The Upstream Region of the Rpe65 Gene Confers Retinal PigmentEpithelium-specific Expression in Vivo and in Vitro and ContainsCritical Octamer and E-box Binding Sites*

Received for publication, April 21, 2000, and in revised form, July 7, 2000Published, JBC Papers in Press, July 14, 2000, DOI 10.1074/jbc.M003441200

Ana Boulanger‡, Suyan Liu, Abraham A. Henningsgaard§, Shirley Yu, and T. Michael Redmond

From the Laboratory of Retinal Cell and Molecular Biology, NEI, National Institutes of Health,Bethesda, Maryland 20892

RPE65 is essential for all-trans- to 11-cis-retinoidisomerization, the hallmark reaction of the retinal pig-ment epithelium (RPE). Here, we identify regulatoryelements in the Rpe65 gene and demonstrate their func-tional relevance to Rpe65 gene expression. We show thatthe 5* flanking region of the mouse Rpe65 gene, like thehuman gene, lacks a canonical TATA box and consensusGC and CAAT boxes. The mouse and human genes doshare several cis-acting elements, including an octamer,a nuclear factor one (NFI) site, and two E-box sites,suggesting a conserved mode of regulation. A mouseRpe65 promoter/b-galactosidase transgene containingbases –655 to 152 (TR4) of the mouse 5* flanking regionwas sufficient to direct high RPE-specific expression intransgenic mice, whereas shorter fragments (–297 to 152or –188 to 152) generated only background activity. Fur-thermore, transient transfection of analogous TR4/lucif-erase constructs also directed high reporter activity inthe human RPE cell line D407 but weak activity in thenon-RPE cell lines HeLa, HepG2, and HS27. Functionalbinding of potential transcription factors to the octamersequence, AP-4, and NFI sites was demonstrated by di-rected mutagenesis, electrophoretic mobility shift assay,and cross-linking. Mutations of these sites abolished bind-ing and corresponding transcriptional activity and indi-cated that octamer and E-box transcription factors syner-gistically regulate the RPE65 promoter function. Thus, wehave identified the regulatory region in the Rpe65 genethat accounts for tissue-specific expression in the RPEand found that octamer and E-box transcription factorsplay a critical role in the transcriptional regulation of theRpe65 gene.

All-trans- to 11-cis-isomerization of vitamin A is an obligateand tissue-specific enzymatic step in the renewal of 11-cis-retinal, the universal chromophore of rhodopsin and other vis-ual pigment proteins, in the visual cycle (1) of the retinalpigment epithelium (RPE).1 Several components, including 11-

cis-retinol dehydrogenase (2), cellular 11-cis-retinaldehyde-binding protein (CRALBP) (3, 4) and lecithin:retinol acyltrans-ferase (5, 6), all essential to the visual cycle activity, are foundhighly expressed, but not exclusively expressed, in the RPE.However, the retinol isomerase activity (7–9), central to 11-cis-chromophore synthesis, is expected, mechanistically, to behighly tissue-specific. A tissue-specific component of the RPE,RPE65 (10–12), which copurifies with 11-cis-retinol dehydro-genase (2), appears to play a crucial role in retinoid isomeriza-tion. Thus, in the Rpe65-deficient mouse (13), rod photorecep-tor function is abolished due to lack of the 11-cis-retinalchromophore. Furthermore, mutations in the human RPE65gene cause several forms of severe early onset blindness (14–17). Clearly, RPE65 is essential to the visual cycle in generaland to all-trans- to 11-cis-retinoid isomerization in particular.

RPE65 is the major protein of the RPE microsomal mem-brane fraction. The bovine (10), human (18), dog (19), rat (20),and salamander (21) cDNAs have been cloned, as have thehuman (18) and mouse genes.2 RPE65 is specific to the verte-brate RPE and is also highly conserved at the level of proteinsequence. Previous data suggest a complex transcriptional andtranslational regulation of RPE65. At the transcriptional level,our knowledge is limited (22), and we lack functional evidenceconcerning the transcriptional elements involved in the activa-tion of the gene and in its specific expression in the RPE.Transcription of Rpe65 appears to be developmentally regu-lated, with the protein first appearing at about postnatal day 4in the rat (11), coincident with the first appearance of thephotoreceptor outer segments. Reverse transcription-polymer-ase chain reaction (reverse transcription-PCR) analysis ofRPE65 in embryonic and newborn rat suggests a biphasicinduction of RPE65 mRNA expression (20). At the level oftranslation, we have found that a 170-nucleotide region of theRPE65 39 untranslated region acts as a translational inhibitionelement (23). Also, when RPE cells are explanted into culture,they lose expression of RPE65 protein within 2 weeks, althoughthe expression of RPE65 mRNA can continue (10, 11).

Here, we present the sequence of the 59 flanking region of themouse Rpe65 gene and indicate its similarity to the correspond-ing human gene region. We have generated transgenic micecontaining Rpe65 promoter-reporter constructs and show thatthe Rpe65 59flanking region –655 to 152 can drive lacZ re-porter gene expression specifically in the RPE. In addition, we

* The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby marked“advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

The nucleotide sequence(s) reported in this paper has been submittedto the GenBankTM/EBI Data Bank with accession number(s) AF271297.

‡ To whom correspondence should be addressed: NEI-LRCMB, Na-tional Institutes of Health, Bldg. 6, Rm. 339, 6 Center Dr. MSC 2740,Bethesda, MD 20892-2740. Tel.: 301-496-0439; Fax: 301-402-1883; E-mail: soto@helix.nih.gov.

§ Sponsored by the Howard Hughes Medical Institute/MontgomeryCounty (Maryland) Public Schools/National Institutes of Health Intern-ship Program.

1 The abbreviations used are: RPE, retinal pigment epithelium; NFI,

nuclear factor one; CRALBP, cellular 11-cis-retinaldehyde-binding pro-tein; PCR, polymerase chain reaction; bp, base pair(s); X-gal, 5-bromo-4-chloro-3-indolyl b-D-galactopyranoside; b-gal, b-galactosidase; EMSA,electrophoretic mobility shift assay; CTF/NFI, CCAAT-box bindingtranscription factor/nuclear factor one; HLH, helix-loop-helix.

2 S. Liu, A. Boulanger, J. Kammer, E. Harris, S. Yu, and T. M.Redmond, manuscript in preparation.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 275, No. 40, Issue of October 6, pp. 31274–31282, 2000Printed in U.S.A.

