THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 263, No. 16, Issue of June 5, pp. 7717-7725,1988 Printed in U. S.A.

Isolation and Characterization of the Saccharomyces cerevisiae MISl Gene Encoding Mitochondrial C1-Tetrahydrofolate Synthase*

(Received for publication, November 16, 1987)

Karen W. Shannon$ and Jesse C. Rabinowitz From the Department of Biochemistry, University of California, Berkeley, California 94720

C1-Tetrahydrofolate synthase is a trifunctional poly- peptide found in eukaryotic organisms that catalyzes 10-formyltetrahydrofolate synthetase (EC 6.3.4.3), 5,lO-methenyltetrahydrofolate cyclohydrolase (EC 3.5.4.9), and 5,lO-methylenetetrahydrofolate dehy- drogenase (EC 1 .5. 1.5) activities. In Saccharomyces cerevisiae, C1-tetrahydrofolate synthase is found in both the cytoplasm and the mitochondria. The gene encoding yeast mitochondrial Cl-tetrahydrofolate syn- thase was isolated using synthetic oligonucleotide probes based on the amino-terminal sequence of the purified protein. Hybridization analysis shows that the gene (designated M I S l ) has a single copy in the yeast genome. The predicted amino acid sequence of mito- chondrial C1-tetrahydrofolate synthase shares 71% identity with yeast C1-tetrahydrofolate synthase and shares 39% identity with clostridial 10-formyltetra- hydrofolate synthetase. Chromosomal deletions of the mitochondrial C1-tetrahydrofolate synthase gene were generated using the cloned MISl gene. Mutant strains which lack a functional MISl gene are viable and can grow in medium containing a nonfermentable carbon source. In fact, deletion of the MISl locus has no de- tectable effect on cell growth.

The transfer of one-carbon units is essential in several major aspects of cellular metabolism. In many of these proc- esses, one-carbon transfers are mediated by the coenzyme tetrahydrofolate (THF).’ Derivatives of THF supply the ac- tivated one-carbon units required for the biosynthesis of purines, thymidylate, methionine, histidine, pantothenate, and formylmethionyl-tRNAMet (Fig. 1) (1-3). Various cata- bolic reactions generate specific one-carbon derivatives of THF, which are then interconverted between different oxi- dation states by 10-formyltetrahydrofolate synthetase (EC 6.3.4.3), 5,lO-methenyltetrahydrofolate cyclohydrolase (EC 3.5.4.9), and 5,lO-methylenetetrahydrofolate dehydrogenase (EC 1.5.1.5). In eukaryotes, synthetase, cyclohydrolase, and dehydrogenase activities are catalyzed by a trifunctional poly-

* This work was supported by United States Public Health Service Grant AM2109 from the National Institute of Arthritis, Metabolism, and Digestive Diseases and by a National Institute of Health predoc- toral traineeship (to K. W. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nuckotide sequence(s) reported in this paper has been submitted

503724. to the GenBankTM/EMBL Data Bank with accession number(s)

$ Present address: Dept. of Biochemistry and Biophysics, Univer- sity of California, 3rd & Parnassus Aves., San Francisco, CA 94143.

The abbreviations used are: THF, 5,6,7,8-tetrahydrofolate; HEPES, N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid; kb, kilobase.

peptide termed C1-THF synthase (4-9). These reactions are summarized in Fig. 1.

In Saccharomyces cereuisiue, Cl-THF synthase is found in the mitochondria as well as in the cytoplasm (10). Other folate-dependent enzymes reported to be present in mitochon- dria include serine hydroxymethyltransferase (11-13), the glycine cleavage system (14), sarcosine dehydrogenase (15, 16), dihydrofolate reductase (17), and methionyl-tRNA trans- formylase (18, 19). Although the existence of many of these folate-dependent enzymes in the mitochondria is not yet well- documented, this has not discouraged workers from proposing potential functions for these enzymes in mitochondrial me- tabolism. However, the physiological role of folate-dependent enzymes in the mitochondria has yet to be established.

We have taken advantage of the genetic manipulations possible in the yeast S. cerevisiae to investigate the function of mitochondrial Cl-THF synthase. We report here the iso- lation and the disruption of the gene encoding mitochondrial C,-THF synthase, which we have designated MISl . We have found, however, that a functional MISl gene is completely dispensable in yeast.

EXPERIMENTAL PROCEDURES

Materials-Restriction enzymes, the large fragment of DNA po- lymerase I (Klenow fragment), and T4 DNA ligase were purchased from Boehringer Mannheim. T4 polynucleotide kinase, DNA polym- erase I, and synthetic linkers were obtained from Bethesda Research Laboratories. All enzymes were used as recommended by the supplier. Radiochemicals were purchased from Amersham Corp. Common re- agents were commercial products of the highest grade available.

Yeast Strains, Genetic Techniques, and Cell Growth-The S. cere- visiae strains used in this study are listed in Table I. The preparation of growth media and the techniques used for diploid construction, sporulation, and tetrad dissection have been described (20). Yeast were grown aerobically at 30 “C. Growth was monitored by measuring turbidity at 600 nm with a Zeiss PMQ I1 spectrophotometer. Unless otherwise indicated, cells were grown in YPD medium (1% yeast extract, 2% Bacto-peptone, 2% glucose) or, to maintain selective pressure for plasmids, in minimal medium (0.67% yeast nitrogen base, 2% glucose, plus appropriate auxotrophic supplements). Cells were harvested in late log phase (ODsw = 10). Extracts were prepared by disrupting washed cells with glass beads (0.45-mm diameter) in buffer containing 50 mM Tris-CI, pH 7.5, 10 mM KCl, 10 mM 2- mercaptoethanol, 1 mM phenylmethanesulfonyl fluoride. Homoge- nates were centrifuged 30 min at 16,000 X g. The supernatant frac- tions were used for enzyme and protein assays.

Recombinant DNA Techniques-The techniques used for isolation of plasmid DNA, attachment of synthetic linkers, DNA blot analysis, nick translation, and transformation of Escherichia coli were as described by Maniatis et al. (21). Published procedures were used for the isolation of yeast genomic DNA (20) and for the transformation of yeast spheroplasts (22).

