the involvement of heparan sulfate in fgf1/hs/fgfr1 signaling
TRANSCRIPT
![Page 1: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/1.jpg)
1
The Involvement of Heparan Sulfate in
FGF1/HS/FGFR1 Signaling Complex
Zhengliang L.Wu1, Lijuan Zhang1, 2, 5, Tomio Yabe3, 6, B. Kuberan1, David L. Beeler1,
Andre Love1, 2, Robert D. Rosenberg1, 2
1 Department of Biology,
3 Department of Chemistry, Massachusetts Institute of Technology, Cambridge,
MA 02139
2 Department of Medicine, Harvard Medical School, BIDMC, Boston, MA 02215
5 Present address: Department of Immunology & Pathology, Washington University School of Medicine, St.
Louis, MO 63110
6Present address: Department of Molecular Developmental Biology, Tokyo Metropolitan Institute for
Neuroscience, Tokyo 183-8526, Japan
Correspondence: [email protected] (617)-253-8803 Fax (617)-258-6553
Running Title: HEPARAN SULFATE AND FGF1/FGFR1 SIGNALING COMPLEX
Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on February 25, 2003 as Manuscript M212590200 by guest on A
pril 16, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 2: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/2.jpg)
2
Summary
FGF signaling begins with the formation of a ternary complex of FGF, FGFR and
heparan sulfate (HS). Multiple models have been proposed for the ternary complex.
However, major discrepancies exist among those models and none of these models
have evaluated the functional importance of the interacting regions on the HS
chains. To resolve the discrepancies, we measured the size and molar ratio of HS in
the complex and showed that both FGF1 and FGFR1 simultaneously interact with
HS; therefore, a model of 2:2:2 FGF1:HS:FGFR1 was shown to fit the data. Using
genetic and biochemical methods, we generated HSs that were defective in FGF1
and/or FGFR1 binding but could form the signaling ternary complex . Both
genetically and chemically modified HSs were subsequently assessed in a BaF3 cell
mitogenic activity assay. The ability of HS to support the ternary complex formation
was found to be required for FGF1 stimulated cell proliferation. Our data also
proved that specific critical groups and sites on HS support complex formation.
Furthermore, the molar ratio of HS, FGF1 and FGFR1 in the ternary complex was
found to be independent of the size of HS, which indicates that the selected model
can take place on the cell surface proteoglycans. Finally, a mechanism for the
FGF/FGFR signaling complex formation on cell membrane was proposed, where
FGF and FGFR have their own binding sites on HS and a distinct ternary complex
formation site is directly responsible for mitogenic activity.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 3: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/3.jpg)
3
INTRODUCTION
Heparan sulfate (HS) is a linear and highly sulfated polysaccharide, consisting of 50 to
150 basic disaccharide repeats of uronic acid and D-glucosamine units (1). Sulfation can
occur at 2-O of the uronic acid and 3-O, 6-O and N- of the D-glucosamine and is
catalyzed by a variety of sulfotransferases. Each modification is incomplete, which leads
to sequence variation on HS, and it is very likely that critical sulfate groups determine
the specificity of HS-protein interactions (2). Along the HS chain, the majority of
sulfated residues are clustered in short functional domains separated by relatively less
sulfated oligosaccharide sequences (3). Heparin resembles these functional domains and
is widely used for the functional study of HS. One major function of HS is to interact
with fibroblast growth factors (FGFs) and their receptors (FGFRs) and form
FGF:HS:FGFR signaling complexes (4-7). Defects in HS can cause complete losses of
FGF, Hedgehog and Wingless signaling pathways and lead to severe abnormality in
embryonic development (8,9). The involvement of HS in the FGF molecular signaling
complex suggests that FGF activity and specificity may be modulated by HS and in turn,
by enzymes that synthesize and degrade HS.
FGFs and FGFRs play critical roles in the control of many fundamental
cellular processes, such as cell proliferation, differentiation and migration (10-13). There
are 23 known FGFs and 5 types of FGFRs in humans (14). FGF1 and FGF2 were the first
to be isolated and were called acidic and basic FGF, respectively. Studies performed
primarily on FGF2, have identified a stretch of basic residues in the polypeptide chain as
participating in the heparin-binding site (15). FGFRs belong to a group of receptor
tyrosine kinases and are activated through FGFs and HS induced dimerization (10). The
unspliced form of FGFR contains an intracellular tyrosine kinase domain, a trans-
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 4: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/4.jpg)
4
membrane region, an extracellular region containing three immunoglobulin (Ig) domains,
a string of acidic residues between the first and second Ig domains (16) and an HS
binding site in the second Ig domain (17). The Ig domain I has been shown to be
dispensable and receptor variants containing only the Ig domain II and III (β form) have
been found to exhibit an equivalent degree of binding to FGFs as the variants containing
all three domains (α form). The Ig domain III can undergo differential splicing and
thereby exhibits IIIb and IIIc forms (16). All receptors show redundant specificity for
ligand binding, i.e. one receptor may bind to several FGFs and one FGF may bind to
more than one receptor (12). FGF1 interacts with almost all FGFRs and FGFR1 is a
common receptor for many ligands ; thus we have chosen FGF1 and FGFR1 to carry out
our studies.
Although the importance of HS in FGF signaling is well documented, the exact
roles of HS in the signaling complex are less well characterized. One key issue concerns
the minimum size of HS in the signaling complex. This size of HS reflects the spatial
arrangement of FGF and FGFR in the complex, thus this parameter is critical for
modeling the FGFR signaling complex. Basically there are three modes of interaction
between multiple proteins and a single chain of HS (Figure 1), designated as the cis, trans
and mix mode. Mix mode contains both cis and trans modes. Different modes of
interaction require HS with different lengths to participate. So far, various models with
different modes of HS-protein interactions and thus different HS length requirements
have been proposed. For examples, hexasaccharide (dp6) was found to be able to link two
FGF1 in a trans mode (18) (Figure 1B, IV); dodecasaccharide (dp12) was thought to be
the minimum length for linking one FGF2 and one FGFR1 in a cis mode (19) (Figure 1A,
I); hexadecasaccharide (dp16) was proposed to be able to fully span a heparin binding
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 5: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/5.jpg)
5
site created by a 2:2 FGF1:FGFR2 complex in a mix mode (Figure 1C, VI) (20). On the
other hand , the shortest biologically active heparin oligosaccharide has been reported to
be an octasaccharide (dp8) (21), hexasaccharide (dp6) (22,23), trisaccharide, or even
disaccharide (dp2) (24,25). These contradictory findings prompted us to design a more
accurate method to determine the size of HS in FGFR signaling complex.
