the effect of function-blocking rhamm peptides in a mouse
TRANSCRIPT
Western University Western University
Scholarship@Western Scholarship@Western
Electronic Thesis and Dissertation Repository
11-12-2018 5:00 PM
The Effect of Function-blocking RHAMM Peptides in a Mouse The Effect of Function-blocking RHAMM Peptides in a Mouse
Model of Bleomycin-induced Systemic Sclerosis Model of Bleomycin-induced Systemic Sclerosis
Kitty Y. Wu, The University of Western Ontario
Supervisor: Turley, Eva A, The University of Western Ontario
Co-Supervisor: Yazdani, Arjang, The University of Western Ontario
A thesis submitted in partial fulfillment of the requirements for the Master of Science degree in
Surgery
© Kitty Y. Wu 2018
Follow this and additional works at: https://ir.lib.uwo.ca/etd
Part of the Skin and Connective Tissue Diseases Commons
Recommended Citation Recommended Citation Wu, Kitty Y., "The Effect of Function-blocking RHAMM Peptides in a Mouse Model of Bleomycin-induced Systemic Sclerosis" (2018). Electronic Thesis and Dissertation Repository. 5884. https://ir.lib.uwo.ca/etd/5884
This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected].
i
Abstract
Systemic sclerosis is a chronic, fibrotic disorder associated with high disease-specific mortality
and morbidity. Cutaneous manifestations include dermal thickening and obliteration of dermal
adipose tissue. The efficacy of function-blocking Rhamm peptides, NPI-110 and NPI-106, were
tested in reducing skin fibrosis and promoting adipogenesis in a bleomycin-induced mouse model
of systemic sclerosis. NPI-110 reduced both visible measures of fibrosis (dermal thickness,
collagen density, and fibril bundling) and mRNA expression of pro-fibrotic genes (Tgfb1, c-Myc,
Col1a1, Col3a1). While there was no measurable change in dermal adipose thickness, NPI-110
treatment upregulated Perilipin mRNA and Adiponectin protein expression and is therefore
hypothesized to create a pro-adipogenic microenvironment. NPI-106 was less effective in
reversing dermal fibrosis and did not affect adipogenesis. Transcriptomic analyses suggest a
mechanism where Rhamm stabilizes β-catenin, activates Erk1 and c-Myc, and causes fibroblast
activation and suppression of adipocyte differentiation. Rhamm function-blocking peptides
reverse these effects and present a novel treatment method for cutaneous fibrosis in systemic
sclerosis.
Keywords: Systemic sclerosis, fibrosis, adipogenesis, hyaluronic acid, Rhamm
ii
Co-Authorship Statement
Animal experiments, including peptide injection, animal sacrifice, and collection of skin tissue
samples were conducted by Stelic MC, Inc under the direction of Dr. Yuichiro Shibazaki.
Histology slides stained with Masson’s Trichrome, Picrosirius Red, and H&E were kindly
provided by Stelic MC. All subsequent experiments were performed in Dr. Eva Turley’s
laboratory.
I performed all preliminary experiments including RT-PCR (Col1a1, Col3a1, c-Myc, Rhamm,
Tgfb1), immunohistochemistry (Tgfb1, c-Myc, adiponectin), polarized microscopy, and RT2
transcriptomic profile assays to optimize the protocol, define antibody/cDNA concentrations, and
determine imaging and analysis parameters. I performed polarized microscopy imaging of
picrosirius red stained slides in Dr. Geoffrey Pickering’s laboratory at Robarts Research Institute,
under the guidance of Caroline O’Neil and Hao Yin.
Stephanie Kim assisted in completing technical replicates for immunohistochemistry (Tgfb1,
adiponectin) and RT-PCR (Col3a1, Plin, c-Myc, Rhamm) experiments. Alexis Sabino assisted in
the immunohistochemistry and quantification for c-Myc.
iii
Acknowledgements
I am very grateful for the opportunity to participate in the Master of Science in Surgery program.
In addition to all of the wonderful lecturers, I would like to thank Dr. Abdel Lawendy, Janice
Sutherland, and Kristine Schroeder for coordinating an extremely cohesive and enriching
academic program.
To Dr. Eva Turley and Dr. Arjang Yazdani, my deepest gratitude for your continued mentorship,
guidance, and support. Thank you for always making the time for research meetings and weekend
emails and for providing the inspiration and encouragement for this project. Thank you to all of
the members of the Turley lab, Conny, Kaustuv, Jenny, Jess, Katelyn, Violet, Alexis, Leslie,
Joselia and Khandakar, for your help in troubleshooting experiments. A very special thanks to
Stephanie Kim. I cannot describe how grateful I am to have had the opportunity to work with you.
Your work ethic and dedication continue to inspire me.
To my parents, thank you for your unwavering love and support.
And to Eugene, who makes all of this possible.
iv
Table of Contents
ABSTRACT……………………………………………………………………………………….i
CO-AUTHORSHIP STATEMENT…………………………………………………………….ii
ACKNOWLEDGEMENTS…………………………………………………………………….iii
TABLE OF CONTENTS……………………………………………………………………….iv
LIST OF TABLES……………………………………………………………………………...vii
LIST OF FIGURES……………………………………………………………………………viii
LIST OF SUPPLEMENTAL TABLES.………………………………………………………..x
LIST OF ABBREVIATIONS…………………………………………………………………..xi
1 INTRODUCTION……………………………………………………………………….1
1.1 Systemic Sclerosis…………………………………………………………………….1
1.1.1 Classification………………………………………………………………...1
1.2 Pathophysiology……………………………………………………………………….2
1.2.1 Etiology……………………………………………………………………...2
1.2.2 Fibroblasts…………………………………………………………………...3
1.2.3 Tgfb1..……………………………………………………………………….3
1.2.4 Dermal adipose tissue……………………………………………………….4
1.2.5 Ppary..……………………………………………………………………….6
1.2.6 Adiponectin………………………………………………………………….6
1.2.7 Wnt/β-catenin………………………………………………………………..7
1.3 Hyaluronic Acid……………………………………………………………………….7
1.3.1 HA receptors………………………………………………………………...8
1.4 Developing targeted therapies…………………………………………………………9
1.4.1 Function-blocking Rhamm peptides...……………………………………..10
1.5 Animal Models……………………………………………………………………….11
1.6 Identifying the problem………………………………………………………………13
v
2 THESIS OBJECTIVES AND AIMS…………………………………………………..14
3 METHODS……………………………………………………………………………...16
3.1 Injectable peptide NPI-110 and NPI-106 Formulations……………………………..16
3.2 Animal Studies……………………………………………………………………….16
3.2.1 Animal Care………………………………………………………………..16
3.2.2 Mouse Treatment Groups………………………………………………….17
3.2.3 Tissue Collection…………………………………………………………..19
3.3 Effect of Peptide NPI-110 and NPI-106 on Fibrosis………………………………...19
3.3.1 Effect of peptides on body weight…………………………………………19
3.3.2 Effect of peptides on dermal thickness…………………………………….19
3.3.2.1 Masson’s Trichrome staining…………………………………….19
3.3.2.2 Quantification of dermal thickness………………………………19
3.3.3 Effect of peptides on collagen density, bundling, and gene expression…...20
3.3.3.1 Picrosirius Red staining………………………………………….20
3.3.3.2 Quantification of area fraction of collagen………………………20
3.3.3.3 Quantification of collagen bundling……………………………..20
3.3.3.4 RT-PCR analysis of Col1a1 and Col3a1 mRNA expression…....21
3.4 Effect of Peptide NPI-110 and NPI-106 on Adipogenesis…………………………..24
3.4.1 Effect of peptides on dermal adipose thickness……………………………24
3.4.2 Effect of peptides on Adiponectin protein expression…………………...24
3.4.3 Effect of peptides on Perilipin mRNA expression……………...…………25
3.5 Elucidating the mechanism of NPI-110 and NPI-106 Function……………………..25
3.5.1 Bioinformatic analyses…………………………………………………….25
3.5.1.1 RT2 Profiler PCR Mouse Fibrosis Array………………………...25
3.5.1.2 RT2 Profiler PCR Mouse Adipogenesis Array…………………..26
3.5.1.3 Bioinformatic Analysis…………………………………………..29
3.5.1.4 Confirmation of Tgfb1 mRNA expression with RT-PCR……......29
3.5.1.5 Tgfb1 Immunohistochemistry..…………………………………..29
vi
3.5.1.6 Confirmation of c-Myc expression with RT-PCR……………….30
3.5.1.7 c-Myc Immunohistochemistry…………………………………...30
3.5.2 Effect of peptides on Rhamm mRNA expression…...……………………..31
3.6 Statistical Analysis…………………………………………………………………...31
4 RESULTS……………………………………………………………………………….32
5 DISCUSSION…………………………………………………………………………...61
6 CONCLUSIONS………………………………………………………………………..73
7 REFERENCES………………………………………………………………………….74
9 CURRICULUM VITAE………………………………………………………………..89
vii
List of Tables
Table 1. Study protocol treatment groups………………………………………………………18
Table 2. RT-PCR Primers………………………………………………………………………23
viii
List of Figures
Figure 1. Comparative anatomy of human and mouse skin……………………………………..….5
Figure 2. Fibrosis pathway-focused 96-well plate set-up……………………………………..…..27
Figure 3. Adipogenesis pathway-focused 96-well plate set-up…………………………………...28
Figure 4. Peptide NPI-110 and NPI-106 treatment does not restore normal weight gain……….33
Figure 5. Peptide NPI-110 and NPI-106 reduces collagen deposition and dermal thickening…....36
Figure 6. Peptide NPI-110 but not NPI-106 reduces the area fraction of collagen…………...…...37
Figure 7. Neither NPI-110 or NPI-106 restores collagen density to baseline …………..……...…38
Figure 8. Peptide NPI-110 and NPI-106 suppress Col1a1 mRNA expression and reduce the Col1a1:Col3a1 ratio …………………………..………………………………………………...40
Figure 9. Peptide NPI-110 and NPI-106 treatment does not ameliorate the detectable loss of dermal adipose issue……………………………………………………………………………..42
Figure 10. Peptide NPI-110 treatment restores Adiponectin protein expression…………..……43
Figure 11. Peptide NPI-110 and NPI-106 treatment partially restores Perilipin mRNA expression………………………………………………………………………………………..44
Figure 12. Transcriptional profiling of fibrosis-specific (A) and adipogenesis-specific (B) genes……………………………………………………………………………………………..46
ix
Figure 13. Focused pathway analysis of top affected canonical pathways and regulators with peptide NPI-110 and NPI-106 treatment………………………………………………………...52
Figure 14. Peptide NPI-110 and NPI-106 treatment does not affect Tgfb1 mRNA expression…...53
Figure 15. NPI-110 but not NPI-106 reduces Tgfb1 protein levels within the dermis and dermal adipose tissue layers……………………………………………………………………………...54
Figure 16. Inhibition of c-Myc mRNA expression is predicted within three signalling cascades of the canonical metastatic colorectal cancer pathway……………………………………...……...56
Figure 17. Peptide NPI-110 and NPI-106 treatment decrease c-Myc mRNA expression below baseline…………………………………………………………………………………………..57
Figure 18. Peptide NPI-110 and NPI-106 treatment reduce c-Myc protein expression……..…...58
Figure 19. Peptide NPI-110 and NPI-106 attenuate Rhamm mRNA expression………….……..60
Figure 20. Rhamm acts as a molecular switch between fibrosis and adipogenesis……………..…68
x
List of Supplemental Tables
Supplementary Table 1. Expression of 84 fibrosis-pathway specific genes………………..……47
Supplementary Table 2. Expression of 84 adipogenesis-pathway specific genes……………….49
xi
List of Abbreviations
ADSC Adipose-derived stem cell
ANOVA Analysis of variance
αSMA Alpha smooth muscle actin
BLM Bleomycin
BSA Bovine serum albumin
CD44 Cluster differentiation 44
c-Myc c-Myelocytomatosis gene
Col1a1 Collagen 1 gene
Col3a1 Collagen 3 gene
Ctgf Connective tissue growth factor
Ctnnb1 Catenin-beta 1 gene
DcSSc Diffuse cutaneous systemic sclerosis
DHLNL Dihydroxyl lysine-norleucine
Dkk Dickkopf
ECM Extracellular matrix
EMT Epithelial-mesenchymal transition
EndoMT Endothelial-mesenchymal transition
Erk1/2 Extracellular signal-related kinase 1/2
Gapdh Glyceraldehyde 3-phosphate dehydrogenase
H&E Hematoxylin and eosin
HA Hyaluronic acid
Hare Hyaluronan receptor for endocytosis
HLA Human leukocyte antigen
Hmmr Hyaluronan-mediated motility receptor gene
HMW-HA High molecular weight hyaluronic acid
IPA Ingenuity pathway analysis
xii
LcSSc Limited cutaneous systemic sclerosis
LMW-HA Low molecular weight hyaluronic acid
LSD Least significant difference
Lyve1 Lymphatic vessel endothelial hyaluronan receptor 1
MAP kinases Mitogen-activated protein kinases
Micro-CT Micro computer tomography
MSC Mesenchymal stem cell
PBS Phosphate-buffered saline
Plin Perilipin gene
Ppary Peroxisome proliferator-activated receptor gamma
RGB Red, green, blue
Rhamm Receptor for hyaluronan-mediated motility
RT-PCR Real-time polymerase chain reaction
SEM Standard error of measurement
SSc Systemic sclerosis
Tgfb1 Transforming growth factor beta
Tlr2,4 Toll-like receptor 2, 4
Tnf Tumour necrosis factor
Wisp2 WNT inducible signaling pathway protein 2
Wnt Wingless
1
1 Introduction
1.1 Systemic Sclerosis
Systemic sclerosis (SSc) is a chronic, progressive, disorder characterized by extensive cutaneous
and visceral fibrosis1,2. The estimated prevalence ranges from 0.07 to 5 per 100 000 depending on
ethnicity and geographic location, with the highest prevalence in North America3,4 Although a rare
disease, SSc has the highest mortality of all rheumatologic conditions with a median survival from
time of diagnosis of 11 years5. The cumulative 5-year survival following diagnosis is 74.9%, and
10-year survival is only 62.5%1,3 with mortality due to progressive visceral organ fibrosis,
interstitial lung disease, and pulmonary arterial hypertension6,7.
This high disease-specific mortality rate is also associated with substantial morbidity, as the
disabling multisystemic effects of SSc pervade across all aspects of daily life. Although not life
threatening, progressive fibrosis and thickening of the skin, especially of the hands and face,
present a significant burden for patients. Skin tightness and joint contractures can lead to
impairments in hand function, mobility, and significant disability. Fibrosis around the mouth
results in difficulties with mouth opening that interfere with the basic tasks of speaking and eating1.
Similarly, disfiguring changes in facial appearance causing ‘mask-like facies’ and loss of facial
expressions are a source of social distress and self-image issues8,9. This is further compounded by
the psychologic impact due to the progressive and heterogenous disease course with the
uncertainty of future disease progression10–12.
1.1.1 Classification
The term scleroderma has recently been replaced with more precise nomenclature to describe the
four subtypes of systemic sclerosis based on clinical symptoms, autoantibody production, and
systemic involvement: limited cutaneous systemic sclerosis (LcSSc, previously also CREST
syndrome), diffuse cutaneous systemic sclerosis (DcSSc), morphea, and systemic sclerosis sine
scleroderma13. LcSSc describes a disease subset with sclerotic changes of the face and only of the
skin distal to the elbow and knees, associated with a high risk of interstitial lung disease and
pulmonary hypertension. In contrast, DcSSc involves skin changes of both the proximal and distal
2
extremities and a predilection towards developing interstitial lung disease, progressive lung
fibrosis, renal crisis, and significant hand disability with Raynaud’s phenomenon and digital
ulcers13. Morphea, previously known as localized scleroderma, refers to involvement limited to
the skin without associated visceral organ fibrosis. Controversy still exists as to whether morphea
represents an early manifestation of systemic sclerosis or actual distinct subtypes14. Systemic
sclerosis sine scleroderma manifests with the fibrosis of visceral organs without cutaneous
fibrosis15.
Currently, there are no curative or disease modifying therapies for systemic sclerosis. Treatment
is directed towards symptom and complication management and there remains an urgent need for
the development of targeted anti-fibrotic therapies. This lack of effective treatment options stems
from the incomplete understanding of the etiology of systemic sclerosis.
1.2 Pathophysiology
1.2.1 Etiology
Systemic sclerosis is an autoimmune disease emerging from the complex interplay of genetic
predisposition and environmental factors, with an unknown exact etiology. Geo-epidemiologic
studies show higher prevalence and mortality rates within African American populations16 as well
as in certain rural communities found to have specific HLA haplotypes that confer disease
susceptibility17. However, genetic factors cannot fully explain the development of SSc, as there is
an extremely low clinical concordance of SSc within monozygotic twins18,19, suggesting the
presence of secondary acquired genetic or environmental triggers. Occupational exposures (silica
dust, organic and chlorinated solvents, epoxy resins)1,20, chemotherapy or radiotherapy
treatment21, and certain infection (cytomegalovirus, parvovirus B19, Ebstein Barr virus, and
Helicobacter pylori)2 have all been implicated as possible inciting agents. This is further
complicated by the multitude of systemic sclerosis-like diseases (scleromyxedema, eosinophilic
fasciitis, porphyria cutanea tarda, diabetic cheiroartropathy)22 and subtypes of systemic sclerosis
which may be a result of similar but divergent mechanisms.
3
1.2.2 Fibroblasts
A cardinal feature of SSc is thickening and fibrosis of the skin. Fibrosis occurs from the excessive
deposition of extracellular matrix (ECM) products such as collagen, fibronectin, and hyaluronan
by activated fibroblasts23,24. Fibroblasts are the predominant cells in connective tissues that
regulate ECM synthesis and turnover. During homeostasis, they maintain a balance between
matrix production and breakdown through expression of matrix proteins/proteoglycans as well as
various matrix proteinases and glycosidases25.
A primary event, such as viral toxins, aberrant autoantibody activation, or vascular endothelial
injury precedes fibrosis and causes the upregulation of pro-inflammatory signals resulting in the
activation of fibroblasts23,26. Activated fibroblasts are able to differentiate into myofibroblasts,
which resemble smooth muscle cells in phenotype. Myofibroblasts are positive for the marker
alpha-smooth muscle actin (αSMA) and actively synthesize, bundle, and contract collagen fibrils.
These processes are normal parts of wound healing, where myofibroblasts help to contract the
wound edges and deposit ECM products required for granulation tissue formation. This activity is
normally attenuated by myofibroblast apoptosis; however, if myofibroblast activity is sustained,
then tissue fibrosis ensues. For example in SSc, fibroblasts subvert these intrinsic regulatory
mechanisms, resulting in unopposed fibroblast activation independent of external stimuli, leading
to the ongoing pathologic remodelling of the ECM26,27.
1.2.3 Tgfb1
Tissue fibrosis is driven by transforming growth factor β (Tgfb1), a master regulator involved in
wound healing, inflammation, and pathologic fibrosis28,29. Tgfb1, a fibrogenic cytokine, is
uniformly upregulated in fibrotic tissues and induces fibroblasts to differentiate into
myofibroblasts29. Activated fibroblasts both upregulate the production of Tgfb1, increase their own
expression of Tgfb1 receptors, and produce factors such as connective tissue growth factor (Ctgf),
a cofactor that enhances Tgfb1 binding30, to establish a vicious cycle of autocrine stimulation31.
Understanding of the origin of activated fibroblasts and myofibroblasts is evolving.
Myofibroblasts in SSc have long been thought to arise from resident fibroblasts in the affected
tissues; however, recent research using new experimental tools for lineage tracing suggest a role
for ‘cell-fate switching’26,32 with the involvement of numerous other adult cell types. Epithelial
4
cells33,34, endothelial cells35, pericytes36, fibrocytes37, and adipocytes38,39 have been shown to
trans-differentiate into activated myofibroblast-like cells which are positive for αSMA and can
produce and bundle collagen. Tgfb1 signaling has been implicated in guiding this cellular plasticity
since it can induce both epithelial-mesenchymal transition (EMT) and endothelial-mesenchymal
transition (EndoMT) in culture35,40. In vivo lineage tracing studies have shown that dermal
adipocyte progenitors also contribute to the population of activated fibroblasts and
myofibroblasts39. In culture analyses of human adipocyte-derived progenitor cells confirm that
Tgfb1 induce myofibroblast-like changes in adipocyte phenotype and transcriptome39.
Collectively these studies point to a more complex and active role of the dermal adipose tissue in
the development of cutaneous fibrosis, rather than just mere consequence of fibrotic changes.
1.2.4 Dermal adipose tissue
In addition to dermal thickening, a consistent but less well-recognized finding is the loss of dermal
adipose tissue in SSc41. This is seen in both excisional biopsies of patients with SSc and in multiple
animal models of SSc and cutaneous fibrosis42–44. This loss of dermal adipose tissue is a result of
both adipocyte apoptosis and cellular reprogramming of adipocytes into myofibroblasts,
suggesting the primary pathological mechanism of SSc may reside within dermal adipose tissue
rather than in the dermis39.
Dermal adipose tissue is a layer of unilocular adipocytes found surrounding hair follicles and
pilosebaceous units45. In rodents, which are loose skinned, the dermal adipose tissue is between
the reticular dermis and panniculosus carnosus muscle layers. This is an adipocyte depot separate
from the subcutaneous adipose tissue layer, which is found deeper to the panniculosus carnosus45.
Human skin does not have a panniculosus carnosus layer and the dermal adipose tissue form cone-
like extensions surrounding the hair follicular unit. The dermal adipose tissue lies superficial to,
and is histologically and metabolically distinct from, the subcutaneous adipose tissue46 (Figure 1).
In both human and rodent skin, dermal adipose tissue lies directly below the reticular dermis, and
this positional information may inform cell-fate decision making. Fibroblasts demonstrate
‘positional identity’ and their transcriptomic profiles vary according to anatomic location47.
Aberrant signalling within dermal adipose tissue may cause the adjacent reticular fibroblasts to
lose their ‘positional memory’ and progress towards fibrosis47.
