TRPLSC-1217; No. of Pages 7

The functional scope of plantmicroRNA-mediated silencingJunyan Li, Marlene Reichel, Yanjiao Li, and Anthony A. Millar

Plant Science Division, Research School of Biology, Australian National University, 0200 ACT, Australia

Opinion

Deep sequencing has identified a complex set of plantmiRNAs that potentially regulates many target genes ofhigh complementarity. Furthermore, the discovery thatmany plant miRNAs work through a translational repres-sion mechanism, along with the identification of nonca-nonical targets, has encouraged bioinformatic searcheswith less stringent parameters, identifying an even wid-er range of potential targets. Together, these findingssuggest that any given plant miRNA family may regulatea highly diverse set of mRNAs. Here we present evolu-tionary, genetic, and mechanistic evidence that opposesthis idea but instead suggests that families of sequence-related miRNAs regulate very few functionally relatedtargets. We propose that complexities beyond comple-mentarity impact plant miRNA target recognition, pos-sibly explaining the current disparity betweenbioinformatic prediction and functional evidence.

Plant miRNAs and their target genesOver the past 10–15 years, a previously unappreciatedlayer of gene regulation conducted by non-protein-codingRNAs has continued to emerge. This includes 20–24-nucleotide (nt) small RNAs (sRNAs), whose ubiquity anddiversity potentially link them with most facets of plantbiology, encompassing development, stress, and epigeneticphenomena [1,2]. Of the many different sRNA classes,miRNAs have been the most extensively characterized.They repress the expression of transcripts to which theyhave high complementarity via a complex mechanism thatincludes transcript cleavage and/or translational repres-sion [3]. Currently, the approximate number of identifiedmiRNAs in a plant genome is around 100–250 [4] and thisnumber continues to grow aided by next-generation se-quencing technologies [5–7]. However, like all plantsRNAs, understanding their true functional scope hasremained problematic and could be considered one of themajor current challenges of plant biology.

A prerequisite to understanding sRNA function is theidentification of the genes they regulate. For plant miR-NAs, early bioinformatics studies were highly successful inthis regard, as most known miRNAs had easily identifi-able, highly complementary targets [8]. Supporting this

1360-1385/

� 2014 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/

j.tplants.2014.08.006

Corresponding author: Millar, A.A. (tony.millar@anu.edu.au).Keywords: miRNA; miRNA targets; bioinformatics; functional analysis.

were functional analyses suggesting that plant miRNAshave a narrow specificity due to high complementarityrequirements [9–11]. Such evidence formed the basisof many bioinformatic programs that predict miRNAtargets [12], including the mainstream web-basedPlant Small RNA Target Analysis Server (psRNATarget)(http://plantgrn.noble.org/psRNATarget/) [13]. Conversely,bioinformatic programs exist that can predict whethera gene of interest is likely to be targeted by a sRNA(http://somart.ist.berkeley.edu/) [14]. Although it is gener-ally accepted that the number of genes that a plant miRNAtargets is at least an order of magnitude lower than foranimal miRNAs, the notion that plant miRNAs have anextensive network of targets, regulating many more genesthan initially identified, is often proposed [15–17]. Here weargue that this notion, which is primarily based on bioinfor-matic and molecular studies, is at odds with functional,evolutionary, and mechanistic evidence.

A complex miRNomeThe use of high-throughput sequencing methods hasresulted in the notion of the plant miRNome (the fullcomplement of miRNAs in a given plant species) havingconsiderable greater complexity than previously thought[7]. Although, by definition, a miRNA gene predominantlygives rise to only one unique, abundant mature miRNA,much of this complexity arises through differential proces-sing of the primary MIRNA transcripts (Figure 1). First,multiple distinct miRNA species can arise from miRNAprecursors and production of these multiple miRNA spe-cies may be highly conserved [18]. Second, alternativeproduction of the passenger strand (miRNA*), which formsa duplex with the canonical miRNA during biogenesis(Figure 1), is a potential widespread source of miRNAdiversity. Usually the miRNA* is excluded from AGO-NAUTE (AGO) loading and rapidly degraded, but thereare now many documented instances in which the miRNA*accumulates to levels equivalent to or greater than thecorresponding canonical miRNA [5,19] and may displaydifferential tissue-specific expression compared with thecorresponding miRNA [20]. Some examples includemiR393* that regulates plant immune responses [21]and miR171*, which appears to have recently acquired atarget in Arabidopsis thaliana [22]. Third, the generationof miRNA isoforms (isomiRs) from the same pre-miRNA,which are thought to arise through imprecise DCL proces-sing [23] or post-transcriptional modifications [24], arefurther mechanisms by which a miRNA locus may extend

Trends in Plant Science xx (2014) 1–7 1

+A +U CH3 Canonical

miRNA(21 nt) miRNA*

DCL processingvariants (19-24 nt)

RNA postedi�ng Non canonical

miRNA (21 nt)

ComplexmiRNome

Pre-miRNA

MiRNA:target interac�on

Differen�al biogenesis

Target accessibility/2nd structure Overall complementarity and pa�ern

RNA binding protein miRNA:target stoichiometry

Canonical target sites(Protein coding sequences)

Non-canonical target sites(UTRs, intergenic regions,

introns, transposable elements)

miRISC

RBP

(A)n

(A)n (A)n (A)n

(A)n

RBP (A)n

AGO1-10

Targ

etex

pres

sion

[miRNA]

[Target mRNA]

Preferen�al AGOloading

IsomiRs Non-overlapping miRs

Differen�al AGOexpression

Silencing efficacy

Strongly silenced targets(Func�onal?)

