The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob

Edwards

Flinders2015

How to annotate a coupleof hundred genomes

RobEdwards

Flinders2015

Annotation of microbial genomesand comparison across differences

Cholerae Haiti Genome Sequencing ORF Calling Annotation Global evolution Niche dimensions

Cholera is caused by Vibrio cholerae

About 3-5 million cases per year

About 100 - 200,000 deaths world wide per year

Notable deaths: Tchaikovsky Polk (11th President USA)

A world wide pandemic

About 75% of patients have no symptoms

25-50 PINTS of diarrhea per DAY

Severe symptoms are by dehydration

Treatment

Clean water

Electrolytes

Vaccine

Not antibiotics

Symptoms

1st – 1817 to 1823 Started at the Ganges, spread by colonialists

2nd – 1829 to 1849 Worldwide spread via immigrants

3rd – 1852 to 1859 John Snow first epidemiologist

Multiple Pandemics

John Snow

Portrait painted in

1847 when he was

34 years old.

First epidemiological study

John Snow

Cholera outbreak in Soho, London 1854

Plotted all cases on a map

Found big cluster around water well

First epidemiological study

John Snow’s Map

First epidemiological study

On the mode of communication

of Cholera

1854

Cholera caused by bacteria

Outbreaks of cholera

1st – 1817 to 1823 Started at the Ganges, spread by colonialists

2nd – 1829 to 1849 Worldwide spread via immigrants

3rd – 1852 to 1859 John Snow first epidemiologist

4th – 1863 to 1879 Originated in mecca

5th – 1881 to 1896 First cholerae vaccine (1892)

6th – 1899 to 1923 Killed 800,000 people

7th – 1961 to present 1991: South America killed > 100,000

people

Multiple Pandemics

Earthquake Jan 12th, 2010

No cholera in Haiti for > 50 years

First case, October 22nd, 2010

By February, 2011 250,000 cases and ~5,000 deaths

What was the original source?

Haitian Outbreak

http://www.ph.ucla.edu/

Haitian cholera outbreaks

Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

Cases by day – Mirebalais Hospital

Cases by Age – St Marc HospitalOn October 20th, 2010

Two hypotheses:

Endemic, waterborne strain that has been in Haiti but not caused disease for 50 years

Imported from another country

Haitian Outbreak

"They have been fortunate in Haiti that for 50 years the conditions have been such that they haven’t had an intense increase in cholera bacterial populations. ... But they’ve had an earthquake, they’ve had destruction, they’ve had a hurricane ... I think it’s very unfortunate to look for a scapegoat. It is an environmental phenomenon that is involved”

Rita ColwellJohns Hopkins School of Public Health

The environmental hypothesis

“The organism that is causing the disease is very uncharacteristic of (Haiti and the Caribbean), and is quite characteristic of the region from where the soldiers in the base came. ... I don't see there is any way to avoid the conclusion that an unfortunate and presumably accidental introduction of the organism occurred."

John MekalanosHarvard Medical School

The human hypothesis

Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

Conditions favor human hypothesis

Conditions favor human hypothesis

Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

Conditions favor human hypothesis

Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

Global evolution of Vibrio

Can we use genomics to identify the global evolution of Vibrio?

Which gene(s) are important for temporal/spatial variation?

Prototype Vibrio cholerae

sequence

TIGRNature 406, 477-483(3 August 2000)

Sequenced genomes

2011 – 32 Vibrio strains sequenced

Fabiano Thompson's Lab @ UFRJ

Fundação Oswaldo Cruz

Ion quality scores

Sequenced genomes

2011 – 32 Vibrio strains sequenced

2011 – 171 Vibrio strains sequenced

How do you analyze 250+ genomes?