Cloning of the MIS1 Gene-Oligonucleotides 1 (5”AAYGAYGAR- ATHCARGC-3’) and 2 (5’-AARCAYCCNAAYTTYAARCC-3’), which correspond to the amino-terminal sequence of mitochondrial C,-THF synthase (lo), were prepared with an Applied Biosystems Model 280A DNA synthesizer and purified by silica gel thin-layer chromatography (23). The oligonucleotides were end-labeled with [y-

7717

7718 Isolation of the Gene Encoding Mitochondrial C1-THF Synthase

CLUCOSE ACETATE HISTIUINE

FIG. 1. Tetrahydrofolate coen- CHOLISE 1 J zymes in C, metabolism. Pathways I 1 J

I J that utilize or generate folate coenzymes are indicated schematically by arrows. Enzymes shown are: I , 10-formyl-THF synthetase; 2, 5,lO-methenyl-THF cy- clohydrolase; 3, 5,lO-methylene-THF t) ++ dehydrogenase; 4, serine hydroxymethy- lase (EC 2.1.2.1); 5, glycine cleavage sys- tem (EC 2.1.2.10); and 6, thymidylate synthase (EC 2.1.1.45). DHF, dihydro- folate.

(FORMIMINO)

THII1IUYI.ATE PURINES

(MEIIIYL) r’ r’ PORYYLMETHlONYL~1RNA

r’ PASTOTHENAIE METHIONINE HISTIDINE

TABLE I S. cerevisiae strains

Strain GenotvDe Source ~

3-5281 YNN281

MATa ade3-130 ural serl E. W. Jones (Carnegie-Mellon University) MATa trpl his3 urd-52 lys2 d e 2 YGSC“

KSY 1 KSY2

MAT@ ade3-130 urd-52 serl Spore from cross of 3-5281 X YNN281

KSY3 MATa ade3-130 urd-52 serl Spore from cross of 3-5281 X YNN281

KSY4 MATa trpl urd-52 lys2-801 Spore from cross of 3-5281 X YNN281 MATa ade3-130 urd-52 serl Diploid of KSYl X KSY2

KSY5 MATa ade3-130 urd-52 serl MATa ade3-130 urd-52 serl misl::URA3 See “Experimental Procedures”

KSYG MATa ade3-130 urd-52 serl mis1::URAS Spore from KSY5 KSY7 MATa ade3-130 urd-52 serl MIS1 KSY8

Spore from KSY5 MATa ade3-130 urd-52 serl misl::URA3

KSY9 Spore from KSY5

MATa urd-52 serl mis1::URAS KSYlO

Spore from cross of KSY3 X KSYG MATa urd-52 serl MISl Spore from cross of KSY3 X KSYG

MATa ade3-130 urd-52 serl MISl

YGSC. Yeast Genetic Stock Center. Deuartment of Biophysics and Medical Physics, University of California, Berkeley, CA.

I _

32P]ATP to a specific activity of lo9 cpm/pg using T4 polynucleotide kinase (21). The labeled oligonucleotides were used to screen a yeast genomic library which was constructed by M. Carlson (Columbia University, New York). The library was constructed by inserting fragments produced by partial Sau3A digestion of total yeast DNA into the BamHI site of vector YEp24. Bacterial colonies containing the yeast genomic library were plated and transferred onto nitrocel- lulose (24), and the filters were probed with the oligonucleotides and washed with 3.0 M tetramethylammonium chloride at 51 “C (oligo- nucleotide 2) (25). Plasmid DNA (designated YEpKS6) was recovered from a single clone that hybridized to both oligonucleotide probes through three rounds of isolation and rescreening. Subclones YEpKS7, YEpKS14, and YEpKS17 were constructed by inserting fragments produced by partial Sau3A digestion of plasmid YEpKS6 into the BamHI site of vector YEp24.

Enzyme Assays-Assay of 10-formyl-THF synthetase and 5,lO- methylene-THF dehydrogenase depended on the spectrophotometric measurement of 5,lO-methenyl-THF concentrations in acidified (Ama = ASm) reaction mixtures (26). 10-Formyl-THF synthetase activity was assayed as previously described (27) except the triethanolamine buffer was replaced with 50 mM potassium/HEPES, pH 7.5, and KC1 and ammonium formate were added to 0.1 M each. 5,lO-Methylene- THF dehydrogenase activity was assayed as described (26) except that assay mixture contained 50 mM potassium/HEPES, pH 7.5,O.l M KCl, 0.6 mM NADP’, 100 pM 2-mercaptoethanol, and 1.5 mM methylene-THF in a final volume of 1.0 ml. Activities are expressed in milli-international units (nanomoles of 5,lO-methenyl-THF formed or hydrolyzed per min) based on an extinction coefficient of 24,900 M” cm” for 5,lO-methenyl-THF. Protein concentrations were determined by the dye-binding assay of Bradford (28) with bovine serum albumin as a standard.

DNA Sequencing-A 5.7-kb PstI fragment from YEpKS6 was cloned into vector pEMBL19 (29), and subclones were generated by digestion with exonuclease I11 (30). Single-stranded templates were prepared from the subclones by superinfection with phage fl (29) and were sequenced by the dideoxy method (31) as modified by Biggin et al. (32). The region outside the PstI fragment was sequenced from single-stranded templates prepared from DNA restriction fragments

cloned into pEMBL18 or pEMBL19. In some cases, synthetic oligo- nucleotides were used to prime sequencing reactions (33). Greater than 95% of the nucleotide sequence was determined from both strands.

Disruption of the MISl Locus-Plasmid pKS31 was constructed by inserting, via BamHI linkers, the 4.9-kb PuuII fragment from YEpKS6 into the BamHI sites of vector pUC4-K (34). Plasmid pKS33, which contains the MISl gene disruption, was constructed by converting the XbaI site of pKS31 to a SalI site using synthetic linkers, cleaving with SalI to remove linkers plus 1.7 kb of the MIS1 coding sequence, and inserting, via SalI linkers, a 1.14-kb HindIII fragment containing the URA3 gene. Diploid strain KSY4 was trans- formed with plasmid pKS33 linearized with BamHI (35), and Ura+ transformants were selected. One transformant, designated strain KSY5, was chosen for further study.