A second key issue that remains controversial concerns the stoichiometry of HS
in the FGF/FGFR signaling complex. Intracellular signaling is believed to be initiated
from receptor dimerization and trans-phosphorylation (10,26), but models with different
stoichiometry for HS and FGF have been proposed (Figure 1). For examples, a single HS
chain binds one FGF and two FGFRs (27) (Figure 1A, III); a single HS chain binds two
FGFs, which in turn bind two FGFRs (18) (Figure 1B, IV); one each of FGF, HS and
FGFR first form an FGF:HS:FGFR half complex, two of which then dimerize (28)
(Figure 1C, VII). Because the size of HS can be up to 150 disaccharide repeats, and only
shorter oligosaccharides no more than 7 disaccharide repeats (dp14) were used for
modeling study in most cases, one unresolved question is whether the models established
with shorter oligosaccharides can be extended to the cell surface HS proteoglycans.
HSs from different tissues or developmental stages have different fine
structures (29,30) and can activate or inhibit FGF signaling pathways (31-33). It is
believed that this phenomenon is caused by replacing of critical functional groups during
the synthesis of the HSs (2,32,34). The critical functional groups on HS interacting with
FGFs (19,23,35) or FGFRs (24,36,37) have been investigated previously. For example, 2-
O sulfation at an iduronic acid was found critical for FGF2 binding (38) and 6-O-
sulfation was found important for FGFR1 binding (37,39). But less information about the
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 6: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/6.jpg)
6
relationship between critical groups on HS mediating FGF:HS:FGFR ternary complex to
the groups required for FGF or FGFR binding has been available.
With in vitro modification of HS and a gel mobility shift assay (40), we have
measured the minimum HS size, the molar ratio among FGF1, HS and FGFR1 as a
function of HS size, and showed that both FGF1 and FGFR1 interacts with HS in the
complex . Based upon these results, we suggest that a 2:2:2 FGF1:HS:FGFR1 model best
fits the data. In addition utilizing cell genetic study, we have found that there are different
critical groups at different sites on HS involved in the ternary complex formation and
FGF and FGFR binding interactions. We also find that the ability of HS to form a ternary
complex with FGF1 and FGFR1 is a prerequisite for FGF1 stimulated mitogenic activity.
Based on these data, we propose a mechanism showing how the FGF1/FGFR1 signaling
complex is formed on HS cell surface proteoglycan.
MATERIALS AND METHODS Reagents
Heparin oligosaccharides (dp4 to dp24) were purchased from Iduron (Manchester, UK). Completely
desulfated and N-sulfated heparin sulfate (DSNS), and completely desulfated and N-acetylated heparin
(DSNAc) was from Seikagaku America (Falmouth, MA). FGF1 and FGFR1β (IIIc)/Fc were from R&D
Systems (Minneapolis, MN). PAPS was from Calbiochem (La Jolla, California). 3-OST-1 and 6-OST-1
were prepared as previously described (40). CHOpgsA-745 cell line and 6-O-desulfated heparin (6ODS)
were kind gifts from Dr. Jeffrey D. Esko (University of California, San Diego). Preparation of [35S] labeled
3'-phosphoadenosine 5'- phosphosulfate ([35S]PAPS), radiolabeling of HS, autoradiograph and gel analysis
were the same as previously described (40). Anti-FGF1 antibody was from Santa Cruz Biotechnology
(Santa Cruz, California). CHO-K1 cell line was from ATCC (Manassas, VA). 2-OST deficient cell
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 7: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/7.jpg)
7
CHOpgsF-17 was prepared as described (41). Fetal bovine serum (FBS) was from Life Technologies
(Rockville, MD). Protein A, Alexa Fluor® 647 conjugate was from Molecular Probe (Eugene, OR)
Heparin Digestion and Disaccharide Analysis
The heparin sample (20µg) was digested with a mixture of heparinase and heparantinase I, II (Seikagaku
Corporation, Tokyo, Japan) at 37oC for 2 hours in 50 µl buffer of 2 mM Ca(Ac)2, 20 mM Na Ac, pH 7.0.
The digestion products were separated with a C18-reversed phase column (IPRP-HPLC) (Vydac, Lake
Forest, CA). The sample was eluted with 2.5%, 6%,10.5%, 18%, 50% acetonitrile in 40 mM NH4H2PO4 and
1 mM tetrabutylammonium dihydrophosphate (Sigma) for 15, 15, 45, 25, 20 minutes respectively, and was
monitored with light absorbance at 232 nm (41).
Expression of FGFR1
The extracellular domain of FGFR1, including Ig domain II and IIIc (from residue 142 to 365) (42,43) was
PCR cloned from a Human Placenta Quik-clone TM cDNA library (Clontech, Palo Alto, California). The
PCR forward primer was GATAACACCAAACCAAACCG and the backward primer was
CCTCTCTTCCAGGGCTTCCA. The PCR product was expressed in a pBAD/TOPO ThioFusion TM
Expression System (Invitrogen, Carsbad, California). The expressed protein was a fusion protein with
thioredoxin at the C terminal and was refolded in 150 mM NaCl, 10 mM Tris pH 8.0, 10% glycerol, 1 mM
L-Cystein.
Binding Reaction and Gel Mobility Shift Assay
For a typical 20 µl binding reaction, 1 µl of FGF1, 1 µl FGFR1 and 0.1 µl of HS (also refer to heparin, if
not specifically stated) were added into appropriate volume of binding buffer. The concentrations of FGF1,
FGFR1 and HS were adjusted as needed before the reaction. The reaction was incubated at 23oC for 20
minutes. The binding buffer contained 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 10 mM of MgCl2
and 1.4 mM KH2PO4 and 12% glycerol. Half of the reaction was loaded onto a native 4.5% polyacrylamide
gel. The gel was run at 6 volt /cm for 70 minutes. After the run, the gel was dried under vacuum and
exposed to phosphor imager plate.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 8: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/8.jpg)
8
Cell Culture and Mitogenic Assays
Suspension cultures of FGFR1α(IIIc)-expressing BaF3 cells (A generous gift from professor Ornitz, D. M.)
were maintained in AIM V media (Gibco BRL, Rockville, MA), supplement with 5 nM recombinant
mouse IL-3 (R & D Systems). For mitogenic assays, 50 ul of AIM V media (serum free) containing HSs
and FGF-1 at final concentrations of 1 ug/ml and 5 nM respectively, were plated into a 96 well assay plate.
Cells were washed and resuspended in AIM V media (serum free) and 2,500 cells were added to each well
for a total volume of 100 ul. The cells were then incubated at 37 oC with 5% CO2 for 24 hours; afterwards,
100 ul Syto-11 dye (Molecular Probes, Eugene, OR), which was prepared in 10 mM Tris, 1 mM EDTA, 50
mM NaCl, pH 8.0, was added to each well and incubated for 30 minutes at 37 oC. The sample was excited
at 508 nm and the fluorescence emission at 527 nm was then measured using the SpectraMax Gemini XS
(Molecular Devices, Sunnyvale, CA). The data was analyzed with Softmax software and each data
presented was the average of a triplicate determination.
Flow Cytometry Analysis
Nearly confluent monolayers of cells in a T-75 flask were detached by adding 10 ml phosphate buffered
saline (PBS) containing 10% FBS and 2 mM EDTA and centrifuged. The cell pellets were placed on ice.