The steps in genome sequencing

Generate genome sequence Assembly ORF calling tRNA identification rRNA identification Functional annotation

www.sigmaaldrich.com

Putative protein

Open Reading Frame (ORF)

A stretch of amino acids with no stop codon

Coding Sequence (CDS) An ORF that could encode a protein

Protein encoding gene (PEG) An ORF that could encode a protein

Hypothetical protein = putative protein

Something that has not been experimentally shown

Polypeptide

Short stretch of ~50 amino acids. Often a domain

Reads per chromosome (Chr. I)

Reads per chromosome (Chr. II)

Cholera Toxin Phage

Assembly

ORF Calling

Annotation

Annotated Vibrio using RAST

Single nucleotide polymorphisms

ATCATCGATCAGCATGCATCAGCATCGATCAGCATCATCGATCAGCATGCATCAGCATCGATCAGCATCATCGATCAGCATGCATCAGCCTCGATCAGCATCATCGATCAGCATGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGATCAGCATCATCGATCAGCAAGCATCAGCCTCGAGCAGCATCATCGATCAGCAAGCATCAGCCTCGAGCAGC

Global evolution

Mutreja et al 2011

Mutreja et al 2011

Waves of spread of cholera

Mutreja et al 2011

Different evolution for each wave

On the source of Haitian cholera

Cholerae

Mimicus

Parahemolyticus

Harveyi

Vibrio cholerae from Bangladesh in 1994 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Bangladesh in 2002 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Haiti in 2010

Outbreak in Khatmandu, Nepal before the soldiers left

Outbreaks downstream (not upstream) along the river from the nepalese UN camp

But that could have come from river trade. Ships used to fly the yellow flag when they were quarantined by cholera

Nepalese soldiers?

http://www.ph.ucla.edu/

Haitian cholera outbreaks

Conservation of the ~120 kb superintegron region across 210 strains

Evolution not only by SNPs

Mother

Daughter Daughter

SNPs HGT

Horizontal gene transferversus

Vertical evolution

210 Vibrio genomes

Reassembled

Reannotated

Find interesting genes!

Year Continent Country Lat/Lon

Coordinates Clinical or

Environmental Source Serogroup Serotype Biotype Mutreja wave

Niche dimensions

Serogroup

Vibrio cholerae

Non-cholera toxin

No disease

Cholera toxin

O1 O139

ClassicalEl Tor

Ogawa Inaba

Epidemics

Biotype

Serotype

V. cholerae classification

15,000 genes in the pangenome

933 subsystems (pathways) present in at least one genome

SNPs (after Mutreja)

Response variables

Recreate evolution of the Vibrios

What are the important genes for each niche dimension

Who, what, when, where!

Use random forests to identifyimportant variables

Analysis

O-antigenExopoly-

saccharideCapsule Sialic Acid

DNA recomb.

01 10 20 5 10

01 10 20 5 10

01 10 20 5 10

0139 100 1 8 10

0139 100 1 8 10

0139 100 1 8 10

0139 100 1 8 10

Random Forest

O139O1

Exopoly-saccharide

<50

Random Forest

O1 O139

DNA-recombination

10

O1 O139

Capsule

<10

Random Forest

Each tree votes on the importance of each variable.

Typically, run 10,000 trees

Responsevariablesand nichedimensions

Genes important for who ?(serogroup)

Genes important for what? (clinical, environmental, ...)

Genes important for where?(continent)

Separation of functions by continent

Genes important for when?(year)

DNA Repair

DNA repair & phages

Normal DNA repair(134 strains)

umuC umuDAdditional DNA repair(4 strains; not O1)

umuCumuDPhage borne DNA repair(72 strains) umuCprophage

Mutreja et al 2011

Waves 2 & 3 have phage Interrupted repair

Different evolution for each wave

Conclusions

Unraveling evolution and spread of new pathogens

Mining genomes and niche dimensions

Don't get scooped!

Multi-genome projects??

Organism Number Organism Number

S. pyogenes 3,615 Mycobacterium tuberculosis

390

S. pneumoniae 3,085 Salmonella in cattle and humans

373

Rice (Oryza sativa) 3,000 Vibrio 274

C. elegans 2,007 Shigella sonnei 263

Clostridium difficile 1,250 Mycobacterium tuberculosis

259

The thousand (human) genome project

1,092 Streptococcus pneumoniae

240

Mycobacterium tuberculosis

1,000 Methicillin-resistant Staphylococcus aereus

193

Plasmodium falciparum

825 Campylobacter jejuni

192

Streptococcus pneumoniae

616 Mycobacterium abscessus in CF

170

Nick Loman: http://lab.loman.net/

Current multigenome projects