This paper is available on line at http://www.jbc.org31274

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

show that this fragment also displays a high transcriptionalactivity in D407 RPE cells in vitro. Furthermore, by directedmutagenesis, electrophoretic mobility shift assay (EMSA), andcross-linking, we demonstrate functional binding of transcrip-tion factors to an octamer sequence and AP-4 and NFI sites andshow their importance to the transcriptional regulation of themouse Rpe65 gene.

EXPERIMENTAL PROCEDURES

DNA Cloning and Sequence Analysis—A P1 clone containing thecomplete mouse Rpe65 gene was isolated (Genomic Systems, St. Louis,MO). Restriction fragments containing the 59 region of the mouse Rpe65gene were identified by Southern blot hybridization to a random-primed32P-labeled bovine cDNA 59 end probe (10). pBluescript subclones con-taining the 59 region of the Rpe65 gene were sequenced. One such clone,E1–12, was found to contain the first three exons of mouse Rpe65, aswell as 2.8 kilobase pairs of 59 flanking region. This was compared withthe sequence of the 59 flanking region of the human RPE65 gene,obtained in the same way (15), using the GeneWorks 2.5 and MacVector6.5 sequence analysis programs (Oxford Molecular, Beaverton, OR).

Reporter Constructs—For transgenic mice, three constructs, TR2,TR3, and TR4, containing sequences included in the mouse 59 flankingregion, were amplified. For amplification, oligonucleotide primer pairscontaining HindIII restriction sites at their 59 ends were used. Theforward oligonucleotide primers used were (restriction sites underlined)as follows: TR4, 59-CCCAAGCTTGCAATGGTGAAGACAGTGA-39;TR3, 59-CCCAAGCTTTACAGTGAGGATAACAGCA-39; and TR2, 59C-CCAAGCTTGATCCAAGTCTGGAAAATA-39. The common reverseprimer used was 59-CCCAAGCTTCTTCCAGTGAAGATTAGAG-39.These fragments were digested with HindIII and subcloned into Hin-dIII-digested pCH126A2 plasmid (24) containing an E. coli lacZ geneand simian virus 40 polyadenylation signal sequences.

For transient transfection luciferase assay, constructs TR3 and TR4were inserted into the plasmid pGL3-Basic (Promega, Madison, WI).The forward primers were the same as those used to amplify TR3 andTR4 fragments during the production of transgenic mice. The commonreverse primer also overlapped with the primer used before, but itlacked four bases at the 39 end.

Site-directed Mutagenesis of the Mouse Rpe65 Promoter—Mutationswere introduced by DNA amplification using QuickChangeTM site-di-rected mutagenesis kit (Stratagene, La Jolla, CA). A total of four site-directed mutants using the pTR4luc plasmid as a template were gen-erated. These were named m1AP4, mNFI, m2AP4, and mOct. 11additional constructs, as well, containing combinatorial mutations intwo, three, or all of the cited elements were created using single, double,or triple mutants as a template, respectively. Mutated oligonucleotidesused for DNA amplification are shown in Table II. The introduction ofmutations was verified by DNA sequencing.

Production and Analysis of Transgenic Mice—DNA constructs weremicroinjected into the male pronuclei of single cell FVB/N mouse em-bryos, which were implanted into pseudopregnant CD1 foster mothers,using standard techniques. Transgenic founder mice and their progenywere identified by PCR of a region common to all of the transgenes. Forsome founders, copy number was estimated by Southern blot analysis ofPstI-digested genomic DNA hybridized with a lacZ gene probe. Trans-genic founders were bred to CD1 mice to generate F1 progeny. b-Ga-lactosidase (b-gal) reporter gene activity was assayed using the chemi-luminescent Galacto-Light Plus assay (Tropix/PE Applied Biosystems,Bedford, MA). Eyes were dissected into three parts: the anterior seg-ment, comprising the cornea, iris, and ciliary body; the posterior seg-ment, comprising the retina, RPE, choroid, and sclera; and the lens.Noneye tissues assayed were brain, liver, lung, heart, kidney, andspleen. For histochemistry, tissues were fixed for 1 h in 4% paraform-aldehyde in phosphate-buffered saline and washed three times in 5-bro-mo-4-chloro-3-indolyl b-D-galactopyranoside (X-gal) rinse buffer (100mM sodium phosphate, pH 7.3, 2 mM MgCl2, 0.01% sodium deoxy-cholate, 0.02% Nonidet P-40). The eyes were stained overnight in asolution of 2 mg/ml X-gal in X-gal rinse buffer containing 5 mM eachpotassium ferrocyanide and potassium ferricyanide. After staining, tis-sues were postfixed in 4% paraformaldehyde and embedded in methac-rylate. Sections were cut at a thickness of 5 mm, counterstained withneutral red, and evaluated for presence of blue product. In addition,stained eyes were postfixed in 4% paraformaldehyde and dissected toremove anterior segment, lens, and retina. The resultant eyecup wasquartered and flat-mounted in 50% glycerol for an en face preparationof the RPE/choroid/sclera complex.

Cell Culture and Transient Transfections—The human retinal pig-

ment epithelium cell line D407 was obtained from Richard C. Hunt (25)and grown in high glucose Dulbecco’s modified Eagle’s medium (LifeTechnologies, Inc.) supplemented with 3% fetal bovine serum, 100units/ml penicillin, 100 mg/ml streptomycin, and 2 mM glutamine.HeLa, HepG2, and HS27 cells were obtained from American TypeCulture Collection (Manassas, VA) and grown in the same medium asused for D407 except that the concentration of fetal bovine serum was10%.

Approximately 2.5 3 105 cells were plated onto six-well tissue culturedishes and allowed to grow for 48–72 h (until 80–90% confluent). Tocorrect for differences in transfection efficiency, 2 mg of each luciferaseplasmid and 90 ng of pSV40/b-gal were added to the cells in a solutioncontaining Superfect transfectant (Qiagen, Chatsworth, CA). Lucifer-ase and b-gal reporter gene activities were assayed using the Dual-Light reporter gene assay (Tropix/PE Applied Biosystems, Bedford,MA). The ratio of luciferase activity to b-gal activity in each sampleserved as a measure of normalized luciferase activity. Experimentswere performed in triplicate at least four times.