5
Figure 1. Comparative anatomy of human and mouse skin. Schematic diagram of layers within human and mouse skin illustrating differential location of the dermal adipose tissue layer. In human skin, the dermal adipose tissue form cones surrounding the hair follicular unit and is directly superficial to, but distinct from, the subcutaneous adipose tissue. In mouse skin, the dermal adipose tissue is separated from the subcutaneous adipose layer by the panniculosus carnosus, which is absent in humans.
6
1.2.5 Ppary
The nuclear transcription factor peroxisome proliferator-activated receptor gamma (Ppary) is a
master regulator of adipogenesis and lipoprotein metabolism. Originally identified in adipocytes,
Ppary is also expressed in macrophages, endothelial cells, and fibroblasts48,49. Adipocyte
development occurs in two main steps. Mesenchymal stem cells first become preadipocytes, which
are cells restricted to an adipocytic fate, and then Ppary directs the terminal differentiation of
preadipocytes into mature adipocytes50.
Importantly, Ppary not only promotes adipogenesis but also has potent intrinsic anti-fibrotic
effects23,26. The expression of Ppary is reduced in skin biopsies from SSc patients as well as in
monocytes of healthy African Americans, who have a much higher susceptibility to developing
SSc51,52. Ppary expression attenuates Tgfb1-stimulated collagen production and myofibroblast
differentiation53,54. Furthermore, exogenous ligands of Ppary block Tgfb1-induced epithelial-
mesenchymal transition in lung fibrosis and promote the differentiation of mesenchymal
progenitor cells into adipocytes instead of fibroblasts55,56. Rosiglitazone, an approved insulin-
sensitizing agent and Ppary agonist, reduces both dermal fibrosis and loss of dermal adipose tissue
in animal models of SSc42,56. This effect is, however, reduced by Tgfb1 which has also been shown
to potently inhibit Ppary expression42. The reciprocally inhibitory nature of Tgfb1 and Ppary
highlight the intricate and complex balance between adipogenesis and fibrosis.
1.2.6 Adiponectin
The circulating adipokine, adiponectin, is only produced by adipocytes and mediates many of the
anti-fibrotic effects of Ppary. Patients with DcSSc have lower circulating levels of serum
adiponectin, which inversely correlates with disease severity57–59. Adiponectin expression is under
the direct transcriptional control of Ppary60, which induces the production of circulating
adiponectin by adipocytes. In SSc fibroblasts, adiponectin suppresses collagen and αSMA
expression and attenuates Tgfb1-induced activation of fibroblasts54,61. This illuminates a key
feedback mechanism for blocking fibrosis whereby the downstream effector of Ppary, adiponectin,
exerts inhibition of Tgfb1 signalling.
7
1.2.7 Wnt/β-catenin
Another key player in the pathogenesis of SSc is Wingless (Wnt), a member of a large family of
secreted glycoproteins that regulate cell fate determination and morphogenesis in early
development. Through its canonical signalling pathway, binding of Wnt ligands stabilize β-
catenin, which translocates to the nucleus and controls transcription of downstream pro-fibrosis
target genes62,63. One specific Wnt ligand, Wnt10b, is increased in lesional SSc skin and drives
fibrosis64. Mice over-expressing Wnt10b exhibit increased collagen production and activation of
fibroblasts64.
The canonical Wnt signalling pathway also inhibits adipogenesis and causes lipoatrophy in
transgenic mice64–67. Elegant lineage tracing studies have demonstrated that the lower reticular
dermis shares a common embryologic origin with pre-adipocytes and mature adipocytes68. In early
development, selective activation of β-catenin in the lower reticular dermis increases fibroblast
proliferation and decreases adipocyte differentiation69. Based on in vitro studies, β-catenin
suppresses adipogenesis by inhibiting Ppary-directed terminal differentiation of adipocytes, and
thus switches the transcriptional programme towards a fibroblastic fate63.
SSc was initially understood to result from dysregulated signalling within the dermis; however,
recent research has refocused the lens on the interface between the reticular dermis and dermal
adipose tissue. Tgfb, Ppary, and Wnt/β-catenin demonstrate mutually antagonistic effects and
multiple layers of control that maintain the tight balance between adipogenesis and fibrosis. The
disruption in this equilibrium may be the hallmark in the pathogenesis of SSc.
1.3 Hyaluronic Acid
Hyaluronic acid (HA), which is found ubiquitously in the ECM and affects both fibrosis and
adipocyte differentiation, may be the homeostatic thermostat regulating this equilibrium. HA is a
large, linear glycosaminoglycan consisting of the repeating disaccharides D-glucuronic acid and
N-acetyl-D-glucosamine70. Although HA is found in abundance in all tissues, more than 50% of
total body HA resides in the dermis71. In its native, high-molecular weight form, HA (HMW-HA
> 500kDa) maintains homeostasis as a hydrophilic viscoelastic structural macromolecule that
8
provides hydration and mechanical integrity to tissues. HMW-HA also acts as a template for the
organization of extracellular matrix structures72,73. HMW-HA suppresses inflammation and
fibrosis72,74–76 by spatially protecting cells from immune recognition, and blocking macrophage
infiltration77,78. Locally, HMW-HA provides an ‘adipogenic niche’ supporting pre-adipocyte
survival and differentiation, maintaining the ‘stemness’ of mesenchymal progenitors79–81.
In the event of tissue injury, reactive oxygen/nitrogen species and hyaluronidases are released from
damaged cells which fragment HMW-HA into pro-inflammatory lower molecular weight
oligosaccharides (<500kDa)82–84. These fragments stimulate wound repair processes, such as
inflammation, fibroblast migration, myofibroblast differentiation, and ECM production85–87. The
persistence of fragmented low molecular weight HA (LMW-HA) leads to unremitting
inflammation with a pathologic consequence of fibrogenesis and tissue architecture destruction88.
The accumulation of LMW-HA fragments is demonstrated in liver fibrosis, asthma, inflammatory
bowel disease, and rheumatoid arthritis amongst many other diseases75,89–91. SSc patients have also
been found to have higher serum levels of LMW-HA, which is positively correlated with the extent
of cutaneous involvement and severity of systemic disease92–95. LMW-HA fragments are not only
pro-fibrotic76,96,97 but anti-adipogenic98,99 and suppress adipocyte differentiation. Collectively this
strongly suggests a role for LMW-HA in mediating the pathologic effects of dermal thickening
and dermal adipose atrophy in SSc.
1.3.1 HA Receptors
HA acts through a variety of receptors, most importantly, CD44 and Rhamm (CD168, receptor for
hyaluronan-mediated motility, encoded by gene hmmr). CD44 is a constitutively expressed
integral membrane protein involved in the cellular cytoskeletal dynamics of proliferation and
migration96,100,101. Conversely, Rhamm is transiently expressed only following tissue injury102 and
preferentially binds to LMW-HA fragments. Rhamm is found as an extracellular and intracellular
protein101,103,104. Extracellular Rhamm, which binds to CD44, activates a number of intracellular
kinases, in particular the mitogen-activated protein (MAP) kinases, Erk1 and 2, (extracellular
signal-related kinase 1, 2), which are involved in fibroblast motility and mesenchymal cell
differentiation101,105. Erk1 maintains a clonally expanded pre-adipocyte population but prevents
their progression towards terminal adipocyte differentiation by inhibiting Pparγ105,106. Rhamm-
9
deficient mice exhibit increased adiposity attributed to relief of Ppary suppression by loss of Erk1
activity, which allows the differentiation of preadipocytes into mature adipocytes107. Intracellular
Rhamm acts as an adaptor molecule linking signalling complexes to the cytoskeleton and
complexes with Erk1,2 to direct its subcellular targeting101,108. Cell surface Rhamm associated with
CD44, controls cellular lamella, focal adhesion turnover, and cellular motility through Erk1,2
activity100,108. Rhamm expression is regulated by Tgfb1 and is a downstream effector of this
cytokine in its induction of fibroblast motility and maintenance of myofibroblast
differentiation101,109. Tgfb1 also promotes production of LMW-HA, which further contributes to
myofibroblast differentiation110,111.
Thus, depending on its molecular weight, HA can function either as a homeostatic balance or as
the first distress signal that initiates inflammation. HA molds the cellular microenvironment by
preferentially sequestering signalling molecules while blocking others. When fragmented, its
signalling through Rhamm promotes the pro-fibrotic (Tgfb1) and anti-adipogenic (Erk1/2)
environment seen in many pathological fibrotic diseases.
1.4 Developing Targeted Therapies
With no approved disease modifying treatments, the mainstay of systemic and DsSSc management
is oral immunosuppressant agents and symptomatic management of cutaneous fibrosis. Many
treatments have been tried for cutaneous fibrosis, including topical immunosuppressants,
vasodilator drugs, phototherapy, and physiotherapy which have limited benefit and efficacy2,3.
The development of effective targeted therapeutic interventions remains a challenge. Tgfb1, one
of the main drivers and regulators of fibrosis, is an obvious target; however, it has pleiotropic and
often opposing effects on inflammation, which have lead to adverse effects. While Tgfb1
expression in macrophages results in pro-fibrotic downstream effects, its expression in CD4+
regulatory cells is anti-inflammatory112. Tgfb1 disruption in mice is lethal at 3 weeks due to diffuse
multi-focal inflammation113. Ppary agonists, which are clinically approved as insulin-sensitization
agents in diabetes, have shown promising results in reversing fibrosis in animal models. However,
10
their substantial side effects, including weight gain, peripheral edema and cardiac complications,
preclude their use as a sustainable treatment option114,115.
Rhamm is an attractive therapeutic target for its specific expression within injured and fibrotic
tissues, which also uniquely accumulate LMW-HA. The hyaluronan binding region of Rhamm is
different from other HA receptors in that it demonstrates preferential binding to smaller
inflammatory HA fragments116,117 and has nM rather than µM affinity for these fragments. Since
LMW-HA fragments represent a small percentage of HA even in injured tissues, these two HA
binding properties of Rhamm provide an opportunity to efficiently and selectively sequester
LMW-HA as a method for preventing pro-inflammatory and pro-fibrotic signaling. In addition,
the restricted expression of Rhamm and LMW-HA predict limited off-target side effects and a
good safety profile.
1.4.1 Function-blocking RHAMM peptides
Rhamm function-blocking peptides have recently been developed based on the HA:Rhamm
binding sequence. These peptides function through two mechanisms: 1) binding to and
sequestering HA fragments away from interacting with downstream receptors 2) binding directly
to Rhamm and sterically preventing its association with HA fragments.
The HA receptors CD44, Lyve1 and Hare bind to the link-protein on HA through a conserved 100
amino acid region that forms a long shallow shelf which larger HA polymers fit into118. In contrast,
HA:Rhamm binding sequences forms two helices connected by a linker sequence that wrap around
short HA polymers. HA:CD44/Lyve1/Stab-2/Hare interactions thus require conformational fit
while HA:Rhamm interactions rely upon ionic bridges and specific basic amino acids interactions.
The HA:Rhamm binding domains contain the BX7B motif where B is any basic amino acid and X
represents any non-acidic residues119,120. The first rationally designed HA-binding peptide, NPI-
106, was based on this Rhamm motif. NPI-106 has the amino acid sequence RGGGRGRRR (R,
arginine; G, glycine residues) and other than a BX7B motif, has no other sequence homology to
Rhamm117. The basic residues spaced 7 amino acids apart allow for ionic interactions between
NPI-106 and the carboxylate ions on the HA molecule119, effectively sequestering the HA
11
fragment away from activating its receptors. In a mouse model of bleomycin-induced lung fibrosis,
NPI-106 strongly reduces macrophage chemotaxis, Col1a1 mRNA expression, and
hydroxyproline content in the lung97,121.
Rhamm sequence-mimetic peptides have also been identified that bind to Rhamm via a homo-
dimerization sequence in the linker region between the two HA binding helices and disrupt
interaction with HA. The peptide NPI-102 (644KLKDENSQLKSEVSK) sterically blocks a leucine
zipper necessary for Rhamm signalling107,117. NPI-110 is based on the same peptide sequence as
NPI-102 but contains acetylated ends which renders it insensitive to cleavage by proteases and
increases its serum half-life to over 24 hours. NPI-110 was identified by screening for peptides
that promoted the survival and adipogenic differentiation of bone marrow mesenchymal stem cells
and the differentiation of human and mouse pre-adipocytes into mature adipocytes107. Injections
of NPI-110 promotes subcutaneous adipogenesis in the dorsal skin and mammary fat pads of rats
and increases the expression of both Ppary and adiponectin. In a model of radiation-induced
mammary fat pad fibrosis, NPI-110 attenuates radiation-induced fibrosis and increases the
expression of adiponectin122. Collectively, this supports the hypothesis that blocking Rhamm
signaling, and thus Erk1 activity, will relieve the inhibitory effects of this MAP kinase upon Ppary,
allowing terminal differentiation of adipocytes.
1.5 Animal Models
A well-established mouse model of SSc is daily subcutaneously injections of bleomycin (BLM)123,
an anti-tumour antibiotic isolated from Streptomyces verticillus. BLM treatment has identified side
effects of skin edema, hyperpigmentation, and fibrosis124,125. Treatment with 1-100μg BLM either
daily or on alternate days induces localized inflammation, dermal fibrosis, and loss of dermal
adipose tissue, which lasts 6 weeks after injections123,126. In this model, dermal fibroblasts become
activated, upregulate their expression of collagen, and increase ECM deposition at the site of
injection127. Lung fibrosis is also evident at 3 weeks, even prior to cutaneous fibrosis, confirming
the systemic induction of fibrosis126. BLM treatment also recapitulates other aspects of SSc
including autoantibody formation and upregulation of inflammatory cytokines. Interestingly, skin
changes are only localized to the area of injections and not to distant sites126. Absent from this
12
model, however, is the obliterative microangiopathy and perivascular inflammation that is also a
defining feature of SSc128.
Modifications of Yamamoto’s original protocol123 demonstrated no difference between daily or
alternate day BLM treatments on dermal thickness; however, mice in the alternate day treatment
regimen had increased collagen accumulation and number of myofibroblasts129. Comparison of
BLM treatment in different mouse strains show C57BL/6 mice more sensitive to BLM compared
to DBA/2129. There are also gender-dependent differences with male mice of all strains
demonstrating more severe phenotypes129. This parallels SSc where there is a predilection for
women but more severe disease phenotype and association with systemic involvement in
men130,131.
Other mouse models of SSc include the tight skin-1 mouse, which contains a mutation of the
fibrillin-1 gene132, and tight skin-2 mouse, which is induced by the mutagenic agent
ethylnitrosourea133. Both models, however, show thickening of the hypodermis instead of the
dermis and do not accurately represent the histological skin changes in human SSc. The chronic
graft-versus-host disease mouse model involves transplantation of immune competent cells from
bone marrow and spleen cells into γ-irradiated mice to incite an alloreactive immune response134.
While these mice exhibit many features of SSc including dermal fibrosis, dermal adipose loss, and
pulmonary fibrosis, this model is technically difficult and requires specialized animal care for
immunocompromised mice.
The present study utilizes the BLM-induced murine model for systemic sclerosis based on the ease
of induction of disease phenotype and well-representation within the existing literature allowing
for the critical comparison of results.
13
1.6 Identifying the Problem
The cutaneous manifestations of systemic sclerosis result from the aberrant deposition of extra-
cellular matrix components within the dermis and loss of the dermal adipose tissue. The
progressive thickening and tightening of the skin lead to significant patient morbidity, with
limitations in hand function, mouth opening, and facial expression. Rhamm, a receptor for HA, is
transiently expressed in injured tissue and is hypothesized to generate the pro-fibrotic and anti-
adipogenic microenvironment in SSc. Novel Rhamm function-blocking peptides have been
developed that attenuate fibrosis and promote adipogenesis in experimental models, opening a
promising new avenue of exploration in the development of targeted treatments for systemic
sclerosis.
14
2 Thesis Objectives and Aims
The effects of the Rhamm function-blocking peptides, NPI-110 and NPI-106, were investigated in
a bleomycin-induced mouse model of systemic sclerosis. Peptide treatment is hypothesized to
attenuate dermal thickening and restore loss of dermal adipose tissue by redirecting the cellular
microenvironment away from fibrogenesis and towards adipogenesis. Analysis of the peptide
treatment effects and investigation of the regulatory pathways involved was performed through
the three objectives outlined below.
Objective 1: Determine the effect of peptides NPI-110 and NPI-106 on fibrosis in a
bleomycin-induced murine model of systemic sclerosis
BLM-treatment produces dermal thickening and increases collagen deposition. The anti-fibrotic
effects of the peptides were examined through measurements of body weight changes, dermal
thickness, and collagen density, bundling, and mRNA expression.
Aim 1: Determine effect of NPI-110 and NPI-106 treatment on body weight
Aim 2: Quantify the effect of NPI-110 and NPI-106 on dermal thickness using Masson’s
trichrome stained paraffin-processed skin samples
Aim 3: Assess the effect of NPI-110 and NPI-106 on collagen density, bundling, and gene
expression using polarized microscopy of Picrosirius Red birefringence and RT-PCR
analysis of Col1a1 and Col3a1 expression
15
Objective 2: Determine the effect of peptides NPI-110 and NPI-106 on adipogenesis in a
bleomycin-induced murine model of systemic sclerosis
BLM-treatment causes loss of dermal adipose tissue. The adipogenic effects of the peptides were
examined through measurements of dermal adipose thickness and analysis of adiponectin protein
and perilipin mRNA expression.
Aim 1: Quantify the effect of NPI-110 and NPI-106 on dermal adipose thickness using
Masson’s trichrome stained paraffin-processed skin samples
Aim 2: Determine the effect NPI-110 and NPI-106 on adiponectin protein expression using
immunohistochemistry of paraffin-processed skin samples
Aim 3: Determine the effect of NPI-110 and NPI-106 on adipogenesis through RT-PCR
analysis of the adipogenic marker, perilipin.
Objective 3: Elucidate the mechanism by which NPI-110 and NPI-106 affect fibrosis and
adipogenesis in a bleomycin-induced murine model of systemic sclerosis
Transcriptional profile analysis of peptide treatment compared to BLM-treatment was performed
to identify potential interacting pathways. Genes of interest, including c-Myc, Tgfb1, and Rhamm
were confirmed with RT-PCR.
Aim 1: Profile 84 fibrosis-pathway specific and 84 adipogenesis-pathway specific genes
and use bioinformatic analysis to identify genes of interest
Aim 2: Confirm the identified genes of interest (Tgfb1, c-Myc) with RT-PCR analysis and
immunohistochemistry of paraffin-processed skin samples
Aim 3: Determine the effect of NPI-110 and NPI-106 treatment on Rhamm mRNA levels
with RT-PCR analysis
16
3 Methods
3.1 Injectable peptide NPI-110 and NPI-106 Formulations
The HA-binding peptide NPI-106 (peptide sequence RGGRGRRR) and the RHAMM-binding
peptide NPI-110 (peptide sequence 644KLKDENSQLKSEVSK) were synthesized and purified to
>95% purity (gift from Dr. L. Luyt, Western University, London, Canada and Eravon
Pharmaceuticals Inc). Peptides were dissolved in PBS and then filter sterilized through a 0.22μm
filter.
3.2 Animal Studies
Animal studies were conducted by Stelic MC, Inc. (Tokyo, Japan) under the direction of Dr.
Yuichiro Shibazaki. All experiments were approved and compliant with the Act of Welfare and
Management of Animals, Standards Relating to the Care and Management of Animals and Relief
of Pain (Ministry of the Environment, Act No. 105 and No. 88), and the Guidelines for Proper
Conduct of Animal Experiments (Science Council of Japan).
3.2.1 Animal Care
Forty-eight six-week-old female C57BL/6J mice (Japan SLC, Japan) were used for the study. Mice
were housed in TPX cages (CLEA Japan) with 6 mice per cage within a temperature-controlled
room with a standard 12-hour light and dark cycle. Sterilized Paper-Clean bedding was provided
and changed weekly. Each mouse was identified with a unique study number engraved on earrings.
Sterilized normal mouse diet was provided ad libitum in a metal lid on top of the cage and on the
floor. Distilled water was provided ad libitum from a water bottle with sipper tube that was
replaced weekly. Mice were weighed daily and monitored for viability and any clinical signs of
deterioration.
17
3.2.2 Mouse Treatment Groups
Forty-eight mice were randomized into four treatment groups as outlined below in Table 1. A
murine model of bleomycin-induced scleroderma was established based on a modified version of
the Yamamoto protocol123. The dorsal backs of all mice where shaved using a razor prior to
injections. Twelve mice were administered 1μg/μL bleomycin (Lot #15180, Nippon Kayaku,
Japan) in 0.9% saline subcutaneously to the dorsal back at a dose of 50μg per mouse on alternate
days, starting on day 0. In the control group, twelve mice were subcutaneously administered an
equal volume of 50μL 0.9% saline to the dorsal back on alternate days, starting on day 0.
Two peptides (NPI-110 and NPI-106) were tested. Twelve mice were administered subcutaneous
bleomycin injections on alternate days as above and then administered 3mg/kg of Peptide NPI-
110 by subcutaneous injection every fourth day starting on day 0 (day 0, 4, 8, 12, 16, 20, 24).
Twelve mice were administered bleomycin on alternate days as above and then administered
3mg/kg of Peptide NPI-106 every fourth day starting on day 0 (day 0, 4, 8, 12, 16, 20, 24).