About 1x106 cells was first mixed with 20 µl PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 10 mM
of MgCl2 and 1.4 mM KH2PO4) and 1 µg FGFR1β(IIIc)/Fc, then 4 µg of protein A-Alexa Fluor® 647
conjugate was added. Protein A binds to the Fc region of FGFR1β(IIIc)/Fc. In a separate experiment, 0.5
µg of FGF1 was also added at this point. After 15 minutes of incubation, the cells were washed once with
10 ml of PBS and resuspended in 300 µl PBS containing 10% FBS. Flow cytometry was performed with
FACScan and FACStar instruments (Becton Dickinson).
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 9: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/9.jpg)
9
RESULTS
Observation of the Ternary Complex of FGF1, HS and FGFR1
Previously, we applied gel mobility shift assay to study antithrombin III/HS interaction
(40). The same method was applied to study FGF/HS/FGFR interactions. A ladder of
defined lengths of oligosaccharides from dp2 to dp24 was first radiolabeled with 6-OST-
1 sulfotransferases (40) and examined on a 15% PAGE gel (Figure 2A). The labeled
ladder was then applied to gel mobility shift assays with FGF1 or FGFR1 (Figure 2B).
FGF1 could bind to tetrasaccharide (dp4) and longer chains, while FGFR1 only showed
significant binding to octasaccharide (dp8) and longer chains. The mobility of the binary
complex FGF1:HS was greater than that of FGFR1:HS. When equivalents of FGF1 and
FGFR1 were mixed with excess dp18 and applied to the assay, a distinct band, with
mobility greater than FGFR1:HS but less than FGF1:HS, was observed (Figure 3A),
suggesting the formation of a ternary complex among FGF1, FGFR1 and HS. This
ternary complex could be observed when the concentrations of FGF1 and FGFR1 were as
low as 128 nM, though either no or less binary complexes of HS:FGFR1 and FGF1:HS
could be observed at this concentration, suggesting the cooperative binding among HS,
FGF and FGFR. Cooperative binding is a characteristic of FGF:HS:FGFR ternary
complex formation (44,45).
To further confirm that the above ternary complex did form at the native state of
the proteins, binding samples were heated before loading onto a gel (Figure 3B). After
the sample was heated at 47 oC, the binary complex of HS:FGFR1 significantly
decreased, whereas the binary complex of FGF1:HS was stable. Heating at 60 oC caused
the disappearance of both of the binary complexes, but not the ternary complex. Heating
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 10: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/10.jpg)
10
at 100 oC caused the disappearance of all the complexes. This experiment suggests that
the native state of the proteins is required for the ternary complex formation and the order
of the thermal stability of the complexes is FGF1:HS:FGFR1 > FGF1:HS > HS:FGFR1.
To see if the observed ternary complex can form on cells with membrane HS
proteoglycan under similar binding conditions, we carried out flow cytometry assays with
CHO cells and FGFR1β(IIIc)/Fc in the presence or absence of FGF1. FGFR1β(IIIc)/Fc
contained the same functional domains as the FGFR1 used in the gel shift assays, except
for the inclusion of an Fc region of IgG. The binding of FGFR1β(IIIc)/Fc to CHO cells
was monitored (Figure 3C). The HS-deficient CHOpgsA-745 cell showed no binding,
even in the presence of FGF1. On the other hand, HS-expressing wild type CHO-K1 cell
had weak binding, but this binding was greatly enhanced when FGF1 was added. These
experiments suggest that FGFR1β(IIIc)/Fc can bind to the HS proteoglycan on cell
membrane and form a much tighter ternary complex together with FGF1. Interestingly, a
2-O sulfotransferase (2OST) deficient cell CHOpgsF-17 did not bind to FGFR1β(IIIc)/Fc
alone, but also showed a much stronger binding in the presence of FGF1, suggesting the
formation of the ternary complex in the absence of 2-O sulfation (Figure 3C).
The Minimum Oligosaccharide Supporting the Ternary Complex Formation
To determine the minimum oligosaccharide that can initiate the ternary complex with
FGF1 and FGFR1, the labeled ladder (Figure 2A) was applied to a gel shift assay with
both FGF1 and FGFR1 (Figure 4A). The ternary complex could be observed with
tetrasaccharide and larger oligosaccharides, but not with disaccharide.
To confirm the above observation, another gel was visualized with anti-FGF1
antibody (Figure 4B). FGF1 had a low mobility in a native gel electrophoresis. The
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 11: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/11.jpg)
11
binding of HS to FGF1 added negative charges to FGF1 and the resulting FGF1:HS
complex moved faster than the free FGF. The further addition of FGFR1 slowed
FGF1:HS complex, because of the formation of the ternary complex. The ternary
complexes were observed with tetrasaccharide and longer oligosaccharides, but not with
disaccharide. This experiment confirmed that tetrasaccharide was the minimum HS
required for the formation of a ternary complex of FGF1, HS and FGFR1.
The Molar Ratio of HS in the Ternary Complex
First, we determined the ratio of FGF1 and FGFR1 in the ternary complex. In this
experiment, fixed amount of FGF1, but increasing amount of FGFR1 was added to a
series of binding reactions (Figure 5A). The bands of the ternary complexes were
subjected to densitometry analysis (Figure 5B) and the band density was plotted against
the molar equivalents of FGFR1 to FGF1 (Figure 5C). The slope of the curve declined
sharply when FGFR1 was equivalent to FGF1, suggesting that FGF1 and FGFR1 have a
1:1 ratio in the ternary complex. The continuing increase in band intensity above
equivalence might be caused by a shift of equilibrium, as excess FGFR1 (the reactant)
generated more product (the ternary complex) formation and caused the disappearance of
the FGF1:HS. At the level of 4 equivalents of FGFR1, there was almost no FGF1:HS
observed.
We further measured the molar ratio of HS in the ternary complex. In a series of
binding reactions with the oligosaccharide ladder (Figure 1A), each reaction contained
250 ng oligosaccharide (from dp4 to dp24), 16 pmol of FGF1 and 64 pmol of FGFR1.
The 4:1 molar concentration ratio of FGFR1 to FGF1 overwhelmingly favored the
formation of FGF1:HS:FGFR1, so that almost all the FGF1 was incorporated into the
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 12: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/12.jpg)
12
ternary complex (Figure 5A). After electrophoresis, the amount of the oligosaccharide
present in the ternary complex in each reaction was calculated by densitometry analysis,
and the molar ratio between the oligosaccharide and FGF1 in the ternary complexes was
then determined (Table 2). It was surprising to find that, independent of the size of HS,
the ratio was consistently near 1:1. Considering the 1:1 ratio between FGF1 and FGFR1,
this result suggests that the ternary complex have a molar ratio of 1:1:1 among FGF1, HS
and FGFR1.