Weakly silenced targets(Non-func�onal?)

Sile

ncin

gst

reng

th

TRENDS in Plant Science

Figure 1. The complexity of plant miRNA-mediated regulation. A diversity of miRNA species can arise from the same precursor through different biogenesis mechanisms.

First, imprecise DICER processing can give rise to isomiRs with heterologous length and/or sequence [5,6,23], whereas RNA post-editing, such as 30 uridylation or

adenylation and methylation, can promote the degradation or stability of isomiRs, respectively (reviewed in [25]). Second, some miRNA*s accumulate to similar or greater

levels compared with their cognate miRNAs [5,6,20–22] and abundant small RNAs unrelated to their precursor annotated miRNAs have been reported [5,6,19]. The

differential developmental and tissue-specific expression patterns of related miRNA species indicate various potential functions [5,6,18], whereas the differences in

expression pattern and miRNA loading preference of AGONAUTE (AGO) family members adds a possible level of regulatory complexity [6]. Upon AGO loading, miRNA-

loaded RNA-induced silencing complexes (miRISCs) interact with their respective targets, whose miRNA-binding site can be located within protein-coding genes, as well as

untranslated regions (UTRs), intergenic regions, introns, and transposable elements [16,28,29]. The interaction between miRISC and targets can be dictated by several

factors: (i) overall complementarity and patterns [9,31,32]; (ii) target mRNA accessibility, which is influenced by its secondary structure; (iii) RNA-binding proteins, which

can facilitate or inhibit target recognition; and (iv) the stoichiometric ratio between miRNA and target mRNA abundance [59]. These factors, individually or combinatorially,

determine silencing efficacy, which is defined as the strength of miRNA regulation over a certain target. This may underpin the existing miRNA–target relationship, where

most functionally important targets are strongly silenced compared with weak and nonfunctional targets.

Opinion Trends in Plant Science xxx xxxx, Vol. xxx, No. x

TRPLSC-1217; No. of Pages 7

its functional influence [25] (Figure 1). As miRNA isoformsvary in size and sequence from the canonical miRNA,alternative targets may be regulated and differentialAGO loading could arise, resulting in diverse regulatoryoutcomes [6]. Such mechanisms provide a wealth of poten-tial for miRNAs to subfunctionalize and acquire regulatorycomplexity with regard to the scope of targets they repressand the mechanisms by which this is achieved.

2

A plethora of potential targets?Early bioinformatics studies with strict complementarityrequirements were highly successful in identifying plantmiRNA target genes. This could be attributed to the factthat most miRNA targets have easily identifiable, highlycomplementary canonical binding motifs [8]. However, aseminal paper showing that translational repression is awidespread mechanism utilized by plant miRNAs [26]

Opinion Trends in Plant Science xxx xxxx, Vol. xxx, No. x

TRPLSC-1217; No. of Pages 7

raised the possibility that plant and animal miRNAs maywork through similar translational repression mecha-nisms and hence the requirement for high complementari-ty may be negated under such a mechanism [27]. This notonly raises the possibility that any given plant miRNA mayhave hundreds of targets [15], but has encouraged bioin-formatic analyses using feasible but less stringent param-eters, leading to predictions that plant miRNAs may havemany more targets than originally thought. For instance,using the psRNATarget algorithm with the maximal num-ber of five mismatches, the 243 annotated ArabidopsismiRNAs in miRBase were shown to have a potential totalof 15 390 binding sites in 10 442 known genes, or41 965 miRNA-binding sites in the entire genome[17]. From this, the study predicts that many genes arepotentially regulated by multiple distinct miRNAs, raisingthe possibility that these targets are subjected to combina-torial control by miRNAs. Furthermore, using bioinformat-ic tools, the introns of many genes have been shown tocontain potential miRNA-binding sites, a subset of whichappear genuine, as degradome signatures correspond tothese regions [16]. Indeed, target search algorithms aregenerally limited to annotated mRNA datasets and hencepossibly miss other potential noncanonical targets such aspseudogenes, long noncoding RNAs, or transposons, thelatter of which have been found to be targeted by manyconserved miRNAs [28]. The recent identification of anoncanonical miRNA-binding site that contains a 6-ntbulge [29] and the identification of degradome signaturesof other noncanonical targets [30] highlight the diversity ofmiRNA-binding sites that may have been overlooked.