RESULTS

Isolation of the Gene Encoding Mitochondrial C1-THF Syn- thase-We designed two degenerate oligonucleotide probes based on the amino-terminal sequence of mitochondrial Cl- THF synthase (10). The probes were used to screen a yeast genomic library in an episomal vector (YEp24) by the colony hybridization technique (24). A single plasmid (YEpKS6) carrying a 10.1-kb genomic insert was isolated which hybrid- ized to both oligonucleotides (Fig. 2). An ade3 deletion strain which lacks cytoplasmic C1-THF synthase (36) was trans- formed with YEpKS6 DNA. The YEpKS6-transformed strain had levels of synthetase and dehydrogenase activities approx- imately 10-fold greater than the same strain transformed with vector DNA alone (Table 11). These levels of synthetase and dehydrogenase activities are comparable to those found in ADE3 wild-type strains; however, transformation with YEpKS6 DNA did not alleviate the adenine and histidine requirement of d e 3 parent strain. We purified synthetase

Isolation of the Gene Encoding Mitochondrial C1-THF Synthase 7719

FIG. 2. Restriction map of the yeast MIS1 gene. The positions of re- striction sites within the inserts of plas- mids YEpKS6, YEpKS7, YEpKS14, and YEpKS17 are indicated. The bored re- gion represents the MIS1 protein coding sequence. ORF, open reading frame.

I MlSI ORF I

I I ; I I I I I I , I I I I1 I I I1 I I I

YEpKS6

I I ,

YEpKS7

I I I I 1 I I I I I I I

YEpKS14

I I I I I I II I I , I I I ,I I I

YEpKS17

H 1.0 kb

TABLE I1 Comparison of mitochondrial C,-THF synthase activities in an ade3

deletion strain ( K S Y l ) transformed with plasmid YEp24 and plasmid YEpKSS

Overexpression

SYN” DH Plasmid Synthetase Dehydrogenase

mIU/mg mIu/mg YEp24 13.8 4.07 1.0 1.0 YEpKS6 140 46.3 10.1 11.4 SYN, synthetase; DH, dehydrogenase.

activity from the YEpKS6-transformed strain and found that the purified protein is indistinguishable from mitochondrial CI-THF synthase with respect to its purification properties and its subunit molecular weight (data not shown).

We performed deletion analysis to localize the boundaries of the mitochondrial Cl-THF synthase gene on YEpKS6. Various fragments generated by partial Sau3A digestion of YEpKS6 were cloned into YEp24; and the resulting plasmids, YEpKS7, YEpKS14, and YEpKS17 (Fig. 2), were used to transform an ade3 deletion strain. Only the strain containing plasmid YEpKS17 had levels of synthetase and dehydrogen- ase activities comparable to those found in the YEpKS6- transformed strain (Fig. 3). These data suggest that sufficient information to overexpress mitochondrial C1-THF synthase is carried on the PuuII fragment of YEpKS6. DNA blots probed with a plasmid carrying this PuuII fragment confirmed the presence of the cloned insert in yeast genomic DNA. The fragments observed in these blots were identical to those predicted from the restriction map of the cloned insert (data not shown). These data indicate that mitochondrial Cl-THF synthase is encoded by a single copy gene which we have designated MISl for mitochondrial Cl-THF synthase.

Nucleotide Sequence of the MISl Gene-The nucleotide

YEpKS6

YEpKS7

YEpKS 14

YEpKS 17

I I I

0 10 20

“Overexpression” FIG. 3. Deletion analysis of the MISZ locus. Plasmids

YEpKS6, YEpKS7, YEpKS14, and YEpKS17 (Fig. 2) and vector YEp24 were used to transform strain KSY1. Specific activities of synthetase ( S Y N , open bars) and dehydrogenase (OH, hatched bars) were measured in extracts prepared from the transformed strains. Data are expressed as the specific activity in cells transformed with a recombinant plasmid to that in cells transformed with vector alone or “overexpression.”

sequence of the MISl gene is shown in Fig. 4. Analysis of the DNA sequence revealed one open reading frame which en- codes a protein of 975 amino acids with a calculated molecular weight of 106,235. The predicted amino acid sequence of residues 35-74 is identical to the amino-terminal sequence of mitochondrial Cl-THF synthase (10). The sequence predicted for residues 1-34 is highly enriched for arginine, leucine, and serine, which is typical of mitochondrial targeting sequences (37). The removal of these initial 34 residues yields a “mature” protein with a calculated molecular weight of 102,251, which

7720 Isolation of the Gene Encoding Mitochondrial C1-THF Synthase

FIG. 4. Nucleotide sequence of the MIS2 gene. The DNA sequence of the MIS1 gene and the predicted amino acid sequence of mitochondrial C,-THF syn- thase are shown. The amino acid resi- dues which were directly sequenced from the purified protein are indicated in bold- face type (residues 35-74).

AAAGTAATCCTGAGTTCAGTTCCAATTCCAATTCCGGTTCAGAGTACGAATCGGAGGAAGAAGTAGTCCCAAGATCAGCCACAGTCACACA

ACTCCAAAGCAGACCAGAGCCATACTACAAGAATAATGGAATGCCCTACTCACTCTCCAAAGTACGAGGAAGGCCCATGTATCCAAGACCT

GCTGAAGATGCTTACAATGCCAATTATATATTCAAGGTCTGCCCCAGTACCAAACATCTTATTTTTCGCAGCTGTTATTATCATCACCCCAGC

ATTACGAACATTCTCCACATCAAAGGAACTTTACGCCATCCAACCAATCGCATGGGAACTTTTATTAAATGTCTACATACATACATACATC

TCGTACATAAATACGCATACGTATCTTCG~AGTAAGAACCGTCACAGATATGATTGAGCACGGTACAATTATGTATTAGTCAAACATTACC

AGTTCTCGAACAAAACCAAAGCTACTCCTGCAACAACACTCTTCTATCGCACATGTATGGTTCTTATTGTTTCCCGAGTTCTTTTTTACTGACG

C G C C A G A A C G A G T A A G A A A G T T C T C T a A A A A T A

ATGTTGCAGCGGTTCTCGATGCCTCAAGAATTGCAGAAGTAAACCAGCCAATACACATCAAAAAACAACTTTCATTACTGTGATTCTCTCA

Isolation of the Gene Encoding Mitochondrial C,-THF Synthase 7721

FIG. 4-continued

G l y A l a P r o A s n V s l L y r Pro G l y 7 5 0

GOT GCT CCA AAT GTT AAG CCC GOA

7 8 0 A l l L y , G l y V.1 S e r A x o L e u V a i GCC AAG GGT GTT AGT AAT TTG GTT

