted in panelD: MTA (O), Spec 1 (O), CyIIla actin (X) . The relative amounts of MTB, mRNA were similarly quantified and the absolute amounts (A) were estimated and plotted in the inset of panel 11.


onset of their transcript accumulation, similar restrictions may apply to the induced and uninduced embryos. In the case of Spec 1, the onset of gene transcription has been detected approximately 2 h prior to the detected accumulation of transcripts (45).

Spatial Expression of MTA and MTBl mRNAs in Pluteus Larvae-The spatial expression of MTA mRNA was not demonstrated directly by previous studies employing in situ hybridization but was inferred from the predominant localization in the aboral ectoderm of a general MT-coding region probe (19), about 90% of which in the total uninduced pluteus larva represented MTA RNA (18). An accurate assessment of the spatial distribution of MTA mRNA, specifically gauged by the use of the specific 3’-UTR probe, reveals this mRNA to be exclusively in the aboral ectoderm (Fig. 7A) . The coding region probe used in the earlier study also could not discern specific MT mRNA localization in embryos induced by heavy metal ions since all MT mRNAs were induced in this case.

FIG. 7. Spatial expression of MTA and MTBl mRNAs in the pluteus larva. Sections of pluteus larvae, incubated for 4 h either in the absence (A, C, and E ) or presence of zinc sulfate (B , D, and F ) , were hybridized in situ with ‘H-labeled 3’-MTA ( A and B ) , ‘H- labeled 3’-MTB (C and D), or “S-labeled 5’-MTB1 ( E and F ) probes. Heavy arrows in A and B indicate aboral ectoderm. The aboral ectoderm (a ) , oral ectoderm ( 0 ) and embryonic gut ( g ) are indicated in E and F. Left and right panels are phase and darkfield photomicro- graphs, respectively.

The MTA 3’-UTR probe, however, now shows that MTA mRNA of the metal-induced pluteus larva is present exclusively in the aboral ectoderm ( B ) . In both the uninduced and induced embryos, the gut and oral ectoderm each accounted for <3% of the silver grains.

The spatial expression of the MTB subfamily of transcripts, assayed by the 3‘-MTB probe, was found to be uniform among the tissues of the pluteus larva, either in the uninduced (C) or heavy metal-induced (D) embryos. Considering that this probe hybridized with at least two and possibly several genes of the MTB subfamily, this uniform distribution can be interpreted as a composite of these gene specificities, within which individual MTB genes may or may not have more narrow specificities. Since the 5’ leader MTB, probe is specific for a unique MTBl gene, this probe can be used to identify specific MTBl transcripts and to assess their specific spatial distribution in the embryo. We found an enhanced localization of MTBl mRNA in the oral ectoderm and embryonic gut in both the uninduced ( E ) and metal-induced ( F ) pluteus larvae. The aboral ectoderm accounted for <20 and 4 0 % of background-corrected signal, respectively, in uninduced and induced embryos. A count of nuclei indicated that the ratio of cell numbers in these regions of embryos was considerably less than the 5:l ratio of autoradiographic silver grains; therefore, an enrichment of MTBl mRNA in the oral ectoderm and gut was evident even on a per cell basis. Moreover, this distribution was very nearly the complement of the spatial distribution of MTA mRNA.

DISCUSSION

Specific Patterns of MTB, and MTA Gene Expression-A total of six or seven MT genes has been indicated in S. purpuratus, with at least four of these being distinct from MTA and comprising an MTB subset on the basis of their hybridization with a 3’-UTR probe. The MTB isoform is encoded by at least two of these, MTBl and MTB2, distinguishable primarily by differences in their 5’ leader sequences. Probes specific for MTA and MTB, on the basis of their hybridization with unique restriction fragments revealed strikingly different histospecific expression patterns. Whereas previous studies utilizing a general coding region probe were limited to a description of the spatial expression of the entire array of MT mRNAs (19)) we have been able to establish with the specific probe that MTA mRNA is restricted to the aboral ectoderm and this same localization holds in embryos induced with heavy metal ions. Therefore, it can also be concluded that induction does not override the restrictions imposed in the uninduced embryo. The spatial pattern of MTBl mRNA expression not only contrasted with the MTA mRNA pattern but was actually its complement, insofar as its expression in uninduced as well as induced embryos was at a high level in both the embryonic gut and oral ectoderm and low in the aboral ectoderm. MTB, gene expression is either suppressed in the aboral ectoderm or enhanced in both the gut and oral ectoderm. While transcription factors cannot be excluded as specific agents in this regulation, other relationships might be relevant. (i) A posited suppression of MTBl might be linked to MTA gene activity. Based on the observation that MTA mRNA expression is about 10-fold higher than the expression of the entire MTB mRNA subset in sea water medium, conditions of low metal ion concentration (18), it may be posited that a competition among these genes for MRE-directed transcription factors would favor MTA. Hence, the activity of MTA in the aboral ectoderm would serve to suppress the expression of the MTB genes, whereas the lack of MTA activity in the other tissues would leave MTB expres-