Such analyses suggest a tremendous regulatory poten-tial of plant miRNAs and a plethora of target genes thatthey may regulate. However, evidence to support the exis-tence of low complementarity (translationally repressed)targets in plants remains to materialize; instead, opposingmolecular evidence is emerging. In an in vitro system,targets with animal-like sites that contain only a comple-mentarity seed region (nt 2–8) are not effectively silenced[31]. Consistently, an in vivo quantitative reporter assayhas found that complementarity appears to be a majordeterminant for plant miRNA site efficacy and animal-likesites with extensive mismatches are ineffectively silenced[32]. Indeed, all documented cases of translationally re-pressed plant miRNA targets possess canonical bindingsites with high complementarity [3,26,33–37], all of whichare also regulated by cleavage, while targets solely sub-jected to translational repression have not been identified.This suggests that, for efficiently regulated targets, there isstrong selection for high complementarity.

Together, these data raise a challenging question: whichof the potential miRNA–target gene relationships are offunctional significance, conferring a biological/physiologi-cal impact? Additionally, do mechanisms that result inmiRNA sequence diversification, like those that generateisomiRs, lead to new target acquisition and broaden theirfunctional scope? However, the question of ‘functionalsignificance’ in itself is a complex one; although thereare very obvious miRNA–target relationships that arecritical for the plant, many miRNA–target relationshipsmay not result in such obvious impact. Instead, they may

play subtle roles in specific cell types or have a bufferingrole in controlling gene expression that may confer aselective advantage only in certain environments and overmany generations (the targeting of transposons by miRNAto form epigenetically activated siRNAs [easiRNAs] couldbe one such example [28]). As this type of regulation isdifficult to detect, for the purposes of this Opinion articlewe define functional significance as having an immediate,obvious impact, playing a major role in controlling target-gene expression that results in an immediate physiologicalconsequence.

Does a constraint on the regulatory scope of plantmiRNAs exist?To address these questions, we must reflect on our under-standing of what is required for miRNA-mediated silenc-ing. A widespread general assumption in plants is that thesequence complementarity of the miRNA–target pair is thesole determinant of silencing, as, to date, there is littleevidence that other mechanisms such as RNA-bindingproteins or target accessibility exist in plants to modulatesilencing. Therefore, if a miRNA and a potential target ofsufficient complementarity are transcribed in the samecell, that target transcript is presumed to be subjectedto miRNA-mediated repression. Supporting this notion isthe overwhelming evidence that any given plant miRNA-loaded RNA-induced silencing complex (miRISC) is able toact independently [31,38], neither requiring to work in acombinatorial fashion nor relying on any additional cofac-tors. This principle of noncombinatorial, independentmiRNA-mediated silencing based solely on complementar-ity raises a regulatory issue. If a miRNA is predicted toregulate two (or more) genes, that miRNA must beexpressed in a pattern and at a level that simultaneouslysatisfy both required regulatory outcomes. Therefore, if amiRNA acquires a primary target, the expression pattern/level of that miRNA will be dictated by the requiredregulatory outcome of that primary target gene. Hence,if a second target is acquired, its regulatory outcome mustbe compatible with the primary miRNA–target relation-ship (Figure 2).

Evolutionary studies suggest that such a regulatoryconstraint may exist. Despite recent bioinformatics studiespredicting many targets for each plant miRNA, most of theconserved miRNAs appear to have conserved target genesthat correspond to only a single paralogous family and thishas persisted over long evolutionary periods [39]. As thesequences of both the miRNAs and their target sitesappear evolutionarily fixed, this suggests that there havebeen strong constraints on sequence divergence and strongselection for these miRNA–target family gene relation-ships.

A possible reason why these sequences have remainedfixed is that, within any given miRNA–target family rela-tionship, there are multiple paralogous miRNAs regulat-ing multiple paralogous target-gene family members. Suchan arrangement would impede sequence divergence ofeither the miRNA or the miRNA-binding site. Divergenceof the binding site would result in poor regulation by allmiRNA family members. Conversely, divergence of a singlemiRNA would alter its ability to regulate all family

3

Target1

miRNA-1

Expr

essio

n

Tissue 2/condi�on B Tissue 1/condi�on A

miRNA-1

Expr

essio

n

Tissue 2/condi�on B Tissue 1/condi�on A

Target2

Target3

Primary miRNA-target rela�onship

Secondary miRNA-target rela�onships

(A)

(B)

TRENDS in Plant Science

Figure 2. A hypothesized constraint on the regulatory scope of plant miRNAs. This

hypothesis is based on the assumption that only high complementarity of a

miRNA–target pair is required for strong miRNA-mediated silencing, where the

miRNA-loaded RNA-induced silencing complex (miRISC) acts in an autonomous,

noncombinatorial fashion. (A) If a miRNA targets a gene (called the primary target),

the expression of the miRNA will be dictated by the required expression outcome

of that target. (B) If the miRNA regulates additional targets, the required expression

outcomes of these secondary targets must be compatible with the desired

expression outcome of the primary target. For example, Target2 has a desired

expression outcome similar to that of Target1, where it is required to be

suppressed in Tissue 1/condition A but expressed in Tissue 2/condition B; hence,

acquisition of this target may result in a beneficial miRNA–target interaction.

However, Target3 is required to be expressed in Tissue 1/condition A, the same

domain in which miRNA-1 is required to be expressed to suppress Target1.

Therefore, a regulatory conflict emerges, which could be circumvented if there are

additional factors, such as target accessibility or RNA-binding proteins, that

attenuate the silencing of Target3 in Tissue 1/condition A.