A l a I l c A s n A r g P h c G l u T h r A s p GCA ATC AAC AGA TTT GAA ACA GAC

8 0 0

8 2 0 G l y A I . S c r H i s A l a V a l T h r S c r AIO H i s Trp Mcf G l u G 1 y G l y L y r G l y A I . V a l G l u L e u A I . H i s GGC GCA TcT CAT GCC GTT ACT TCT A A T CAC TGC ATG GAA GOT GGT AAA GGT OCA GTA GAA TTA GCA CAT

8 3 0 8 4 0

8 5 0 A I . V a l V a l A s p A I . Thr L y s G l u Pro L y l A S P Phc A s n Phc L e u Tyr A s p V a l A r n S a r S c r I l c G l U GCT GTG GTA GAT GCA ACG AAA GAA CCA AAG AAC TTT AAC TTT TTG TAC GAC GTC A A T AGC TCC ATC GAG

8 6 0

8 7 0

A s p L y r L e u T h r S s r I l c V a l G l n L y r M e t T y r G l y G l y A I . L y s I l c G l u Vsl S c r Pro G l u A l a G l n GAC AAG CTT ACC AGC ATC GTC CAA AAA ATG TAT GGT GGG GCA AAA ATC GAA GTA TCA CCA GAA GCC CAA

8 8 0

L y . L y . 1 1 0 A s p T h r T y r L y r L y s G l o G l y P h c G l y A s n L e u P r o I I c C y . 1 1 s A l a L y s T h r G l n T y r 8 9 0 9 0 0 9 1 0

AAA AhG ATA GAC ACC TAC AAA AAA CAA GGC TTC GGT AAT CTT CCC ATC TOT ATT GCT AAG ACA CAA TAT

9 2 0 S e r L e u S c r H i # A s p Pro S c r L e u L y s G l y Vsl P r o A r g G l y Phc Thr P h c P r o I l o A r g A s p V a l A r g TCA TTA TCC CAT GAT CCA TCA TTA AAG GGT GTT CCT AGA GGT TTT ACG TTC CCC ATC AGO GAT GTG AGA

9 3 0

A I . S c r I I c G l y A I . G l y T y r L e u T y r A l a L e u A I . A I . G l u I I c G I n T h r Ils P r o G I y L c u S c r Thr 9 4 0 9 5 0

GCT TCA A T A GOT GCA GGT TAT TTA TAC GCT TTG GCT GCA GAA ATT CAA ACC ATA CCG GOT CTA TCG ACA

9 6 0 9 7 0 Tyr A l a G l y T y i Met A l a VII G l n V a l A x p A s p A s p G l y G l u I I = G l u G l y L s u P h s GC TAT GCT GGT TAC ATG GCA GTA GAA GTC GAC GAC GAC GGT GAA ATT GAA GGT CTA TTT T A A ATAGTTTGGCAG

9 7 s

ACTCCTAATGGCATCAATTCGACCTCGATGTCCGTCTGCACGAGTACCCTTTATATAAACAATTGAGATGAGAATATTAOAAAAATGGGT

TTTAGTTATGTAGGTATATGTGCATACATACGTATTATCGAAGTTTTTGCTACCTGTTTATTAACTGAGTATGTATATTAAGATAAATTA

ATTAAAGAAAATTTAAGCGTCTTCCTTCAATAAAOCAATAAAGCATCTCTCTTTTCAGCAACTCTTTGAGCTCTTCTGTCACGAGCAGCTCTGTTCTT

CAATCTTCTAGCTTCAGCTTCTTCGTTCAAAGCCTTTTCACGTTGAGCATCAGCCTTAGCTTGGATGATGTGTTCAACCAAGGCTCTCTT

GTGTTTGAAAGCGTTACCCTTAGArTCCTTGTACAAAACATGGTACAAGTGCTTGrCAArCrrACCAG~ATCACGGTAClrAGCCAATAA

TCTTCTCAAGACACGTAATCTTCTGATCCAGACAACTTGGGATGGTAAACGGGCTTCTCTGGTACCCTTTCTCTTACCGTAACCACTGTG

ACGACCTTCTCTCTTAGATTGAGCATGGGCTCTGGTTCTGGATTTAGAGTGGACGGTAACGCTCTTCTTTACGATGGTACCGTTCTTAAC

CAATTTCTAATGGCGTTTCTGGAG

closely matches the subunit molecular weight of mitochon- predicted amino acid sequence of mitochondrial Cl-THF syn- drial C1-THF synthase estimated by sodium dodecyl sulfate- thase to that of C1-THF synthase from yeast (38) and of 10- polyacrylamide gel electrophoresis (M, = 100,000) (10). These formyl-THF synthetase from Clostridium acidiurici.* The mi- results indicate that the cloned DNA is the structural gene tochondrial and cytoplasmic Cl-THF synthases are 71% iden- for yeast mitochondrial C1-THF synthase.

H o ~ ~ g y of the Protein Encoded by MIS1 to CI-THF Whitehead, T. R., and Rabinowitz, J. C. (1988) J. Bacteriol., in Synthase and IO-Formyl-THF Synthetase-We compared the press.

7722 Isolation of the Gene Encoding Mitochondrial C1-THF Synthase

FIG. 5. Comparison of the amino acid eequences of mitochondrial Cl- THF synthase, yeast Cl-THF syn- thase, and clostridial 10-formyl- THF synthetase. The upper l ine shows the predicted amino acid sequence of mitochondrial C,-THF synthase which has been aligned with the amino acid sequences predicted for yeast Cl-THF synthase (middle line) and clostridial 10- formyl-THF synthetase (lower line). Residues that are identical between the three protein sequences are indicated by capital letters.