EMSA—Nuclear extracts from D407 and freshly dissected RPE bo-vine cells were prepared by the method of Dignam et al. (26). For EMSA,double-stranded oligonucleotides (Table II) were labeled with polynu-cleotide kinase and [g-32P]dATP (6000 Ci/mmol). Approximately 15 mgof nuclear extract were added to binding buffer (33 mM Tris-HCl, pH7.5, 166 mM NaCl, 1.6 mM dithiothreitol), 4 mg of poly(dI-dC), 0.04%Nonidet P-40, 8% glycerol, and 32P-labeled probe (30,000–50,000 cpm)and incubated at room temperature 30 min. For the competition assay,a 50–2000-fold molar excess of unlabeled wild type, mutant, or nonspe-cific competitor oligonucleotide was used along with the labeled probe.The DNA-protein complexes were resolved on 5% polyacrylamide gelsin 0.53 Tris borate-EDTA buffer and visualized by autoradiography.For antibody supershifts, nuclear extracts were incubated with 1 ml ofCTF/NFI polyclonal antibody (provided by Naoko Tanese) or 4 ml ofa-Oct-1 monoclonal antibody (provided by Winship Herr, isotype IgG1,k) for 1 h at room temperature prior to addition of labeled probe.

Corresponding preimmune serum was used as a control in the NFIsupershift assay. Medium containing Dulbecco’s modified Eagle’s me-dium supplemented with 10% fetal bovine serum and antibiotics and anOct-2 antibody (provided by Winship Herr) with the same isotype as thea-Oct-1 antibody were used as controls in the supershift assays.

Cross-linking—For cross-linking experiments, thymidines were sub-stituted by 5-bromo-deoxyuridine in one oligonucleotide strand. Afterincubation with the probe in the same conditions described above,samples were cross-linked for 10 min under UV radiation in a Strata-linker. For molecular weight determinations, samples were electro-phoresed on a 12% polyacrylamide-Tris-HCl gel (Bio-Rad) in 13 Tris-glycine-SDS buffer.

RESULTS

Sequence Conservation of the Mouse and Human 59 FlankingRegions—We have sequenced approximately 2.8 kilobase pairsof 59 flanking region upstream of the putative transcriptionstart site of the mouse Rpe65 gene (Fig. 1A; numbered 11based on homology with the human gene (22)) and searched forsequences evolutionarily conserved between the mouse andhuman Rpe65/RPE65 genes 59 flanking regions. When 2.8kilobase pairs of the 59 flanking region of the mouse and humanRpe65/RPE65 genes were compared by dot matrix analysis, adiagonal of similarity was seen distally to approximately –1200with a short region of similarity closer to the 59 end of eachsegment (data not shown). The proximal 628 and 581 nucleo-tides of the human and mouse 59 flanking regions, respectively,and 59 untranslated regions were compared by ClustalW align-ment (Fig. 1B). Many conserved blocks of sequence were notedbetween the two, including NFI (at –178 to –165), octamer (at–498 to –491), and two E-box consensus (at –84 to –79 and–257 to –252) binding sites. The overall homology is over 70%.A possible site homologous to the human CRALBP gene (27)element, noted by Nicoletti et al. (22) in the human RPE65 59flanking region is present at –72 to –63 in the mouse Rpe65 59flanking region. This element, however, is not represented inthe mouse CRALBP gene promoter. The NFI site in both geneshas a similar intervening nonconsensus sequence (AAA(T/C)A)only seen previously in the human RPE65 gene (22), but the

Rpe65 Gene Promoter Confers Tissue-specific Expression 31275

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

FIG. 1. The 5* flanking and 5* untranslated region of the mouse Rpe65 gene. A, the 59 flanking region of the mouse Rpe65 gene. Basedon homology with the human gene (22), the mouse Rpe65 transcriptional start site is numbered 11. A nonconsensus possible TATA box isunderlined and labeled (?TATA). Various consensus binding sites (AP-4, NFI, and octamer) are underlined and labeled. The 59 ends of fragmentsused to generate transgene constructs (TR2, TR3, and TR4) are indicated by asterisks. Each fragment is indicated by an underlined boldfacedesignation (TR2–TR4). This sequence has been submitted to GenBankTM (accession number AF271297). This sequence has been scanned againstthe GenBank data base (July 1999), and the only sequence with significant relatedness identified was the 59 untranslated region of the rat RPE65cDNA (AF035673). B, optimal alignment of mouse and human Rpe65/RPE65 proximal promoter sequences. Conserved nucleotides are boxed andshaded, and consensus-binding elements for transcription factors are indicated. Putative Ret1/PCE1, TATA box, and human CRALBP, as well asAP-4, NFI, and octamer gene elements are also indicated.

Rpe65 Gene Promoter Confers Tissue-specific Expression31276

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

consensus binding half-sites (TGGA-N5-GCCA) match per-fectly with the CTF/NFI family consensus. The two E-box sitesare consensus basic helix-loop-helix (HLH) protein bindingsites, although Nicoletti et al. (22) specifically ascribed them toAP-4. An octamer sequence was also identified in both promot-ers; they differed by only one nucleotide from the consensusoctamer sequence ATGCAAAT. Both human and mouse geneslack consensus GC and CAAT boxes. A possible TATA box wasidentified at –27 to –20 in the human gene (22), although, as inthe mouse gene, it is somewhat deviated from consensus (28,29). In addition, sequences similar to motifs found in otherretina-specific genes, including interphotoreceptor retinoid-binding protein (IRBP) (30) and CRALBP (27), were identified.Although similar sequences were found in the human RPE65gene proximal promoter (22), it is not yet clear what role, if any,these play in the overall activity of the Rpe65 gene.

Analysis of Rpe65 Promoter-driven LacZ Activity in Trans-genic Mouse Tissues—To identify sequence elements and tran-scriptional factors responsible of Rpe65 expression, we firstdetermined the minimal Rpe65 promoter sequence necessaryfor the in vivo specific expression of the Rpe65 gene in the RPE.We made three constructs containing the upstream sequence ofthe Rpe65 gene coupled to the lacZ gene/SV40 poly(A) signalsequence, and we analyzed their corresponding b-gal activity intransgenic mice. These contained the following sequence posi-tions (construct name in parentheses): –188 to 152 (TR2), –297to 152 (TR3), and –655 to 152 (TR4). Microinjection of theseconstructs into fertilized oocytes resulted in the generation ofseveral founder lines for each construct. Copy number wasestimated by comparing the hybridization signal of probe withgenomic DNA from transgenic mice to serial dilutions of aknown quantity of the relevant linearized construct. The num-ber of founders analyzed and the number of copies and b-galexpression levels of each construct are presented in Table I.