Critical Sulfate Groups on HS for the Ternary Complex Formation
We used completely desulfated, N-acetylated (DSNAc), completely desulfated, N-
resulfated (DSNS) and 6-O desulfated (6ODS) heparin as starting materials to investigate
the role of critical groups (Figure 6A). When DSNAc was modified with 6-OST-1, or 6-
OST-1 plus 3-OST-1, it could not bind to either FGF1 or FGFR1 and failed to form the
ternary complex with FGF1 and FGFR1. When DSNS was modified with 6-OST-1 or 3-
OST-1, it still could not bind to either FGF1 or FGFR1 individually, but could initiate the
ternary complex formation. When 6ODS was modified with 3-OST-1, it could not bind to
FGFR1, but could bind to FGF1 and initiate the ternary complex formation. These
experiments suggest that N-sulfation and perhaps to a lesser extent O-sulfation are critical
for the ternary complex formation. On the contrary, 6-O sulfation, which is critical for
FGFR1 binding is not critical for the ternary complex formation.
The chemical compositions of these modified heparins were further validated
through disaccharide analysis (Figure 6B). The major disaccharides found in DSNAc and
DSNS were ∆UA-(1-4)GlcNAc (∆UA, unsaturated uronic acid; GlcN, glucosamine;
GlcNAc, N-acetylated GlcN) and ∆UA-(1-4)GlcNS (GlcNS, N-sulfated GlcN) ,
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 13: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/13.jpg)
13
respectively. Only very small amounts of ∆UA2S-(1-4)GlcNS (∆UA2S, 2-O sulfated
∆UA) and ∆UA-(1-4)GlcNS6S (GlcNS6S, N- and 6-O sulfated GlcN) were observed in
DSNS, which might arise from non-specific sulfation during the chemical N-sulfation
step. The major disaccharide found in 6ODS was ∆UA2S-(1-4)GlcNS, as a result of the
6-O desulfation of the trisulfated disaccharide, ∆UA2S-(1-4)GlcNS6S. Because of the
presence of a small amount of ∆UA2S-(1-4)GlcNS in DSNS, and ∆UA-(1-4)GlcNS6S in
6ODS, it is hard to reach a definitive conclusion about the importance of 2-O and 6-O
sulfation in the ternary complex formation; nevertheless, since 2-O and 6-O sulfation in
DSNS and 6ODS, respectively, was significantly lower than that in the wild type heparin,
2-O and 6-O sulfation may not be as important in the ternary complex formation as in the
binary complex formation. Interestingly, because the trisulfated disaccharide, ∆UA2S-(1-
4)GlcNS6S was not found in DSNS and 6ODS, yet DSNS/31 and 6ODS/31 could
support the ternary complex formation, it is concluded that the trisulfated disaccharide is
not required for the ternary complex formation.
The Ability of HS to Form a Ternary Complex with FGF1 and FGFR1 but not Binary
Complexes Is Associated with Cell Mitogenic Activity
Ternary complex formation was observed with various modified heparins and heparin
oligosaccharides, but it is more important to know if the formed ternary complexes are
responsible for mitogenic activity. The oligosaccharides and modified heparins were
further tested for their mitogenic activities in an FGFR1α(IIIc)-expressing BaF3 cell
system (21) stimulated with FGF1 (Table 3). FGFR1α(IIIc) contains all three Ig-like
extracellular domains and it showed the same binding characteristics with FGFR1β(IIIc)
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 14: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/14.jpg)
14
(16). In the assay, disaccharide had background mitogenic activity; tetramer, hexamer
and octamer oligosaccharides had medium mitogenic activities; decasaccharide and
larger oligosaccharides had mitogenic activities comparable to that of heparin. Except for
disaccharide, all other oligosaccharides showed the ability to support the ternary complex
formation (Figure 4). The 6-O and 3-O sulfated DSNAc, which didn’t support the ternary
complex formation (Figure 6A), had almost no activity. On the other hand, 6-O or 3-O
sulfated DSNS and 3-O sulfated 6ODS, which did not support the binary complex with
either FGF1 or FGFR1, but supported ternary complex formation (Figure 6A), showed
significant activities. These data suggest that the abilities of these oligosaccharides and
modified heparins to initiate FGF1:HS:FGFR1 ternary complex but not FGF1:HS and
FGFR1:HS complexes correlate with mitogenic activities.
DISCUSSION
Since Yayon et al. (4) first demonstrated the importance of heparan sulfate proteoglycan
for high affinity FGF2:FGFR1 binding, a large amount of data has been produced,
indicating that HS is essential for FGF signaling (3,5,46). Later, HS was proved to be an
essential component of FGF/FGFR signaling complex (3,10,42), but the roles that HS
plays in the signaling complex formation are still obscure. We have provided a novel
strategy to study the physical parameters of HS as well as the signaling complex as a
whole. This new strategy enabled us to measure the size, molar ratio and molecular
interactions of HS in the ternary complex. It allowed us to study critical groups on HS
involved in the ternary complex formation and FGFR activation. It also allowed us to
correlate the ability of HS to initiate a ternary complex and the mitogenic activity.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 15: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/15.jpg)
15
Requirements on Ternary Complex Formation Select a 2:2:2 Model Based on our data, we have identified three molecular parameters for choosing
models of the FGF1/FGFR1 signaling complex. First, the minimum HS in the ternary
complex is a tetrasaccharide. Second, the molar ratio among HS, FGF1 and FGFR1 in the
ternary complex is 1:1:1. Third, HS interacts with both FGF1 and FGFR1 in the ternary
complex. These requirements along with the requirement of receptor dimerization (10,26)
are used to evaluate the potential models in Figure 1 (Table 1).
Whereas the requirements on the size and ratio of HS in the complex are obvious,
the requirement that HS interacts with both FGF1 and FGFR1 may not be so obvious.
Because both FGF1 and FGFR1 can bind to HS independently (Figure 2B), with similar
affinity (47,48), it is likely that both of them bind to HS in the ternary complex. If HS
interacts only with FGF1 in the ternary complex, the dissociation of FGF1 from the
polysaccharide will release HS from the ternary complex, thus HS should be liberated
from FGF1:HS and FGF1:HS:FGFR1 at the same temperature, but experiment showed
that HS could only be liberated from the ternary complex at higher temperature (Figure
3B). Again, if HS interacts only with FGF1 in the ternary complex, an HS with no
affinity for FGF1 will not be able to form a ternary complex with FGF1 and FGFR1, but
experiments showed the opposite (Figure 6A). One might argue that FGF1 may
experience a major conformational change upon the association with FGFR1 and thus
have greater affinity towards HS, but this has not been seen in crystallographic studies
(15,18,20,42,49).