0 0

70 38

140 108

210 178

27 2 24 8

342 318

0

404 380 61

456 432 112

508 484 150

570 546 174

627 604 232

68 1 65 8 286

737 709 327

197 769 379

862 834 444

924

506 896

p v p s D I d I s r a q s p K h I k q v A e c l g I h s h c [LELYG] h [YKAK] iSpnifkrLcarcnGKyvLVag p v p s D l d l s r ~ q q p K l l n q l A q c l g l y s h e [LELYG] h [YKAK] iSpkvierLqtrqnGKyiLVsg . m k t D I q I a q c a q m K h I k d v A e l i d I h c d d [LELYG] k [YKAK] vSldvldqLkdkpdCKlvLVts

I t [PTP] 1 [GEGK] sTTtmCLvqsLssh [LGK] psianvRq [PSLGP] 1 1 [GVKGGAAGGG I t [PTP] 1 [GEGK] aTTtmGLvqrLtsh [LGK] paianvRq [PSLGP] t 1 [GVKGGAAGGG I n [PTP] a [GEGK] tTTniGLsmgLnk. [LGK] ktstalRe [PSLGP] s f [GVKGGAAGGG

Y] aQViPMdef [NLH] I [TGD] i [HAI] saAnn [LLAA] aiDtrmfHcxtqkndstfykr1 Y] sQViPMdcf [NLH] 1 [TGD] 1 [HAI] g a A n n [LLAA] aiDtrmfHcttqkndatfynr1 Y] aQVvPMadi [NLH] f [TGD] f [HAI] tsAhs [LLAA] IvDnhlhH . . . . . . . . . . . . . .

v p r k k g i r k f t p s m q r r l k r l d i e k c d p d s l t p e c v k r f s r L n l n p d t I t i ~ [RVVD] i [NDRI mL v p r k n g k r k f t p s m q r r l n r l g i q k t n p d d ~ t p c e i n k f a r L ~ I d p d t l t i k [RVVD] i [NDR] mL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . g naLrIdtnrIvwk [RVVD] m [NDRI a L

RqltiGe*atakgfTRtt [GFDITVASE] 1 [MAIL] aLskalhcm [KER] iGrmVigndydnkp RqItiGqaptcknhTRvt [GFDITVASE] 1 [MAIL] aLskdlrdm [KER] iGrvVvaadvnrsp RkIvvGlggkaqgiTRcd [GFDITVASE] i [MAIL] =Landredl [KER) IGnmVvsynvdgd~

VtveDigct [GALT] alLr [DAI] kPNlm [QTLE] gTPvmvHs [GPFANI] siGasSViAd1 VtvcDvgct [GALT] alLr [DAI] kPNlm [QTLE] gTPvlvHa [GPFANI] siGasSViAdr VrakDlcsq [GALT] liLk [DAI] nPNiv [QTLE] nTPafiHg [GPFANI] ahGcnSV1Atk

m [ALK] IvgseknplndknihepgYv [VTEAGF] dfsmGgErFFd [IKCR] srGLvPdsvV1 [ v [ALK] I v g t c p e a k t . . . . . cagYv [VTEAGF] dftmGgErFFn [IKCR] ssGLtPnsvV1 [ 1 [ALK] t . . . . . . . . . . . . . . . gdYa [VTEAGF] gadlGsEkFFd [IKCR] yaGLnPdvaVi [

VATVRALK] s [HGG] a p d v k p G q p l p s s y t e E N i c f v e K G a ~ N m c k q I a N i k q F G ~ P v [VVAIN] VATVRALK] s [HGG] a p n v k p G q s l p k e y t c E N i d f v a K G v s N l v k q l c N i k t F G i P v [VVAIN]

VATVRALK] m [HGG] v a k c d 1 G . . . . . . . . t E N I d s L a K G m t N I c r h I c N v a k F G ~ P r [VVAIN]

k F c T D t e g E i a = i r k a a l c a G a f c A v t s n h w a c G G k C a i d L A k a V i ~ . ~ s n q p ” d F h f [LYDV] n s S v r F c T D s q a E i c v i k k ~ e I n a G s s h A v t s n h w m c G G k G a v e L A h a V v d . ~ t k c p k n F n f [LYDV] nsSi

~ F p T D t c s E k q l v f d k c k e m G v d v A i s d v f . a k G G d G g v c L A q k V i d v c c n k k s d F k v [LYDV] eeSi

e d K 1 T s I v q k m Y g g ~ k i c v s p c A q k k I d t y k l ; q G f g n [LPIC] i [AKTQYS] IShDpsLkGvPrGF e d K l T t I v q k m Y g g a a i d i l p e A q ~ k I d m y k e q G f g n [LPIC] i [AKTQYS] 1ShDatLkGvPtGF p c K i T k I a k e i Y r s d k v n f s k a A k k q I a c l e k l G l d k [LPIC] m [AKTQYS] fSdDpnLlGaPeGF

t f p [IRD] v r a s i [GAG] ylyALaaeIqti [PGL] styagymavcvddd [GEI] e [GLF]. tfp [IRD] v r l s n [GAG] ylyALarcIqti [PGL] atysgymavcvddd {GEI] d [GLF]. e l t [IRD] l c l a a [GAG] fivALtgdImrm [PGL] pkvpsanrrndVlpn [GEI] i [GLF].

tical (Fig. 5). The similarity extends for the entire length of the coding sequences except for the putative “targeting se- quence” at the amino terminus of the mitochondrial isoen- zyme. A comparison of the three protein sequences showed 39% identity when gaps were introduced to obtain maximal alignment (Fig. 5). The bacterial protein aligned with the carboxyl-terminal region of the yeast proteins mitochondrial C1-THF synthase (residues 344-975) and C1-THF synthase (residues 320-946).

Disruption of the MISl Gene-Mitochondrial Cl-THF syn- thase is present in ade3 mutants that lack Cl-THF synthase, yet the mitochondrial isoenzyme cannot satisfy the require- ment for adenine and histidine that is characteristic of most ade3 mutant strains. This observation suggests that C1-THF synthase and mitochondrial C,-THF synthase have different metabolic roles. To determine how the lack of mitochondrial C1-THF synthase affects cell growth, we disrupted the MISl gene in vitro and introduced the nonfunctional gene into the yeast chromosome. A 1.7-kb fragment of the MISl coding sequence was replaced with a DNA fragment carrying the

URA3 gene (Fig. 6A). The disrupted gene was excised from the plasmid and was used to transform a diploid urd-52/ urd-52 ade3-130/ade3-130 serllserl strain (KSY4) to uracil prototrophy. Hybridization analysis of genomic DNA isolated from a Ura+ transformant confirmed that the disrupted gene had integrated into the MISl locus (Fig. 6B). The pattern of fragments seen in these blots suggests that the diploid trans- formant carries one wild-type copy of the MISl gene and one disrupted copy.