Although RPE65 has been shown to be expressed specificallyin the RPE of the eye and is not found in nonocular tissues (11),we surveyed expression of RPE65 promoter-lacZ gene con-structs in a variety of tissues. We assayed eye tissues (theanterior segment, comprising the cornea, iris and ciliary body;the posterior segment, comprising the retina, RPE, choroid,and sclera; and the lens) and noneye tissues (brain, heart, lung,liver, kidney, and spleen) from transgenic and nontransgenicF1 or F2 littermates for b-gal activity. We found that theconstructs pTR2lacZ (–188/152, not shown) and pTR3lacZ(–297/152) produced only background b-gal activity in controlor transgenic animals in all tissues assayed (Fig. 2A). However,the longest construct pTR4lacZ (–655/152) exhibited an aver-age of about 15-fold higher b-gal activity than the control in theposterior segment, but no significant difference in other ocularand nonocular tissues (Fig. 2B). The values obtained for TR3

(progeny of founder 12) are shown in Fig. 2A, and those ob-tained for TR4 (progeny of founder 3) are shown in Fig. 2B.Concerning TR4, very similar values were obtained for F1progeny of founder 6 and 184, but founder 190 had values 75%lower than these.

Discernible staining was seen only in the eyes of pTR4lacZ(–655/152) transgenic animals (founders 3, 6, and 184). At thegross level, staining of the whole eyes revealed a punctatepattern (Fig. 3A). In sections of these eyes examined by lightmicroscopy, the blue X-gal product was seen to be restricted inits distribution to the RPE cells of transgenic mice (Fig. 3C),whereas none was present in nontransgenic littermates (Fig. 3,B and D). No staining of lens, anterior segment, or neuralretina was observed in transgenic and nontransgenic animals(data not shown). Staining of the RPE was patchy, however,and this was best appreciated by en face light microscopy oftransgenic RPE/choroid/sclera flat mount (Fig. 3E). Again, nostaining was present in nontransgenic littermate controls (Fig.3F). Although most, if not all, cells of the RPE demonstratedsome level of X-gal staining in the cytoplasm, about 15% of cellswere much more highly stained and filled with blue product.

Analyses of fixed TR4 noneye tissues stained with X-gal didnot reveal any detectable staining except for the founder 6progeny, which showed an ectopic b-gal expression in the cer-ebellum. RPE65 is not expressed in brain (11) or cerebellum.3

Analysis of the Rpe65 Promoter-driven Luciferase Activity inVitro—To better understand the transcriptional regulation ofthe Rpe65 gene, we searched for a cellular model capable ofactivation of the mouse Rpe65 promoter. Although only tracesof RPE65 mRNA are detected by PCR in nonconfluent culturesof the human RPE cell D407 (data not shown), it has beendemonstrated that these cells are able to activate a humanRPE65 promoter (22). Thus, to test its activity and specificityin vitro, the promoter fragment TR4 (–655 to 1 52) was cloned

3 T. M. Redmond, unpublished data.

TABLE Ib-Gal activity in transgenic mouse lines

Construct Founder na Copy no.b PS-bgalc Ectopicd

TR2 4 6 NDe 2 2TR3 8 12 1 2 2

12 10 1 2 Retina9 4 ND 2 2

TR4 3 6 2 111 26 30 2 111 Cerebellum

184 3 ND 111 2190 1 ND 1 2

a Number of mice analyzed.b Number of transgene copies integrated.c b-Gal expression in the posterior segment (PS) of the eye. 111, 1,

and 2 represent comparison of b-gal activity. 111, high expression; 1,low expression; 2, no expression.

d Ectopic b-gal expression in non-RPE tissues.e ND, value not determined.

FIG. 2. Rpe65 promoter-driven LacZ activity in transgenicmouse tissues. Eye tissues, including anterior segment (AS), posteriorsegment containing the RPE (PS), and lens (Le), and noneye tissues,including brain (Br), heart (He), lung (Lu), liver (Li), kidney (Ki), andspleen (Sp), from transgenic and nontransgenic (control) F1 or F2littermates were assayed for b-gal activity. The blank (Bl) contained allof the assay reagents but with no tissue. A, pTR3lacZ (–297/152); B,pTR4lacZ (–655/152). The means and S.E. are shown (n $ 3).

Rpe65 Gene Promoter Confers Tissue-specific Expression 31277

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

into the luciferase reporter vector pGL3-Basic and transfectedinto D407 cells. To show the cellular specificity of the vector, itwas also transfected into the non-RPE cell lines HeLa, HepG2,and HS27. None of these latter cell lines or the tissues fromwhich they are derived (cervix, liver, and skin, respectively)express the RPE65 mRNA.

Our results show that luciferase activity generated bypTR3luc was very low and was similar in all of the cell linestested. In HeLa, HepG2, and HS27, pTR4luc activity was alsosimilar to that produced by pTR3luc (2.6, 2.2, and 2.6 timeshigher, respectively, than luciferase activity generated bypGL3-Basic alone). In contrast, in D407 cells, pTR4luc gener-ated activity 10–15 times higher than that generated by con-trol plasmid alone (Fig. 4).

Mutational Analysis of the Rpe65 Promoter—To identifyfunctionally important elements in the Rpe65 promoter, mu-tated derivatives of the TR4 promoter fragment (–655 to 152)cloned into pGL3-Basic (pTR4luc) were constructed and trans-fected into D407 cells (oligonucleotides used for directed mu-tagenesis are shown in Table II). The mutation (TGGAAAAT-AGCCAA f TGGAAAATATAAAA) introduced into the NFIsite (31) (located at position –178 to –165) had only a minorpositive effect on promoter activity (Fig. 5A). In contrast, mu-tations of the core sequence of the two potential AP-4 bindingsites, 1AP-4 (TCAGCTGAGG f TCCATCGAA) and 2AP-4(TCAGCTCAGG f TCATTAATT), located at positions –84 to

–79 and –257 to –252, reduced promoter activity by 67 and60%, respectively (Fig. 5A). In addition, mutations of the octa-mer sequence (ATGCAAAG f CCACACCA), located at posi-tion –498 to –491, reduced promoter activity by 67%.

Because none of these individual mutations completely abol-ished promoter activity, we next constructed combination mu-tants. The double combination of mutations in the 1AP-4 and2AP-4 or octamer site had a greater effect than either mutationalone (Fig. 5B), dramatically reducing promoter activity byabout 78%, although the double mutant retained measurablepromoter activity (3.5-fold the level of vector alone). Interest-ingly, a vector containing mutated 1AP-4, 2AP-4, and octamersites further lowered luciferase activity (85% reduction com-pared with the wild type vector; Fig. 5C). This suggested thatthe E-box and octamer sequences are critical Rpe65 promoterelements. Finally, combinations that included the mutated NFIsite together with an octamer mutation increased the luciferaseactivity obtained, compared with the values when this site wasnormal (Fig. 5, B and C).