Opinion Trends in Plant Science xxx xxxx, Vol. xxx, No. x

TRPLSC-1217; No. of Pages 7

members and hence lower its fitness. While there is evi-dence that individual miRNA family members have sub-functionalized to regulate individual paralogous targetfamily members in a particular tissue or process [40,41],there is no strong functional or evolutionary evidence forwidespread target diversification, where a sequence vari-ant of a miRNA family has acquired a new, nonparalogoustarget (see below). This implies that acquiring a newfunctional target is extremely rare.

Plant miRNAs target multiple nonparalogous genes thatare functionally relatedInterestingly, in examples where plant miRNAs do havemultiple conserved nonparalogous targets, these targetgenes appear to be components of a related process [39],consistent with the regulatory constraint discussed above.For example, miR395, which is induced by sulfate depri-vation, has two distinct target genes, both of which areinvolved in sulfur metabolism: ATP SULFURYLASES andSULFATE TRANSPORTER 2; 1 [42]. Likewise, miR398,which is expressed under Cu2+-limiting conditions, targets

4

genes that encode proteins that require Cu2+ as a cofactor.This includes the copper/zinc superoxide dismutase familymembers CSD1 and CSD2, as well as the copper chaperone(CCS1) that encodes a protein that delivers the Cu2+

necessary for CSD1 and CSD2 activity [43]. Additionally,it targets the genes encoding blue copper-binding protein(BCBP) and the Cu2+-binding plastocyanin protein[29]. miR399 also has two distinct conserved targets:PHO2, an E2 ubiquitin conjugase protein, and IPS1, atarget mimic that inhibits miR399 activity under phos-phate starvation to induce PHO2 expression [44]. Support-ing this notion, a recent study using conservation as acriterion for identifying miRNA targets found several ad-ditional miRNAs that regulate multiple nonparalogoustargets of related function [45].

Another possible scenario is that nonparalogous targetsmay not be in the same biochemical pathway but sharecommonalities in terms of their required expression pat-terns. For instance, miR159 targets two distinct classes ofgenes encoding MYB transcription factors; namely,GAMYB-like and DUO1 [11]. However, the miR159-bind-ing site appear to have arisen independently, as they arelocated in different regions of the MYB genes, makingthese evolutionarily distinct targets. The commonalitybetween these MYB targets is that they are both requiredfor male development; the GAMYB-like genes MYB33 andMYB65 are required for anther development [46], whereasDUO1 is required for pollen development [47]. As miR159is widely expressed and highly abundant to restrict MYB33and MYB65 expression to the anther/pollen, this miR159expression pattern is compatible with that of DUO1, whichis expressed exclusively in pollen. Interestingly, of the top20 predicted miR159 targets in Arabidopsis, 12 are pre-dominantly transcribed in anthers/pollen [48]. Thus, al-though it may be implied from the list of targets thatmiR159 could be involved in a range of diverse pathwaysand processes, an alternative hypothesis is that the role ofmiR159 is simply to restrict expression of these targetgenes to anthers/pollen, acting as a secondary level ofregulation silencing any leaky transcription of these genesoutside the anther [48].

Functional specialization of miRNAs to acquire newtargets occurs infrequentlyAs most miRNAs exist in small gene families comprisingmature miRNAs that have slight sequence variations, thepotential of functional specialization of related miRNAfamily members through acquiring new, nonparalogoustargets would seem high. Nevertheless, there is little evi-dence supporting the existence of frequent neo-target ac-quisition due to sequence divergence of a miRNA familymember. To date, there are only a few examples of se-quence-related miRNAs with distinct target genes; forinstance, the miR159/miR319 families [11], the miR390/miR4376/miR7122 superfamily [49,50], and the miR482/miR2118 family [51,52]. Indeed, for some ancient miRNAfamilies, such as miR156/157, miR165/166, miR169, andmiR170/171, despite sequence divergence arising, itappears that the related miRNAs still predominantly tar-get the same paralogous target families (Figure 3). Fur-thermore, some completely distinct miRNAs resemble one

miR156 3’-CACGAGUGAGAGAAGACAGU SPL 5’ -GACUCGAGCUGUGCUCUCUCUCUUCUGUCAACCCAmiR529 3’-UUCGACAUGAGAGAGAGAAGA

miR170 CUAUAACUGUGCCGAGUUAGUSCL CGCAAGGGAUAUUGGCGCGGCUCAAUCACAACCUUmiR171 GCACUAUAACCGUGCCGAGUU

(A)

(B)

TRENDS in Plant Science

Figure 3. Different miRNAs that target the same miRNA-binding site. (A) miR156

(osa-miR156a-j) and miR529 (osa-miR529b) arise from unrelated precursors but

have evolved to predominantly target the same miRNA-binding sites on the SPL

family of genes [5]. (B) miR170 and miR171 have diverged in Arabidopsis but still

regulate the same predominant target SCL gene family [56,66].