To determine whether a functional MISl gene is required for cell growth, we sporulated a MISl/misl::URA3 diploid (KSY5) to generate haploid segregants. Four spores in each of 12 tetrads dissected grew on rich YPD medium. Two spores per tetrad were Ura+, and two were Ura-. To test whether or not mitochondrial C,-THF synthase is produced from the disrupted MISl locus, we measured synthetase and dehydro- genase activities in extracts prepared from the spores of a single tetrad. Extracts prepared from the Ura- spores had levels of synthetase and dehydrogenase activities found in MIS1 ade3 strains, whereas extracts from the Ura+ sister

Isolation of the Gene Encoding Mitochondrial CI-THF Synthase 7723

A I M I S I ORF I

FIG. 6. Analysis of MIS1 gene dis- ruption. A, physical map of the MISl gene disruption. The construction of the mis1::URAS allele is described under "Experimental Procedures." The MISl coding sequence and the fragment con- taining the URA3 gene are represented by boxes. The arrow indicates the direc- tion of transcription of URA3. B, hybrid- ization analysis of the MISl gene disrup- tion. DNA (20 pg/lane) isolated from the parent diploid strain, KSY4 (lanes 1 and 3) , and a Ura' transformant, KSY5 (lanes 2 and 4 ) , were digested with PuuII (lanes 1 and 2 ) or PstI (lanes 3 and 41, fractionated by electrophoresis on a 0.8% agarose gel, and transferred onto nitrocellulose. The filter was probed with plasmid pKS31 radiolabeled by nick translation. The molecular weight stand- ards used were X DNAIHindIII frag- ments and 6x174 replicative form DNA/ HaeIII fragments.

B

23,130 - 9,416 - 6,557 -

4,361 -

2,322 - 2,027 -

1,353 - 1,078 -

872 -

603 -

H 1 kb

- 23,130

- 9,416

- 6,557

- 4,361

- 2,322 - 2,027

- 1,353

- 1,078

- 872

- 603

spores had no detectable activities (Table 111). These results indicate that misl mutant strains are viable and that mito- chondrial C1-THF synthase is dispensable in yeast.

Initiation of protein synthesis in mitochondria occurs via a unique tRNA species, tRNAN" (18), which functions as a formylated methionylated derivative. The formyl group is transferred to methionyl-tRNA'"' from 10-formyl-THF (19), a product of mitochondrial CI-THF synthase. Thus, a plau-

sible function for this enzyme may be to supply 10-formyl- THF for the synthesis of formylmethionyl-tRNAMet. Reduced folates are required for mitochondrial function in yeast (39), possibly because mitochondrial protein synthesis is dependent on the formylation of methionyl-tRNAM" (40). However, we found that strains containing the disrupted MISl gene which completely lack mitochondrial CI-THF synthase grew on me- dium containing a nonfermentable carbon source (YPG me-

7724 Isolation of the Gene Encoding Mitochondrial C1-THF Synthase

TABLE I11 Comparison of mitochondrial C,-THF synthase activities in haploid

segregants of a MISl /MISl diploid strain (KSY4) and a MIS1/ nis1::URAJ diploid strain (KSY5)

Strain spore Genotype Synthe- Dehydro- type tase genase

mlUlmg mlUlmg KSY4 1 Ura- a MISl u r d 24.9 6.26

2 Ura- a MZSl u r d 24.1 6.67 3 Ura- a MISl u r d 23.6 6.84 4 Ura- a MISl u r d 24.1 6.90

KSY5 1 Ura' a rnis1::URAd u r d 0.00 0.08 2 Ura- a MISl u r d 19.1 5.39 3 Ura' a rnis1::URAS u r d 0.00 0.02 4 Ura- a MIS1 u r d 26.7 7.27

dium: 1% yeast extract, 2% Bacto-peptone, 3% glycerol). In fact, the growth rates of a misl::URA3 mutant strain (KSY8) and a MISl wild-type strain (KSY7) in YPG medium are indistinguishable (doubling time = 2.4 h) (data not shown). These results indicate that mitochondrial Cl-THF synthase is not required for mitochondrial protein synthesis in yeast.

Mitochondria contain many folate-dependent enzymes in- cluding serine hydroxymethyltransferase and the glycine cleavage system (41) as well as Cl-THF synthase (10). Genetic studies have demonstrated that certain folate-dependent re- actions in the mitochondria supply one-carbon units for spe- cific biosynthetic processes in the cytoplasm (17, 42). Thus, although mitochondrial Cl-THF synthase is not required for growth on rich media, it may offer an advantage to cells grown under more arduous conditions. However, we found that a misl::URA3 mutant strain (KSYS) and a MZSl wild-type strain (KSY10) grew at the same rate (doubling time = 2.25 h) in minimal medium (0.67% yeast nitrogen base, 2% dex- trose, plus uracil and serine) (data not shown). These results suggest that the products of mitochondrial C1-THF synthase are not required for folate-dependent reactions in the cyto- plasm.