Specific Interactions of D407 and Bovine-RPE Nuclear Pro-teins with Elements in the Rpe65 Promoter—To determinewhether transcription factors binding to the potential NFI,octamer, and AP-4 sites in the Rpe65 promoter were present invivo and in vitro, we performed EMSA using bovine-RPE nu-clear proteins from freshly dissected bovine RPE tissue andD407 cells. A pattern consisting of three specific complexeswas observed when either bovine RPE or D407 nuclear ex-tracts were incubated with a labeled probe containing theNFI site. Each of these three complexes showed a similarmobility between the two nuclear extracts, and these wereinhibited by addition of a 370-fold molar excess of cold com-petitor (Figs. 6B and 7B).

Incubation of bovine RPE or D407 nuclear extract with thedownstream (1AP-4) (Figs. 6A and 7A) or the upstream (2AP-4)(Figs. 6C and 7C) AP-4 site resulted in the formation of aspecific complex with each AP-4 probe. However, transcriptionfactors bound to these sites with different affinities. In fact, thesingle complex formed with the 1AP-4 probe was observed onlyafter 10 min of cross-linking (only traces were seen withoutcross-linking). A complex composed of a doublet was obtainedwith both nuclear extracts when 2AP-4 was used as a probe. Inall cases, complexes were competed in the presence of an excess

FIG. 3. The pTR4lacZ(–655/152) transgene directs RPE-spe-cific expression of reporter gene activity. Whole eyes from trans-genic (A) and nontransgenic (B) littermates were fixed and stained inX-gal substrate solution. Punctate blue staining (arrows) revealed thepresence of b-gal reporter expression in the RPE visible through thescleral coat. Eyes were fixed and stained in X-gal substrate solution.Transgenic (C) and nontransgenic (D) eyes were embedded in methac-rylate and sectioned. Ch/Sc, choriocapillaris and sclera. Transgenic (E)and nontransgenic (F) eyes were dissected and flat-mounted in 50%glycerol and examined en face. C and E, arrows indicate RPE cells withlow to moderate accumulation of blue X-gal product. Arrowheads indi-cate intensely stained cells filled with blue X-gal product.

FIG. 4. Comparison of in vitro transient transfection expres-sion of TR3 and TR4 in different RPE and non-RPE cell lines.The constructs pTR3luc and pTR4luc were transiently transfected intoD407, HeLa, HepG2, and HS27 cell lines, and luciferase reporter geneactivity was assayed. The activities of the luciferase reporter genewere expressed as fold relative to the activity of pGL3-Basic (whichwas assigned an activity value of 1.0). The means and S.E. are shown(n $ 4).

Rpe65 Gene Promoter Confers Tissue-specific Expression31278

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

of cold competitor but not in the presence of a similar excess ofmutated or nonspecific competitor.

Incubation of D407 nuclear extract with the Oct-1 proberesulted in the formation of two complexes. The lower molecu-lar weight complex was competed away by a 250-fold molarexcess of cold wild type competitor but not by cold mutant orirrelevant competitor, whereas the higher molecular weightcomplex was not inhibited by cold mutant competitor and wasjudged to be nonspecific (Fig. 7D). Only one complex was ob-served when the bovine-RPE nuclear extract was incubatedwith the Oct-1 probe (Fig. 6D); this complex migrated with thesame mobility as the smaller one observed with the D407nuclear extract. No complex was seen when any of the labeledmutant oligonucleotides were incubated with either of the nu-clear extracts. These results suggest that these sites bind pro-teins involved in the regulation of the Rpe65 promoter.

Transcription Factors CTF/NFI and a-Oct-1 Bind to theRPE65 Promoter—Antibodies against CTF/NFI and a-Oct-1were used to characterize the transcription factors involved inthe binding of the D407 nuclear extracts with the NFI andOct-1 probe, respectively. The polyclonal CTF/NFI antibodycompletely supershifted the three complexes seen with NFI inthe absence of antibody (Fig. 8A, panel 1). However, although asupershifted band was also detected in the presence of themonoclonal a-Oct-1 antibody and the corresponding probe (Fig.8A, panel 2), most of the complex was not supershifted, indi-cating that some other factor(s) may also be implicated in thebinding to the octamer site. Alternatively, this result may bedue to the restrictive epitope recognition of monoclonal anti-

bodies. Supershift was absent when the samples were incu-bated with the corresponding preimmune serum (Fig. 8A, panel1) or media containing 10% fetal bovine serum (Fig. 8A, panel2), respectively, for each probe. A similar negative result wasobserved when an Oct-2 antibody with the same isotype as thea-Oct-1 antibody was used as a control (data not shown).

The lack of available AP-4 antiserum precluded confirmationof AP-4 as a component of the complexes identified by EMSAwith the two AP-4 probes. However, we performed UV cross-linking assays using the 1AP-4 probe and a D407 nuclearextract in order to determine the molecular weight of the com-plexes observed by EMSA. A higher band of 120 kDa and alower band of 50 kDa were observed with both AP-4 probes(Fig. 8B). Both of the bands were competed away with a 2000-fold molar excess of cold probe but not with the same excess ofan irrelevant competitor. These sizes correspond to those ob-served before for AP-4 by Mermod et al. (32).

DISCUSSION

RPE65 is, to date, the only known RPE-specific component ofthe RPE-specific all-trans- to 11-cis-retinoid isomerizationmechanism known as the visual cycle. To understand themechanism of this tissue specificity, we have characterized theRpe65 promoter in vivo and in vitro. In this paper, we showthat the –655 to 152 region of the mouse Rpe65 promoterconfers tissue-specific expression in vivo and in vitro, and wedefine elements within this sequence that are crucial to thisexpression.

Our first goal was to identify a region of the 59 flanking

TABLE IIOligonucleotides used for EMSA and directed mutagenesis

Respective binding sequences are in boldface. Base substitutions are noted in all the mutated oligonucleotides (m). 5Br, 5-bromodeoxyuridine (5).

Name Position Sequence (59-39)

Oct-1 2515 to 2475 GATAGCAGGGTTAAAACATGCAAAGACAGCACCTCATATACOct-1m 2515 to 2475 –––––––––––––––––CCA––CCA––––––––––––––––2AP-4 2271 to 2237 GATGACTGAGGTCAGCTCAGGACTGCATGGCAGGC2AP-4m 2271 to 2237 ––––––––––––––AT–A–TT––––––––––––––NFI 2187 to 2155 ATCCAAGTCTGGAAAATAGCCAAAACACTGTTANFIm 2187 to 2155 ––––––––––––––––––TAA––––––––––––EBNA-1 AATTGAGCTCGGTACCCGGGGATCCTATCTGGGTAGCATAT

GCTATCCTAATGGATCCTCTAGAGTCGACCTGGAGGCATGC1AP-4 2102 to 264 CTTTTGTTACCTTCCATCAGCTGAGGGGTGGAGAGGGTTC1AP-4m 2102 to 264 ––––––––––––––––––CATC––A–––––––––––––––1AP-4–5Br 264 to 2102 GAACCC5C5CCACCCC5CAGC5GA5GGAAGG5AACAAAAG

FIG. 5. Effect of mutations onmouse Rpe65 promoter activity. Puta-tive cis-acting elements identified withinthe Rpe65 promoter are indicated, as arethe locations of the different mutations(3). D407 cells were transfected withpTR4luc (WT) or mutated pTR4luc (m)constructs. In all panels, the promoter ac-tivity of the WT and the constructs con-taining single mutations (A), double mu-tations (B), and triple or quadruplemutations (m4) (C) are shown. The activ-ities of the luciferase reporter gene wereexpressed as fold relative to the activity ofpGL3-Basic (which was assigned an activ-ity value of 1.0). The means and S.E. areshown (n $ 4).