Opinion Trends in Plant Science xxx xxxx, Vol. xxx, No. x

TRPLSC-1217; No. of Pages 7

another. For instance, in rice (Oryza sativa), miR529 andmiR156 share 14 nucleotides and appear to target thesame binding site, although binding is offset by five nucleo-tides [5]. Similarly, miR1430 and miR1433 are similar tomiR169 and are predicted to target the same genes [5]. Be-cause the miR529, miR1430, and miR1433 precursors donot show any sequence similarity to canonical miR156 andmiR169 precursors, this may be an instance of convergentevolution, with strong selection pressure for miRNAs totarget these canonical miRNA-binding sites. This suggeststhat, despite the apparent potential for target diversifica-tion, the opposite may be true: could the existence ofconserved miRNA-binding sites be acting as a strong se-lective pressure, resulting in an increased number of in-dividual miRNAs that regulate a single paralogous targetfamily, from which discrete miRNA–target modules maythen arise [53]?

Table 1. Current methodologies in the identification and validatiotarget?

Method Pros

RNA ligase-mediated

50-RACE

Recovers in vivo cleavage products of target

mRNA with high sensitivity, especially for targ

mRNA at low abundance.

Degradome sequencing Can give an estimation of to what extend

miRNA-guided cleavage contributed to the

degradation of the target mRNA. More likely t

detect biologically important and/or strongly

regulated targets compared with 50-RACE.

Overexpression of

miRNA-resistant target

Has been successful in identifying functionall

important miRNA–target relationships. Many

miRNA-resistant transgenes confer phenotype

that are highly similar to the corresponding

loss-of-function mirna phenotype.

Overexpression of miRNA Can identify potential targets. Resulting

transgenic plants can exhibit phenotypes

similar to those of the knockout mutants of

target genes.

Loss-of-function mutant Identifies bona fide, biologically important

miRNA–target relationships.

Inhibition of miRNAs by

target mimicry

Can be potent inhibitors of endogenous miRN

activities and generate loss-of-function

phenotypes. Able to overcome redundancy

among genes in the same miRNA family [56]

Loss-of-function genetic approaches define a narrowfunctional specificity for plant miRNAsThe above data suggest that evolutionary constraints mayexist, lessening the chance for miRNAs to acquire newtargets. Such a narrow target specificity of plant miRNAsis supported by genetic analysis. In any instance wheremiRNA activity is inhibited through a loss-of-functionapproach, deregulation of only one group of paralogoustargets appears predominantly responsible for any corre-sponding mutant phenotype. For instance, in an Arabidop-sis loss-of-function mir164abc combinatorial mutant, thesubsequent phenotype appears to be mainly due to thederegulation of the CUC1 and CUC2 family members only[40]. In a mir159ab mutant, all pleiotropic developmentaldefects were suppressed by the introduction of myb33 andmyb65 loss-of-function alleles [54]. In maize (Zea mays),aberrant development caused by a mir172 mutation isalmost fully suppressed by the mutation of just one targetgene [55]. Additionally, target mimicry (MIM) has beenused to inhibit individual miRNA families to generatemirna loss-of-function phenotypes in Arabidopsis [56]. In-terestingly, many of the resulting mutant MIM phenotypesgenerated phenocopied transgenic plants that expressedthe corresponding miRNA-resistant target gene. Thisagain suggests that the generation of these mutant phe-notypes was predominantly due to the deregulation of justa single paralogous family of target genes.

Does molecular validation of a miRNA–targetinteraction equate to functionally important regulation?It may be argued that only the obvious targets that resultin the major regulatory outcomes are being identified

n of plant miRNA targets: what defines a bona fide miRNA

Cons

et

PCR-based method. Could detect inefficient basal cleavage activity

that potentially has no functional importance, as the contribution of

miRNA-guided cleavage to regulating the mRNA levels of that

particular target is not quantitated.

o

y

s

Transgenic expression of one miRNA-resistant target gene often

unexpectedly confers stronger phenotypes than those observed in

the loss-of-function mirna mutant, where multiple paralogous

genes have been deregulated. Faithful duplication of target

transcription patterns and levels cannot be guaranteed even under

the control of endogenous promoters. Therefore, the functional

significance of the miRNA–target relationship may be exaggerated

[67].

The miRNA is normally misexpressed at artificially high levels.

Therefore, the endogenous role of the miRNA may be

misrepresented.

Difficult to obtain for two reasons: (i) MIR genes are usually small,

thus the chances of finding a mutation are low; and (ii) extensive

genetic redundancy in most miRNA families makes isolating and

generating combinatorial mutants unfeasible.

A

.

5

Box 1. Future challenges

� Identify factors beyond complementarity involved in controlling

miRNA silencing efficacy.

� Achieve a greater understanding of the roles/mechanisms of

factors determining silencing efficacy:

target accessibility/secondary structure;

RNA-binding proteins;

target site context.

� Understand the functional significance of newly identified miR-

NAs, including species-specific miRNAs, miRNA variants, and

isomiRs.

� Improve bioinformatic programs for miRNA target prediction by

incorporating factors beyond complementarity.