18
Treatment Group
Number of Mice
Treatment
Bleomycin 12 50uL (1μg/μL) of BLM administered subcutaneously on
alternate days (Day 0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26)
Control 12 50μL of 0.9% saline administered subcutaneously on
alternate days (Day 0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26)
Peptide NPI-110 12
50uL (1μg/μL) of BLM administered subcutaneously on alternate days
(Day 0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26)
3mg/kg of Peptide NPI-110 administered every fourth day after BLM injections (Days 0, 4, 8, 12, 16, 20, 24)
Peptide NPI-106 12
50uL (1μg/μL) of BLM administered subcutaneously on alternate days
(Day 0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26)
3mg/kg of Peptide NPI-106 administered every fourth day after BLM injections (Days 0, 4, 8, 12, 16, 20, 24)
Table 1. Study protocol treatment groups
19
3.2.3 Tissue Collection
All mice were euthanized on day 28 under pentobarbital sodium anesthesia by exsanguination
through the abdominal aorta. Full thickness skin biopsies of the dorsal back within the area of
injections were collected from each mouse. A portion of skin tissue was fixed in 10% neutral
buffered formalin prior to embedding in paraffin wax for preparation of histologic sections. The
remaining portion was placed into microcentrifuge tubes, snap frozen, and stored at -80oC.
3.3 Effect of Peptide NPI-110 and NPI-106 on Fibrosis
3.3.1 Effect of peptides on body weight
Mice from each group were weighed daily starting on Day 0 and their weight was recorded at
each time point as a percent of their starting Day 0 weight.
3.3.2 Effect of peptides on dermal thickness
3.3.2.1 Masson’s Trichrome Staining
4μm paraffin-processed histology slides were prepared from mouse skin samples from each of the
four treatment groups using a Microm HM 200 Ergostar Microtome (GMI; Ramsey, Minnesota).
Paraffin-processed sections were stained with hematoxylin and eosin and Masson’s Trichrome
according to manufacturer’s instructions (Sigma-Aldrich, St.Louis, Missouri) by Stelic MC, Inc.
3.3.2.2 Quantification of dermal thickness
Masson’s Trichrome stained slides of mouse skin sections were digitized using the Aperio
Scanscope (Leica Biosystems, Wetzlar, Germany) and viewed using the Aperio ImageScope
Viewer (Aperio ePathology Solutions; http://www.aperio.com) at 10X magnification. Dermal
thickness was measured from the epidermal-dermal junction to the dermal-adipose junction. Three
representative sections from twelve mice per treatment group were used for analysis. Three
random measurements were taken per section by an independent blinded observer.
20
3.3.3. Effect of peptides on collagen density, bundling, and gene expression
3.3.3.1 Picrosirius Red staining
Paraffin-embedded mouse skin sections were stained for Picrosirius Red according to
manufacturer’s instructions (Polysciences, Warrington, PA) with the help of Robarts Research
Institute. Representative sections from seven mice from each of the four treatment groups were
stained and used for analysis.
3.3.3.2 Quantification of area fraction of collagen
Picrosirius Red stained sections were viewed using a polarized microscope equipped with a
circular polarizer and interference filters (Olympus BX51, Cambridge Research &
Instrumentation, Woburn, MA, USA) and images were acquired using Abrio LC-PolScope
processing software (Woburn, MA, USA) at 10X magnification. Three images were taken per slide
by an independent blinded observer. Images were exported as .TIFF files in RGB format and then
imported into ImageJ 1.47 (NIH; https://imagej.nih.gov/ij/). Collagen fibrils appear white under
polarized microscopy, and the collagen density was calculated as the number of collagen fibril
pixels within a defined area of dermis. The dermis was outlined using freehand selection and this
area was calculated in square pixels. The thresholding function was executed with a lower limit of
45 and upper limit of 255. This threshold was first defined using several test slides to determine
the optimal setting for accurate isolation of the collagen fibrils. Once this was defined, the same
threshold was used for analysis of all subsequent slides. The collagen density was calculated as
below.
Area fraction of collagen = ������ �� ������ �� �������� �������
����� ����� ���� �� ������
3.3.3.3 Quantification of collagen bundling
Picrosirius Red stained slides were also viewed using polarized microscopy with pseudo-colour
channels applied to assess the density of collagen bundling. With this method, red indicates area
of denser collagen bundling and blue indicates area of less dense collagen bundling135. The same
captured images from 3.3.3.2 were viewed with pseudo-colour channels applied with an intensity
21
range for live image capture at 99.6 nm. Images were exported as .TIFF files in RGB format and
then imported into Photoshop CC (Adobe, Mountain View, California). Overall collagen bundling
was assessed by analyzing the red to blue color ratio within a defined dermal area. The dermis was
outlined using freehand selection and this area was calculated in square pixels. Red and blue
colored pixels within this area were isolated according to RGB channels and the mean intensity
(out of 255) was calculated for each colour. The total number of red pixels and blue pixels were
counted within the outlined dermal area and then multiplied by the mean intensity of that color to
obtain absolute measurements as below.
Red/blue expression = ��� ������ � ��� ���� ���������
���� ������ � ���� ���� ���������
3.3.3.4 RT-PCR analysis of Col1a1 and Col3a1 mRNA expression
The mRNA expression of Col1a1 and Col3a1 of five mice from each of the four treatment groups
was assayed by RT-PCR using the primers for Col1a1 and Col3a1 listed in Table 2. Skin biopsy
samples were homogenized on ice in 600 μL of Trizol (Thermo-Fisher, Waltham, MA) in a
microcentrifuge tube using the Ika T8 Ultra Turrax Homogenizer (Ika Works Inc, Wilmington,
NC). Once tissues were adequately homogenized, an additional 400 μL of Trizol was added. RNA
was extracted using the Trizol-chloroform liquid-liquid method136. 200 μL of chloroform was
added to the sample and then vortexed for 10 seconds prior to centrifuging at 4oC for 15 minutes
at 12 000 rpm (Sorvall Legend Micro 21R, Thermo Fisher Scientific, Waltham, MA). The top
aqueous layer was then transferred into a new microcentrifuge tube without touching the liquid
interface and the bottom layer was discarded. RNA was precipitated with the addition of 0.5 mL
of pure isopropanol to each sample and then kept on ice for 10 minutes prior to centrifugation at
4oC for 15 minutes at 12 000 rpm. The supernatant was removed and the RNA pellet washed with
1mL of cold 70% ethanol three times with centrifugation at 4oC for 15 minutes at 7500 rpm in
between each wash. The 70% ethanol was removed and pellet left to dry in a fume hood for 30
minutes. The RNA pellet was resuspended in 20 μL of UltraPure RNAse-free distilled water
(Invitrogen, Carlsbad, CA) and quantified using the NanoDrop One/OneC (Thermo-Fisher,
Waltham, MA). RNA was stored at -80oC and only RNA samples with A260/280 > 1.8 and
A260/230 > 1.7 were used for further experiments.
22
Reverse transcription was performed using the SuperScript VILO cDNA Mastermix (Thermo-
Fischer, Waltham, MA) according to manufacturer’s instructions. Complementary cDNA was
generated from 1 μg RNA per sample. In addition to this amount of RNA, each reaction mixture
contained 4 μL 5x VILO Reaction Mix, 2 μL of 10x Superscript Enzyme Mix, and enough
Ultrapure RNA-ase free distilled water to make a total reaction volume of 20 μL. The reaction
mixture was incubated at room temperature for 10 minutes and then in a 42oC water bath for 60
minutes. The reaction was stopped at 85oC in a heat block for 5 minutes. cDNA was then diluted
1:10 in 180 μL of Ultrapure distilled water and stored at -20oC until further use.
RT-PCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-rad,
Hercules, CA). Each reaction consisted of 8 μL of cDNA, 10 μL of SYBR Green Mastermix, and
1 μL each of forward and reverse primer (Table 2) to make a total reaction volume of 20 μL.
Reactions were prepared in a 96-well plate. RT-PCR experiments were performed using the
Stratagene Mx3000P system (Agilent Technologies, Santa Clara, CA) with amplication profile of
10 minutes 95oC, 40 cycles of 30 seconds at 95oC, 1 minute at 60oC, and 1 minute at 72oC.
Analysis was performed using 5 mice from each of the four treatment groups and five technical
replicates. Data was analyzed with a non-adaptive baseline starting from cycle two to two cycles
before the earliest amplification observed. Threshold values were defined manually in log view
and placed above the background signal but within the lower third of the linear phase of
amplification plot. The same threshold value was used for each set of experiments. CT values were
exported as a text file into Excel and analyzed using 2-ΔΔCt method 137 with standard propagation
of errors. Data was normalized to Gapdh and compared to control normal saline treated mouse and
expressed as fold change in Col1a1 and Col3a1 expression. The Col1a1:Col3a1 ratio was
calculated as below with standard propagation of errors.
Col1a1:Col3a1 ratio = Avg 2-ΔΔCt Col1a1 / Avg 2-ΔΔCt
Col3a1
23
Table 2. RT-PCR Primers
Gene
Forward Primer
Reverse Primer
Gapdh
AAGGTCATCCCAGAGCTGAA
CTGCTTCACCACCTTCTTGA
Col1a1
TGACTGGAAGAGCGGAGAGT
ATCCATCGGTCATGCTCTCT
Col3a1
CTGTAACATGGAAACTGGGGAAA
CCATAGCTGAACTGAAAACCACC
Tgfb1
CTCCCGTGGCTTCTAGTGC
GCCTTAGTTTGGACAGGATCTG
Rhamm
CCTTGCTTGCTTCGGCTAAAA
AGCAAAGCTCAATGCAGCAG
c-Myc
CTGTACCTCGTCCGATTCCAC
TTCTTGCTCTTCTTCAGAGTCG
Plin
ACTCTCCGGAACACCATCT
CCACAGTGTCTACCACGTTATC
24
3.4 Effect of Peptide NPI-110 and NPI-106 on Adipogenesis
3.4.1 Effect of peptides on dermal adipose thickness
Masson’s Trichrome stained slides of mouse skin biopsies were viewed using the Aperio
ImageScope Viewer at 10X magnification. Dermal adipose tissue thickness was measured from
the dermal-adipose tissue junction to the adipose-panniculus carnosus junction or the farthest
extent of the adipose tissue when muscle not identifiable. Three representative skin sections from
twelve mice per treatment group were used for analysis. Three random measurements were taken
per section by an independent blinded observer.
3.4.2 Effect of peptides on adiponectin protein expression
4 μm sections from paraffin-embedded mouse skin samples were prepared onto glass slides with
two skin sections per slide. Sections were then deparaffinized with two 15-minute xylene washes
and then rehydrated with a descending alcohol series of 100%, 95%, 70% ethanol, followed by
distilled water and PBS, pH 7.4, washes. Antigen retrieval was performed in 10 mM sodium citrate,
pH 6.4, with an inverter microwave (Panasonic, Kadoma, Osaka) for 3 minutes at maximum
power, 5 minutes at medium power, and 8 minutes at low power. Extra 10 mM sodium citrate
solution was added with ongoing evaporation to ensure tissues were covered at all times.
Endogenous peroxidase activity was then blocked with 3.0% H2O2 diluted in PBS for 10 minutes,
rinses with PBS, and then 3.0% BSA diluted in PBS for 2 hours. A pen with hydrophobic ink was
then used to trace around the two skin sections. Slides were incubated with rabbit polyclonal anti-
adiponectin antibody (ab216502, Abcam) at 1:600 diluted in 1% BSA overnight at 4oC. Each slide
contained a negative control of isotype matched non-immune rabbit IgG (DAKO Agilent, Santa
Clara, CA). The following day, slides were washed in PBS prior to incubation with biotin-
conjugated goat anti-rabbit secondary IgG (Vector Labs, Burlington, ON) at 1:500 dilution in PBS
for 2 hours at room temperature. Streptavidin-horseradish peroxidase (ab7403, Abcam) diluted
1:2000 in PBS was then applied to each section and incubated for 30 minutes at room temperature.
Diaminobenzidine (DAKO Liquid DAB Substrate+ Chromogen system, Agilent, Santa Clara, CA)
was applied for 5 minutes to visualize staining and then washed in PBS. Sections were
counterstained with hematoxylin prior to washing in an ascending ethanol series (70%, 95%, 100%
25
ethanol), and then cleared with xylene. Slides were mounted with Cytoseal-60 (Thermo Fisher,
Waltham, MA) and a glass slide and left overnight to dry with protection against ambient light.
Immunohistochemical analysis of adiponectin was performed by digitizing the slides using the
Scanscope at 10X magnification and importing .TIFF file images into ImageJ 1.47. Representative
sections from three mice per treatment group were used for analysis, with three high powered field
sections per slide and three separate slides per mouse. In the ImageJ software, free-hand selections
were used to remove the epidermis and hair follicles, which uniformly stained positive for
adiponectin in all treatment groups. The area of the remaining region was calculated. The image
was then deconvoluted with the ‘H-DAB’ setting with conservative thresholds for brown pixels at
165 units and blue pixels at 240 units. The number of positively stained brown pixels per mm2 was
then recorded for each section.
3.4.3 Effect of peptides on perilipin mRNA expression
Perilipin mRNA expression in mouse skin biopsy tissues was assayed by RT-PCR as previously
described in section 3.3.3.4 using primers listed in Table 2. Analysis was performed using three
mice from each treatment group and five technical replicates. Data was exported to Excel and
analyzed using 2-ΔΔCt method normalized to Gapdh and compared to control normal saline treated
mouse. Data expressed as fold change in Plin mRNA expression.
3.5 Elucidating the Mechanism of NPI-110 and NPI-106 Function
3.5.1 Bioinformatic analysis of expression of 84 fibrosis and 84 adipogenesis-pathway specific
genes
3.5.1.1 RT2 Profiler PCR Mouse Fibrosis Array
The expression of 84 fibrosis pathway-focused genes (Figure 2) was profiled using the 96-well
RT2 Profiler PCR Plate Array (Qiagen, Hilden, Germany). RNA was isolated from mouse skin
biopsy tissues as outlined in 3.3.3.4 using the Trizol-chloroform liquid-liquid extraction method.
As a screening array, experiments were performed with one technical replicate from one mouse
from each of the four treatment groups. 2 μg of RNA was reverse transcribed to cDNA using the
26
RT2 First Strand Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. A
mastermix of 1350 μL of RT2 SYBR Green Mastermix, 102 μL of the cDNA synthesis reaction,
and 1248 μL of Ultrapure distilled water was first prepared. 25 μL of this mastermix was added to
each well of RT2 Profiler PCR Mouse Fibrosis Array (PAMM-120Z, Qiagen, Hilden, Germany)
and sealed with optical thin-wall 8-cap strips. PCR was run using the Stratagene Mx3000P system
(Agilent Technologies, Santa Clara, CA). Data was exported to Excel after setting a non-adaptive
baseline and manual thresholding. Data was then analyzed using the SABiosciences PCR array
data analysis software (Qiagen, www.SABiosciences.com/pcrarraydataanalysis.php) using the 2-
ΔΔCt method normalized to Gapdh and compared to the BLM-treated mouse.
3.5.1.2 RT2 Profiler PCR Mouse Adipogenesis Array
To elucidate the mechanism by which NPI-110 and NPI-106 affect adipogenesis, expression of 84
adipogenesis pathway-focused genes (Figure 3) were profiled using the 96-well RT2 Profiler PCR
Mouse Adipogenesis Array (PAMM-049A, Qiagen, Hilden, Germany). Experiments were
performed with one mouse from each of the four treatment groups and analyzed as in 3.5.1.1.
27
Figure 2. Fibrosis pathway-focused 96-well plate set-up. Layout of 96-well RT2 Profiler PCR Mouse Fibrosis Array (Qiagen, Hilden, Germany) profiling 84 different genes. Full gene list in Supplementary Table 1. RTC, reverse transcriptase control; PPC, positive PCR control.
28
Figure 3. Adipogenesis pathway-focused 96-well plate set-up. Layout of 96-well RT2 Profiler PCR Mouse Adipogenesis Array (Qiagen, Hilden, Germany) profiling 84 different genes. Full gene list in Supplementary Table 2. RTC, reverse transcriptase control; PPC, positive PCR control.
29
3.5.1.3 Bioinformatic Analysis
Ingenuity Pathway Analysis Software (Qiagen Bioinformatics, Hilden, Germany) was used to
compare the transcriptional profiles of NPI-110 and NPI-106 treatment with that of BLM-
treatment alone. The core analysis was performed using fold-expression values of each assayed
gene from the RT2 Profiler Fibrosis and Adipogenesis arrays with strict criteria for a fold change
> 1.5 for upregulated and down-regulated genes. Causal pathway analysis was performed for
canonical pathways and upstream regulators.
3.5.1.4 Confirmation of Tgfb1 mRNA expression with RT-PCR
IPA upstream regulator analysis indicated Tgfb1 as the top most predicted regulator and these
results were confirmed with RT-PCR analysis using primers for Tgfb1 as listed in Table 2.
Analysis was performed as in 3.3.3.1 using three mice from each treatment group and five technical
replicates. Data was exported to Excel and analyzed using 2-ΔΔCt method normalized to Gapdh and
compared to control normal saline treated mouse. Data expressed as fold change in Tgfb1
expression.
3.5.1.5 TGFβ1 Immunohistochemistry
4 μm sections from paraffin-embedded skin samples were used for immunohistochemistry staining
for total Tgfb1 with antigen retrieval and blocking performed in the same manner as in 3.4.2. Slides
were then incubated with anti-Tgfb1 antibody (ab92486, Abcam) at 1:600 dilution in 1% BSA
overnight, washed in PBS, and then incubated with biotin-conjugated goat anti-rabbit secondary
IgG (Vector Labs, Burlington, ON) 1:500 dilution for 2 hours. Each slide contained a negative
control of isotype matched non-immune rabbit IgG (DAKO Agilent, Santa Clara, CA).
Streptavidin-horseradish peroxidase diluted 1:2000 in PBS was applied to each section for 30
minutes at room temperature. Colorimetric detection was then performed with diaminobenzidine
(DAKO Liquid DAB Substrate+ Chromogen system, Agilent, Santa Clara, CA) applied for 5
minutes. Sections were counterstained with hematoxylin, taken through an ascending ethanol
series, cleared with xylene, and then mounted with Cytoseal-60 (Thermo Fisher, Waltham, MA)
30
and a glass slide. Sections were dried overnight with protection against ambient light prior to
analysis.
Analysis of total Tgfb1 staining was performed by digitizing the slides using the Scanscope at 10X
magnification and importing .TIFF file images into ImageJ 1.47. Representative sections from
three mice per treatment group were used for analysis, with three high powered field magnification
sections per slide and three separate slides per mouse. In ImageJ software, free-hand selections
were used to isolate the dermal layer and dermal adipose tissue layer for separate analysis. The
area of the selected area was recorded in mm2. Using the counting function, the number of
positively stained cells within the selected area was counted manually and recorded to calculate
the number of positive cells/mm2. This was repeated for the dermal adipose tissue layer.
3.5.1.6 Confirmation of c-Myc mRNA expression with RT-PCR
Myc gene expression was found to be down-regulated with both NPI-110 and NPI-106 peptide
treatment in the fibrosis-specific gene panel. IPA canonical pathway analysis further identified c-
Myc as a potential regulator of NPI-110 and NPI-106 peptide function. This was further confirmed
with RT-PCR analysis using the primers for c-Myc listed in Table 2. Analysis was performed as
in 3.3.3.1 using three mice from each treatment group and five technical replicates. Data was
exported to Excel and analyzed using 2-ΔΔCt method normalized to Gapdh and compared to control
normal saline treated mouse. Data expressed as fold change in c-Myc expression.
3.5.1.7 c-Myc Immunohistochemistry
4 μm sections from paraffin-embedded skin samples were used for immunohistochemistry staining
for c-Myc with antigen retrieval and blocking performed in the same manner as in 3.4.2. Slides
were then incubated with recombinant rabbit monoclonal anti-c-Myc antibody (ab32072, Abcam)
at 5 ug/mL dilution in 1% BSA overnight, washed in PBS, and then incubated with biotin-
conjugated goat anti-rabbit secondary IgG (Vector Labs, Burlington, ON) diluted 1:500 for 2
hours. Each slide contained a negative control of isotype matched non-immune rabbit IgG (DAKO
Agilent, Santa Clara, CA). Streptavidin-horseradish peroxidase diluted 1:2000 in PBS was applied
to each section for 30 minutes at room temperature and then colorimetric detection performed with
31
diaminobenzidine (DAKO Liquid DAB Substrate+ Chromogen system, Agilent, Santa Clara, CA)
applied for 5 minutes. Sections were counterstained with hematoxylin, taken through an ascending
ethanol series, cleared with xylene, and then mounted with Cytoseal-60 (Thermo Fisher, Waltham,
MA) and a glass slide. Sections were dried overnight with protection against ambient light prior
to analysis.
Immunohistochemical analysis of c-Myc was performed in the same manner as in 3.4.2 with
analysis of .TIFF file images using ImageJ 1.47 with representative sections from five mice per
treatment group and three high power field sections per slide. Free-hand selections were used to
remove the epidermis and hair follicles and image deconvolution with the ‘H-DAB’ setting was
used to record the number of positively stained brown pixels per mm2.
3.5.2 Effect of peptide on Rhamm mRNA expression
Rhamm mRNA expression was confirmed with RT-PCR analysis using primers for Rhamm as
listed in Table 2. Analysis was performed as in 3.3.3.1 using three mice from each treatment group
and five technical replicates. Data was exported to Excel and analyzed using 2-ΔΔCt method
normalized to Gapdh and compared to control normal saline treated mouse. Data expressed as fold
change in Rhamm mRNA expression.
3.6 Statistical Analysis
Data recorded in Excel was imported into SPSS Statistics 25 (IBM, Armonk, NY) and tested for
normality using the Shapiro-Wilk test. Statistical analysis was performed for parametric data using
one-way ANOVA to compare means between all four treatment groups and post-hoc analysis with
Fisher’s least significant difference (LSD) test. Non-parametric data was analyzed using the
Kruskall-Wallis test with post-hoc Mann-Whitney U with Bonferroni correction for repeated
comparisons. Significance was set at p < 0.05.
32
4 Results
The BLM-induced systemic sclerosis mouse model is well-established to recapitulate the early
inflammatory phase of scleroderma, which is associated with increased serum HA in SSc
patients92–94. The effects of the novel Rhamm-binding peptide (NPI-110) and the HA-binding
peptide (NPI-106) were tested in a mouse model of BLM-induced systemic sclerosis. C57BL/6J
mice, injected subcutaneously with bleomycin on alternate days, were treated with either NPI-110
or NPI-106 to determine the ability of the peptides attenuate Rhamm-directed signalling of
fibrogenesis and to promote adipogenesis.