Rpe65 Gene Promoter Confers Tissue-specific Expression 31279

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

region of the Rpe65 gene that reliably conferred in vivo RPE-specific expression. Our results from transgenic mice showedthat the upstream region of the Rpe65 gene (–655 to 152)confers RPE-specific expression in adult animals, with no ex-pression in nonocular tissues. b-Gal expression was also ob-served in mice at postnatal day 4 (data not shown), correlatingwith RPE65 expression (11). Histology of adult mouse eyesshowed a patchy nature of the RPE-specific expression. Thiskind of nonhomogeneous spotty staining pattern has been ob-served before in other transgenic mouse tissues (33). Althoughectopic expression was observed in cerebellum of progeny offounder 6, this was likely a result of integration of the trans-gene into or next to a cerebellum-expressed gene.

Shorter fragments (–297 to 152 and –188 to 152) did notconfer activity in transgenic animals, indicating that a crucialelement(s) is present in the –655 to –297 interval. It is inter-esting that although the mRNA for RPE65 has been detectedby reverse transcription-PCR in salamander cone photorecep-tors (21), we detected no staining of retinal cells, including conephotoreceptors.

Because transgenic animal production is a long-term proce-dure and unsuited to testing the effects of multiple mutations,we used an RPE cell line to perform in vitro experiments.However, expression levels of the Rpe65 gene are low or non-existent in RPE cell lines (34)4 when compared with the in vivoexpression in cells obtained from freshly dissected bovine eye.Variation in mRNA expression levels between in vivo and invitro may result from changes due to immortalization andsubsequent multiple passage of cell lines. Alternatively, repres-sion of the endogenous Rpe65 gene in cell lines may be due toits context within chromatin. Because a transfected luciferasereporter gene is likely not to be in the same repressive chro-matin context as the endogenous gene, its expression may bedetected in a transient transfection assay if the transcriptional

4 A. Boulanger and T. M. Redmond, unpublished data.

FIG. 6. Determination of bovine RPE nuclear protein bindingto the Rpe65 promoter by EMSA. The indicated radiolabeled oligo-nucleotide probes (lanes 1–5) and the corresponding mutated oligonu-cleotides (lanes 6 and 7) were incubated with (1) or without (–) bovineRPE nuclear extract, in the presence (probe A, 2000; probe B, 370; probeC, 50; probe D, 250-fold molar excess) or absence of cold wild type (WT),mutant, or nonspecific (N/s) competitors, as indicated. Specific com-plexes are indicated by arrows. A, 1AP-4 site probe (bp –102 to –64);nonspecific competitor, bp –187 to –155. B, NFI site probe (bp –187 to–155); nonspecific competitor, EBNA sequence. C, 2AP-4 site probe (bp–271 to –237); nonspecific competitor, bp –187 to –155. D, Oct-1 siteprobe (bp –515 to –475); nonspecific competitor, bp –271 to –237.

FIG. 7. Determination of D407 nuclear proteins binding to theRpe65 promoter by EMSA. The indicated radiolabeled oligonucleo-tide probes (lanes 1–5) and the corresponding mutated oligonucleotides(lanes 6 and 7) were incubated with (1) or without (–) bovine RPEnuclear extract, in the presence (probe A, 2000; probe B, 370; probe C,50; probe D, 250 molar excess) or absence of cold wild type (WT),mutant, or nonspecific (N/s) competitors, as indicated. Specific com-plexes are indicated by arrows. A, 1AP-4 site probe (bp –102 to –64);nonspecific competitor, bp –187 to –155. B, NFI site probe (bp –187 to–155); nonspecific competitor, EBNA sequence. C, 2AP-4 site probe (bp–271 to –237); nonspecific competitor, bp –187 to –155. D, Oct-1 siteprobe (bp –515 to –475); nonspecific competitor, bp –271 to –237.

FIG. 8. Transcription factors binding to the Rpe65 promoter.The indicated radiolabeled probes NFI (A) and Oct-1 (B) were incubatedwith (1) or without (–) D407 nuclear extract in the presence or absenceof the corresponding antibodies. A, panel 1, 1 ml of CTF/NFI antibody;A, panel 2, 4 ml of a-Oct-1 antibody. Supershifted complexes are indi-cated by arrows. B, UV-cross-linking analysis of the nuclear proteinbinding to 1AP-4–5-bromodeoxyuridine (1AP-4–5Br) oligo. Radiola-beled 1AP-4–5-bromodeoxyuridine probe was incubated with (1) orwithout (–) D407 nuclear extract before 10 min UV exposure in thepresence or absence of a 2000-fold molar excess of cold wild type (WT)or nonspecific bp –178 to –165 (N/s) competitor.

Rpe65 Gene Promoter Confers Tissue-specific Expression31280

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

elements necessary for this activation are present. A very lowlevel of RPE65 mRNA was detectable by reverse transcription-PCR in 80% confluent cultures of the human RPE cell lineD407 (not shown). Nicoletti et al. (22) reported that D407 is theRPE cell line that showed the highest transcriptional activitywhen transfected with a reporter human RPE65 promoter-luciferase vector. Accordingly, we used this cell line for trans-fection experiments to determine the minimal promoter se-quence and to study the transcriptional elements necessary toinduce luciferase expression. Our results showed that, as invivo, the TR4 fragment induces the highest levels of luciferaseexpression, indicating that most, if not all, of the positive ele-ments regulating the Rpe65 promoter activity in the RPE areindeed located in the –655 to 152 bp promoter sequence. Con-sequently, transcription factors binding to the AP-4, NFI, andoctamer elements appeared to be obvious candidates for theRpe65 specific gene expression in the RPE.