From the binding assay, we found the minimum HS for FGF1 and FGFR1
binding were tetrasaccharide and octasaccharide respectively (Figure 2B), and the
minimum HS required for ternary complex formation was only a tetrasaccharide (Figure
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 16: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/16.jpg)
16
4). Based upon these findings, the length of two contiguous FGF1 binding sites on HS
will span at least eight sugar residues, and the length needed for one FGF1 site and one
FGFR1 site will cover at least twelve sugar residues (Figure 1A, Table 1). Obviously, the
cis mode can not explain the findings from the present and past studies(24,25,50) that
shorter oligosaccharides could initiate the ternary complex formation and activate FGF
receptors.
Compare to the cis mode, the trans mode would better explain the requirement of
HS size. In a typical model of the trans mode, two FGFs bind to an oligosaccharide from
the opposite sides; therefore, a tetrasaccharide will be of sufficient in size (Figure 1B,
IV). However, this model does not contain FGFR1/HS interaction and the molar ratio of
HS to FGF1 and FGFR1 is 1:2:2. Model V (Figurer 1B) is excluded, because the
minimum HS in this model is an octasaccharide.
Recently, models with mix mode of interaction have been proposed based on
crystallographic studies (20,28,42, 43). In Schlessinger’s “two-end” model, two
antiparallel oligosaccharides are incorporated and the oligosaccharide can be as short as
hexasaccharide (Figure 1C, VII). The complex is a dimer consisting of two 1:1:1
FGF2:HS:FGFR1 half complexes and is stabilized via both FGFR1/FGFR1 and
HS/FGFR1 contacts. Within each 1:1:1 FGF2:HS:FGFR1 complex, the hexasaccharide
not only makes numerous contacts with both FGF2 and FGFR1, thereby augmenting
FGF2/FGFR1 binding, but also makes contacts with FGFR1 in the neighboring half
complex, thus playing a dual role in the ternary complex formation. Except for the
difference in the minimum size on HS (Table 1), this “two-end” model fits the data
described previously.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 17: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/17.jpg)
17
Though hexasaccharide was the smallest oligosaccharide shown to be effective in
the “two-end” model (28), we believe that a tetrasaccharide still can make effective
contacts with FGF2 and FGFR1 in the ternary complex. According to Schlessinger’s
crystal structure (28), the first six sugar residues at the non-reducing end of a
decasaccharide make 30 hydrogen bonds, including 9 with FGFR1, 16 with FGF2 in the
same half complex, and 5 with FGFR1 in the adjoining half complex. Among these, all
the contacts to the FGFR1, and 8 out of the 16 contacts to the FGF2 are due to the first
four sugar residues. On the other hand, the first two sugar residues make 12 contacts,
with only one to FGF2, while the next two sugar residues make 10 contacts, with none to
the FGFR1 in the same half complex. This suggests that a tetrasaccharide, but not a
disaccharide, may still fulfill the dual role played by a hexasaccharide in the ternary
complex formation, and thus explains why a tetrasaccharide was the minimum
oligosaccharide capable of initiating the ternary complex formation and possessing
biological activity. Recently tetrasaccharide has also been reported to bind FGF2 and
promote cell growth (23,24,50).
The fact that a tetrasaccharide can not make full contacts with FGF2 and FGFR1
may explain why it is not as active as a hexasaccharide (Table 3), but it still remains
unclear why shorter oligosaccharides like dp 6, dp8 showed lower mitogenic activity than
longer oligosaccharides (Table 3). It is possible that additional HS length helps the
recruitment of FGF1 or FGFR1 to form the ternary complex. The opportunity for each of
FGF1, HS and FGFR1 to encounter each other simultaneously on a cell surface is
probably low. It is more likely that HS, by its abundance, first associates with one of the
proteins (47), FGFR1, for example; then the unoccupied region of HS functions as a
recruiter, where FGF1 can bind and join the complex by proximity. The analysis of the
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 18: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/18.jpg)
18
binding mechanism and study of critical functional groups on HS further supports this
hypothesis (Figure 7).
Novel Binding Mechanism for HS in the Ternary Complex Involves Different Critical
Functional Groups and Different Binding Site
Plotnikov and Schlessinger’s crystal structures (28,43) show that a new binding grove for
HS forms among two FGFs and two FGFRs. Since the binding environment of HS in the
ternary complex is very different from that on individual FGF or FGFR, it is likely that
the contacts could be made through different set of functional groups on HS, which is
suggested in our experiments. It was previously shown that 2-O sulfation is critical for
FGF1 binding (19,51) and both 2- and 6-O sulfation is critical for FGFR1 binding (Figure
3C, Figure 6A) (52), but N- sulfation is critical for the ternary complex formation (Figure
6). Besides, the N-, 2-O and 6-O trisulfated disaccharide is not found to be important for
the ternary complex formation (Figure 6). Consistently, among the first four sugar
residues of the octasaccharide in Schlessinger’s crystal structure, the N-sulfation and the
backbone structure make 16 out of 22 hydrogen bonds to all the necessary protein
components (28). The observation of different critical groups in ternary complex
formation suggests that by changing critical groups, HS can determine the nature of
FGF1:HS:FGFR1 complex formation.
Different set of critical groups suggests that the site where ternary complex forms
on HS can be different from the site where FGF1 or FGFR1 binds. The fact that enzyme
modified 6ODS and HS on CHOpgsF-17 cells couldn’t bind to FGFR1 but still formed a
ternary complex with FGF1 and FGFR1 (Figure 6A, 3C) suggest that the ternary complex
formation site is different from the site where FGFR1 binds (Figure 7). This is also
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 19: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/19.jpg)
19
consistent with and explains the previous report that 6-O desulfated heparin showed
mitogenic activity (53). On the other hand, cells with 2OST deficient were able to form a
ternary complex with FGF1 and FGFR1 (Figure 3C) and mount an apparently normal
signaling response to FGF1 (Table 3) and FGF2 (54), though 2-O sulfation is critical for
FGF1 and FGF2 binding (19,35,51). It is also reported that the HS from the culture
medium of the mammary fibroblasts and the myoepithelial-like cells possessed high
affinity to FGF2 but lacked mitogenic activity (55). These evidences suggest that the
ternary complex formation site can be different from the site where FGF1 or FGF2 binds
(Figure 7). The fact that the modified DSNS without the ability to bind either FGF1 or
FGFR1 (Figure 6A) could initiate a ternary complex and possess mitogenic activity
(Table 3) further supports the idea.
A Proposed Mechanism for the Formation of FGF1/FGFR1 Signaling Complex on Cell
Membrane
For all tested oligosaccharides, the 1:1:1 ratio among FGF1, HS and FGFR1 (Table 2)
implies that there is only one site where the ternary complex can form on each HS.