There were no differences in mortality between the four treatment groups, and all forty-eight mice
survived until day 28. Weights were recorded daily and BLM-treated mice did not gain weight at
the same rate as compared to control mice. This difference was significant by day 9 and persisted
until day 28. (p < 0.0001) (Figure 4). Neither peptide was able to restore normal weight gain at
any time point.
33
Figure 4. Peptide NPI-110 and NPI-106 treatment does not restore normal weight gain. Weekly body weights of mice in each of the four treatment groups expressed as a percentage of baseline body weight on day 0. * indicates time points of statistically significant differences between BLM-treated and control groups (p < 0.0001). Values represent mean and SEM with analysis of 12 mice per treatment group. Analysis with one-way ANOVA and post-hoc LSD test for significance. Data and figure provided by Stelic MC.
34
Mouse skin biopsy samples were visualized with H&E and Masson’s Trichrome to determine if
peptide treatments ameliorated BLM-induced fibrosis, as measured by dermal thickness, collagen
bundling and density, and Col1a1 and Col3a1 mRNA expression.
Masson’s trichrome stains collagen blue and in the BLM treatment group, there is thickening of
the dermal layer and replacement of normal tissues with collagen. Visually, both peptide
treatments blunted the accumulation of collagen within the dermis (Figure 5A). This was
quantified with measurements of dermal thickness from the epidermal-dermal junction to the
dermal-adipose tissue junction. BLM-injection caused a 25% increase in dermal thickness
compared to control (p < 0.0001). This was significantly decreased by 6% with both peptide
treatments compared to BLM treatment (NPI-110 p = 0.004, NPI-106 p = 0.006); however, neither
peptide was able restore dermal thickness back to baseline.
Given the increased dermal thickness, the architecture and density of collagen bundling was
investigated with Picrosirius Red stained paraffin-processed slides. Picrosirius Red stains collagen
fibres red, and when viewed in brightfield microscopy, highly cross-linked collagen fibres produce
a stronger red staining pattern135,138. Collagen in lesional skin treated with BLM stained intensely
red, whereas peptide treatment resulted in weaker-staining, less cross-linked fibres (Figure 6A).
Viewed under polarized microscopy, collagen fibers in lesional BLM-treated skin demonstrate
strong birefringence (Figure 6A) with collagen fibres appearing white. The area fraction of
collagen was calculated as a measurement of collagen content. BLM treatment induced a 24%
increase in the area fraction of collagen (p < 0.001) compared to control. While peptide NPI-110
decreased the area fraction of collagen (p = 0.039), treatment with peptide NPI-106 did not have a
significant effect (p = 0.53). The density of collagen accumulation within the dermis was assayed
with the application of pseudo-color channels during polarized microscopy. With this technique,
densely packed collagen fibrils appear red and loosely packed collagen appears blue (Figure 7A).
The proportional area of densely-packed collagen was quantified with calculations of the red/blue
colour fraction, which was more than two-fold higher in BLM treated skin compared to control
(Figure 7B), reflecting accumulation of densely packed collagen. However, there was no
significant effect of NPI-110 or NPI-106 treatment on collagen density as measured by the red/blue
35
colour fraction. These findings suggest that peptide NPI-110 treatment reduced dermal thickness
and collagen content in BLM-induced SSc. Peptide NPI-106 was not effective in ameliorating
these BLM-induced fibrotic changes.
36
Figure 5. Peptide NPI-110 and NPI-106 reduces collagen deposition and dermal thickening. (A) Paraffin processed histology sections of mice from all four treatment groups stained for H&E and Masson’s Trichrome to visualize tissue architecture and collagen distribution. (B) Quantification of dermal thickness with measurements from the epidermal-dermal junction to the dermal-adipose junction. Values represent mean and SEM from three random measurements in three sections per mouse, 12 mice per treatment group. Analysis with Kruskall-Wallis test with post-hoc Mann-Whitney U with Bonferroni correction. (* p < 0.05, ***p < 0.0001).
A
B
37
Figure 6. Peptide NPI-110 but not NPI-106 reduces the area fraction of collagen. (A) Picrosirius Red stained paraffin-processed histology sections of mice from four treatment groups on day 28 visualized with brightfield (top) and polarized (bottom) microscopy. (B) Calculated area fraction of collagen. Values represent mean and SEM of three random sections per slide, three slides per mouse, and 7 mice per group. Analysis with one-way ANOVA and post-hoc LSD test for significance. (* p < 0.05, ***p < 0.0001).
38
Figure 7. Neither NPI-110 or NPI-106 reduces collagen density to baseline. (A) Picrosirius Red stained paraffin-processed histology sections of mice from all four treatment groups on day 28 visualized with polarized microscopy and pseudo-colour channels. Red color indicates more densely packed collagen fibrils and blue highlight more loosely packed collagen. (B) Quantification of collagen density with red-to-blue color ratio. Values represent mean and SEM of three random sections per slide, three slides per mouse, and 7 mice per group. Analysis with Kruskall-Wallis test with post-hoc Mann-Whitney U with Bonferroni correction. (**p < 0.001).
39
To further characterize the type of collagen accumulating within the dermis, Col1a1 and Col3a1
mRNA expression was examined with RT-PCR. Clinically, SSc is characterized by the increased
deposition of type 1 collagen in the extracellular matrix139,140 and RT-PCR analysis confirmed this
in the BLM-induced SSc model with a statistically significant 1.22-fold increase in Col1a1 mRNA
expression (p = 0.03) compared to control. Both peptides demonstrated potent effects in
suppressing type 1 collagen expression significantly below baseline, with NPI-110 and NPI-106
decreasing Col1a1 expression by 11-fold (p < 0.0001) and 14-fold (p < 0.0001), respectively
(Figure 8A). In contrast to type 1 collagen, type 3 collagen expression in lesional BLM-treated
skin was decreased 2.5-fold (p < 0.0001) (Figure 8B). The concomitant increase in type 1 collagen
and decrease in type 3 collagen resulted in a 3-fold increase in the Col11:Col3a1 ratio with BLM-
treatment (Figure 8C). Peptide NPI-110 treatment was able to ameliorate some of the loss of
collagen 3 expression (p = 0.012); however, interestingly, NPI-106 treatment resulted in further
decrease collagen 3 expression (p < 0.0001 compared to BLM-treatment) (Figure 8B). NPI-110
treatment reduced the Col1a1:Col3a1 ratio below baseline (NPI-110 p < 0.0001 compared to
control) while NPI-106 treatment normalized the Col11:Col3a1 ratio to control (Figure 8C).
40
Figure 8. Peptide NPI-110 and NPI-106 suppress Col1a1 mRNA expression and reduce the Col1a1:Col3a1 ratio. RT-PCR analysis of Col1a1 and (A) Col3a1 (B) mRNA expression in mice from each of the four treatment groups on day 28. Values represent mean and SEM of fold change from five mice per treatment group and five technical replicates. Analysis with one-way ANOVA and post-hoc LSD test. (* p < 0.05, ** p < 0.001, **p < 0.0001).
41
The increase in dermal thickness and collagen content in SSc is at the expense of the dermal
adipose tissue which is substantially decreased. BLM-treatment caused a 14% loss of dermal
adipose tissue thickness (p = 0.001) (Figure 9). Treatment with either NPI-110 and NPI-106 was
unable to ameliorate the detectable loss of dermal adipose tissue.
Next, the effect of peptide treatment on adipokine expression was examined to see if they promoted
a more favourable microenvironment that was supportive of adipogenesis. Immunohistochemical
analysis of adiponectin, show that the loss of dermal adipose tissue thickness in BLM-injected skin
is also reflected in a significant decrease in adiponectin expression (p < 0.0001) (Figure 10).
Despite no measurable changes in dermal adipose thickness, NPI-110 treatment significantly
increased adiponectin expression (p < 0.0001 compared to BLM-treatment) comparable to baseline
levels (Figure 10B). There was no change in adiponectin expression with NPI-106 treatment (p =
0.061) (Figure 10B).
Perilipin mRNA expression was assayed as another measure of adipogenesis. Perilipin is a lipid
droplet-binding protein that is highly expressed from adipocytes141. BLM treatment resulted in 7-
fold reduction in Plin mRNA expression and both peptide NPI-110 and NPI-106 treatments led to
partial recovery of Plin mRNA expression to only a 2-fold reduction compared to baseline (Figure
11).
42
Figure 9. Peptide NPI-110 and NPI-106 treatment does not ameliorate the detectable loss of dermal adipose tissue. Quantification of dermal adipose tissue thickness with measurements from Masson’s Trichrome stained paraffin-embedded slides from the epidermal-dermal junction to the adipose-panniculosus carnosus junction. Values representing mean and SEM from three random measurements in three sections per mouse, 12 mice per treatment group. Analysis with Kruskall-Wallis test with post-hoc Mann-Whitney U with Bonferroni correction. (** p < 0.001).
43
Figure 10. Peptide NPI-110 treatment restores adiponectin protein expression. (A) Paraffin-processed skin sections of mice from all four treatment groups at day 28 stained for anti-adiponectin antibody. (B) Quantification of immunohistochemical staining for adiponectin. Values represent mean and SEM from three random measurements in three sections per mouse, 3 mice per treatment group. Analysis with one-way ANOVA and post-hoc LSD test for significance. (** p < 0.001, *** p < 0.0001).
44
Figure 11. Peptide NPI-110 and NPI-106 treatment partially restores Plin mRNA expression. RT-PCR performed on lesional skin from mice after 28 days of either BLM-treatment or BLM-treatment with peptide injections, with saline injections as control. Values represent means and SEM from three mice per treatment group and five technical replicates. Analysis with one-way ANOVA and post-hoc LSD test. (* p < 0.05, *** p < 0.0001).
45
To elucidate the mechanisms by which NPI-110 and NPI-106 affect fibrosis and adipogenesis,
transcriptional expression of 84 fibrosis-specific and 84 adipogenesis-specific genes were profiled.
Fibrosis pathway related genes include ECM and cell adhesion molecules, inflammatory
cytokines, growth factors, Tgfb1 superfamily members, and regulators of epithelial-to-
mesenchymal transition. Adipogenesis pathway related genes included adipokines, Ppary targets,
Wnt family proteins, and adipogenesis regulators involved in white and brown adipose tissue
development.
The results of 29 selected fibrosis-pathway genes are shown (Figure 12A, full results of all genes
in Supplementary Table 1). NPI-110 significantly reduced the expression of 22/84 fibrosis genes,
including Myc which was decreased 196-fold with NPI-110 treatment but not with NPI-106. The
results of 26 selected adipogenesis-pathway genes are shown (Figure 12B, full results of all genes
in Supplementary Table 2). The majority of genes are down-regulated, including the pro-fibrotic
genes fibroblast-growth factor 1, 2, and 10 which demonstrated up to 68.6-fold reduction with
NPI-110 treatment. All members of the Wnt family assayed in the adipogenesis-specific pathway
gene panel were suppressed by both NPI-110 and NPI-106 (Figure 12). NPI-110 induced a 50.9-
fold reduction in Wnt1, 68.6-fold reduction in Wnt3a and 55.7-fold reduction in Wnt5b. Wnt10b
and Wnt5a were down-regulated 4.4 and 3.9-fold, respectively, with NPI-110 treatment. NPI-106
also reduced Wnt expression although to a lesser degree. Ppary which is normally inhibited by
Erk1 through Rhamm, was comparatively less suppressed, with only 2-fold reduction with peptide
treatment, suggesting perhaps release of Erk1 inhibition. This supports the hypothesis that the
antifibrotic effects of peptide treatment may be able to create a more favourable microenvironment
for adipogenesis to occur as indicated by increased expression of adipokines.
46
Figure 12. Transcriptional profiling of fibrosis-specific (A) and adipogenesis-specific (B) genes. Selected data of 29 fibrosis-specific genes (A) and 26 adipogenesis-specific genes (B) profiled by RT-PCR that are either upregulated or downregulated by NPI-110 (blue bars) or NPI-106 (orange bars) with fold expression expressed relative to BLM-treated group. Full gene names and data in Supplementary Table 1 (Fibrosis) and Supplementary Table 2 (Adipogenesis). All data represent fold expression from one mouse per treatment group with one technical replicate.
47
Gene Symbol NPI-110 NPI-106
Acta2 Actin, alpha 2, smooth muscle, aorta -5.4 -3.7
Agt Angiotensinogen (serpin peptidase inhibitor, clade A, member 8) -1.6 -1.9
Akt1 Thymoma viral proto-oncogene 1 2.7 -1.9
Bcl2 B-cell leukemia/lymphoma 2 1.2 3.1
Bmp7 Bone morphogenetic protein 7 2.7 -1.9
Cav1 Caveolin 1, caveolae protein -1.3 -2.5
Ccl11 Chemokine (C-C motif) ligand 11 -8.6 -2.9
Ccl12 Chemokine (C-C motif) ligand 12 -21.0 -31.3
Ccl3 Chemokine (C-C motif) ligand 3 -1.6 -6.1
Ccr2 Chemokine (C-C motif) receptor 2 -3.7 -1.9
Cepbp CCAAT/enhancer binding protein (C/EBP), beta -1.4 -1.3
Col1a2 Collagen, type I, alpha 2 -5.6 -29.7
Col3a1 Collagen, type III, alpha 1 -2.6 -34.1
CTGF Connective tissue growth factor 2.6 -1.9
Cxcr4 Chemokine (C-X-C motif) receptor 4 -16.1 -10.2
Dcn Decorin -1.1 -77.2
Edn1 Endothelin 1 -1.9 -1.9
Egf Epidermal growth factor -6.6 -4.4
Eng Endoglin -2.2 -1.5
Fasl Fas ligand (TNF superfamily, member 6) -118.6 -19.4
Grem1 Gremlin 1 -1.6 -1.9
Hgf Hepatocyte growth factor -1.2 1.3
Ifng Interferon gamma -3.8 1.3
Il10 Interleukin 10 -1.6 -1.9
Il13 Interleukin 13 -10.3 -16.0
Il13ra2 Interleukin 13 receptor, alpha 2 -14.3 -6.0
Il1a Interleukin 1 alpha 1.1 2.0
Il1b Interleukin 1 beta 1.1 -1.9
Il4 Interleukin 4 -1.2 -1.9
Il5 Interleukin 5 -1.1 -1.9
Ilk Integrin linked kinase 2.6 -1.9
Inhbe Inhibin beta E -2.8 -1.9
Itga1 Integrin alpha 1 2.8 1.5
Itga2 Integrin alpha 2 1.0 -1.9
Itga3 Integrin alpha 3 -1.1 -1.9
Itgav Integrin alpha V 6.1 1.5
Itgb1 Integrin beta 1 (fibronectin receptor beta) -2.6 -16.6
Itgb3 Integrin beta 3 -1.6 -1.9
Itgb5 Integrin beta 5 -2.5 -9.4
Itgb6 Integrin beta 6 -6.2 -11.1
Itgb8 Integrin beta 8 -1.8 -2.0
Jun Jun oncogene 3.3 -1.9
Lox Lysyl oxidase 1.7 -1.9
Ltbp1 Latent transforming growth factor beta binding protein 1 1.0 1.8
Mmp13 Matrix metallopeptidase 13 -2.7 1.2
Mmp14 Matrix metallopeptidase 14 (membrane-inserted) 4.7 -1.9
48
Mmp1a Matrix metallopeptidase 1a (interstitial collagenase) 1.5 1.1
Mmp2 Matrix metallopeptidase 2 1.3 -1.3
Mmp3 Matrix metallopeptidase 3 -2.6 -2.5
Mmp8 Matrix metallopeptidase 8 -7.9 3.1
Mmp9 Matrix metallopeptidase 9 -1.9 -1.1
Myc Myelocytomatosis oncogene -196.7 -15.6
Nfkb1 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1, p105 1.3 -1.9
Pdgfa Platelet derived growth factor, alpha -1.8 -1.9
Pdgfb Platelet derived growth factor, B polypeptide -3.5 -2.6
Plat Plasminogen activator, tissue 2.1 -1.9
Plau Plasminogen activator, urokinase 1.4 -2.0
Plg Plasminogen -1.5 -1.9
Serpina1a Serine (or cysteine) peptidase inhibitor, clade A, member 1a -5.7 1.3
Serpine1 Serine (or cysteine) peptidase inhibitor, clade E, member 1 -1.3 1.0
Serpinh1 Serine (or cysteine) peptidase inhibitor, clade H, member 1 2.9 -4.1
Smad2 MAD homolog 2 (Drosophila) 2.7 5.2
Smad3 MAD homolog 3 (Drosophila) 1.8 -1.9
Smad4 MAD homolog 4 (Drosophila) 1.0 -1.9
Smad6 MAD homolog 6 (Drosophila) -1.8 -1.0
Smad7 MAD homolog 7 (Drosophila) -1.7 1.2
Snai1 Snail homolog 1 (Drosophila) -24.6 -1.9
Sp1 Trans-acting transcription factor 1 1.3 1.2
Stat1 Signal transducer and activator of transcription 1 -3.8 -67.6
Stat6 Signal transducer and activator of transcription 6 -24.6 -1.9
Tgfb1 Transforming growth factor, beta 1 2.0 -1.5
Tgfb2 Transforming growth factor, beta 2 -2.0 -1.9
Tgfb3 Transforming growth factor, beta 3 -3.6 -1.9
Tgfbr1 Transforming growth factor, beta receptor I -5.0 -3.0
Tgfbr2 Transforming growth factor, beta receptor II 2.4 -1.9
Tgif1 TGFB-induced factor homeobox 1 -6.3 -1.9
Thbs1 Thrombospondin 1 -1.2 -1.8
Thbs2 Thrombospondin 2 -5.6 -32.4
Timp1 Tissue inhibitor of metalloproteinase 1 -3.1 -7.2
Timp2 Tissue inhibitor of metalloproteinase 2 -5.7 -107.6
Timp3 Tissue inhibitor of metalloproteinase 3 6.3 -1.9
Timp4 Tissue inhibitor of metalloproteinase 4 -1.8 -1.9
Tnf Tumor necrosis factor 1.3 -1.9
Vegfa Vascular endothelial growth factor A 1.8 4.7
Supplementary Table 1. Expression of 84 fibrosis-pathway specific genes. Fold expression of 84 fibrosis-specific genes with NPI-110 or NPI-106 peptide-treatment relative to BLM-treated group. Negative numbers indicate under-expression and positive numbers indicate over-expression of specific gene. Data represents RT-PCR analysis of mRNA from one mouse per treatment group with one technical replicate.
49
Gene Full Gene Name NPI-110 NPI-106
Acacb Acetyl-Coenzyme A carboxylase beta -5.5 -15.6
Adig Adipogenin -4.1 1.2
Adipog Adiponectin, C1Q and collagen domain containing -23.8 -15.6
Adrb2 Adrenergic receptor, beta 2 -7.1 -18.8
Agt Angiotensinogen (serpin peptidase inhibitor, clade A, member 8) -16.7 -15.6
Angpt2 Angiopoietin 2 -1.4 -15.6
Axin1 Axin 1 -3.7 -2.2
Bmp2 Bone morphogenetic protein 2 -11.2 -6.3
Bmp4 Bone morphogenetic protein 4 -2.4 -2.7
Bmp7 Bone morphogenetic protein 7 -7.7 -15.6
Ccnd1 Cyclin D1 -26.5 -27.7
Cdk4 Cyclin-dependent kinase 4 -15.9 -42.2
Cdkn1a Cyclin-dependent kinase inhibitor 1A (P21) -1.1 -4.5
Cdkn1b Cyclin-dependent kinase inhibitor 1B -2.5 -15.6
Cebpa CCAAT/enhancer binding protein (C/EBP), alpha -3.4 -16.0
Cebpd CCAAT/enhancer binding protein (C/EBP), beta -6.5 -15.6
Cebpd CCAAT/enhancer binding protein (C/EBP), delta -12.9 -15.6
Cfd Complement factor D (adipsin) -18.4 -2.3
Creb1 CAMP responsive element binding protein 1 -4.5 -10.2
Ddit3 DNA-damage inducible transcript 3 -5.6 -8.1
Dio2 Deiodinase, iodothyronine, type II -4.6 -6.2
Dkk1 Dickkopf homolog 1 (Xenopus laevis) -3.8 -15.6
Dlk1 Delta-like 1 homolog (Drosophila) -68.6 -15.6
E2f1 E2F transcription factor 1 -9.6 -15.6
Egr1 Early growth response 2 -9.3 -3.8
Fabp4 Fatty acid binding protein 4, adipocyte -18.5 -3.4
Fasn Fatty acid synthase -4.4 1.0
Fgf1 Fibroblast growth factor 1 -15.5 -44.9
Fgf10 Fibroblast growth factor 10 -68.6 -13.5
Fgf2 Fibroblast growth factor 2 -4.1 -15.6
Foxc2 Forkhead box C2 -14.7 -12.5
Foxo1 Forkhead box O1 -4.7 -4.8
Gata2 GATA binding protein 2 1.4 3.7
Gata3 GATA binding protein 3 -68.6 -4.9
Hes1 Hairy and enhancer of split 1 (Drosophila) -2.5 -15.6
Insr Insulin receptor -8.3 -2.5
Inr1 Insulin receptor substrate 1 -3.0 -15.6
Inr2 Insulin receptor substrate 2 -4.1 -6.4
Jun Jun oncogene -11.4 -78.8
Klf15 Kruppel-like factor 15 -68.6 -1.7
Klf2 Kruppel-like factor 2 (lung) -68.6 -15.6
Klf3 Kruppel-like factor 3 (basic) -3.3 -15.6
Klf4 Kruppel-like factor 4 (gut) 1.6 -15.6
Lep Leptin -15.9 -4.4
Lipe Lipase, hormone sensitive -11.5 -15.6
Lmna Lamin A -2.3 -8.9
50
Lpl Lipoprotein lipase -12.1 -3.6
Lrp5 Low density lipoprotein receptor-related protein 5 -12.7 -1.2
Mapk13 Mitogen-activated protein kinase 14 -2.5 -8.3
Ncoa2 Nuclear receptor coactivator 2 -6.9 1.3
Ncor2 Nuclear receptor co-repressor 2 -40.5 -15.6
Nr0b2 Nuclear receptor subfamily 0, group B, member 2 -2.9 -15.6
Nr1h3 Nuclear receptor subfamily 1, group H, member 3 -3.4 -14.4
Nrf1 Nuclear respiratory factor 1 -2.8 -1.3
Ppara Peroxisome proliferator activated receptor alpha -7.8 -5.6
Ppard Peroxisome proliferator activator receptor delta -8.3 -15.6
Pparg Peroxisome proliferator activated receptor gamma -2.3 -2.1
Ppargc1a Peroxisome proliferative activated receptor, gamma, coactivator 1 alpha -9.5 -3.7
Ppargc1b Peroxisome proliferative activated receptor, gamma, coactivator 1 beta -2.5 -1.6
Prdm16 PR domain containing 16 -68.6 -15.6
Rb1 Retinoblastoma 1 -5.7 -6.7
Retn Resistin -27.9 -11.2
Runx1t1 Runt-related transcription factor 1; translocated to, 1 (cyclin D-related) -68.6 -15.6
Rxra Retinoid X receptor alpha -8.0 -10.3
Sfrp1 Secreted frizzled-related protein 1 -68.6 -15.6
Sfrp5 Secreted frizzled-related sequence protein 5 -48.2 -15.6
Shh Sonic hedgehog -6.6 -2.9
Sirt1 Sirtuin 1 (silent mating type information regulation 2, homolog) 1 (S.
cerevisiae) -3.5 -15.6
Sirt2 Sirtuin 2 (silent mating type information regulation 2, homolog) 2 (S.
cerevisiae) -18.6 -4.7
Sirt3 Sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S.
cerevisiae) -3.8 -3.4
Slc2a4 Solute carrier family 2 (facilitated glucose transporter), member 4 -4.4 -7.1
Src Rous sarcoma oncogene -4.6 -15.6
Srebf1 Sterol regulatory element binding transcription factor 1 -11.5 -44.0
Taz Tafazzin -6.6 -1.5
Tcf712 Transcription factor 7-like 2, T-cell specific, HMG-box -1.1 -2.1
Tsc22d3 TSC22 domain family, member 3 -5.0 -54.9
Twist1 Twist homolog 1 (Drosophila) -5.0 -15.6
ucp1 Uncoupling protein 1 (mitochondrial, proton carrier) -27.1 24.4
Vdr Vitamin D receptor -19.7 -4.9
Wnt1 Wingless-related MMTV integration site 1 -50.9 -15.6
Wnt10b Wingless related MMTV integration site 10b -4.4 -8.1
Wnt3a Wingless-related MMTV integration site 3A -68.6 -5.9
Wnt5a Wingless-related MMTV integration site 5A -3.9 -1.1
Wnt5b Wingless-related MMTV integration site 5B -55.7 -2.7
Supplementary Table 2. Expression of 84 adipogenesis-pathway specific genes. Fold expression of 84 adipogenesis-specific genes with NPI-110 or NPI-106 peptide-treatment relative to BLM-treated group. Negative numbers indicate under-expression and positive numbers indicate over-expression of specific gene. Data represents RT-PCR analysis of mRNA from one mouse per treatment group with one technical replicate.