Specific and similar binding was detected by EMSA withnuclear extracts obtained either from freshly dissected bovineRPE cells or from D407, indicating that the same nuclearproteins may be involved in the Rpe65 gene expression both invivo and in vitro. We found that mutations performed both inthe AP-4 sites and in the octamer sequence completely dis-rupted the binding of nuclear proteins to these sites. In addi-tion, these mutations introduced into the pTR4luc vector re-duced the transcriptional activity of these potential elements.Although mutations of the upstream and downstream AP-4sites separately reduced Rpe65 promoter activity by 67 and60%, respectively, it was diminished by 78% by mutation ofboth together. Concurrent mutation of the octamer sequencefurther decreased transcriptional activity. This suggests a syn-ergistic positive action of the transcription factors binding tothese three sites in the transcriptional regulation of the Rpe65gene.

Synergism of HLH and octamer binding proteins with them-selves, between HLH and octamer binding proteins, and evenof each with other proteins is consistent with previous studies.HLH proteins can act in concert with other HLH proteins toactivate transcription. For instance, late transcription of SV40activated by AP-4 is augmented by the addition of transcriptionfactor AP-1 (32). Also, although MyoD can bind single sites, itmust bind to multiple sites or adjacent to other transcriptionfactors to activate muscle-specific genes (35, 36). Recently,tissue specific expression of the tyrosine hydroxylase gene hasbeen shown to involve synergy between an HLH motif and anadjacent AP-1 site (37). In addition, the rat insulin gene isapparently transactivated by synergism between the Pan HLHfactor and lmx-1, a homeodomain-containing protein (38). Inthe case of octamer factors, Oct-2 has been shown to bindcooperatively to adjacent heptamer and octamer sites to syn-ergistically activate immunoglobin-chain gene promoters (39).Numerous other examples of synergy of octamer factors withother transcription factors exist (40–42).

Given that Oct-1 can participate in tissue-specific expression(43–47), Oct-1 and AP-4 are potentially the major determi-nants of Rpe65 promoter activity in RPE cells, both in vivo andin vitro. Their presence alone, however, might not account forthe specificity of the promoter, because Oct-1 is ubiquitouslyexpressed and AP-4 is expressed relatively widely. Thus, onepossibility is that a threshold level of one of these is requiredfor activation of the promoter. Another possibility is that theoctamer sequence is recognized by other octamer factors, be-cause it has been shown that Oct-1 and Oct-2 factors can bindto the same octamer sequence (39). In addition, cell-specificenhancers that contain octamer binding sites tend to bindOct-1 weakly (48). Furthermore, it has been shown that a

cervical cell-specific octamer factor binds a nonconsensus octa-mer site more strongly than the octamer consensus (49). Thus,it is tempting to speculate that octamer motifs in the Rpe65promoter may represent the binding site of an RPE-restrictedfactor, active alone or as a trans-activator by binding to aubiquitous octamer factor as Oct-1. This might account for theweak supershift observed in the presence of a-Oct-1 monoclonalantibody. Finally, it is conceivable that RPE65 expression innon-RPE cells is repressed by a negative-acting factor. Oneexample of such a factor is neuronal restrictive silencer fac-tor/RE1 (represor element 1)-silencing transcription factor(NRSF/REST), required for repression of multiple neuronaltarget genes in nonneuronal cells (50, 51).

The role of NFI in the Rpe65 transcriptional regulation is notclear. Our results indicated that NFI specifically binds to theRpe65 promoter and also that luciferase reporter activity in-creases when the NFI site is mutated in combination with theoctamer mutation. This might suggest a weakly negative effectof NFI in Rpe65 gene expression.

In summary, we have established that the proximal pro-moter region of the mouse Rpe65 gene can direct RPE-specificexpression of a b-gal reporter construct in transgenic mice. Wehave also found that HLH and octamer-binding factors cansynergistically regulate the Rpe65 gene and that mutations inthese elements abolish transcriptional activity and preventbinding of the corresponding proteins. An NFI element is alsoinvolved but might act in a negative context. Although theregulation of Rpe65 gene expression provides a paradigm oftissue specific gene regulation, further investigation will benecessary to understand these mechanisms fully. In particular,identification and characterization of transcription factorsbinding to the transcriptional elements described is required.Such experiments are under way.

Acknowledgments—We thank the staff of the NEI Transgenics andGenomic Manipulation Section, Laboratory of Molecular and Develop-mental Biology (Dr. Eric Wawrousek, Susan Dickinson, and Steve Lee)for their technical help in producing the transgenic mice used in thisstudy. We thank Drs. Peggy Zelenka and Susan Gentleman for criticalreading of the manuscript and helpful suggestions. We also thank Dr.Gerry Robison for help in the histology work, Dr. Naoko Tanese (Uni-versity of New York, Medical Center) for helpful comments and theCTF/NF1 antibody, Dr. Winship Herr (Cold Spring Harbor Laboratory)for the a-Oct-1 and Oct-2 antibodies, and Dr. Richard Hunt (Universityof South Carolina, School of Medicine), who provided us with the D407cell line.

REFERENCES

1. Saari, J. C. (2000) Invest. Ophthalmol. Visual Sci. 41, 337–482. Simon, A., Hellman, U., Wernstedt, C., and Eriksson, U. (1995) J. Biol. Chem.

270, 1107–11123. Saari, J. C., and Bredberg, D. L. (1988) Exp. Eye Res. 46, 569–5784. Saari, J. C., Bredberg, D. L., and Noy, N. (1994) Biochemistry 33, 3106–31125. Saari, J. C., and Bredberg, D. L. (1988) J. Biol. Chem. 263, 8084–80906. Ruiz, A., Winston, A., Lim, Y. H., Gilbert, B. A., Rando, R. R., and Bok, D.