According to Schlessinger’s model (28), this site would be at the non-reducing end of
HS. On the other hand, there could be internal binding sites for FGF1 (48) and FGFR1
inside of the sulfated domains (3). Given the size of the sulfated domains on heparan
sulfate usually covers 12 to 20 sugar residues (1), these sites could be located on different
sulfated domains or located contiguously in the same sulfated domain. Due to the
overwhelming abundance of HS, FGF1 and FGFR1 may first bind to HS individually
(47). Because FGF1 and FGFR1 bind to HS with relative low affinities (44,45) and the
resulting FGF1:HS and FGFR1:HS binary complexes are less stable (Figure 3B), FGF1
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 20: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/20.jpg)
20
and FGFR1 can undergo binding-releasing cycles rapidly and therefore translocate along
the HS chains. Once an FGF1 and an FGFR1 interacts with each other on HS chain, they
will probably form a half complex at the non-reducing end of the HS. Alternatively, the
FGF1 and FGFR1 can associate with each other in the surrounding solution and the
FGF1:FGFR1 complex then bind to its binding site at the non-reducing end of the HS.
Two half complexes then may associate with each other and form a much more stable
ternary complex (Figure 3B), which allows the receptor trans-phosphorylation (Figure 7).
On the other hand, the binding of FGF1 and FGFR1 to HS can be considered as a
recruiting mechanism to increase the effective concentration and facilitate the association
of FGF1, FGFR1 at the non-reducing ends for the formation of the ternary complex
(Figure 7). In this sense, HS serves as both a “catalyst of molecular encounter” (47) and a
structure component. Shorter oligosaccharides lacking these FGF1 and FGFR1 binding
sites would have less chance to form a ternary complex and thus explain why they
showed less biological activities (Table 3).
Perspective
Overall, we observed a direct link among critical groups on HS, FGF1/FGFR1 signaling
complex formation, and cell growth. The regulatory role of HS in organ development and
cell proliferation has been observed before (8,9,29,30,56), but the mechanism of this
regulation was obscure. It is possible that a cell could regulate its own activity, through
altering the critical groups on HS thus affecting the formation of specific FGFR signaling
complexes. The placement of critical groups on HS must result from the operation of a
set of tightly regulated modification enzymes. Recently, the gene structures for almost all
of these enzymes have been elucidated, and it has been shown that N, 3-O and 6-O
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 21: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/21.jpg)
21
sulfotransferases exhibit genetic polymorphism and encode distinct isoforms (2,7). These
isoforms differ in substrate specificity and expression pattern, both spatially and
temporally (7), which may cause the specific modification on HS. Further study of these
enzymes is crucial to our understanding of specific modifications on HS and the
regulatory role of HS.
Using chemically and enzymatically modified heparin sulfates and gel mobility
shift assay, we were able to monitor the formation of FGF1/FGFR1 signaling complex
and study the physical parameters of HS in the complex. The results concerning the size,
molar ratio and molecular interactions of HS in the complex and the concept of receptor
dimerization (10,26) allowed us select a 2:2:2 FGF1:HS:FGFR1 signaling model. We
demonstrated that FGF1, FGFR1 and the FGF1:FGFR1 complex can bind to different
sites on HS and only ternary complex formation site possesses mitogenic activity. We
also demonstrated that different critical groups are present in these different HS sites.
Finally, the molar ratio of HS, FGF1 and FGFR1 in the ternary complex was found to be
independent of the size of HS, which provides strong evidence that the formation of the
proposed signaling complex can occur on cell surface HS proteoglycans. This study
demonstrates the structural as well as regulatory roles of HS in the FGF1:HS:FGFR1
complex and can serve as a model for studying other HS molecular interactions.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 22: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/22.jpg)
22
REFERENCES
1. Bernfield, M., Gotte, M., Park, P. W., Reizes, O., Fitzgerald, M. L., Lincecum, J., and Zako, M.
(1999) Annu Rev Biochem 68, 729-77
2. Rosenberg, R. D., Shworak, N. W., Liu, J., Schwartz, J. J., and Zhang, L. (1997) J Clin Invest
99(9), 2062-70.
3. Gallagher, J. T. (2001) J Clin Invest 108(3), 357-61.
4. Yayon, A., Klagsbrun, M., Esko, J. D., Leder, P., and Ornitz, D. M. (1991) Cell 64(4), 841-8.
5. Rapraeger, A. C., Krufka, A., and Olwin, B. B. (1991) Science 252(5013), 1705-8.
6. Spivak-Kroizman, T., Lemmon, M. A., Dikic, I., Ladbury, J. E., Pinchasi, D., Huang, J., Jaye, M.,
Crumley, G., Schlessinger, J., and Lax, I. (1994) Cell 79(6), 1015-24.
7. Esko, J. D., and Selleck, S. B. (2002) Annu Rev Biochem 71, 435-71
8. Perrimon, N., and Bernfield, M. (2000) Nature 404(6779), 725-8.
9. Lander, A. D., and Selleck, S. B. (2000) J Cell Biol 148(2), 227-32.
10. Schlessinger, J. (2000) Cell 103(2), 211-25.
11. Lemmon, M. A., and Schlessinger, J. (1994) Trends Biochem Sci 19(11), 459-63.
12. Galzie, Z., Kinsella, A. R., and Smith, J. A. (1997) Biochem Cell Biol 75(6), 669-85
13. Naski, M. C., and Ornitz, D. M. (1998) Front Biosci 3, D781-94.
14. Sleeman, M., Fraser, J., McDonald, M., Yuan, S., White, D., Grandison, P., Kumble, K., Watson,
J. D., and Murison, J. G. (2001) Gene 271(2), 171-82.
15. Faham, S., Hileman, R. E., Fromm, J. R., Linhardt, R. J., and Rees, D. C. (1996) Science
271(5252), 1116-20.
16. Givol, D., and Yayon, A. (1992) FASEB J 6(15), 3362-9.
17. Kan, M., Wang, F., Xu, J., Crabb, J. W., Hou, J., and McKeehan, W. L. (1993) Science 259(5103),
1918-21.
18. DiGabriele, A. D., Lax, I., Chen, D. I., Svahn, C. M., Jaye, M., Schlessinger, J., and Hendrickson,
W. A. (1998) Nature 393(6687), 812-7.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 23: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/23.jpg)
23
19. Guimond, S., Maccarana, M., Olwin, B. B., Lindahl, U., and Rapraeger, A. C. (1993) J Biol Chem
268(32), 23906-14.
20. Stauber, D. J., DiGabriele, A. D., and Hendrickson, W. A. (2000) Proc Natl Acad Sci U S A 97(1),
49-54.
21. Ornitz, D. M., Yayon, A., Flanagan, J. G., Svahn, C. M., Levi, E., and Leder, P. (1992) Mol Cell
Biol 12(1), 240-7.
22. Gambarini, A. G., Miyamoto, C. A., Lima, G. A., Nader, H. B., and Dietrich, C. P. (1993) Mol
Cell Biochem 124(2), 121-9.
23. Zhou, F. Y., Kan, M., Owens, R. T., McKeehan, W. L., Thompson, J. A., Linhardt, R. J., and
Hook, M. (1997) Eur J Cell Biol 73(1), 71-80.
24. Ostrovsky, O., Berman, B., Gallagher, J., Mulloy, B., Fernig, D. G., Delehedde, M., and Ron, D.
(2002) J Biol Chem 277(4), 2444-53.