Opinion Trends in Plant Science xxx xxxx, Vol. xxx, No. x

TRPLSC-1217; No. of Pages 7

through loss-of-function genetic approaches and that manymore minor regulatory relationships exist. There is molec-ular evidence to support this idea, because 50 rapid ampli-fication of cDNA ends (50-RACE) assays that enablevalidation of bona fide miRNA targets through detectionof specific miRNA-guided cleavage products can identifyadditional targets compared with functional analysis. Forinstance, of the approximately 20 predicted miR159 tar-gets in Arabidopsis, ten have been validated as targetsthrough 50-RACE analysis, despite genetic analysis dem-onstrating that miR159 regulation of only two targets,MYB33 and MYB65, is functionally important [48]. How-ever, detection of such miRNA-guided cleavage productsusing a PCR-based method may not equate to functionallyrelevant miRNA regulation as the assay is not quantita-tive, giving no indication of the contribution of miRNA-mediated silencing to the overall regulation of the targetgene (Table 1). By contrast, deep-sequencing degradomeapproaches may be more likely to detect functionally rele-vant or strongly regulated targets, as MYB33 and MYB65are the only miR159 targets that have consistently strongCategory I signatures, which is also the case for manyconserved canonical targets [57,58]. However, there areweak signatures recovered for conserved canonical targets,as well as potential targets that do not conform to theempirical parameters [57–59]. So again, although degra-dome signatures indicate that a miRNA can guide cleavageof the corresponding mRNA, the functional significance ofthese signatures is far from clear. We advocate that muchgreater caution is warranted in the ‘functional’ interpreta-tion of these molecular measurements.

Concluding remarks: complexities of plant miRNAtarget recognitionThe discrepancy between the number of miRNA targetspredicted by bioinformatics and the number of targets sub-jected to functionally significant regulation may reflect apoor understanding of plant miRNA target recognition andthe factors that impact silencing efficacy (Box 1). Although itis clear that high complementarity between miRNA andtarget is a prerequisite for strong silencing, there are otherfactors beyond complementarity that facilitate silencing[59]. The initial success of artificial miRNAs (amiRNAs)may have argued against such factors, as their design isbased purely on complementarity [60]. However, it is be-coming clear that amiRNAs operate with highly inconsis-tent efficacies that cannot be explained by complementarityalone [37,61]. In many ways this is unsurprising, consider-ing that factors such as target accessibility determined byRNA secondary structure and mRNA-binding proteins canstrongly dictate miRNA–target interactions in animals[62,63]. Similar evidence is now emerging in plants. Forinstance, it has been observed that the miRNA-binding sitesin Arabidopsis are generally less structured than the flank-ing regions [64], which may result in increased accessibilityand allow more efficient interaction between miRNA and itstarget mRNA as suggested by previous bioinformatic anal-ysis [65]. Moreover, mutations of deeply conserved nucleo-tides flanking the miR159-binding site of MYB33 stronglyattenuate miR159 regulation, indicating that the sequencecontext in which a miRNA-binding site resides can

6

significantly impact the silencing outcome [59]. Given thatmany miRNA–target relationships are ancient, it is possiblethat the molecular architecture of miRNA target sites hasevolved higher-order regulatory complexities that enablethe required regulatory outcome.

The complexities of plant miRNA target recognition mayunderlie the discrepancy between the number of targetspredicted by bioinformatics programs and the number oftargets that are subjected to functionally relevant miRNAregulation as defined by genetic analysis. Conversely, it mayalso provide a mechanism to overcome the regulatory con-flict as outlined in Figure 2, allowing some targets to beexpressed despite the presence of the miRNA. It probablyhighlights the long, hard road ahead in defining whichmiRNA–target relationships are of functional significance,a task necessary for understanding the biological role of thevery complex and diverse plant miRNome.

AcknowledgmentsThis research was supported by Australian Research Council grantDP130103697.

References1 Bologna, N.G. and Voinnet, O. (2014) The diversity, biogenesis, and

activities of endogenous silencing small RNAs in Arabidopsis. Annu.Rev. Plant Biol. 65, 473–503

2 Castel, S.E. and Martienssen, R.A. (2013) RNA interference in thenucleus: roles for small RNAs in transcription epigenetics and beyond.Nat. Rev. Genet. 14, 100–112

3 Li, S. et al. (2013) MicroRNAs inhibit the translation of target mRNAson the endoplasmic reticulum in Arabidopsis. Cell 153, 562–574

4 Sun, G. (2012) MicroRNAs and their diverse functions in plants. PlantMol. Biol. 80, 17–36

5 Jeong, D.H. et al. (2011) Massive analysis of rice small RNAs:mechanistic implications of regulated microRNAs and variants fordifferential target RNA cleavage. Plant Cell 23, 4185–4207

6 Jeong, D.H. et al. (2013) Parallel analysis of RNA ends enhances globalinvestigation of microRNAs and target RNAs of Brachypodiumdistachyon. Genome Biol. 14, R145

7 Jeong, D.H. et al. (2013) Comprehensive investigation of microRNAsenhanced by analysis of sequence variants, expression patterns,ARGONAUTE loading, and target cleavage. Plant Physiol. 162,1225–1245