(1999) J. Biol. Chem. 274, 3834–38417. Bernstein, P. S., and Rando, R. R. (1986) Biochemistry 25, 6473–64788. Deigner, P. S., Law, W. C., Canada, F. J., and Rando, R. R. (1989) Science 244,

968–9719. Winston, A., and Rando, R. R. (1998) Biochemistry 37, 2044–2050

10. Hamel, C. P., Tsilou, E., Pfeffer, B. A., Hooks, J. J., Detrick, B., and Redmond,T. M. (1993) J. Biol. Chem. 268, 15751–15757

11. Hamel, C. P., Tsilou, E., Harris, E., Pfeffer, B. A., Hooks, J. J., Detrick, B., andRedmond, T. M. (1993) J. Neurosci. Res. 34, 414–425

12. Hamel, C. P., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., and Redmond,T. M. (1994) Genomics 20, 509–512

13. Redmond, T. M., Yu, S., Lee, E., Bok, D., Hamasaki, D., Chen, N., Goletz, P.,Ma, J. X., Crouch, R. K., and Pfeifer, K. (1998) Nat. Genet. 20, 344–351

14. Morimura, H., Fishman, G. A., Grover, S. A., Fulton, A. B., Berson, E. L., andDryja, T. P. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3088–3093

15. Marlhens, F., Bareil, C., Griffoin, J. M., Zrenner, E., Amalric, P., Eliaou, C.,Liu, S. Y., Harris, E., Redmond, T. M., Arnaud, B., Claustres, M., andHamel, C. P. (1997) Nat. Genet. 17, 139–141

16. Marlhens, F., Griffoin, J. M., Bareil, C., Arnaud, B., Claustres, M., and Hamel,C. P. (1998) Eur. J. Hum. Genet. 6, 527–531

17. Gu, S. M., Thompson, D. A., Srikumari, C. R., Lorenz, B., Finckh, U., Nicoletti,A., Murthy, K. R., Rathmann, M., Kumaramanickavel, G., Denton, M. J.,and Gal, A. (1997) Nat. Genet. 17, 194–197

Rpe65 Gene Promoter Confers Tissue-specific Expression 31281

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

18. Nicoletti, A., Wong, D. J., Kawase, K., Gibson, L. H., Yang-Feng, T. L.,Richards, J. E., and Thompson, D. A. (1995) Hum. Mol. Genet. 4, 641–649

19. Aguirre, G. D., Baldwin, V., Pearce-Kelling, S., Narfstrom, K., Ray, K., andAcland, G. M. (1998) Mol. Vis. 4, 23

20. Manes, G., Leducq, R., Kucharczak, J., Pages, A., Schmitt-Bernard, C. F., andHamel, C. P. (1998) FEBS Lett. 423, 133–137

21. Ma, J., Xu, L., Othersen, D. K., Redmond, T. M., and Crouch, R. K. (1998)Biochim. Biophys. Acta 1443, 255–261

22. Nicoletti, A., Kawase, K., and Thompson, D. A. (1998) Invest. Ophthalmol.Visual Sci. 39, 637–644

23. Liu, S. Y., and Redmond, T. M. (1998) Arch. Biochem. Biophys. 357, 37–4424. Goring, D. R., Rossant, J., Clapoff, S., Breitman, M. L., and Tsui, L. C. (1987)

Science 235, 456–45825. Davis, A. A., Bernstein, P. S., Bok, D., Turner, J., Nachtigal, M., and Hunt,

R. C. (1995) Invest. Ophthalmol. Visual Sci. 36, 955–96426. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11,

1475–148927. Kennedy, B. N., Goldflam, S., Chang, M. A., Campochiaro, P., Davis, A. A.,

Zack, D. J., and Crabb, J. W. (1998) J. Biol. Chem. 273, 5591–559828. Wobbe, C. R., and Struhl, K. (1990) Mol. Cell. Biol. 10, 3859–386729. Singer, V. L., Wobbe, C. R., and Struhl, K. (1990) Genes Dev. 4, 636–64530. Bobola, N., Hirsch, E., Albini, A., Altruda, F., Noonan, D., and Ravazzolo, R.

(1995) J. Biol. Chem. 270, 1289–129431. Jones, K. A., Kadonaga, J. T., Rosenfeld, P. J., Kelly, T. J., and Tjian, R. (1987)

Cell 48, 79–8932. Mermod, N., Williams, T. J., and Tjian, R. (1988) Nature 332, 557–56133. Li, S., Zhou, W., Doglio, L., and Goldberg, E. (1998) J. Biol. Chem. 273,

31191–3119434. Dunn, K. C., Aotaki-Keen, A. E., Putkey, F. R., and Hjelmeland, L. M. (1996)

Exp. Eye Res. 62, 155–16935. Sartorelli, V., Webster, K. A., and Kedes, L. (1990) Genes Dev. 4, 1811–182236. Weintraub, H., Davis, R., Lockshon, D., and Lassar, A. (1990) Proc. Natl. Acad.

Sci. U. S. A. 87, 5623–562737. Yoon, S. O., and Chikaraishi, D. M. (1992) Neuron 9, 55–6738. German, M. S., Wang, J., Chadwick, R. B., and Rutter, W. J. (1992) Genes Dev.

6, 2165–217639. Poellinger, L., Yoza, B. K., and Roeder, R. G. (1989) Nature 337, 573–57640. Bruggemeier, U., Kalff, M., Franke, S., Scheidereit, C., and Beato, M. (1991)

Cell 64, 565–57241. Gerster, T., and Roeder, R. G. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,

6347–635142. Tverberg, L. A., and Russo, A. F. (1993) J. Biol. Chem. 268, 15965–1597343. Clark, M. E., and Mellon, P. L. (1995) Mol. Cell. Biol. 15, 6169–617744. Lefebvre, V., Zhou, G., Mukhopadhyay, K., Smith, C. N., Zhang, Z.,

Eberspaecher, H., Zhou, X., Sinha, S., Maity, S. N., and de Crombrugghe, B.(1996) Mol. Cell. Biol. 16, 4512–4523

45. Fadel, B. M., Boutet, S. C., and Quertermous, T. (1999) J. Biol. Chem. 274,20376–20383

46. Lakich, M. M., Diagana, T. T., North, D. L., and Whalen, R. G. (1998) J. Biol.Chem. 273, 15217–15226

47. Zhou, D. X., and Yen, T. S. (1991) Mol. Cell. Biol. 11, 1353–135948. Kemler, I., and Schaffner, W. (1990) FASEB J. 4, 1444–144949. Dent, C. L., McIndoe, G. A., and Latchman, D. S. (1991) Nucleic Acids Res. 19,

4531–453550. Schoenherr, C. J., and Anderson, D. J. (1995) Science 267, 1360–136351. Chen, Z. F., Paquette, A. J., and Anderson, D. J. (1998) Nat. Genet. 20,

136–142

Rpe65 Gene Promoter Confers Tissue-specific Expression31282

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from

RedmondAna Boulanger, Suyan Liu, Abraham A. Henningsgaard, Shirley Yu and T. Michael

and E-box Binding Sites and Contains Critical Octamerin Vitro and in VivoEpithelium-specific Expression

Gene Confers Retinal PigmentRpe65The Upstream Region of the

doi: 10.1074/jbc.M003441200 originally published online July 14, 20002000, 275:31274-31282.J. Biol. Chem. 

  10.1074/jbc.M003441200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/275/40/31274.full.html#ref-list-1

This article cites 51 references, 27 of which can be accessed free at

by guest on June 7, 2018http://w

ww

.jbc.org/D

ownloaded from