DISCUSSION

We have isolated the gene encoding mitochondrial Cl-THF synthase from S. cerevisiae. In yeast, mitochondrial C,-THF synthase is encoded by a single gene which we have designated MISl . The protein encoded by MISl shows extensive homol- ogy with yeast cytoplasmic C1-THF synthase and clostridial 10-formyl-THF synthetase. Genetic and physical evidence indicates that Cl-THF synthase has two functionally inde- pendent domains (4, 36, 43). Synthetase activity is catalyzed on a 70-kDa carboxyl-terminal domain, and dehydrogenase and cyclohydrolase activities are catalyzed on a 30-kDa amino-terminal domain. The alignment of the amino acid sequence predicted for monofunctional 10-formyl-THF syn- thetase with mitochondrial and cytoplasmic C1-THF syn- thases may define the synthetase domains of the trifunctional proteins. In both mitochondrial and cytoplasmic THF syn- thase, the putative synthetase domain is immediately pre- ceded by a proline-rich region. These proline-rich regions probably have disordered and extended conformations that could act to separate the two domains. Proteolysis studies in our laboratory show that yeast CI-THF synthase can be cleaved with chymotrypsin to generate 70- and 30-kDa pep- tides. The combined proteolytic fragments have each of the activities of the intact enzyme. However, we cannot isolate an active dehydrogenase and cyclohydrolase fragment.3 Here we show that a fragment of the MISl gene which carries

N. Tse and M. Williams, unpublished observations.

sufficient information to encode the dehydrogenase and cy- clohydrolase domain (YEpKS14) does not express a protein with dehydrogenase activity. These data may suggest that an intact synthetase domain is necessary to stabilize the dehy- drogenase and cyclohydrolase domain in yeast Cl-THF syn- thases.

Mitochondria use active one-carbon units for the formyla- tion of the initiator tRNA, methionyl-tRNAmet. The formyl donor in this reaction is 10-formyl-THF, a product of C1- THF synthase and mitochondrial Cl-THF synthase. We found that mutant strains that lack both C1-THF and mito- chondrial Cl-THF synthase can grow on nonfermentable car- bon sources, showing that these enzymes and their products are not required for mitochondrial function. These results can best be explained if mitochondrial protein synthesis can be initiated with unformylated methionyl-tRNAmet.

Although it is generally believed that the formylation of the initiator tRNA is required for protein synthesis in bacteria (44) and in eukaryotic organelles (40, 45), it has been estab- lished that this requirement is not absolute. Streptococcus faecalis can initiate protein synthesis in the absence of for- mylmethionyl-tRNAmet. This organism cannot synthesize folate and normally requires this vitamin for growth. How- ever, the requirement for folate can be entirely replaced by the addition of serine, methionine, thymine, a purine base, and pantothenate to the growth medium (46). Under these folate-deficient conditions, formylmethionyl-tRNAmet is not synthesized, and initiation of protein synthesis proceeds with non-formylated methionyl-tRNA""' (47-49). The ability of this bacteria to initiate protein synthesis without formylated methionyl-tRNAmet is due to a single modification in the initiator tRNA. In folate-sufficient cells, the uracil residue in loop IV is methylated to ribothymine; whereas in folate- deficient cells, this methylation does not occur (50). It was later shown that in S. faecalis a folate derivative, 5,lO-meth- ylene-THF, serves as the methyl donor in this methylation (51).

Similarly, certain E. coli mutants can initiate protein syn- thesis with unformylated methionyl-tRNA'"'. Baumstark et al. (52) isolated mutants that grew in the absence of p - aminobenzoate from a strain that required p-aminobenzoate for growth. These mutants cannot synthesize folate, and the cells contain no 10-formyl-THF. Extracts of the mutant strain support protein synthesis from exogenous mRNA; however, the proteins synthesized are initiated with methionine rather than with formylmethionine. The mutant strain is deficient in tRNA methyltransferase; and as a result, tRNA, from these cells have reduced levels of ribothymidine. Thus, in both folate-deficient S. faecalis and the mutant E. coli strain, the lack of ribothymidine in the tRNA allows initiation of protein synthesis with unformylated methionyl-tRNAmet. We are now directing our efforts toward determining whether the initiator tRNAmet from our ade3 misl mutant strain is for- mylated in vivo to investigate whether a similar mechanism can occur in yeast mitochondria.

Because reduced folates and their derivatives are not trans- ported across the inner mitochondrial membrane (53), it is generally believed that active one-carbon units are independ- ently generated in the mitochondria and the cytoplasm for use in each cellular compartment. However, there is evidence to suggest that one-carbon units generated in the mitochon- dria are used in the cytoplasm. Yeast tmp3 mutants, which lack the mitochondrial form of serine hydroxymethyltransfer- ase, require dTMP, methionine, histidine, and adenine (13, 54). Also, a glycine-requiring Chinese hamster cell line was found to be deficient in the mitochondrial form of serine

Isolation of the Gene Encoding Mitochondrial C1-THF Synthase 7725

hydroxymethyltransferase (42). More recently, Barlowe and Appling4 found that isolated rat liver mitochondria can utilize serine or sarcosine to generate one-carbon units for purine synthesis in the cytoplasm. They propose that a significant fraction of the cell's one-carbon units are generated from serine in the mitochondria via mitochondrial serine hydrox- ymethyltransferase. The 5,lO-methylene-THF generated in this reaction is converted to formate via mitochondrial C1- THF synthase, which can exit the mitochondria to be acti- vatedvia cytoplasmic C1-THF synthase for use in biosynthetic reactions in the cytoplasm. This pathway for generating cy- toplasmic one-carbon units depends on the integrity of mito- chondrial CI-THF synthase; however, we found that the pres- ence of mitochondrial C1-THF synthase offers no advantage to cells growing on minimal medium. Our results indicate that the mitochondrial folate pathway is not essential in yeast, although they do not rule out the possibility that this pathway can act as an alternate route for the synthesis of activated one-carbon units.

Acknowledgments-We thank Jasper Rine and Jeremy Thorner for their helpful suggestions and their critical reading of the manu- script, Morgan Park for his assistance in generating some of the sequencing templates, and Charles Barlowe and Dean Appling for sharing a preprint of their manuscript prior to publication.

1.

2. 3.

4.

5.

6.

7.

8. 9.

10.

11.

12. 13. 14. 15.

16.

17.

REFERENCES

Rabinowitz, J. C. (1960) in The Enzymes (Boyer, P. D., Lardy, H., and Myrback, K., eds) Vol. 2, 2nd Ed., pp. 185-252, Aca- demic Press, New York

Blakely, R. L. (1957) Biochem. J. 65,331-342 MacKenzie, R. E. (1984) in Folates and Pterins (Blakely, R. L.,

and Benkovic, S. J., eds) Vol. 1, pp. 255-306, John Wiley & Sons, New York

Paukert, J. L., Straus, L. D., and Rabinowitz, J. C. (1976) J. Bwl. Chem. 251,5104-5111

Paukert, J. L., Williams, G. R., and Rabinowitz, J. C. (1977) Bwchem. Biophys. Res. Commun. 77,147-154

de Mata, Z. S., and Rabinowitz, J. C. (1980) J. Bwl. Chem. 255,

Tan, L. U. L., Drury, E. J., and MacKenzie, R. E. (1977) J. Biol.