51
The transcriptional profiles of NPI-110 and NPI-106 were analyzed using Ingenuity Pathway
Analysis (IPA) software (Qiagen Bioinformatics, Hilden, Germany). The top twelve IPA-
identified canonical pathways involved in NPI-110 and NPI-106 peptide function included the
hepatic fibrosis, colorectal cancer metastasis, rheumatoid arthritis, and Tgfb signalling pathways
(Figure 13A). The top IPA-predicted upstream regulators suggest that the peptides block signalling
from bleomycin stimulus through the inhibition of Tgfb (Figure 13B).
Although predicted to be a top IPA-inhibited upstream regulator, Tgfb1 mRNA expression was
not found to be significantly down-regulated in the profiled fibrosis genes with either peptide
treatment. This was further investigated with RT-PCR analysis, which confirmed these findings
(Figure 14). Tgfb1 mRNA expression was not significantly up-regulated in the BLM-treatment
group, and similarly, showed no significant changes with peptide treatment. Tgfb1 is stored within
the ECM as a homodimer within a latent complex and requires cleavage of the latency binding
protein before activation142. These post-translational modifications involved in activation of Tgfb1
are not reflected in changes in mRNA expression; therefore, immunohistochemical analysis of
Tgfb1 protein expression was performed to determine if changes were present in Tgfb1 protein
levels.
BLM treatment resulted in significantly increased levels of Tgfb1 protein expression in both the
dermis (p = 0.047) and dermal adipose (p = 0.001) layers. NPI-110 treatment significantly reduced
Tgfb1 expression by 67% within the dermal adipose layer (p = 0.031) and completely back to
baseline levels in the dermis (p < 0.0001) (Figure 14). Treatment with NPI-106; however, did not
decrease Tgfb1 expression in either tissue layer.
52
Figure 13. Focused pathway analysis of top affected canonical pathways and regulators with peptide NPI-110 and NPI-106 treatment. (A) Top 12 IPA-predicted affected canonical pathways. y-axis shows percent of overlapping up-regulated (green) and down-regulated (red) genes in each pathway. Yellow line indicates IPA predicted p-value of overlap. (B) Top 5 IPA-identified upstream regulators based on ranking of IPA-generated p-values of overlap.
53
Figure 14. Peptide NPI-110 and NPI-106 treatment does not affect Tgfb1 mRNA expression. RT-PCR performed on lesional skin from mice after 28 days of either BLM-treatment or BLM-treatment with peptide injections, with saline injections as control. Values represent mean and SEM from three mice per treatment group and five technical replicates. Analysis with one-way ANOVA and post-hoc LSD test. (ns, not significant).
54
Figure 15. NPI-110 but not NPI-106 reduces Tgfb1 protein levels within the dermis and dermal adipose tissue layers. (A) Paraffin-processed skin sections of mice from all four treatment groups at day 28 stained for anti-Tgfb1 antibody. Quantification of immunohistochemical staining for Tgfb1 in the dermis (B) and dermal adipose tissue (C). Values represent mean and SEM from three random measurements in three sections per mouse, 3 mice per treatment group. Analysis with one-way ANOVA and post-hoc LSD test for significance. (* p < 0.05, ** p < 0.001, *** p < 0.0001).
55
Myc was one of the most significantly down-regulated genes within the profiled fibrosis-specific
genes with NPI-110 treatment causing 196-fold inhibition in expression (Figure 12). Further
analysis of the IPA canonical colorectal metastasis pathway show involvement of c-Myc in the
Wnt/β-catenin, Erk1/2, and Tgfb1 signalling cascades. Pathway analyses predicted that c-Myc,
one of three members of the Myc family, is downregulated by peptide NPI-110 treatment, and
predicted to decrease cellular proliferation, growth, and tumor progression (Figure 16).
Thus, c-Myc was further explored as a potential downstream effector of NPI-110 and NPI-106
peptide function and its mRNA expression was confirmed with RT-PCR (Figure 17). c-Myc found
to be increased 2-fold (p = 0.03) with BLM-treatment and was significantly down-regulated with
both NPI-110 or NPI-106 treatment leading to a 14.4-fold (p < 0.0001) and 111-fold (p < 0.0001)
decrease compared to baseline, respectively. A similar trend was observed with c-Myc protein
levels. Immunohistochemical analyses demonstrate a 1.8-fold increase in c-Myc expression with
BLM-treatment (p = 0.031), and this was significantly reduced by both peptides back to baseline
(NPI-110 p = 0.013, NPI-106 p = 0.002).
56
Figure 16. Inhibition of c-Myc mRNA expression is predicted within three signalling cascades of the canonical metastatic colorectal cancer pathway. Regulatory networks within the IPA canonical metastatic colorectal cancer pathway with predicted up-regulated (green) and down-regulated (red) gene targets.
57
Figure 17. Peptide NPI-110 and NPI-106 treatment decreases c-Myc mRNA expression below baseline. RT-PCR performed on lesional skin from mice after 28 days of either BLM-treatment or BLM-treatment with peptide injections, with saline injections as control. Values represent mean and SEM from three mice per treatment group and five technical replicates. Analysis with one-way ANOVA and post-hoc LSD test. (* < 0.05, ** < 0.001, *** < 0.0001).
58
Figure 18. Peptide NPI-110 and NPI-106 treatment reduce c-Myc protein expression. (A) Paraffin-processed skin sections of mice from all four treatment groups at day 28 stained for anti-c-Myc antibody. (B) Quantification of immunohistochemical staining for c-Myc. Values represent mean and SEM from three random measurements in three sections per mouse, 4 mice per treatment group. Analysis with one-way ANOVA and post-hoc LSD test for significance. (* < 0.05, ** p < 0.001).
59
A key regulator of both these processes, Rhamm mRNA expression was first quantified in BLM-
treated skin. A stress response and signal of tissue damage, Rhamm mRNA expression was
increased 1.5-fold in the BLM treatment group compared to control (p = 0.03) (Figure 15). NPI-
110 reduced Rhamm expression back to the baseline level of control (p = 0.03) and NPI-106
treatment resulted in a further 2.8-fold reduction in expression compared to control (p = 0.003)
(Figure 15). Function-blocking peptides, NPI-110 and NPI-106, block Rhamm signalling at the
protein level by binding either to Rhamm or LMW-HA. Therefore, the reduction in Rhamm mRNA
expression is indicative of a regulatory feedback mechanism of Rhamm on its own expression.
Rhamm signalling may positively feedback to maintain its expression through downstream Erk1
targeted transcription factors, which is attenuated with peptide treatment.
60
Figure 19. Peptide NPI-110 and NPI-106 attenuate Rhamm mRNA expression. RT-PCR performed on lesional skin from mice after 28 days of either BLM-treatment or BLM-treatment with peptide injections, with saline injections as control. Values represent mean and SEM from three mice per treatment group and five technical replicates. Analysis with one-way ANOVA and post-hoc LSD test. (* p < 0.05, ** p < 0.001).
61
5 Discussion
This study investigated the effects of two function-blocking Rhamm peptides, NPI-110 and NPI-
106, in reducing dermal fibrosis and promoting dermal adipogenesis in a mouse model of systemic
sclerosis. Both peptides were able to reduce dermal thickness; however, only NPI-110 inhibited
collagen fibrillogenesis as measured by the area fraction of collagen fibrils. Neither peptide
detectably restored dermal adipose tissue, but NPI-110 treatment increased adipokine expression
with increased Perilipin mRNA and Adiponectin protein expression. Transcriptomic and pathway
analyses suggest a mechanism by which Rhamm stabilizes β-catenin, leading to downstream
activation of pro-fibrosis genes, including Erk1. Erk1 suppresses adipogenesis by inhibiting Pparγ
and through activating c-Myc, causes clonal proliferation of pre-adipocytes that do not terminally
differentiate. Erk1 also drives fibrosis through c-Myc induced proliferation of fibroblasts. The
peptides function by blocking HA-dependent Rhamm signalling and thus suppress β-catenin/Erk1
driven fibrogenesis and relieve Pparγ suppression, allowing differentiation of mature adipocytes
(Figure 20). Thus, Rhamm is hypothesized to acts as a key upstream switch that directs cell fate
decisions towards fibrosis or adipogenesis.
Collagen and ECM Biomechanics
In our study, bleomycin treatment induced dermal fibrosis with densely packed collagen fibrils, as
demonstrated by Masson’s Trichrome and Picrosirius Red staining. Dermal fibrosis can result from
altered collagen isoform synthesis, processing, or degradation. Interestingly, in BLM treated skin,
there was an increase in type 1 collagen mRNA expression, but a decrease in type 3 collagen
mRNA expression. Normal human skin is comprised of 80% type 1 collagen and 20% type 3
collagen143, and this Col1a1:Col3a1 ratio is shifted towards more type 1 collagen in stiff scars,
tissue fibrosis, and systemic sclerosis127,139,144. Type 1 collagen is comprised of two type α1(I)
chains and one α2 chain in tightly packed fibrils that are cross-linked to form an insoluble matrix
providing tensile strength and stability145. Type 3 collagen is comprised of three α1(III) chains and
is randomly dispersed as fine loosely packed fibres that provide pliability to tissues145,146. Peptide
NPI-110 treatment decreased dermal fibrosis as measured by dermal thickness, area fraction, and
collagen density. This effect appears to be primarily due to a decrease in Col1a1 expression and
62
an increase in Col3a1 expression. In contrast, although NPI-106 treatment decreased dermal
thickness, it did not improve other measures of fibrosis. Furthermore, although NPI-106 decreased
Col1a1 expression, it also decreased Col3a1 expression. However, both peptides strongly reduced
the Col1a1:Col3a1 ratio indicating that type 1 collagen synthesis was more strongly blocked then
type 3 collagen. A reduction in Col1a1:Col3a1 ratio is commonly used as an indictor of reduced
tissue fibrosis. By these criteria, both peptides NPI-110 and NPI-106 are anti-fibrotic, and at least
one mechanism for this property is blockage of collagen 1 synthesis.
This conclusion is consistent with previous reports of SSc patient serum and fibroblasts, noting an
increase in Col1a1:Col3a1 ratio147–149. Given this, there must be a greater increase in the
accumulation of type 1 collagens within diseased dermis for the ratio of Col1a1:Col3a1 to be
increased. However, within the present study the temporal relationship between type 1 and 3
collagen changes are uncertain in that our results represent only one snapshot of mRNA
expression. For example, the expression of type 3 collagen may have already peaked prior to day
28, and given the single experimental time-point in these experiments, this trend may have been
missed.
Tissue characteristics and pliability are determined not only by collagen type but also the amount
and type of cross-links. SSc fibroblasts deposit a collagen matrix with dihyroxyl lysine-norleucine
(DHLNL) cross-links, which are typically only found in collagen of normal cartilage or bone.
These strongly increase stiffness of the ECM127,150. Fibroblast morphology and behaviour is
affected by ECM stiffness and the mechanical forces generated through the tissue. Mechanical
tension placed onto fibroblasts induces the increased production of more ECM products and also
causes activation of latent Tgfb1 within the ECM151. Mechanical stiffness affects lineage
commitment in mesenchymal stem cells (MSC) and inhibits adipogenesis. Mouse pre-adipocytes
embedded in stiffer matrices demonstrate higher concentration of type 1 collagen and reduced
terminal differentiation into adipocytes152. Similarly, a stiff microenvironment inhibits adipogenic
differentiation of MSCs by increasing Wnt activation and nuclear β-catenin accumulation153.
Peptide NPI-110 treatment resulted in increased adiponectin protein and perilipin mRNA
expression levels compared to BLM treatment alone. Adiponectin is only produced by pre-
adipocytes or adipocytes, and this supports the hypothesis that peptide treatment may create a more
favourable tissue microenvironment that is conducive to adipogenesis.
63
Differential Effects of NPI-110 and NPI-106
Two RHAMM function-blocking peptides NPI-110 and NPI-106 were tested for their ability to
restore normal tissue homeostasis, decrease collagen fibrillogenesis, and promote an adipogenic
microenvironment. NPI-110 is thought to bind directly to the RHAMM receptor to block its HA-
binding functions. These function blocking properties reduced dermal thickness and area fraction
and restored normal skin Col1a1:Col3a1 ratio. NPI-106, which sequesters HA fragments away
from binding to RHAMM or other HA receptors, reduced dermal thickness and led to decreased
Col1a1:Col3a1 ratio even below baseline. Neither peptide visually restored dermal adipose tissue
thickness, although NPI-110 treatment increased adipokine levels. Both peptides strongly blocked
expression of Rhamm mRNA, and thus affected Rhamm function via different mechanisms.
The differential effects of the two peptides may be explained by their different mechanisms of
blocking Rhamm signalling. LMH-HA fragments range from several disaccharides up to 500kDa
and fragment size affects binding affinity with receptors86,154. Fragmentation of HMW-HA during
tissue inflammation produces a large variety of fragment sizes. NPI-106 binds to HA, sequestering
it from Rhamm, but likely binds preferentially to a certain range of LMW-HA fragments.
Fragments outside of the NPI-106 binding range will still be able to signal through Rhamm,
leading to incomplete blockade of downstream effects, such as decreased in fibrogenic responses
and minimal promotion of adipogenesis. As well, there are other HA receptors such as TLR2,4,
which are not blocked, that can still bind to HA fragments90,97,155. In contrast, NPI-110, binds
directly to Rhamm preventing fragments of any size from signalling and likely more specifically
blocks Rhamm signaling function.
NPI-110 was modified based on a previous peptide, NPI-102, and acetylated to increase its serum
half-life. Injections of NPI-110 may produce longer-lasting effects compared to NPI-106, which
may require more frequently injections to produce the same effects.
RHAMM as a Regulatory Switch Between Fibrosis and Adipogenesis
Tgfb1 is a key driver of aberrant fibroblast activation and has been implicated in many fibrotic
diseases30,40,156. Tgfb1 not only promotes resident myofibroblast differentiation and ECM
production, but is also involved in expanding the population of activated fibroblasts through trans-
64
differentiation of other cell types into myofibroblast-like cells35,38,40. Most importantly, Tgfb1
induces transcriptional reprogramming of adipocytes into activated myofibroblasts39.
IPA analyses highlighted Tgfb1as one of the top affected canonical pathways and one of the top
inhibited upstream regulators with peptide treatment (Figure 13). RT-PCR analyses show no
differences in Tgfb1 mRNA expression among the four treatment groups (Figure 14), which is
unsurprising since Tgfb1 exists within the extracellular matrix in a bound latent form. Tgfb1 is
released from this latent complex through conformational changes induced by binding cell-surface
integrins26. Consistent with the induction of dermal fibrosis, Tgfb1 protein expression was
increased with BLM-treatment in both the dermis and dermal adipose tissues (Figure 15). This
effect was ameliorated with NPI-110 treatment, but not with NPI-106.
Transcriptomic analysis of NPI-110 and NPI-106-treated skin was performed to identify the
molecular mechanisms involved in Rhamm signalling. All members of the Wnt family assayed in
the adipogenesis-specific pathway gene panel were potently suppressed with peptide treatment.
NPI-110 caused a 50.9-fold reduction in Wnt1 and a 4.4-fold reduction in Wnt10b, both of which
are strongly expressed in fibrotic skin of SSc patients and in multiple other fibrotic diseases157.
Wnt signalling induces fibroblast activation and release of ECM components. The Wnt proteins
are secreted ligands that bind to the cell surface receptor Frizzled and induce intracellular
signalling events leading to the stabilization and nuclear translocation of β-catenin (canonical
pathway)157. Wnt signalling is tightly regulated by multiple suppressors, including Dickkopf
(Dkk). Tgfb1 activates the canonical Wnt pathway by inhibiting Dkk, and thus releases Wnt from
Dkk suppression. Furthermore, inhibition of Wnt signalling ameliorated Tgfb1-induced fibrosis in
cell culture and animal experiments, demonstrating that Wnt is required for Tgfb1-mediated
fibrosis62,157. In a seemingly contradictory study, Wei et al found that transgenic mice expressing
Wnt-10b ectopically in white and brown adipose tissue demonstrated Tgfb1-independent dermal
fibrosis and subcutaneous lipoatrophy 64. This can be explained by Tgfb1 being upstream of Wnt
signalling. A transgenic mouse construct that ectopically expresses Wnt would not require Tgfb1
to relieve Dkk inhibition and therefore, appear to function in a Tgfb1-independent manner. Other
studies describe the relationship between Tgfb1 and Wnt as reciprocal or interactive with multiple
levels of cross-talk between downstream components. For example, Axin and β-catenin, both
65
downstream targets of Wnt can regulate the stability of Smad3, a signal transducer of the Tgf1
pathway158,159.
β-catenin mediates the effects of Tgfb1 induced fibroblast proliferation in wound repair and is
especially important in promoting fibroblast motility160–163. β-catenin levels are elevated during
the proliferative phase of wound healing, and transgenic mice with aberrant β-catenin expression
in mesenchymal cells developed locally aggressive fibromatoses and exhibit hyperplastic
wounding responses164. In HT1080 fibrosarcoma cells, immunoprecipitation experiments
demonstrate formation of intracellular Rhamm, Erk1 and β-catenin complexes, hypothesized to
protect β-catenin from degradation during nuclear translocation165. In this study, levels of
cytoplasmic β-catenin were positively regulated by Rhamm and lead to increased proliferation.
This effect was abrogated with Rhamm knock down and by inhibition of Erk1, which binds directly
to intracellular Rhamm165. This is further supported by other studies demonstrating a positive
interaction between HA signalling and Wnt/β-catenin activation. HA treatment of human amniotic
mesenchymal stem cells increased expression of Wnt1, Wnt3a, Wnt8a, and nuclear localization of
β-catenin, leading to increased cellular proliferation166. Furthermore, genetic deletion of Rhamm
in mice showed less aggressive fibromatosis tumour formation, providing further evidence that
Rhamm is required for β-catenin induced cellular proliferation and motility167.
β-catenin expression was not directly assayed in our transcriptomic analysis; however, Myc, a
downstream target of β-catenin168, was down-regulated by both NPI-110 and NPI-106 treatment
in the fibrosis gene-specific panel. A well-established downstream target of β-catenin, c-Myc is
one of three members of the Myc family of proto-oncogenes (c-Myc, n-Myc, and l-Myc) involved
in a broad range of cellular functions including cell-cycle progression, and cellular proliferation
and differentiation169. c-Myc dysregulation is implicated in more than 50% of human cancers and
is a ‘super-transcription’ factor regulating transcription of more than 15% of the genome169,170.
IPA analysis predicted c-Myc to be inhibited within the Wnt/β-catenin, Tgfb1, and Erk1/2
signalling cascades in the canonical metastatic colorectal cancer pathway (Figure 16).