25. Ornitz, D. M., Herr, A. B., Nilsson, M., Westman, J., Svahn, C. M., and Waksman, G. (1995)
Science 268(5209), 432-6.
26. Heldin, C. H. (1995) Cell 80(2), 213-23.
27. Springer, B. A., Pantoliano, M. W., Barbera, F. A., Gunyuzlu, P. L., Thompson, L. D., Herblin,
W. F., Rosenfeld, S. A., and Book, G. W. (1994) J Biol Chem 269(43), 26879-84.
28. Schlessinger, J., Plotnikov, A. N., Ibrahimi, O. A., Eliseenkova, A. V., Yeh, B. K., Yayon, A.,
Linhardt, R. J., and Mohammadi, M. (2000) Mol Cell 6(3), 743-50.
29. Allen, B. L., Filla, M. S., and Rapraeger, A. C. (2001) J Cell Biol 155(5), 845-58.
30. Lindahl, U., Kusche-Gullberg, M., and Kjellen, L. (1998) J Biol Chem 273(39), 24979-82.
31. Zhang, Z., Coomans, C., and David, G. (2001) J Biol Chem 276(45), 41921-9.
32. Pye, D. A., Vives, R. R., Hyde, P., and Gallagher, J. T. (2000) Glycobiology 10(11), 1183-92.
33. Guimond, S. E., and Turnbull, J. E. (1999) Curr Biol 9(22), 1343-6.
34. Berry, D., Kwan, C. P., Shriver, Z., Venkataraman, G., and Sasisekharan, R. (2001) Faseb J 15(8),
1422-4.
35. Turnbull, J. E., Fernig, D. G., Ke, Y., Wilkinson, M. C., and Gallagher, J. T. (1992) J Biol Chem
267(15), 10337-41.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 24: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/24.jpg)
24
36. Loo, B. M., Kreuger, J., Jalkanen, M., Lindahl, U., and Salmivirta, M. (2001) J Biol Chem
276(20), 16868-76.
37. McKeehan, W. L., Wu, X., and Kan, M. (1999) J Biol Chem 274(31), 21511-4.
38. Maccarana, M., Casu, B., and Lindahl, U. (1993) J Biol Chem 268(32), 23898-905.
39. Pye, D. A., Vives, R. R., Turnbull, J. E., Hyde, P., and Gallagher, J. T. (1998) J Biol Chem
273(36), 22936-42.
40. Wu, Z. L., Zhang, L., Beeler, D. L., Kuberan, B., and Rosenberg, R. D. (2002) FASEB J 16(6),
539-45.
41. Zhang, L., Lawrence, R., Schwartz, J. J., Bai, X., Wei, G., Esko, J. D., and Rosenberg, R. D.
(2001) J Biol Chem 276(31), 28806-13.
42. Pellegrini, L., Burke, D. F., von Delft, F., Mulloy, B., and Blundell, T. L. (2000) Nature
407(6807), 1029-34.
43. Plotnikov, A. N., Schlessinger, J., Hubbard, S. R., and Mohammadi, M. (1999) Cell 98(5), 641-50.
44. Nugent, M. A., and Edelman, E. R. (1992) Biochemistry 31(37), 8876-83.
45. Pantoliano, M. W., Horlick, R. A., Springer, B. A., Van Dyk, D. E., Tobery, T., Wetmore, D. R.,
Lear, J. D., Nahapetian, A. T., Bradley, J. D., and Sisk, W. P. (1994) Biochemistry 33(34), 10229-
48.
46. Lin, X., Buff, E. M., Perrimon, N., and Michelson, A. M. (1999) Development 126(17), 3715-23.
47. Powell, A. K., Fernig, D. G., and Turnbull, J. E. (2002) J Biol Chem 277(32), 28554-63.
48. Mach, H., Volkin, D. B., Burke, C. J., Middaugh, C. R., Linhardt, R. J., Fromm, J. R., Loganathan,
D., and Mattsson, L. (1993) Biochemistry 32(20), 5480-9.
49. Plotnikov, A. N., Hubbard, S. R., Schlessinger, J., and Mohammadi, M. (2000) Cell 101(4), 413-
24.
50. Delehedde, M., Lyon, M., Gallagher, J. T., Rudland, P. S., and Fernig, D. G. (2002) Biochem J 9
51. Ishihara, M., Kariya, Y., Kikuchi, H., Minamisawa, T., and Yoshida, K. (1997) J Biochem (Tokyo)
121(2), 345-9.
52. Lundin, L., Larsson, H., Kreuger, J., Kanda, S., Lindahl, U., Salmivirta, M., and Claesson-Welsh,
L. (2000) J Biol Chem 275(32), 24653-60.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 25: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/25.jpg)
25
53. Kariya, Y., Kyogashima, M., Suzuki, K., Isomura, T., Sakamoto, T., Horie, K., Ishihara, M.,
Takano, R., Kamei, K., and Hara, S. (2000) J Biol Chem 275(34), 25949-58.
54. Merry, C. L., Bullock, S. L., Swan, D. C., Backen, A. C., Lyon, M., Beddington, R. S., Wilson, V.
A., and Gallagher, J. T. (2001) J Biol Chem 276(38), 35429-34.
55. Rahmoune, H., Chen, H. L., Gallagher, J. T., Rudland, P. S., and Fernig, D. G. (1998) J Biol Chem
273(13), 7303-10.
56. Brickman, Y. G., Ford, M. D., Gallagher, J. T., Nurcombe, V., Bartlett, P. F., and Turnbull, J. E.
(1998) J Biol Chem 273(8), 4350-9.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 26: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/26.jpg)
26
FIGURE LEGEND
Figure 1. Various Models of FGFR Signaling Complexes with Three Modes of Protein/HS Interaction
(A) Three models with cis mode of interaction. The yellow balls represent FGFs; the blue bars represent
FGFRs; the red rods represent HS. (B) Two models with trans mode of interaction. (C) Three models with
mix mode of interaction. In model VII, two chains of HS are incorporated.
Figure 2. Oligosaccharide Labeling and Binding Assay with FGF1 and FGFR1
(A) An oligosaccharide ladder from dp2 to dp24 was radiolabeled with 6-OST-1 and separated with a 15%
PAGE gel. The dp2 was prepared from digestion of a 6-OST-1 labeled heparin. The size of each
oligosaccharide is indicated. (B) Measuring the minimum FGF1 and FGFR1 binding HS. The
oligosaccharide ladder was used to do the binding assay with FGF1 or FGFR1. Each lane contained
roughly 25 ng of oligosaccharide and 31 pmol (50 ng) of FGF1 or 24 pmol (100 ng) of FGFR1. F1, FGF1;
R1, FGFR1.