6592 Sea Urchin Metallothionein Gene Structure and Expression

sion unimpeded. (ii) Another consideration, favoring the up- regulation of MTB, expression, is the difference between the tissues of the late stage embryo in their cell division status. It has been proposed by Cohen et al. (46) that in the post- gastrula embryo the aboral ectoderm is no longer engaged in cell division, while the cells of the embryonic gut and oral ectoderm are actively dividing. MTB, gene expression may thus be linked to cell division and in this way becomes localized in the actively dividing embryonic gut and oral ectoderm.

Structures, Sequence Elements and Patterns of Expression of the MTBl and MTA Gene-The MTA and MTB, genes were compared on the basis of percentage identity a t 10-bp intervals and interruptions by segments in one having no counterpart in the other (Fig. 8). They have an extensive high degree of identity, including 90% identity in their 0.7-kb 5‘- flanking regions and coding regions within 3 exons, as well as 85% identity in regions of the second introns and the fourth exons. The former is interrupted by an insert in MTA and the latter by a segment in MTB1, that is highly repetitive in the S. purpuratus genome (18). The most divergent regions are the -30% identical interiors of the first and third introns. However, neither the consensus MREs nor the extra copies of element A present exclusively in MTA seem entirely miss- ing from MTBl, but appear as vestiges in homologous regions of the gene. Thus, at a position counterpart to that of MREil, a vestigial MRE sequence TGCAgACc, appears in the MTB, intron 1 (lower case letters here and in the sequences below indicate the bases different from those in MTA). Similarly, the MTB, counterpart to MREi2 is GGGGCaCA. While we have not ascertained the functionality of either intronic MRE sequence in MTA, the divergence of both MTB, counterparts from the prescribed TGCPuCXC sequence (47, 48) appears to preclude their MRE-like activity. The element A counterparts in MTB, are a t most vestigial sequences, AGaAAAc in the first intron and aTTTGaa and tGtcAAt in the third intron, differing, respectively, by two, three, and four substi-

tutions from 5’AGCAAAAB’ (or 5’TTTTGCT3’) at the corresponding positions in MTA. These MRE and element A vestiges in MTBl suggest that this gene was derived from a progenitor that contained these elements intact and in loci similar to those of MTA and thus arose through the degen- eration of an MTA-like gene. The opposite of this proposition, that MTA arose from an MTB1-like gene, would require an unlikely, concerted array of specific mutations.

The identical pairs of MREs, located in the promoter regions of these genes at the same distance from each other and from the TATA or CATA box, suggest that the same prereq- uisites for metal induction apply to MTB, that we have demonstrated for MTA (5). Cell-type specificity differences associated with TATA box variation (49) and the enhancer properties of remotely situated MRE sequences (50, 51) in other systems suggest that the CATA box variation in MTBl and the exclusive presence of canonical MRE sequences (MREil and MREi2) in the MTA introns ought to be analyzed for their potential contributions to the two-magnitude greater level of MTA compared to MTB, mRNA expression in the uninduced embryo, as well as to the different cell-type specificities of these MT genes.

The highly identical 0.7-kb upstream promoter sequences contain the elements designated 1, 2, and 3, which are also present in the Spec 1 promoter region in the same order and approximately the same spacing as in MTA and MTB1. While these common features might be related to the concurrent blastula-stage activation of these genes, other DNA elements have already been implicated as being involved in the temporal regulation of the similarly scheduled CyIIIa actin gene expression (52-54). A single 7-bp element, designated “A,” is present in MTB1, in contrast to multiples of this element in the other genes: at two sites in the promoters of Spec 1 (Fig. 8) and CyIIIa actin (at positions -171 and -1588 (52)) and at five sites in MTA (Fig. 8). Whereas a multiplicity of element A distinguishes these genes from MTBl, other DNA elements can be expected to be involved in the aboral ecto-