Confirmation with RT-PCR demonstrated a 2-fold increase in c-Myc with BLM-treatment, which
was potently suppressed by both NPI-110 and NPI-106 treatment. Immunohistochemistry also
confirm these trends at the protein level. HA treatment of quiescent NIH/3T3 cells induced
accumulation of c-Myc protein stimulated cellular proliferation171, further suggesting that HA and
66
HA receptors, such as Rhamm, are involved in β-catenin signalling of c-Myc. Sears et al. showed
that the MAP kinases, Erk1,2, phosphorylate c-Myc at serine residue 62 and extends the half-life
and cellular accumulation of c-Myc172,173.
Numerous studies indicate that Erk1,2 is downstream of β-catenin and affects cellular proliferation
and fibroblast contractility26. Erk1,2 complexes with CD44 and Rhamm and is implicated in
HA/Rhamm-mediated HT1080 fibrosarcoma proliferation165,174 The abnormal cellular
proliferation in melanoma cells is also related to abnormal Erk1 activity, which was shown to be
suppressed with β-catenin inhibition. Furthermore, the Tgfb1 activation of human lung fibroblasts
to myofibroblasts was dependent nuclear β-catenin translocation and Erk1,2 activation175. Lastly,
Erk1 maintains clonal proliferation of pre-adipocytes105,106, likely through phosphorylation and
activation of c-Myc. Activation of c-Myc leads to mitotic clonal expansion of 3T3-L1 pre-
adipocytes in culture eventually leading to dysfunctional and small adipocytes176. Sirtuin 1 inhibits
c-Myc through deacetylation and results in the return of normal functional adipocytes176.
HA signalling initiated through cell-surface Rhamm leads to the upregulation of intracellular
Rhamm, through a positive feedback mechanism (Figure 19). BLM treatments led to only a 1.5-
fold increase in Rhamm mRNA expression, which may be explained by the critical role of Rhamm
as a regulator of cell cycle progression and mitotic spindle orientation and orientation177,178.
Rhamm overexpression under a strong cytomegalovirus promoter results in cellular apoptosis179.
Function-blocking Rhamm peptides NPI-110 and NPI-106 blocked Rhamm signalling at the
protein level but also led to a reduction in Rhamm mRNA expression, pointing towards feedback
control of Rhamm protein upon its own expression.
We propose a model where intracellular Rhamm binds to β-catenin and Erk1 forming a complex
that both stabilizes β-catenin and facilitates its nuclear translocation, leading to downstream
fibroblast activation and differentiation into myofibroblasts. The Rhamm-β-catenin complex also
sustains activation of the MAP kinase, Erk. In the nucleus, Erk1 then phosphorylates c-Myc
leading to the mitotic clonal expansion of pre-adipocytes. Erk1 also inhibits Ppary which prevents
this expanded pre-adipocyte population from its terminal differentiation into mature adipocytes.
In this way, HA-dependent Rhamm signalling leads to fibrosis and inhibits adipogenesis (Figure
20A).
67
Rhamm function-blocking peptides, NPI-110 and NPI-106, inhibit Rhamm signalling and
downregulates Rhamm expression. This leads to down-regulation of β-catenin, Erk1, and c-Myc
expression and activity. In this way, the peptides prevent aberrant fibroblast activation and
differentiation into myofibroblasts and promote the differentiation of pre-adipocytes. Ppary has
been reported to suppress Tgfb142,156 and Wnt/β-catenin180,181 expression, further decreasing
fibrotic signalling. Ppary blocks phosphorylation and activation of Erk1, demonstrating
reciprocally antagonistic regulatory mechanisms between Ppary and Erk1 signaling182. Here, we
predict that Tgfb1, Wnt/β-catenin, and ERK1 act along the same signalling pathway to control
fibrosis and adipogenesis, so Ppary may have multiple points of inhibitory action. The release of
Erk1 inhibition of Ppary allows terminal differentiation of preadipocytes into mature adipocytes.
Under the control of Ppary, adipocytes then release adiponectin, a 30 kD adipokine demonstrated
to have anti-fibrotic effects61,183. mRNA expression of both adiponectin and the adiponectin
receptors AdipoR1 and AdipoR2 are reduced in primary SSc fibroblasts61. The function-blocking
Rhamm peptides relieve Ppary suppression from Erk1, leading to increased adiponectin
production. Together with adiponectin, Ppary suppresses Tgfb1 and Wnt/β-catenin induced
fibrosis. Thus, Rhamm function-blocking peptides present a potentially novel method of switching
the rigid fibrotic cellular program towards adipogenesis (Figure 20B).
68
Figure 20. RHAMM acts as a molecular switch between fibrosis and adipogenesis. A) LMW-HA binds cell-surface Rhamm and upregulates intracellular Rhamm through feedback mechanisms, which stabilizes β-catenin. This leads to activation of Erk1 which induces fibrosis through c-Myc. Erk1 also inhibits Ppary and prevents a clonally expanded population of pre-adipocytes from differentiation into mature adipocytes. B) Function-blocking Rhamm peptides bind to either LMW-HA or to cell-surface Rhamm which downregulates intracellular Rhamm. This reduces fibrosis by preventing activation of Erk1 and c-Myc. Ppary is no longer inhibited by Erk1 and is able to induce terminal differentiation of pre-adipocytes, leading to an increase in adipogenesis.
69
Regeneration of Adipocytes
In SSc, the trans-differentiation of adipocytes into fibroblasts contributes to the loss of dermal
adipose tissue41. This phenotypic plasticity between adipocytes and fibroblasts can be targeted as
a method for reversing fibrosis. Maksin et al. demonstrated that adipocytes also regenerate from
myofibroblasts during wound healing in mice, and that human keloid fibroblasts can trans-
differentiate into adipocytes184. Both transformations are dependent on bone morphogenic protein
(Bmp) signalling.
Bmp is a growth factor and member of the Tgfb superfamily that directs adipogenic
commitment185,186. The Wnt1 inducible signaling pathway protein 2 (WISP2) binds to and inhibits
zinc finger protein 423 (Zfp423), which is a transcriptional activator of Ppary. This prevents Ppary
activation. BMP4 dissociates the WISP2-Zfp423 complex, allowing Zfp423 to translocate into the
nucleus and activate PPARy185. Zfp423 is critical to myofibroblast-adipocyte trans-differentiation,
as Zfp423 mutant mice are unable to regenerate adipocytes184. Rhamm function-blocking peptides
decrease Wnt signalling and thus may either facilitate, or contribute directly to, myofibroblast
reversion to adipocytes. Reverting myofibroblasts into adipocytes is a potential method to directly
reverse the underlying pathophysiology of SSc and an exciting potential novel therapeutic option
in SSc treatment. Future experiments to delineate the interaction between Bmp and Rhamm will
help to elucidate this connection.
Peptide Adjuncts to Autologous Lipotransfer
In addition to directly ameliorating fibrosis by targeting fibroblast activation, the Rhamm function-
blocking peptides increased adipokine expression and are hypothesized to create a pro-adipogenic
environment, which not only contributes to dampening fibrosis but also presents a useful adjunct
for enhancing the efficacy of autologous lipotransfer therapies. Autologous lipotransfer has
recently emerged as a potential treatment option for cutaneous fibrosis187–190. Elective lipotransfer
is safe, well-tolerated, and a commonly performed procedure in plastic surgery with minimal
complications189,191,192. Lipotransfer therapy directly addresses the loss of dermal adipose tissue,
helps with soft tissue filling, and increases the pliability of the skin. However, the unpredictable
patient to patient variability in graft retention remains an important clinical problem.
70
The lipoaspirate contains adipose-derived stem cell (ADSC) populations, which have intrinsic
regenerative and anti-fibrotic properties. ADSCs retain developmental plasticity and can undergo
self-renewal193. Lipotransfer studies in animal models of fibrosis show decreased dermal thickness
and Tgfb1 suppression with ADSC injections194–196. Early experience with the treatment of SSc
patients with oro-facial fibrosis demonstrated restoration of facial lipoatrophy, increased oral
perimeter, improved mouth opening, and decreased pain scores187,197. Similar results were seen in
twelve SSc patients undergoing ADSC injections to the hands198. The effects of a one-time
treatment improved hand functioning, hand pain, and decreased the incidence of digital ulcers,
which was sustained at one-year follow-up198.
Inherent difficulties with lipotransfer procedures include predicting the amount of fat retention and
issues with fat necrosis, as not all transferred fat survive in the grafted areas. This remains a key
limitation requiring further investigation and optimization. Function-blocking Rhamm peptides
should be further explored as a potential adjunct to lipotransfer therapy to improve fat retention.
Clinical Translation Function-blocking Rhamm peptides present a potentially novel method of reversing cutaneous
fibrosis in systemic sclerosis. Recent studies have highlighted the dynamic and reversible nature
of fibrosis in the liver, heart, kidney and lungs, with the potential for almost complete restitution
of normal tissue architecture199–201. In animal models of liver and lung fibrosis, the cessation of
fibrogenic cytokine signalling leads to the depletion of macrophages, myofibroblast senescence
and apoptosis, and degradation of the extracellular matrix201,202. This is further supported in human
diseases with liver biopsy histology specimens showing resolution of fibrosis in patients
successfully treated for hepatitis C infection199. Cutaneous fibrosis, in animal models of BLM
induced fibrosis, was fully reversed 6 weeks after the cessation of subcutaneous injections203.
Thus, a longer duration of peptide treatment may demonstrate even further reduction of fibrosis.
The future development of peptides amenable to topical application would preclude the discomfort
of repeated subcutaneous injections.
71
Limitations and Future Directions
Limitations of this study include the technical aspects of standardizing BLM injections. BLM was
injected subcutaneously into the dorsal back skin of mice. This area was shaved prior to injections
but the location of injection was estimated within this area and not precisely standardized. The
BLM-induced SSc mouse model exhibits localized cutaneous fibrosis around the area of injection
but not at distant sites123. The effect size of BLM injection sites is unknown and there may be a
gradient effect proportional to distance away from injection site. Skin biopsies were taken in the
same region of injections but standardized exactly over the injection point. Future experiments
should include tattooing four points to delineate a 1cm x 1cm square region marking the injection
and skin biopsy site to ensure accurate and standardized tissue sampling. Tattooing directly over
the point of injection could lead to aberrant pigment and potential inflammatory effects.
Furthermore, instead of normal saline injections in the control group, a better control would be the
use of a control peptide in which the key amino acids required for binding to Rhamm (NPI-110)
or HA (NPI-106) are mutated leading to a non-functional peptide. Logistical limitations also
precluded the testing of multiple peptide concentrations and dosing regimens. Both require further
optimization within the BLM-induced SSc mouse model.
In our study, peptide treatments did not lead to a measurable difference in dermal adipose tissue
but did increase adiponectin protein and perilipin mRNA expression. Measurement of dermal
adipose tissue thickness using histology sections is an imprecise measure of adipogenesis. Small
detected differences on a two-dimensional slide may be representative of larger overall volumetric
changes. Three-dimensional volumetric analysis of adipose tissue with high frequency ultrasound
and whole animal micro-CT have been described and represent more accurate methods of
quantifying changes in adipose tissue107,122. Future experiments including measurement of serum
adiponectin and collagen tripeptides will further characterize the systemic effect of peptide
injections. Mice were sacrificed on day 28 and a longer observational and treatment period may
also have been required to detect the restoration of dermal adipose architecture.
A further limitation is the examination of lesional skin at only one time-point, on day 28.
Examination of fibrosis and adipogenic markers at earlier and later time-points may help to
elucidate the effects of peptide treatment on early inflammatory markers and to evaluate ongoing
adipogenic changes. This would also provide more information on whether type 3 collagen peaks
72
earlier in the development of BLM-induced fibrosis compared to type 1 collagen. Our study
demonstrated a decrease in type 3 collagen by day 28 which may represent a true reduction or the
downward trend after an earlier peak in expression. Future experiments with peptide injections for
a longer duration would provide more information on whether Rhamm peptide injection leads to
the eventual return of dermal adipose architecture and fully reverses dermal thickening. Peptide
treatments resulted in a 6% decrease in dermal thickness and this effect may show further
improvement with prolonged treatments. Experiments including additional controls of peptide
only injection in the absence of BLM will help to determine the effect of peptide injection in
healthy tissue and to ensure that the observed effects are specific. Future studies will include
pathway analysis to confirm the involvement of β-catenin, Erk1, and c-Myc through Western blot
and co-immunoprecipitation experiments. First, β-catenin RT-PCR and immunohistochemical
analysis will confirm whether β-catenin is overexpressed and drives BLM-induced SSc. β-catenin
mRNA and protein expression should be reduced with peptide treatment. Next co-
immunoprecipitation experiments will identify the β-catenin-Rhamm complex, which should be
dissociated with the application of Rhamm function-blocking peptides. To determine if the
peptides function through the regulation of β-catenin, both gain of function and loss of function β-
catenin mouse models will be tested. Constitutively activated β-catenin activity can be induced
using a Cre-lox mouse with fibroblast specific deletion of exon 3 of β-catenin204, which contains
its degradation site. In this mouse, constitutively active β-catenin should induce dermal fibrosis
and loss of dermal adipose tissue regardless of Rhamm peptide treatment. Conversely, fibroblast
specific deletion of β-catenin using the Ctnnb1fl/fl mouse (deletion of introns 1 and 6 of β-catenin
gene)204 should be resistant to BLM-induced SSc and dermal fibrosis. In both of these models,
mRNA and protein expression of c-Myc, Erk1, and Ppary will be assayed. Together, these
experiments will elucidate the mechanism by which Rhamm controls fibrosis and adipogenesis
and provide a more thorough understanding of peptide function.
73
6 Conclusions
In a mouse model of BLM-induced systemic sclerosis, Rhamm function-blocking peptides reduce
dermal fibrosis and increase adipokine expression. Transcriptomic analyses suggest a pathway
where Rhamm function-blocking peptides lead to the down-regulation of β-catenin, Erk1, and c-
Myc signalling, which decreases fibroblast activation and promotes terminal adipocyte
differentiation. These results support future applications of Rhamm peptides as a primary
therapeutic agent for the treatment of cutaneous fibrosis in systemic sclerosis.
74
7 References
1. Denton CP, Khanna D. Systemic sclerosis. Lancet. 2017;390(10103):1685-1699.
2. Denton CP. Advances in pathogenesis and treatment of systemic sclerosis. Clin Med (Lond). 2016;16(1):55-60.
3. Rossi D, Zanatta E, Marson P, Sciascia S, Polito P, Roccatello D, Cozzi F. How I treat patients with systemic sclerosis in clinical practice. Autoimmun Rev. 2017;16(10):1024-1028.
4. Shapira Y, Agmon-Levin N, Shoenfeld Y. Geoepidemiology of autoimmune rheumatic diseases. Nat Rev Rheumatol. 2010;6(8):468-476.
5. Mayes M, Lacey JV, Beebe-Dimmer J, Gillespie BW, Cooper B, Laing TJ, Schottenfeld D. Prevalence, incidence, survival, and disease characteristics of systemic sclerosis in a large US population. Arthritis Rheumatol. 2003;48(8):2246-2255.
6. Domsic R, Nihtyanova S, Wisniewski S, Fine MJ, Lucas M, Kwoh CK, Denton CP, Medsger TA Jr. Derivation and valiation of a prediction rule for two-year mortality in early diffuse cutaneous systemic sclerosis. Arthritis Rheumatol. 2014;66:1616-1624.
7. Rongioletti F, Kaiser F, Cinotti E, Metze D, Battistella M, Calzavara-Pinton PG, Damevska K, girolomoni G, Andre J, Perrot JL, Kempf W, Cavelier-Balloy B. Scleredema. A multicentre study of characteristics, comorbidities, course, and therapy in 44 patients. J Eur Acad Dermatol Venereol. 2015;29:2399-2404.
8. Sumpton D, Thakkar V, O’Neill S, Singh-Grewal D, Craig JC, Tong A. “It’s Not Me, It’s Not Really Me.” Insights From Patients on Living With Systemic Sclerosis: An Interview Study. Arthritis Care Res (Hoboken). 2017;69(11):1733-1742.
9. Nakayama A, Tunnicliffe DJ, Thakkar V, Singh-Grewal D, O'Neill S, Craig JC, Tong A. Patients Perspectives and Experiences Living with Systemic Sclerosis: A Systematic Review and Thematic Synthesis of Qualitative Studies. J Rheumatol. 2016;43(7):1363-1375.
10. Haythornthwaite J, Heinberg LJ, McGuire L. Psychologic factors in scleroderma. Rheum Dis Clin North Am. 2003;29(2):427-439.
11. Leon L, Abasolo L, Redondo M, Perez-Nieto MA, Rodriguez-Rodriguez L, Casado MI, Curbelo R, Jover JA. Negative affect in systemic sclerosis. Rheumatol Int. 2014;34(5):597-604.
12. Thombs B, Taillefer S, Hudson M, Baron M. Depression in patients with systemic sclerosis: a systematic review of the evidence. Arthritis Rheumatol. 2007;57(6):1089-1097.
13. Fett N. Scleroderma: nomenclature , etiology , pathogenesis , prognosis , and treatments: facts and controversies. Clin Dermatol. 2013;31(4):432-437.
14. Fett N. Werth VP. Update on morphea: part I. Epidemiology, clinical presentation, and pathogenesis. J Am Acad Dermatology. 2012;64(2):217-228.
75
15. Diab S, Dostrovsky N, Hudson M, Tatibouet S, Fritzler MJ, Baron M, Khalidi N, Canadian Scleroderma Research Group. Systemic sclerosis sine scleroderma: a multicentre study of 1417 subjects. J Rheumatol. 2014;41(11):2179-2185.
16. Laing T, Gillespie BW, Toth MB, Mayes MD, Gallavan RH Jr, Burns CJ, Johanns JR, Cooper BC, Keroack BJ, Wasko MC, Lacey JV Jr, Schottenfeld D. Racial differences in scleroderma among women in Michigan. Arthritis Rheumatol. 1997;40:734-742.
17. Valesini G, Litta A, Bonavita MS, Luan FL, Purpura M, Mariani M, Balsano F. Geographical clustering of scleroderma in a rural area in the province of Rome. Clin Exp Rheumatol. 1993;11(1):41-47.
18. Zhou X, Tan FK, Xiong M, Arnett FC, Feghali-bostwick CA. Monozygotic twins clinically discordant for scleroderma show concordance for fibroblast gene expression profiles. Arthritis Rheum. 2005;52(10):3305-3314.
19. Feghali-Bostwick C, Medsger TA Jr, Wright TM. Analysis of Systemic Sclerosis in twins reveals low concordance for disease and high concordance for the presence of antinuclear antibodies. Arthritis Rheum. 2003;48(7):1956-1963.
20. Dospinescu P, Jones GT, Basu N. Environmental risk factors in systemic sclerosis. Curr Opin Rheumatol. 2013:179-183.
21. Spalek M, Jonska-Gmyrek J, Gałecki J. Radiation-induced morphea - a literature review. J Eur Acad Dermatology Venereol. 2015;29(2):197-202.
22. Ferreli C, Gasparini G, Parodi A, Cozzani E, Rongioletti F, Atzori L. Cutaneous manifestations of scleroderma and scleroderma-like disorders: a comprehensive review. Clin Rev Allergy Immunol. 2017;53(3):306-336.
23. Ho YY, Lagares D, Tager AM, Kapoor M. Fibrosis - A lethal component of systemic sclerosis. Nat Rev Rheumatol. 2014;10(7):390-402.
24. Fleming JN, Shulman HM, Nash RA, Johnson PY, Wright TN, Gown A, Schwartz SM. Cutaneous chronic graft-versus-host disease does not have the abnormal endothelial phenotype or vascular rarefaction characteristic of systemic sclerosis. PLoS One 2009;4(7).
25. Cui N, Hu M, Khalil RA. Biochemical and biological attributes of matrix metalloproteinases. Prog Mol Biol Trans Sci. 2017; 147:1-73.
26. Bhattacharyya S, Wei J, Varga J. Understanding fibrosis in systemic sclerosis: shifting paradigms, emerging opportunities. Nat Rev Rheumatol. 2011;8(1):42-54.
27. Gilbane AJ, Denton CP, Holmes AM. Scleroderma pathogenesis: a pivotal role for fibroblasts as effector cells. Arthritis Res Ther. 2013;15(3):215.
28. Biobe GC, Schiemann WP, Lodish HF. Role of transforming growth factor beta in human disease. N Engl J Med. 2000;342(18):1350-1358.
29. Varga J, Pasche B. Transforming growth factor beta as a therapeutic target in systemic sclerosis. Nat Rev Rheumatol. 2009;5(4):200-206.
76
30. Ihn H. Pathogenesis of fibrosis: role for TGF-beta and CTGF. Curr Opin Rheumatol. 2002;14(6):681-685.
31. Kawakami T, Ihn H, Xu W, Smith E, Leroy C, Trojanowska M. Increased expression of TGF-beta receptors by scleroderma fibroblasts: evidence for contribution of autocrine TGF-beta signaling to scleroderma phenotype. J Invest Dermatol. 1998;110(1):47-51.
32. Ebmeier S, Horsley V. Origin of fibrosing cells in systemic sclerosis. Curr Opin Rheumatol. 2015;27(6):555-562.
33. McCoy SS, Reed TJ, Berthier CC, Tsou PS, Liu J, Gudjonsson JE, Khanna D, Kahlenberg JM. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta. Rheumatology (Oxford). 2017;56(11):1970-1981.
34. Thiery JP, Sleeman JP. Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol. 2006;7(2):131-142.
35. Hashimoto N, Phan SH, Imaizumi K, Matsuo M, Nakashima H, Kawabe T, Shimokata K, Hasegawa Y. Endothelial-mesenchymal transition in bleomycin induced pulmonary fibrosis. Am J Respir Cell Mol Biol. 2010; 43(2):161-172.
36. Rajkumar VS, Howell K, Csiszar K, Denton CP, Black CM, Abraham DJ. Shared epxression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis. Arthritis Res Ther. 2005;7(5):1113-1123.
37. Cheshey J, Bucala R. Peripheral blood fibrocytes: novel fibroblast-like cells that present antigen and mediate tissue repair. Biochem Soc Trans. 1997;25(2):520-524.