Figure 3. Observation of FGF1:HS:FGFR1 Ternary Complex
(A) Complex formation and its concentration dependence. Excess dp18 was used for the reactions and the
concentrations of FGF1 and FGFR1 in the binding reactions are indicated. F1:HS, binary complex of FGF1
and HS; HS:R1, binary complex of HS and FGFR1; F1:HS:R1, ternary complex of FGF1, HS and FGFR1.
(B) Thermal stability of the binary and ternary complexes. Around 0.8 µM each of FGF1, FGFR1 and dp18
were used in all the binding reactions. The heating temperature and the duration (in minutes) for each
reaction are indicated. (C) Ternary complex formation on CHO cells assayed with flow cytometry. The
cells were sequentially sorted without any protein, with FGFR1β(IIIc)/Fc, and with both FGF1 and
FGFR1β(IIIc)/Fc. Left panel, HS-deficient CHOpgsA-745 cell. Middle panel, HS-expressing CHO-K1 cell.
Right panel, a CHO cell expressing 2-O sulfation negative HS. The fluorescence tagged FGFR1β(IIIc)/Fc
was monitored. F1, FGF1; R1/Fc, FGFR1β(IIIc)/Fc.
Figure 4. Minimal HS in the Ternary Complex of FGF1:HS:FGFR1
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 27: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/27.jpg)
27
(A) Binding assay with the oligosaccharide ladder in the presence of FGF1 and/or FGFR1. Each lane
contained 100 ng oligosaccharide and 16 pmol each of FGF1 and/or FGFR1. FGF1:HS:FGFR1 is visible
from dp4 to dp6. (B) Western blot of another gel with anti-FGF1. In order to see FGF1:HS, limited FGFR1
was applied to each binding reaction. Lane 1 and 2 contained no HS.
Figure 5. Molar Ratio between FGF1 and FGFR1 in the Ternary Complex
(A) Gel shift assay with excess HS (dp12). Lane 2 to 9, constant concentrations of FGF1 (0.8 µM), but
increasing concentrations of FGFR1 were applied. The molar concentration ratios (R1/F1) were indicated
on the top. No protein was in lane 1 and only FGFR1 (3.2 µM) was added in lane 10. (B) Densitometry
analysis of A. (C) The band intensity of the ternary complex was plotted against the molar equivalents of
FGFR1 to FGF1.
Figure 6. Effect of Critical Sulfate Groups on the Formation of the Ternary Complex
(A) 3-OST-1 and/or 6-OST-1 modified heparin oligosaccharides and chemically modified heparin were
shifted with FGF1 and /or FGFR1. ~/31, modified with 3-OST-1; ~/61, modified with 6-OST-1; ~/31,61,
modified with 3-OST-1 and 6-OST-1; F1, FGF1; R1, FGFR1. (B) Disaccharide analysis of the heparin and
chemically modified heparins. a, heparin; b, DSNAc; c, DSNS, d, 6ODS
Figure 7. A Proposed Mechanism for the Formation of the FGF1/FGFR1 Signaling Complex
In inactive state, FGF1 and FGFR1 bind to their primary binding sites on the HS chain. The binding sites
can be contiguous in a same sulfated domain or separated in different sulfated domains, depending on the
size of the sulfated domains. During the activation, one FGF1 binds to one FGFR1 on the same chain of HS
and form a half complex at the non-reducing ends. Two of these half complexes then associate to an active
molecular signaling complex.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 28: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/28.jpg)
28
TABLES
Table 1. Selecting FGFR1 Molecular Signaling Models with HS Size and Stoichiometry
Models in Figure 1 I II III IV V
VI VII
VIII
Minimum HS sizea dp 12 dp 8 dp 20 dp 4 dp8 dp8 dp 4 dp8
Molar ratio of FGF1, HS, FGFR1
1:1:1 2:1:2 1:1:2 2:1:2 1:1:1 2:1:2 2:2:2
2:1:2
HS/FGFR1 interaction
yes yes yes no yes yes yes yes/nob
Receptor dimerization
no yes yes yes no yes yes yes
Fit no no no no no no yes no
aMinimum HS is derived from either literature or calculation whichever is smaller. Calculation is estimated
according that the minimum FGF1 binding HS is a tetrasaccharide and minimum FGFR1 biding HS is an
octasaccharide (Figure 2B)
bOne FGFR1 interacts with HS, the other does not.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 29: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/29.jpg)
29
Table 2. The Molar Ratio of Oligosaccharide to FGF1 in the Ternary Complex
HS size 4 6 8 10 12 14 16 18 20 24
HS (pmol) 16.7 12.5 14.6 16.6 15.5 15.2 19.5 14.1 14.4 13.8
FGF1/HS 1.04 0.78 0.90 1.03 0.96 0.95 1.21 0.88 0.90 0.86
Note: Each binding reaction contained 16 pmol of FGF1, 64 pmol of FGFR1 and 250 ng of oligosaccharide.
The molecular weight of oligosaccharides was calculated based on the molecular weight of the fully sulfated
disaccharide, which is 577.
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 30: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/30.jpg)
30
Table 3. Sulfation versus complex formation and mitogenic activity
HS Sulfation aF1:HS aHS:R1 aF1:HS:R1 bMitogenic Activity
Dp2 2, 3, 6-O, N- - - - 0.07± 0.08
Dp4 2, 3, 6-O, N- + - + 0.35 ± 0.15
Dp6 2, 3, 6-O, N- + - + 0.46 ± 0.14
Dp8 2, 3, 6-O, N- + + + 0.51 ± 0.12
Dp10 2, 3, 6-O, N- + + + 0.75 ± 0.20
Dp12 2, 3, 6-O, N- + + + 0.83 ± 0.19
Dp14 2, 3, 6-O, N- + + + 0.95 ± 0.22
Dp16 2, 3, 6-O, N- + + + 0.97 ± 0.22
DSNAc/61 6-O- - - - 0.03 ± 0.05
DSNAc/61,31 3, 6-O- - - - 0.04 ± 0.05
DSNS/61 6-O, N- - - + 0.75 ± 0.25
DSNS/31 3-O, N- - - + 0.56 ± 0.17
6ODS/31 2, 3-O, N- + - + 0.66 ± 0.20
HSpgsF-17c 3, 6-O, N- - - + 0.72 ± 0.14
aThe formation of the corresponding complex is indicated by plus and minus signs.
bRelative values to the mitogenic activities of heparin.
cThe HS prepared from mutant cell CHOpgsF-17
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 38: The Involvement of Heparan Sulfate in FGF1/HS/FGFR1 Signaling](https://reader031.vdocuments.mx/reader031/viewer/2022022418/58a309dd1a28ab722c8bc1bb/html5/thumbnails/38.jpg)
and Robert D. RosenbergZhengliang L. Wu, Lijuan Zhang, Tomio Yabe, B. Kuberan, David L. Beeler, Andre Love
The involvement of heparan sulfate in FGF1/HS/FGFR1 signaling complex
published online February 25, 2003J. Biol. Chem.
10.1074/jbc.M212590200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 16, 2018
http://ww
w.jbc.org/
Dow
nloaded from