H l W b p

3 I

T-7 n

FIG. 8. A diagrammatic representation of the sequence similarities and differences between the MTA and MTB, genes. The percentage identity of the MTA and MTBl genes at 10-bp intervals (indicated by the ordinate on the left) is given by a bar graph throughout their lengths from 0.7 kb upstream to the terminus of their last exons. Regions of essentially no identity are presented as triangular inserts on the MTA (aboue) or MTBI

sequences. MREa (TGCACACG) and MREb (CGTGTGCA), and the corresponding TATA and CATA boxes, are (below) side. Exons (ex) are boxes (open for untranslated, f i k d for translated), placed at locations containing their

shown in both genes. MREil (TGCGCACG) and MREi2 (GGGGCGCA) are in MTA introns 1 and 2. Element A is AGCAAAA or TTTTGCT. Elements 1 3 are ACCTTTATC, ATTACAT, and AACCATTT, respectively. Also shown is the Spec 1 promoter region (43), which contains these elements. Intron 1 of MTA is shown also to contain the P3A-binding site described in the CyIIIa actin gene promoter (48).


derm specificity of these genes, as indicated by the involve- ment of the distinct elements P3A and P7II in the spatial regulation of CyIIIa actin gene expression (52, 54). At least one of these elements, P3A, is represented perfectly, TGTGTGCGCAT, at position 526 in the first intron of MTA (5), but is entirely absent from MTBl (Fig. 8). The introns of MTA and MTB, are thus interestingly different. Intron 1 of MTA contains at least three potentially functional sites, i.e. element A, MREil, and P3A, none of which are present in the MTB, introns. Tests of the functionalities of regions of these genes cannot, therefore, be limited to their 5”flanking promoter sequences but must include other regions, especially their first introns.

In conclusion, the extensive high degree of sequence identity between the MTBl and MTA genes can be taken as an indication that they evolved from a common progenitor MT gene, and their subtle differences can be linked to divergences in their expression and their functions in cellular differentiation and to the character of cellular differentiation that evolved with them.

20. Lynn, D. A., Angerer, L. M., Bruskin, A. M., Klein, W. H., and Angerer, R. C. (1983) Proc. Natl. Acad. Sci. U. S. A. 80,2656- 2660

21. Cox, K. H., Angerer, L. M., Lee, J. J., Davidson, E. H., and Angerer, R. C. (1986) J. Mol. Biol. 188,159-172

22. Hardin, P. E., Angerer, L. M., Hardin, S. H., Angerer, R. C., and Klein, W. H. (1988) J. Mol. Biol. 202, 417-431

23. Akasaka, K., Takayuki, U., Higashinakagawa, T., Yamada, K., and Shimada, H. (1990) Deu. Growth &Differ. 32 , 9-13

24. Yang, Q., Angerer, L. M., and Angerer, R. C. (1989) Deu. Biol.

25. McClay, D. R., and Chambers, A. F. (1978) Deu. Biol. 6 3 , 179- 186

26. Williams, K. R., Spicer, E. K., LoPresti, M. B., Guggenheimer, R. A., and Chase, J. W. (1983) J . Biol. Chem. 258 , 3346-3355

27. Devereux, J., Haeberli, P., and Smithies, 0. (1984) Nucleic Acids Res. 12,387-395

28. Saiki, R., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985) Science 230,1350-1354

29. Nemer, M. (1986) Deu. Biol. 114 , 214-224 30. Bruskin, A. M., Tyner, A. L., Wells, D. E., Showman, R. M., and

31. Stoflet, E. S., Koeberl, D. D., Sarkar, G., and Sommer, S. S.

135,53-65

Klein, W. H. (1981) Deu. Biol. 8 7 , 308-318

(1988) Science 239.491-494 Acknowledgments-We thank Elizabeth C. Travaglini for helpful 32. Lee, J . J., Shott, R. J.; Rose 111, S. J., Thomas, T. L., Britten, R.

J., and Davidson, E. H. (1984) J. Mol. Biol. 172 , 149-176 discussions and Margaret Campbell for excellent technical assistance. 33. Southern. E. M. (1975) J, Mol, Bioi, 98. 503-517

1. 2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14. 15.

16.

17.

18. 19.

REFERENCES Hamer, D. H. (1986) Annu. Reu. Biochem. 55,913-951 Furey, W. F., Robbins, A. H., Clancy, L. L., Winge, D. R., Wang,

B. C., and Stout, C. D. (1986) Science 231 , 704-710 Bonham, K., Zafarullah, M., and Gedamu, L. (1987) DNA 6,

Nemer, M., Wilkinson, D. G., Travaglini, E. C., Sternberg, E. J., and Butt, T. R. (1985) Proc. Natl. Acad. Sci. U. S. A . 82,4992- 4994

Harlow, P., Watkins, E., Thornton, R. D., and Nemer, M. (1989) Mol. Cell. Biol. 9, 5445-5455

Searle, P. F., Davison, B. L., Stuart, G. W., Wilkie, T. M., Norstedt, G., and Palmiter, R. (1984) Mol. Cell. Biol. 4, 1221- 1230

Gedamu, L., Varshney, U., Jahroudi, N., Foster, R., and Shworak, N. W. (1987) Experientia Suppl. 5 2 , 361-372

Karin, M., Haslinger, A., Heguy, A., Dietlin, T., and Imbra, R. (1987) Experientia Suppl. 52, 401-405

Schmidt, C. J., and Hamer, D. H. (1986) Proc. Natl. Acad. Sci.