38. Onuora S. Connective tissue disease: Adipocyte-myofibroblast transition: linking intradermal fat loss to skin fibrosis in SSc. Nat Rev Rheumatol. 2015;11(2):63.
39. Marangoni RG, Korman BD, Wei J, Wood TA, Graham LV, Whitfield ML, Scherer PE, Tourtellotte WG, Varga J. Myofibroblasts in murine cutaneous fibrosis originate from adiponectin-positive intradermal progenitors. Arthritis Rheumatol. 2015;67(4):1062-1073.
40. Willis B, Borok Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Phyiol Lung Cell Mol Physiol. 2007;293(3):L525-534.
41. Marangoni RG, Lu TT. The roles of dermal white adipose tissue loss in scleroderma skin fibrosis. Curr Opin Rheumatol. 2017;29(6):585-590.
42. Wu M, Melichian DS, Chang E, Warner-Blankenship M, Ghosh AK, Varga J. Rosiglitazone abrogates bleomycin-induced scleroderma and blocks profibrotic responses through peroxisome proliferator-activated receptor-gamma. Am J Pathol. 2009;174(2):519-533.
43. Fleischmajer R, Damiano V, Nedwich A. Scleroderma and the subcutaneous tissue. Science. 1971;171(3975):1019-1021.
44. Ohgo S, Hasegawa S, Hasebe Y, Mizutani H, Nakata S, Akamatsu H. Bleomycin inhibits adipogenesis and accelerates fibrosis in the subcutaneous adipose layer through TGF-β1. Exp Dermatol. 2013;22(11):769-771.
77
45. Driskell RR, Jahoda CA, Chuong CM, Watt FM, Horsley V. Defining dermal adipose tissue. Exp Dermatol. 2014;23(9):629-631.
46. Walker GE, Verti B, Marzullo P, Savia G, Mencarelli M, Zurleni F, Liuzzi A, Di Blasio AM. Deep subcutaneous adipose tissue: a distinct abdominal adipose depot. Obesity (Silver Spring). 2007;15(8):1933-1942.
47. Chang HY, Chi J, Dudoit S, Bondre C, van de Rijn M, Botstein D, Brown PO. Diversity, topographic differentiation, and positional memory in human fibroblasts. Proc Natl Acad Sci USA 2002;99(20):12877-12882.
48. Wei J, Bhattacharyya S, Varga J. Peroxisome proliferator-activated receptor γ: innate protection from excessive fibrogenesis and potential therapeutic target in systemic sclerosis. Curr Opin Rheumatol. 2010;22(6):671-676.
49. Lehrke M, Lazar M. The many faces of PPARgamma. Cell. 2015;123(6):993-999.
50. Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, Mortenson RM. PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol Cell. 1999;4(4):611-617.
51. Wei J, Ghosh AK, Sargent JL, Komura K, Wu M, Huang QQ, Jain M, Whitfield ML, Feghali-Bostwick C, Varga J. PPARγ downregulation by TGFβ in fibroblast and impaired expression and function in systemic sclerosis: a novel mechanism for progressive fibrogenesis. PLoS One. 2010; 5(11):e13778.
52. Lee R, Reese C, Carmen-Lopez G, Perry B, Bonner M, Zemskova M, Wilson CL, Helke KL, Silver RM, Hoffman S, Tourkina E. Deficient adipogenesis of scleroderma patient and healthy African American monocytes. Front Pharmacol. 2017;8:174.
53. Burgess H, Daughterty LE, Thatcher TH, Lakatos HF, Ray DM, Redonnet M, Phipps RP, Sime PJ. PPARgamma agonists inhibit TGF-beta induced pulmonary myofibroblast differentiation and collagen production: implications for therapy of lung fibrosis. Am J Physiol Lung Cell Mol Physiol. 2005;288(6):L1146-1153.
54. Ghosh AK, Bhattacharyya S, Lakos G, Chen S, Mori Y, Varga J. Disruption of transforming growth factor beta signaling and profibrotic responses in normal skin fibroblasts by peroxisome proliferator-activated receptor gamma. Arthritis Rheum. 2004; 50(4):1305-1318.
55. Tan X, Dagher H, Hutton C, Bourke J. Effects of PPAR gamma ligands of TGF-beta1-induced epithelial-mesenchymal transition in alveolar epithelial cells. Respir Res. 2010;11:21.
56. Shi-Wen X, Eastwood M, Stratton R, Denton CP, Leask A, Abraham DJ. Rosiglitazone alleviates the persistent fibrotic phneotype of lesional skin scleroderma fibroblasts. Rheumatol (Oxford). 2010;49(2):259-263.
57. Arakwa H, Jinnin M, Muchemwa FC, Makino K, Sakai K, Fukushima S. Adiponectin expression is decreased in involved skin and sera of diffuse cutaneous scleroderma patients. Exp Dermatol. 2011;20(9):764-766.
78
58. Masui Y, Asano Y, Shibata S, Aozasa N, Akamata K, Yamada D, Tamaki Z, Tada Y, Sugaya M, Sato S, Kadono T. Serum adiponectin levels inversely correlate with activity of progressive skin sclerosis in patients with diffuse cutaneous systemic sclerosis. J Eur Acad Dermatol Venereol. 2012; 26(3):354-360.
59. Winsz-Szczotka K, Kuźnik-Trocha K, Komosińska-Vassev K, Kucharz E, Kotulska A, Olczyk K. Relationship between adiponectin, leptin, IGF-1 and total lipid peroxides plasma concentrations in patients with systemic sclerosis: possible role in disease development. Int J Rheum Dis. 2016:706-714.
60. Perera R, Marcusson E, Koo S, Kang X, Kim Y, White N, Dean NM. Identification of novel PPARgamma target genes in primary human adipocytes. Gene. 2006;369:90-99.
61. Fang F, Liu L, Yang Y, Tamaki Z, Wei J, Marangoni RG, Bhattacharyya S, Summer RS, Ye B, Varga J. The adipokine adiponectin has potent anti-fibrotic effects mediated via adenosine monophosphate-activated protein kinase: novel target for fibrosis therapy. Arthritis Res Ther. 2012;14(5):R229.
62. Beyer C, Schramm A, Akhmetshina A, Dees C, Kireva T, Gelse K, Sonnylal S, De Crombrugghe B, Taketo MM, Distler O, Schett G, Dislter JH. β-catenin is a central mediator of pro-fibrotic Wnt signaling in systemic sclerosis. Ann Rheum Dis. 2012;71(5):761-767.
63. Kawai M, Mushiake S, Bessho K, Murakami M, Namba N, Kokubu C, Michigami T, Ozono K. Wnt/Lrp/β-catenin signaling suppresses adipogenesis by inhibiting mutual activation of PPARγ and C/EBPα. Biochem Biophys Res Commun. 2007;363(2):276-282.
64. Wei J, Melichian D, Komura K, Hinchcliff M, Lam AP, Lafyatis R, Gottardi CJ, MacDougald OA, Varga J. Canonical Wnt signaling induces skin fibrosis and subcutaneous lipoatrophy: a novel mouse model for scleroderma? Arthritis Rheum. 2011;63(6):1707-1717.
65. Ross SE, Hemato N, Longo KA, Bennett CN, Lucas PC, Erickson RL, MacDougald OA. Inhibition of adipogenesis by Wnt signalling. Science. 2000;289(5481):950-953.
66. Longo KA, Wright WS, Kang S, Gerin I, Chiang SH, Lucas PC, Opp MR, MacDougald OA. Wnt10b inhibits development of white and brown adipose tissues. J Biol Chem. 2004;279(34):35503-35509.
67. Wang L, Jin Q, Lee J, Su IH, Ge K. Histone H3K27 methyltransferase Ezh2 represses Wnt genes to facilitate adipogenesis. Proc Natl Acad Sci USA. 2010;107(16):7317-7322.
68. Driskell RR, Lichtenberger BM, Hoste E, Kretzschmar K, Simons BD, Charalambous M, Ferron SR, Herault Y, Pavlovic G, Ferguson-Smith AC, Watt FM. Distinct fibroblast lineages determine dermal architecture in skin development and repair. Nature. 2013;504(7479):277-281.
69. Mastrogiannaki M, Lichtenberger BM, Reimer A, Collins CA, Driskell RR, Watt FM. β-catenin stabilization in skin fibroblasts causes fibrotic lesions by preventing adipocyte differentiation of the reticular dermis. J Invest Dermatol. 2016;136(6):1130-1142.
79
70. Ferguson EL, Roberts JL, Moseley R, Griffiths PC, Thomas DW. Evaluation of the physical and biological properties of hyaluronan and hyaluronan fragments. Int J Pharm. 2011;420(1):84-92.
71. Reed RK, Lilja K, Laurent TC. Hyaluronan in the rat with special reference to the skin. Acta Physiol Scand. 1988;134(3):405-411.
72. Petrey AC, de la Motte CA. Hyaluronan, a crucial regulator of inflammation. Front Immunol. 2014;5:101.
73. Balazs EA, Denlinger JL. Sodium hyaluronate and joint function. J Equine Vet Sci. 1985;5(4):217-228.
74. Albeiroti S, Soroosh A, de la Motte CA. Hyaluronan’s role in fibrosis: a pathogenic factor or a passive player? Biomed Res Int. 2015.
75. de la Motte CA. Hyaluronan in intestinal homeostasis and inflammation: implications for fibrosis. Am J Physiol Gastrointes Liver Physiol. 2011;301(6):945-949.
76. Bollyky P, Bogdani M, Bollyky JB, Hull RL, Wight TN. The role of hyaluronan and the extracellular matrix in islet inflammation and immune regulation. Curr Diab Rep. 2012;12(5):471-480.
77. McBride WH, Bard J. Hyalurondase-sensitive halos around adherent cells. Their role in blocking lymphocyte-mediated cytolysis. J Exp Med. 1979;149(2):507-515.
78. Forrester JV, Balazs EA . Inhibition of phagocytosis by high molecular weight hyaluronate. Immunology. 1980;40(3):435-446.
79. Lee YH, Petkova AP, Granneman JG. Identification of an adipogenic niche for adipose tissue remodeling and restoration. Cell Metab. 2013;18(3):355-367.
80. Guo J, Guo S, Wang Y, Yu Y. Adipose-derived stem cells and hyaluronic acid based gel compatibility, studied in vitro. Mol Med Rep. 2017;16(4):4095-4100.
81. Solis MA, Chen YH, Wong TY, Bittencourt VZ, Lin YC, Huang LL. Hyaluronan regulates cell behavior: a potential niche matrix for stem cells. Biochem Res Int. 2012;346972.
82. Chapple IL. Reactive oxygen species and antioxidants in inflammatory diseases. J Clin Periodontol. 1997;24(5):287-296.
83. Hawkins CL, Davies MJ. Degradation of hyaluronic acid, poly-, and monosaccharides, and model compounds by hylochlorite: evidence for radical intermediates and fragmentation. Free Radic Biol Med. 1998;24(9):1396-1410.
84. Yamazaki K, Fukuda K, Matsukawa M, Hara F, K Y, Akagi M, Munakata H, Hamanishi C. Reactive oxygen species depolymerize hyaluronan: involvement of the hydroxyl radical. Pathophysiology. 2003;9(4):215-220.
85. Cowman MK, Lee HG, Schwertfeger KL, McCarthy JB, Turley EA. The content and size of hyaluronan in biological fluids and tissues. Front Immunol. 2015;6:1-8.
80
86. Tolg C, Telmer P, Turley EA. Specific sizes of hyaluronan oligosaccharides stimulate fibroblast migration and excisional wound repair. PLoS One. 2014;9(2):1-10.
87. Tolg C, McCarthy JB, Yazdani A, Turley EA. Hyaluronan and RHAMM in wound repair and the “cancerization” of Stromal Tissues. Biomed Res Int. 2014.
88. Liang J, Jiang D, Noble PW. Hyaluronan as a therapeutic target in human diseases. Adv Drug Deliv Rev. 2016;97:186-203.
89. Guéchot J, Loria A, Serfaty L, Giral P, Giboudeau J, Poupon R. Serum hyaluronan as a marker of liver fibrosis in chronic viral hepatitis C: effect of alpha-interferon therapy. J Hepatol. 1995;22(1):22-26.
90. Liang J, Jiang D, Jung Y, Xie T, Ingram J, Church T, Degan S, Leonard M, Kraf M, Noble PW. Role of hyaluronan and hyaluronan-binding proteins in human asthma. J Allergy Clin Immunol. 2011;128(2):403-411.e3.
91. Aytekin M, Comhair SA, de la Motte CA, Bandyopadhyay SK, Farver CF, Hascall VC, Erzurum SC, Dweik RA. High levels of hyaluronan in idiopathic pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol. 2008;295(5):L789-99.
92. Scheja A, Akesson A, Hørslev-Petersen K. Serum levels of aminoterminal type III procollagen peptide and hyaluronan predict mortality in systemic sclerosis. Scand J Rheumatol. 1992;21(1):5-9.
93. Freitas JP, Filipe P, Emerit I, Meunier P, Manso CF, Guerra Rodrigo G. Hyaluronic acid in progressive systemic sclerosis. Dermatology. 1996;192(1):46-49.
94. Levesque H, Baudot N, Delpech B, Vayssairat M, Gancel A, Lauret P, Courtois H. Clinical correlations and prognosis based on hyaluronic acid serum levels in patients with progressive systemic sclerosis. Br J Dermatol. 1991;124(5):423-428.
95. Engstrom-Laurent A, Feltelius N, Hallgren R, Wasteson A. Raised serum hyaluronate levels in scleroderma: an effect of growth factor induced activation of connective tissue cells? Ann Rheum Dis. 1985;44(9):614-620.
96. Misra S, Hascall VC, Markwald RR, Ghatak S. Interactions between hyaluronan and its receptors (CD44, RHAMM) regulate the activities of inflammation and cancer. Front Immunol. 2015;6:201.
97. Savani RC, Hou G, Liu P, Wang C, Simons E, Grimm PC, Stern R, Greenberg AH, DeLisser HM, Khalil N. A role for hyaluronan in macrophage accumulation and collagen deposition after bleomycin-induced lung injury. Am J Respir Cell Mol Biol. 2000;23(4):475-484.
98. Park BG, Lee CW, Park JW, Cui Y, Park YS, Shin WS. Enzymatic fragments of hyaluronan inhibit adipocyte differentiation in 3T3-L1 pre-adipocytes. Biochem Biophys Res Commun. 2015;467(4):623-628.
99. Park BG, Park YS, Park JW, Shin E, Shin WS. Anti-obesity potential of enzymatic fragments of hyaluronan on high-fat diet-induced obesity in C57BL/6 mice. Biochem Biophys Res Commun. 2016;472(1):290-295.
81
100. Nikitovic D, Kouvidi K, Karamanos NK, Tzanakakis GN. The roles of hyaluronan/RHAMM/CD44 and their respective interactions along the insidious pathways of fibrosarcoma progression. Biomed Res Int. 2013;2013:929531.
101. Tolg C, Hamilton SR, Nakrieko KA, Nakrieko KA, Kooshesh F, Walton P, mcCarthy JB, Bissell MJ, Turley EA. Rhamm-/-fibroblasts are defective in CD44-mediated ERK1,2 motogenic signaling, leading to defective skin wound repair. J Cell Biol. 2006;175(6):1017-1028.
102. Savani RC, Wang C, Yang B, Zhang S, Kinsella MG, Wight T, Stern R, Nance DM, Turley EA. Migration of bovine aortic smooth muscle cells after wounding injury. The role of hyaluronan and RHAMM. J Clin Invest. 1995;95(3):1158-1168.
103. Assmann V, Jenkinson D, Marshall JF, Hart IR. The intracellular hyaluronan receptor RHAMM/IHABP interacts with microtubules and actin filaments. J Cell Sci. 1999;112 ( Pt 22):3943-3954.
104. Entwistle J, Hall CL, Turley EA. HA receptors: regulators of signalling to the cytoskeleton. J Cell Biochem. 1996;61(4):569-577.
105. Bost F, Aouadi M, Caron L, Binétruy B. The role of MAPKs in adipocyte differentiation and obesity. Biochimie. 2005;87(1):51-56.
106. Scioli M, Bielli A, Gentile P, Mazzaglia D, Cervelli V, Orlandi A. The biomolecular basis of adipogenic differentiation of adipose-derived stem cells. Int J Mol Sci. 2014;15(4):6517-6526.
107. Bahrami SB, Tolg C, Peart T, Symonette C, Veiseh M, Umoh JU, Holdsworth DW, McCarthy JB, Luyl LG, Bissell MJ, Yazdani A, Turley EA. Receptor for hyaluronan mediated motility (RHAMM/HMMR) is a novel target for promoting subcutaneous adipogenesis. Integr Biol (Camb). 2017:9(2);223-237.
108. Turley E, Noble P, Bourguignon L. Signaling properties of hyaluronan receptors. J Biol Chem. 2002;277(7):4589-4592.
109. Webber J, Meran S, Steadman R, Phillips A. Hyaluronan orchestrates transforming growth factor-beta1-dependent maintenance of myofibroblast phenotype. J Biol Chem. 2009;284(14):9083-9092.
110. Midgley AC, Rogers M, Hallett MB, Clayton A, Bowen T, Phillips AO, Steadman R. Transforming growth factor-β1 (TGF-β1)-stimulated fibroblast to myofibroblast differentiation is mediated by hyaluronan (HA)-facilitated epidermal growth factor receptor (EGFR) and CD44 co-localization in lipid rafts. J Biol Chem. 2013;288(21):14824-14838.
111. Midgley AC, Duggal L, Jenkins R, Hascall V, Steadman R, Phillips AO, Meran S. Hyaluronan regulates bone morphogenetic protein-7-dependent prevention and reversal of myofibroblast phenotype. J Biol Chem. 2015;290(18):11218-11234.
112. Kitani A, Fuss I, Nakamura K, Kumaki F, Usui T, Strober W. Transforming growth factor (TGF)-B1-producing regulatory T cells induce Smad-mediated interleukin 10 secretion that facilitates coordinated immunoregulatory activity and amelioration of TGF-B1-mediated fibrosis. J Exp Mol. 2003;198:1179-1188.
82
113. Kulkarni A, Huh C, Becker D, Geiser A, Lyght M, Flanders KC, Roberts AB, Sporn MB, Ward JM, Karlsson S. Transforming growth factor B1 null mutation in mice causes excessive inflammatory response and early death. PNAS. 1993;90(s):770-774.
114. Bundhun PK, Janoo G, Teeluck AR, Huang F. Adverse drug effects observed with vildagliptin versus pioglitazone or rosiglitazone in the treatment of patients with type 2 diabetes mellitus: a systematic review and meta-analysis of randomized controlled trials. BMC Pharmacol Toxicol. 2017;18(1):66.
115. Verschuren L, Wielinga PY, Kelder T, Radonjic M, Salic K, Kleemann R, van Ommen B, Kooistra T. A systems biology approach to understand the pathophysiological mechanisms of cardiac pathological hypertrophy associated with rosiglitazone. BMC Med Genomics. 2014;7(1):35.
116. Tolg C, Hamilton SR, Zalinska E, McCulloch L, Amin R, Akentieva N, Winnik F, Savani R, Bagli DJ, Luyt LG, Cowman MK, McCarthy JB, Turley EA. A RHAMM mimetic peptide blocks hyaluronan signaling and reduces inflammation and fibrogenesis in excisional skin wounds. Am J Pathol. 2012;181(4):1250-1270.
117. Hauser-Kawaguchi A, Luyt LG, Turley E. Design of peptide mimetics to block pro-inflammatory functions of HA fragments. Matrix Biol. 2018;(2017):20-23.
118. Higman V, Briggs DC, Mahoney DJ, Blundell CD, Sattelle BM, Dyer DP, Green DE, DeAngelis PL, Almond A, Milner CM, Day AJ. A refined model for the TSG-6 link module in complex with hyaluronan use of defined oligosaccharides to prove structure and function. J Biol Chem. 2014;289(9):5619-5634.
119. Yang B, Yang BL, Savani RC, Turley EA. Identification of a common hyaluronan binding motif in the hyaluronan binding proteins RHAMM, CD44 and link protein. EMBO J. 1994;13(2):286-296.
120. Yang B, Zhang L, Turley EA. Identification of two hyaluronan-binding domains in the hyaluronan receptor RHAMM. J Biol Chem. 1993;268(12):8617-8623.
121. Foley JP, Lam D, Jiang H, Liao J, Cheong N, McDevitt TM, Zaman A, Wright JR, Savani RC. Toll-like receptor 2 (TLR2), transforming growth factor-β, hyaluronan (HA), and receptor for HA-mediated motility (RHAMM) are required for surfactant protein A-stimulated macrophage chemotaxis. J Biol Chem. 2012;287(44):37406-37419.
122. Truong J. The promotion of adipogenesis in a rat model of radiation-induced mammary fat pad fibrosis. Electronic Thesis and Dissertation Repository. 2017;4982
123. Yamamoto T, Takagawa S, Katayama I, Yazmazaki K, Hamazaki Y, Shinkai H, Nishioka K. Animal model of sclerotic skin. I: Local injections of bleomycin induce sclerotic skin mimicking scleroderma. J Invest Dermatol. 1999;112(4):456-462.
124. Umezawa H, Maeda K, Takeuchi T, Okami Y. New antibiotics, bleomycin A and B. J Antibiot. 1966;19(5):200-209.
125. Remlinger K. Cutaneous reactions to chemotherapy drugs. The art of consultation. Arch Dermatol. 2003;139(1):77-81.
83
126. Yamamoto T. Animal model of sclerotic skin induced by bleomycin: a clue to the pathogenesis of and therapy for scleroderma? Clin Immunol. 2002;102(3):209-216.
127. Yamamoto T, Eckes B, Krieg T. Bleomycin increases steady-state levels of type I collagen, fibronectin, and decorin gene expression in human skin fibroblasts. Arch Dermatol Res. 2000;292(11): 556-561.