8 Rhoades, M.W. et al. (2002) Prediction of plant microRNA targets. Cell110, 513–520

9 Schwab, R. et al. (2005) Specific effects of microRNAs on the planttranscriptome. Dev. Cell 8, 517–527

10 Jones-Rhoades, M.W. et al. (2006) MicroRNAS and their regulatoryroles in plants. Annu. Rev. Plant Biol. 57, 19–53

11 Palatnik, J.F. et al. (2007) Sequence and expression differencesunderlie functional specialization of Arabidopsis microRNAs miR159and miR319. Dev. Cell 13, 115–125

12 Dai, X. et al. (2011) Computational analysis of miRNA targets in plants:current status and challenges. Brief. Bioinform. 12, 115–121

Opinion Trends in Plant Science xxx xxxx, Vol. xxx, No. x

TRPLSC-1217; No. of Pages 7

13 Dai, X. and Zhao, P.X. (2011) psRNATarget: a plant small RNA targetanalysis server. Nucleic Acids Res. 39, W155–W159

14 Li, F. et al. (2012) SoMART: a web server for plant miRNA, tasiRNAand target gene analysis. Plant J. 70, 891–901

15 Pasquinelli, A.E. (2012) MicroRNAs and their targets: recognition,regulation and an emerging reciprocal relationship. Nat. Rev. Genet.13, 271–282

16 Meng, Y.J. et al. (2011) Construction of microRNA- and microRNA*-mediated regulatory networks in plants. RNA Biol. 8, 1124–1148

17 Bulow, L. et al. (2012) ‘MicroRNA Targets’, a new AthaMap web-tool forgenome-wide identification of miRNA targets in Arabidopsis thaliana.BioData Min. 5, 7

18 Li, Y. et al. (2011) Evolution of MIR159/319 microRNA genes and theirpost-transcriptional regulatory link to siRNA pathways. BMC Evol.Biol. 11, 122

19 Devers, E.A. et al. (2011) Stars and symbiosis: microRNA- andmicroRNA*-mediated transcript cleavage involved in arbuscularmycorrhizal symbiosis. Plant Physiol. 156, 1990–2010

20 Wong, C.E. et al. (2011) MicroRNAs in the shoot apical meristem ofsoybean. J. Exp. Bot. 62, 2495–2506

21 Zhang, X.M. et al. (2011) Arabidopsis Argonaute 2 regulates innateimmunity via miRNA393*-mediated silencing of a Golgi-localizedSNARE gene, MEMB12. Mol. Cell 42, 356–366

22 Manavella, P.A. et al. (2013) Tissue-specific silencing of ArabidopsisSU(VAR)3-9 HOMOLOG8 by miR171a. Plant Physiol. 161, 805–812

23 Colaiacovo, M. et al. (2012) A survey of microRNA length variantscontributing to miRNome complexity in peach (Prunus persica L.).Front. Plant Sci. 3, 165

24 Jeong, D.H. and Green, P.J. (2012) Methods for validation of miRNAsequence variants and the cleavage of their targets. Methods 58, 135–143

25 Neilsen, C.T. et al. (2012) IsomiRs – the overlooked repertoire in thedynamic microRNAome. Trends Genet. 28, 544–549

26 Brodersen, P. et al. (2008) Widespread translational inhibition by plantmiRNAs and siRNAs. Science 320, 1185–1190

27 Brodersen, P. and Voinnet, O. (2009) Revisiting the principles ofmicroRNA target recognition and mode of action. Nat. Rev. Mol. CellBiol. 10, 141–148

28 Creasey, K.M. et al. (2014) miRNAs trigger widespread epigeneticallyactivated siRNAs from transposons in Arabidopsis. Nature 508, 411–415

29 Brousse, C. et al. (2014) A non-canonical plant microRNA target site.Nucleic Acids Res. 42, 5270–5279

30 Zheng, Y. et al. (2012) SeqTar: an effective method for identifyingmicroRNA guided cleavage sites from degradome of polyadenylatedtranscripts in plants. Nucleic Acids Res. 40, e28

31 Iwakawa, H. and Tomari, Y. (2013) Molecular insights into microRNA-mediated translational repression in plants. Mol. Cell 52, 591–601

32 Liu, Q.K. et al. (2014) Analysis of complementarity requirements forplant microRNA targeting using a Nicotiana benthamianaquantitative transient assay. Plant Cell 26, 741–753

33 Aukerman, M.J. and Sakai, H. (2003) Regulation of flowering time andfloral organ identity by a microRNA and its APETALA2-like targetgenes. Plant Cell 15, 2730–2741

34 Chen, X. (2004) A microRNA as a translational repressor of APETALA2in Arabidopsis flower development. Science 303, 2022–2025

35 Gandikota, M. et al. (2007) The miRNA156/157 recognition element inthe 30 UTR of the Arabidopsis SBP box gene SPL3 prevents earlyflowering by translational inhibition in seedlings. Plant J. 49, 683–693

36 Yang, L. et al. (2012) Mutations in the GW-repeat protein SUO reveal adevelopmental function for microRNA-mediated translationalrepression in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 109, 315–320

37 Li, J.F. et al. (2013) Comprehensive protein-based artificial microRNAscreens for effective gene silencing in plants. Plant Cell 25, 1507–1522