Richards, R. I., Heguy, A., and Karin, M. (1984) Cell 37 , 263-

Heguy, A., West, A., Richards, R. I., and Karin, M. (1986) Mol.

Nemer, M., Travaglini, E. C., Rondinelli, E., and D’Alonzo, J.

Varshney, U., Jahroudi, N., Foster, R., and Gedamu, L. (1986)

Compere, S. J., and Palmiter, R. D. (1981) Cell 25, 233-240 Mueller, P. R., Salser, S. J., and Wold, B. (1988) Genes & Deu.

Jones, N. C., Rigby, P. W. J., and Ziff, E. B. (1988) Genes & Deu.

Lee, W., Haslinger, A., Karin, M., and Tjian, R. (1987) Nature

Wilkinson, D. G., and Nemer, M. (1987) Mol. Cell. Bid . 7 , 48-58 Angerer, L. M., Kawczynski, G., Wilkinson, D. G., Nemer, M.,

519-528

U. S. A. 83,3346-3350

272

Cell. Biol. 6 , 2149-2157

(1984) Deu. Biol. 102 , 471-482

Mol. Cell. Biol. 6, 26-37

2,412-427

2 , 267-281

325,368-372

and Angerer, R. C. (1986) Deu. Biol. 116,543-547

34. Lehrach,’H., Diamond, D., Wozney, J. M., and Boedtker, H.

35. Card, P. C., Fitzpatrick-McElligott, S., Gozes, I., and Baldino,

36. Gray, D. M., Liu, J-J., Ratliff, R. L., and Allen, F. S. (1981)

37. Lee, J. J., Calzone, F. J., Britten, R. J., Angerer, R. C., and

38. Wilkinson, D. G., Bailes, J. A., and McMahon, A. P. (1987) Cell

39. Sharpe, P. A., Arnold, J., and Berget, S. M. (1980) Methods

40. Karin, M., and Richards, R. I. (1982) Nature 299, 797-802 41. Bucher, P., and Trifonov, E. N. (1986) Nucleic Acids Res. 24,

42. Britten, R. J., Cetta, A,, and Davidson, E. H. (1978) Cell 15,

43. Hardin, S. H., Carpenter, D. C., Hardin, P. E., Bruskin, A. M.,

44. Shott, R. J., Lee, J. J., Britten, R. J., and Davidson, E. H. (1984)

45. Tomlinson, C. R., and Klein, W. H. (1990) Mol. Reprod. Deu. 25,

46. Cohen, L. H., Hinegardner, R. T., and McFadden, G. (1981) J .

47. Culotta, V. C., and Hamer, D. H. (1989) Mol. Cell. Biol. 9 , 1376-

48. Searle, P. F., Stuart, G. W., and Palmiter, R. D. (1987) Experien-

49. Wefald, F. C., Devlin, B. H., and Williams, R. S. (1990) Nature

50. Serfling, E., Lubbe, A., Dorsch-Hasler, K., and Schaffner, W.

51. Westin, G., and Schaffner, W. (1988) EMBO J . 7 , 3763-3770 52. Theze, N., Calzone, F. J., Thiebaud, P., Hill, R. L., Britten, R. J.,

and Davidson, E. H. (1990) Mol. Reprod. Deu. 25,110-122 53. Calzone, F. J., Th6z6, N., Thiebaud, P., Hill, R. L., Britten, R. J.,

and Davidson, E. H. (1988) Genes & Deu. 2 , 1074-1088 54. Davidson, E. H. (1989) Development 105, 421-445

(1977) Biochemistry 16,4743-4751

Jr., F. (1988) Cell Tissue Res. 252 , 307-315

Biopolymers 20 , 1337-1382

Davidson, E. H. (1986) J. Mol. Biol. 188 , 173-183

50,79-88

Enzymol. 65,750-768

10009-10026

1175-1186

and Klein, W. H. (1985) J. Mol. Biol. 186 , 243-255

Deu. Bid. 101, 295-306

328-338

Cell. Biol. 9 1 , 69a

1380

tia Suppl. 52, 407-414

344 , 260-262

(1985) EMBO J. 4,3851-3859

the journal of no. u. s. a. structure, spatial, and ... · the metallothionein-b genes of the sea...

Documents