128. De Langhe E, Lories R. Fibrogenesis, novel lessons from animal models. Semin Immunopathol. 2015;37(5):565-574.
129. Ruzehaji N, Avouac J, Elhai M, Frechet M, Frantz C, Ruiz B, Distler JH, Allanore Y. Combined effect of genetic background and gender in a mouse model of bleomycin-induced skin fibrosis. Arthritis Res Ther. 2015;17(1):1-12.
130. Peoples C, Medsger TA Jr, Lucas M, Rosario B, Feghali-Bostwick C. Gender differences in systemic sclerosis: relationship to clinical features, serologic status, and outcomes. J Scleroderma Relat Disord. 2016;1(2):177-240.
131. Wielosz E, Majdan M, Dryglewska M, Suszek D. Comparison of clinical and serological parameters in females and males with systemic sclerosis. Rheumatologia. 2015;53(6):315-320.
132. Siracusa L, McGrath R, Ma Q, Moskow JJ, Manne J, Christner PJ, Buchberg AM, Jimenez SA. A tandem duplication within the fibrillin-1 gene is associated with the mouse tight skin mutation. Genome Res. 1996;6(4):300-313.
133. Christner P, Peters J, Hawkins D, Siracusa LD, Jimenez SA. The tight-skin 2 mouse. An animal model of scleroderma displaying cutaneous fibrosis and mononuclear cell infiltration. Arthritis Rheum. 1995;38(12):1791-1798.
134. Jaffee D, Claman H. Chronic graft-versus-host disease (GVHD) as a model for scleroderma. I. Description of model systems. Cell Immunol. 1983;77(1):1-12.
135. Lattouf R, Younes R, Lutomski D, Naaman N, Godeau G, Senni K, Changotade S. Picrosirius Red Staining: a useful tool to appraise collagen networks in normal and pathological tissues. J Histochem Cytochem. 2014;62(10):751-758.
136. Rio D, Ares M, Hannon G, Nilsen T. Purification of RNA using TRIzol (TRI Reagent). Cold Spring Harb Protoc. 2010(6):pdb.prot5439.
137. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25(4):402-408.
138. Constantine VS, Mowry RW. Selective staining of human dermal collagen. II. The use of picrosirius red F3BA with polarization microsscopy. J Invest Dermatol. 1967;50(5):419-424.
139. Søndergaard K, Heickendorff L, Risteli L, Ristelli J, Zachariae J, Stengaard-Pedersen K, Deleuran B. Increased levels of type I and III collagen and hyaluronan in scleroderma skin. Br J Dermatol. 1997;136(1):47-53.
84
140. Fleischmajer R, Dessau W, Timpl R, Krieg T, Luderschmidt C, Wiestner M. Immunofluorescence analysis of collagen, fibronectin, and basement membrane protein in scleroderma skin. J Invest Dermatol. 1980;75(3):270-274.
141. Sohn JH, Lee YK, Han JS, et al. Perilipin 1 (Plin1) deficiency promotes inflammatory responses in lean adipose tissue through lipid dysregulation. J Biol Chem. 2018;1(6):jbc.RA118.003541. doi:10.1074/jbc.RA118.003541.
142. Shi M, Zhu J, Wang R, Chen X, Mi L, Walz T, Springer TA. Latent TGF-β structure and activation. Nature. 2011;474(7351):343-349.
143. Riekki R, Parikka M, Jukkola A, Salo T, Risteli J, Oikarinen A. Increased expression of collagen types I and III in human skin as a consequence of radiotherapy. Arch Dermatol Res. 2002;294(4):178-184.
144. Shuttleworth CA, Forrest L, Jackson DS. Comparison of the cyanogen bromide peptides of insoluble guinea-pig skin and scar collagen. Biochim Biophys Acta. 1975;379(1):207-216.
145. Eckes B, Wang F, Moinzadeh P, Hunzelmann N, Krieg T. Pathophysiological mechanisms in sclerosing skin diseases. Front Med (Lausanne). 2017;4:120.
146. Hanace AJ, Crystal RG. Rigid control of synthesis of collagen types I and III by cells in culture. Nature. 1977;268(5616):152-154.
147. Perlish JS, Lemlich G, Fleischmajer R. Identification of collagen fibrils in scleroderma skin. J Invest Dermatol. 1988;90(1):48-54.
148. Krieg T, Langer I, Gerstmeier H, Keller J, Mensing H, Goerz G, Timpl R. Type III collagen aminopropeptide levels in serum of patients with progressive systemic scleroderma. J Invest Dermatol. 1986;87(6):788-791.
149. Kähäri V-M, Sandberg M, Kalimo H, Vuorio T, Vuorio E. Identification of fibroblasts responsible for increased collagen production in localized scleroderma by in situ hybridization. J Invest Dermatol. 1988;90(5):664-670.
150. van der Slot AJ, Zuurmond A-M, van den Bogaerdt AJ, Ulrich MM, Middelkoop E, Boers W, Karel Ronday H, DeGroot J, Huizinga TW, Bank RA. Increased formation of pyridinoline cross-links due to higher telopeptide lysyl hydroxylase levels is a general fibrotic phenomenon. Matrix Biol. 2004;23(4):251-257.
151. Leask A. Matrix remodeling in systemic sclerosis. Semin Immunopathol. 2015;37(5):559-563.
152. Chun T-H, Hotary KB, Sabeh F, Saltiel AR, Allen ED, Weiss SJ. A pericellular collagenase directs the 3-dimensional development of white adipose tissue. Cell. 2006;125(3):577-591.
153. Sen B, Xie Z, Case N, Ma M, Rubin C, Rubin J. Mechanical strain inhibits adipogenesis in mesenchymal stem cells by stimulating a durable beta-catenin signal. Endocrinology. 2008;149(12):6065-6075.
154. Cyphert JM, Trempus CS, Garantziotis S. Size Matters: Molecular weight specificity of hyaluronan effects in cell biology. Int J Cell Biol. 2015;2015:563818.
85
155. Suga H, Sugaya M, Fujita H, Asano Y, Tada Y, Kadono T, Sato S. TLR4, rather than TLR2, regulates wound healing through TGF-β and CCL5 expression. J Dermatol Sci. 2014;73(2):117-124.
156. Ghosh AK, Bhattacharyya S, Lakos G, Chen SJ, Mori Y, Varga J. Disruption of transforming growth factor beta signaling and profibrotic responses in normal skin fibroblasts by peroxisome proliferator-activated receptor gamma. Arthritis Rheum. 2004;50(4):1305-1318.
157. Akhmetshina A, Palumbo K, Dees C, Bergmann C, Venalis P, Zerr P, Horn A, Kireva T, Beyer C, Zwerina J, Schneider H, Sadowski A, Riender MO, MacDougald OA, Distler O, Schett G, Distler JH. Activation of canonical Wnt signalling is required for TGF-β-mediated fibrosis. 2012; 13(3):735
158. Furuhashi M, Yagi K, Yamamoto H, Furukawa Y, Shimada S, Nakamura Y, Kikuchi A, Miyazona K, Kato M. Axin facilitates Smad3 activation in the transforming growth factor beta signaling pathway. Mol Cell Biol. 2001;21(15):5132-5141.
159. Zhou B, Liu Y, Kahn M, Ann DK, Han A, Wang H, Nguyen C, Flodby P, Zhong Q, Krishnaveni MS, Liebler JM, Minoo P, Crandall ED, Borok Z. Interactions between β-catenin and transforming growth factor-β signaling pathways mediate epithelial-mesenchymal transition and are dependent on the transcriptional co-activator cAMP-response element-binding protein (CREB)-binding protein (CBP). 2012;287(10):7026-7038.
160. Poon R, Nik SA, Ahn J, Slade L, Alman BA. β-catenin and transforming growth factor β have distinct roles regulating fibroblast cell motility and the induction of collagen lattice contraction. BMC Cell Biol. 2009;10:38.
161. Sato M. Upregulation of the Wnt/beta-catenin pathway induced by transforming growth factor-beta in hypertrophic scars and keloids. Acta Derm Venereol. 2006;86(4):300-307.
162. Cheon SS, Wei Q, Gurung A, Youn A, Bright T, Poon R, Whetstone H, Guha A, Alman BA. Beta-catenin regulates wound size and mediates the effect of TGF-beta in cutaneous healing. FASEB J. 2006;20(6):692-701.
163. Sun Q, Guo S, Wang CC, Sun X, Wang D, Xu N, Jin SF, Li KZ. Cross-talk between TGF-β/Smad pathway and Wnt/β-catenin pathway in pathological scar formation. Int J Clin Exp Pathol. 2015;8(6):7631-7639.
164. Cheon SS, Cheah AYL, Turley S, et al. -Catenin stabilization dysregulates mesenchymal cell proliferation, motility, and invasiveness and causes aggressive fibromatosis and hyperplastic cutaneous wounds. Proc Natl Acad Sci. 2002;99(10):6973-6978.
165. Kouvidi K, Berdiaki A, Tzardi M, Karousou E, Passi A, Nikitovic D, Tzanakakis GN. Receptor for hyaluronic acid-mediated motility (RHAMM) regulates HT1080 fibrosarcoma cell proliferation via a β-catenin/c-myc signaling axis. Biochim Biophys Acta. 2016;1860(4):814-824.
86
166. Liu R, Sun R, Zhang L, Zhang QF, Chen DX, Zhong JJ, Xiao JH. Hyaluronic acid enhances proliferation of human amniotic mesenchymal stem cells through activation of Wnt/β-catenin signaling pathway. Exp Cell Res. 2016;345(2):218-229.
167. Tolg C, Poon R, Fodde R, Turley EA, Alman BA. Genetic deletion of receptor for hyaluronan-mediated motility (Rhamm) attenuates the formation of aggressive fibromatosis (desmoid tumor). Oncogene. 2003;22(44):6873-6882.
168. Calaf GM, Hei TK. Ionizing radiation induces alterations in cellular proliferation and c-myc, c-jun and c-fos protein expression in breast epithelial cells. Int J Oncol. 2004;25(6):1859-1866.
169. Chen H, Liu H, Qing G. Targeting oncogenic Myc as a strategy for cancer treatment. Signal Transduct Target Ther. 2018;3:5.
170. Dang C V., O’Donnell KA, Zeller KI, Nguyen T, Osthus RC, Li F. The c-Myc target gene network. Semin Cancer Biol. 2006;16(4):253-264.
171. Moon SO, Lee JH, Kim TJ. Changes in the expression of c-myc, RB and tyrosine-phosphorylated proteins during proliferation of NIH 3T3 cells induced by hyaluronic acid. Exp Mol Med. 1998;30(1):29-33.
172. Sears R, Nuckolls F, Haura E, Taya Y, Tamai K, Nevins JR. Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev. 2000; 14(19):2501-2514.
173. Alvarezs E, Northwood IC, Gonzalez FA, Latour DA, Seth A, Abate C, Curran T, Davis RJ. Pro-Leu-Ser/Thr-Pro is a consensus primary sequence for substrate protein phosphorylation. J Biol Chem. 1991;2(38):15277-15285.
174. Hamilton SR, Fard SF, Paiwand FF, Tolg C, Veiseh M, Wang C, McCarthy JB, Bissell MJ, Koropatnick J, Turley EA. The hyaluronan receptors CD44 and Rhamm (CD168) form complexes with ERK1,2 that sustain high basal motility in breast cancer cells. J Biol Chem. 2007;282(22):16667-16680.
175. Caraci F, Gili E, Calafiore M, Failla M, La Rosa C, Crimi N, Sortino MA, Nicoletti F, Copani A, Vancheri C TGF-beta1 targets the GSK-3beta/beta-catenin pathway via ERK activation in the transition of human lung fibroblasts into myofibroblasts. Pharmacol Res. 2008;57:274-282.
176. Abdesselem H, Madani A, Hani A, Al-Noubi M, Goswami N, Ben Hamidane H, Billing AM, Pasquier J, Bonkowski MS, Halabi N, Dalloul R, Sheriff MZ, Mesaeli N, ElRayess M, Sinclair DA, Grauman J, Mazloum NA. SIRT1 limits adipocyte hyperplasia through c-Myc inhibition. J Biol Chem. 2016;291(5):2119-2135.
177. Tolg C, Hamilton SR, Morningstar L, Zhang J, Zhang S, Esguerra KV, Telmer PG, Luyl LG, Harrison R, McCarthy JB, Turley EA. RHAMM promotes interphase microtubule instability and mitotic spindle integrity through MEK1/ERK1/2 activity. J Biol Chem. 2010;285(34):26461-26474.
87
178. Chen H, Mohan P, Jiang J, Nemirovsky O, He D, Fleisch MC, Niederacher D, Pilarski LM, Lim CJ, Maxwell CA. Spatial regulation of Aurora A activity during mitotic spindle assembly requires RHAMM to correctly localize TPX2. Cell Cycle. 2014;13(14):2248-2261.
179. Elhayek S. The effect of RHAMM on cell division, cell motility, and tumorigenesis. Electron Thesis Repository. 2014; 2308.
180. Lecarpentier Y, Claes V, Duthoit G, Hébert JL. Circadian rhythms, Wnt/beta-catenin pathway and PPAR alpha/gamma profiles in diseases with primary or secondary cardiac dysfunction. Front Physiol. 2014;5:429.
181. Vallée A, Lecarpentier Y. Crosstalk between peroxisome proliferator-activated receptor gamma and the canonical WNT/β-catenin pathway in chronic inflammation and oxidative stress during carcinogenesis. Front Immunol. 2018;9:745.
182. Jeon K, Phipps RP, Sime PJ, Huxlin KR. Anti fibrotic actions of peroxisome proliferator- activated receptor γ ligands in corneal fibroblasts are mediated by β-catenin-regulated pathways. Am J Pathol. 2017;187(8):1660-1669.
183. Marangoni RG, Masui Y, Fang F, Korman B, Lord G, Lee J, Lakota K, Wei J, Scherer PE, Otvos L, Yamauchi T, Kubota N, Kadawaki T, Asano Y, Sato S, Tourtellotte WG, Varga J. Adiponectin is an endogenous anti-fibrotic mediator and therapeutic target. Sci Rep. 2017;7(1):4397.
184. Plikus M V, Guerrero-juarez CF, Ito M, Li YR, Dedhia PH, Zheng Y, Shao M, Gay DL, Ramos R, Hsi TC, Oh JW, Wang X, Ramirez A, Konopelski SE, Elzein A, Wang A, Supapannachart RJ, Lee HL, Lim CH, Nace A, Guo A, Treffeisen E, Andl T, Ramirez RN, Murad R, Offermanns S, Metzger D, Chambon P, Widgerow AD, Tuan TL, Mortazavi A, Gupta RK, Hamliton BA, Millar SE, Seale P, Pear WS, Lazar WS, Cotsarelis G. Regeneration of fat cells from myofibroblasts during wound healing. Science. 2017; 355(6326):748-752.
185. Hammarstedt A, Hedjazifar S, Jenndahl L, Gogg S, Grunberg J, Gustafson B, Klimcakova E, Stich V, Langin D, Laakso M, Smith U. WISP2 regulates preadipocyte commitment and PPARγ activation by BMP4. Proc Natl Acad Sci. 2013;110(7):2563-2568.
186. Gupta RK, Arany Z, Seale P, Mepani RJ, Ye L, Conroe HM, Roby YA, Kulaga H, Reed RR, Spiegelman BM. Transcriptional control of preadipocyte determination by Zfp423. Nature. 2010;464(7288):619-623.
187. Del Papa N, Caviggioli F, Sambataro D, Zaccara E, Vinci V, Di Luca G, Parafioriti A, Armiraglio E, Maglione W, Polosa R, Klinger F, Klinger M. Autologous fat grafting in the treatment of fibrotic perioral changes in patients with systemic sclerosis. Cell Transplant. 2015;24(1):63-72.
188. Guillaume-Jugnot P, Daumas A, Magalon J, Sautereau N, Veran J, Magalon G, Sabatier F, Granel B. State of the art. Autologous fat graft and adipose tissue-derived stromal vascular fraction injection for hand therapy in systemic sclerosis patients. Curr Res Transl Med. 2016;64(1):35-42.
88
189. Coleman SR, Katzel EB. Fat grafting for facial filling and regeneration. Clin Plast Surg. 2015;42(3):289-300.
190. Griffin MF, Almadori A, Butler PE. Use of lipotransfer in scleroderma. Aesthet Surg J. 2017;37(suppl_3):S33-S37.
191. Strong AL, Cederna PS, Rubin JP, Coleman SR, Levi B. The current state of fat grafting. Plast Reconstr Surg. 2015;136(4):897-912.
192. Largo RD, Tchang LA, Mele V, Scherberich A, Harder Y, Wettstein R, Schaefer DJ. Efficacy, safety and complications of autologous fat grafting to healthy breast tissue: a systematic review. J Plast Reconstr Aesthetic Surg. 2014;67(4):437-448.
193. Scuderi N, Ceccarelli S, Onesti MG, Fioramonti P, Guidi C, Romano F, Frati L, Angeloni A, Marchese C. Human adipose-derived stromal cells for cell-based therapies in the treatment of systemic sclerosis. Cell Transplant. 2013;22(5):779-795.
194. Chen W, Xia ZK, Zhang MH, Ding GC, Zhang XY, Wang ZX, Yang RY Adipose tissue-derived stem cells ameliorates dermal fibrosis in a mouse model of scleroderma. Asian Pac J Trop Med. 2017;10(1):52-56.
195. Sun W, Ni X, Sun S, Cai L, Yu J, Wang J, Nie B, Sun Z, Ni X, Cao X. Adipose-derived stem cells alleviate radiation-induced muscular fibrosis by auppressing the expression of TGF-β1. Stem Cells Int. 2016;2016:5638204.
196. Jiang X, Jiang X, Qu C, Chang P, Zhang C, Qu Y, Liu Y. Intravenous delivery of adipose-derived mesenchymal stromal cells attenuates acute radiation-induced lung injury in rats. Cytotherapy. 2015;17(5):560-570.
197. Hunt D, Uppal L, Denton C, Butler P. The effect of lipotransfer on facial scleroderma. Plast Reconstr Surg. 2015;135(4S):1181.
198. Daumas A, Magalon J, Jouve E, Truillet R, Casanova D, Giraudo L, Veran J, Benyamine A, Dignat-George F, Magalon G, Sabatier F, Granel B. Long-term follow-up after autologous adipose-derived stromal vascular fraction injection into fingers in systemic sclerosis patients. Curr Res Transl Med. 2017;65(1):40-43.
199. Sun M, Kisseleva T. Reversibility of liver fibrosis. Clin Res Hepatol Gastroenterol. 2015; Sep; 39 Suppl 1: S60-3.
200. Rockey DC, Darwin Bell P, Hill JA. Fibrosis – a common pathway to organ injury and failure. N Engl J Med. 2015; 372: 1138 – 1149.
201. Glasser SW, Hagood JS, Wong S, Taype CA, Madal SK, Hardie WD. Mechanisms of lung fibrossis resolution. Am J Pathol. 2016; 186:1066 – 1077.
202. Krizhanovsky V, Yon M, Dickins RA, Heam S, Simon J, Miething C, Yee H, Zender L, Lowe SW. Senescence of activated stellate cells limits liver fibrosis. Cell. 2008; 134: 657 – 667.
89
203. van der Slot-Verhoeven AJ, van Dura EA, Attema J, Blauw B, DeGroot J, Huizinga TWJ, Zuurmond AM, Bank RA. The type of collagen cross-link determines the reversibility of experimental skin fibrosis. Biochimica et Biophysica Acta. 2005: 1740; 60 – 67.
204. Beyer C, Schramm A, Akhmetshina A, Dees C, Kireva T, Gelse K, Sonnylal S, de Crombrugghe B, Taketo MM, Distler O, Schett G, Distler JH. B-catenin is a central mediator of pro-fibrotic Wnt signalling in systemic sclerosis. Ann Rheum Dis. 2012; 71(5): 761-767.
90
8 Curriculum Vitae
KITTY Y WU
EDUCATION
Resident Physician, Plastic and Reconstructive Surgery, Western University 2016 – Present Masters of Science in Surgery (Candidate), Western University 2017 - Present Doctor of Medicine, Western University 2016 Bachelor of Sciences (Honours), University of Toronto 2012
PUBLICATIONS Kitty Wu, Clare Padmore, Emily Lalone, Nina Suh. (2018). An anthropometric assessment of the proximal hamate autograft for scaphoid proximal pole reconstruction. Journal of Hand Surgery. [Epub ahead of print] Kitty Wu, Stephanie Kim, Kevin Fung, Kathryn Roth. (2018). Assessing non-technical skills in Otolaryngology emergencies through simulation-based training. Laryngoscope. [Epub ahead of print] Kitty Wu, Romeet Ahluwalia, Joshua Vincent, Shrikant Chinchalkar, Robert Richards, Nina Suh. (2018). The effect of simulated total distal interphalangeal joint stiffness on grip strength. Canadian Journal of Plastic Surgery. 26(3):160-164. Rasha Baaqeel, Kitty Wu, Shrikant Chinchalkar, Douglas Ross. (2018). The effect of isolated finger stiffness on adjacent digit function. HAND. 13(3) 296-300. Kitty Wu, Yvonne Yau, Larrisa Matukas, Valerie Waters. (2013). Biofilm compared to conventional susceptibility for Stenotrophomonas maltophilia isolates from cystic fibrosis patients. Antimicrobial Agents and Chemotherapy. 57(3):1546-8.
RESEARCH GRANTS & AWARDS
CSPS Educational Foundation Basic Science Award 2018 Dr. Robert McFarlane Resident Research Award 2018 Frederik Banting and Charles Best Canada Graduate Scholarship ($17 500) 2017 Dr. Robert McFarlane Resident Research Award 2017 Department of Surgery Resident Research Award ($5000) 2017 - 2018 Schulich Summer Research Student Award ($8000) 2013 - 2014 Dr. F. R. Eccles Scholarship ($1200) 2016 Leslie Paul Nyman Scholarship ($1400) 2011 University of Toronto National Arbor Scholar ($10 00) 2007 University of Toronto, Faculty of Arts & Science Entrance Scholarship 2007