38 Tang, G. et al. (2003) A biochemical framework for RNA silencing inplants. Genes Dev. 17, 49–63

39 Jones-Rhoades, M.W. (2012) Conservation and divergence in plantmicroRNAs. Plant Mol. Biol. 80, 3–16

40 Sieber, P. et al. (2007) Redundancy and specialization among plantmicroRNAs: role of the MIR164 family in developmental robustness.Development 134, 1051–1060

41 Sorin, C. et al. (2014) A miR169 isoform regulates specific NF-YA targetsand root architecture in Arabidopsis. New Phytol. 202, 1197–1211

42 Liang, G. et al. (2010) MicroRNA395 mediates regulation of sulfateaccumulation and allocation in Arabidopsis thaliana. Plant J. 62,1046–1057

43 Beauclair, L. et al. (2010) MicroRNA-directed cleavage andtranslational repression of the copper chaperone for superoxidedismutase mRNA in Arabidopsis. Plant J. 62, 454–462

44 Franco-Zorrilla, J.M. et al. (2007) Target mimicry provides a newmechanism for regulation of microRNA activity. Nat. Genet. 39,1033–1037

45 Chorostecki, U. et al. (2012) Identification of new microRNA-regulatedgenes by conserved targeting in plant species. Nucleic Acids Res. 40,8893–8904

46 Millar, A.A. and Gubler, F. (2005) The Arabidopsis GAMYB-like genes,MYB33 and MYB65, are microRNA-regulated genes that redundantlyfacilitate anther development. Plant Cell 17, 705–721

47 Rotman, N. et al. (2005) A novel class of MYB factors controls sperm-cell formation in plants. Curr. Biol. 15, 244–248

48 Allen, R. et al. (2010) MicroR159 regulation of most conserved targetsin Arabidopsis has negligible phenotypic effects. Silence 1, 18

49 Wang, Y. et al. (2011) Function and evolution of a microRNA thatregulates a Ca2+-ATPase and triggers the formation of phased smallinterfering RNAs in tomato reproductive growth. Plant Cell 23, 3185–3203

50 Xia, R. et al. (2013) MicroRNA superfamilies descended from miR390and their roles in secondary small interfering RNA biogenesis ineudicots. Plant Cell 25, 1555–1572

51 Shivaprasad, P.V. et al. (2012) A microRNA superfamily regulatesnucleotide binding site leucine-rich repeats and other mRNAs. PlantCell 24, 859–874

52 Song, X.W. et al. (2012) Roles of DCL4 and DCL3b in rice phased smallRNA biogenesis. Plant J. 69, 462–474

53 Rubio-Somoza, I. et al. (2009) Regulation and functional specializationof small RNA–target nodes during plant development. Curr. Opin.Plant Biol. 12, 622–627

54 Allen, R. et al. (2007) Genetic analysis reveals functional redundancyand the major target genes of the Arabidopsis miR159 family. Proc.Natl. Acad. Sci. U.S.A. 104, 16371–16376

55 Chuck, G. et al. (2007) The maize tasselseed4 microRNA controls sexdetermination and meristem cell fate by targeting tasselseed6/indeterminate spikelet1. Nat. Genet. 39, 1517–1521

56 Todesco, M. et al. (2010) A collection of target mimics forcomprehensive analysis of microRNA function in Arabidopsisthaliana. PLoS Genet. 6, e1001031

57 Addo-Quaye, C. et al. (2008) Endogenous siRNA and miRNA targetsidentified by sequencing of the Arabidopsis degradome. Curr. Biol. 18,758–762

58 German, M.A. et al. (2008) Global identification of microRNA–targetRNA pairs by parallel analysis of RNA ends. Nat. Biotechnol. 26, 941–946

59 Li, J. et al. (2014) Determinants beyond both complementarity andcleavage govern microR159 efficacy in Arabidopsis. PLoS Genet. 10,e1004232

60 Schwab, R. et al. (2006) Highly specific gene silencing by artificialmicroRNAs in Arabidopsis. Plant Cell 18, 1121–1133

61 Deveson, I. et al. (2013) MicroRNAs with analogous targetcomplementarities perform with highly variable efficacies inArabidopsis. FEBS Lett. 587, 3703–3708

62 Kertesz, M. et al. (2007) The role of site accessibility in microRNAtarget recognition. Nat. Genet. 39, 1278–1284

63 Kedde, M. et al. (2007) RNA-binding protein Dnd1 inhibits microRNAaccess to target mRNA. Cell 131, 1273–1286

64 Li, F. et al. (2012) Regulatory impact of RNA secondary structureacross the Arabidopsis transcriptome. Plant Cell 24, 4346–4359

65 Gu, W.J. et al. (2012) Selection on synonymous sites for increasedaccessibility around miRNA binding sites in plants. Mol. Biol. Evol. 29,3037–3044

66 Llave, C. et al. (2002) Cleavage of Scarecrow-like mRNA targetsdirected by a class of Arabidopsis miRNA. Science 297, 2053–2056

67 Li, J. and Millar, A.A. (2013) Expression of a microRNA-resistanttarget transgene misrepresents the functional significance of theendogenous microRNA:target gene relationship. Mol. Plant 6, 577–580

7