Schirch, L. (1978) Arch. Biochem. Biophys. 189, 283-290 Caperelli, C. A., Chettur, G., Lin, L. Y., and Benkovic, S. J. (1978)

Shannon, K. W., and Rabinowitz, J. C. (1986) J. Biol. Chem.

Nakano, Y., Fujioka, M., and Wada, H. (1968) Biochim. Bwphys.

Fujioka, M. (1969) Biochim. Biophys. Acta 185, 338-349 Zelikson, R. (1976) Eur. J. Biochern. 64, 7-13 Kikuchi, G. (1973) Mol. Cell. Biochem. 1, 169-187 Frisell, W. R., and MacKenzie, C. G. (1962) J. Biol. Chem. 237,

Wittwer, A. J., and Wagner, C. (1981) J. Bwl. Chem. 256,4102-

Zelikson, R., and Luzzati, M. (1977) Eur. J. Biochem. 79, 285-

2569-2577

Chem. 252,1117-1122

Bwchem. Biophys. Res. Commun. 82,403-410

261,12266-12271

Acta 159, 19-26

94-98

4108

292

18. Smith, A. E., and Marcker, K. A. (1968) J. Mol. Biol. 38, 241-

19. Halbreich, A., and Rabinowitz, M. (1971) Proc. Natl. Acad. Sci.

20. Sherman, F., Fink, G. R., and Hicks, J. B. (1986) Methods in Yeast Genetics. Cold Swine: Harbor Laboratorv. Cold Surine

243

U. S. A. 68,294-298

Harbor, NY " I. "

21. Maniatis. T.. Fritsch. E. F.. and Sambrook. J. 11982) Molecular Cloning: A 'hborato'ry Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

22. Hinnen, A., Hicks, J. B., and Fink, G. R. (1978) Proc. Natl. Acad. Sci. U. S. A. 75,1929-1933

23. Alvarado-Urbina, G., Sathe, G. M., Liu, W.-C., Gillen, M. F., Duck, P. D., Bender, R., and Ogilvie, K. K. (1981) Science 214, 270-274

24. Ish-Horowicz, D., and Burke, J. F. (1981) Nucleic Acids Res. 9,

25. Wood, W. I., Gitschier, J., Lasky, L. A., and Lawn, R. M. (1985)

26. Scrimgeour, K. G., and Huennekens, F. M. (1963) Methods En-

27. Rabinowitz, J. C., and Pricer, W. E., Jr. (1962) J. Biol. Chem.

28. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 29. Dente, L., Cesareni, G., and Cortese, R. (1983) Nucleic Acids Res.

30. Henikoff, S. (1984) Gene (Amst.) 28, 351-359 31. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl.

32. Biggin, M. D., Gibson, T.J., and Hong, G. F. (1983) Proc. Natl.

33. Strauss, E. C., Kobori, J. A., Su, G., and Hood, L. (1986) Anal.

34. Vieira, J., and Messing, J. (1982) Gene (Amst.) 19, 259-268 35. Rothstein, R. J. (1983) Methods Enzymol. 101, 202-211 36. McKenzie, K. Q., and Jones, E. W. (1977) Genetics 86,85-102 37. von Heijne, G. (1986) EMBO J. 5,1335-1342 38. Staben, C., and Rabinowitz, J. C. (1986) J. Biol. Chem. 261,

39. Stone, A. B., and Wilkie, D. (1974) J. Gen. Microbiol. 83, 283-

40. Bianchetti, R., Lucchini, G., Crosti, P., and Tortora, P. (1977) J.

41. Blakely, R. L., and Benkovic, S. J. (eds) (1984) Folates and

42. Chasin, L. A., Feldman, A., Konstam, M., and Urlaub, G. (1974)

43. Tan, L. U. L., and MacKenzie, R. E. (1979) Can. J. Biochem. 57,

44. Lengyel, P., and So11, D. (1969) Bacterid. Rev. 33, 264-301 45. Galper, J. B. (1974) J. Cell Bwl. 60, 755-763 46. Snell, E. E., and Mitchell, H. K. (1941) Proc. Natl. Acad. Sci. U.

47. Samuel, C. E., D'Ari, L., and Rabinowitz, J. C. (1970) J. Biol.

48. Samuel, C. E., Murray, C. L., and Rabinowitz, J. C. (1972) J.

49. Samuel, C. E., and Rabinowitz, J. C. (1974) J. Biol. Chem. 249,

50. Delk, A. S., and Rabinowitz, J. C. (1974) Nature 252, 106-109 51. Delk, A. S., Romeo, J. M., Nagle, D. P., Jr., and Rabinowitz, J.

52. Baumstark, B. R., Spremulli, L. L., RajBhandary, U. L., and

53. Cvbulski. R. L.. and Fisher. R. R. (1981) Biochim. B ~ O D ~ V S . Acta

2989-2998

Proc. Natl. Acad. Sci. U. S. A. 82, 1585-1588

zymol. 6, 368-372

237,2898-2902

11,1645-1655

Acad. Sci. U. S. A. 74,5463-5467

Acad. Sci. U. S. A. 80,3963-3965

Biochem. 154,353-360

4629-4637

293

Biol. Chem. 252,2519-2523

Pteridines, Vol. 1, John Wiley & Sons, New York

Proc. Natl. Acad. Sci. U. S. A. 71, 718-722

806-812

S. A. 27, 1-7

Chem. 245,5115-5121

Bwl. Chem. 247,6856-6865

1198-1206

C. (1976) J. Biol. Chem. 251, 7649-7656

Brown, G. M. (1977) J. Bacteriol. 129, 457-471 . ,

-646,329-333 . "

'Barlowe, C. K., and Appling, D. R. (1988) Biofactors, in press. 54. Luzzati, M. (1975) Eur. J. Biochem. 56,533-538