the conjugation of protein and peptide therapeutics to ... · simple amine-containing organic...

Syracuse UniversitySURFACESyracuse University Honors Program CapstoneProjects

Syracuse University Honors Program CapstoneProjects

Spring 5-1-2013

The Conjugation of Protein and PeptideTherapeutics to Vitamin B12 for the OralTreatment of DiabetesJamie L. Bernstein

Follow this and additional works at: http://surface.syr.edu/honors_capstone

Part of the Chemistry Commons

This Honors Capstone Project is brought to you for free and open access by the Syracuse University Honors Program Capstone Projects at SURFACE.It has been accepted for inclusion in Syracuse University Honors Program Capstone Projects by an authorized administrator of SURFACE. For moreinformation, please contact [email protected].

Recommended CitationBernstein, Jamie L., "The Conjugation of Protein and Peptide Therapeutics to Vitamin B12 for the Oral Treatment of Diabetes"(2013). Syracuse University Honors Program Capstone Projects. Paper 59.

http://surface.syr.edu?utm_source=surface.syr.edu%2Fhonors_capstone%2F59&utm_medium=PDF&utm_campaign=PDFCoverPages

http://surface.syr.edu/honors_capstone?utm_source=surface.syr.edu%2Fhonors_capstone%2F59&utm_medium=PDF&utm_campaign=PDFCoverPages


http://surface.syr.edu/honors_capstones?utm_source=surface.syr.edu%2Fhonors_capstone%2F59&utm_medium=PDF&utm_campaign=PDFCoverPages

http://surface.syr.edu/honors_capstones?utm_source=surface.syr.edu%2Fhonors_capstone%2F59&utm_medium=PDF&utm_campaign=PDFCoverPages


http://network.bepress.com/hgg/discipline/131?utm_source=surface.syr.edu%2Fhonors_capstone%2F59&utm_medium=PDF&utm_campaign=PDFCoverPages

http://surface.syr.edu/honors_capstone/59?utm_source=surface.syr.edu%2Fhonors_capstone%2F59&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

I

The Conjugation of Protein and Peptide Therapeutics to Vitamin B12 for the Oral Treatment of Diabetes

A Capstone Project Submitted in Partial Fulfillment of the Requirements of the Renée Crown University Honors Program at

Syracuse University

Jaime L. Bernstein Candidate for B.S. Degree in Chemistry and Spanish

and Renée Crown University Honors

May 2013

Honors Capstone Project in Chemistry

Capstone Project Advisor: _______________________ Professor Robert Doyle

Capstone Project Reader: _______________________

Professor James Kallmerten

Honors Director: _______________________

Stephen Kuusisto, Director

Date: 04/23/2013

II

Abstract

Currently patients with diabetes receive most of their treatments, including insulin, subcutaneously. Developing a method to orally deliver proteins, peptides, and potentially other therapeutics has the ability to increase patient compliance by making treatments easier to administer. Utilizing the Vitamin B12 uptake pathway is one proposed method of oral delivery of protein therapeutics.

We investigated a way to synthesize a carboxylic acid derivative of Vitamin B12 (B12) that could increase the ease of its conjugation to proteins and peptides. The 5’-position of the ribose tail of B12 was oxidized using excess 2-iodoxybenzoic acid (IBX) and 2-hydroxypyridine (HYP). The synthesis of this B12 derivative allows for peptides, proteins, and other molecules to be conjugated to the 5’-position of the ribose tail of B12 using an amide bond instead of a carbamate bond. Conjugation of a simple amine-containing organic molecule, benzylamine , to this B12 derivative with a 40% yield supported the synthesis of the derivative and its potential to increase the yield of B12 conjugate formation.

We also investigated a method to recombinately express C-peptide using a SUMO system and Escherichia coli. The ability to deliver C-peptide orally using the vitamin B12 uptake pathway would be an easy treatment to potentially reduce diabetic neuropathy, a complication present in many patients with diabetes.

III

Table of Contents

1 Diabetes

1.1 Diabetes

1.1.1 Type 1 Diabetes


1.2 Diabetes in the United States

1.3 Current Treatments

2 Vitamin B12

2.1 Structure

2.2 B12 Uptake Pathway

3 The Use of Vitamin B12 in Oral Delivery

3.1 Background

3.2 Conjugation Sites

4 C-Peptide

4.1 Background

5 Site-Selective Oxidation of Vitamin B12

5.1 Background

5.1.1 2-Iodobenzoic Acid

IV

5.2 Synthesis of 5’-Carboxylic Acid of B12 Ribose Tail

5.3 Identification of B12CA

5.3.1 Matrix Assisted Laser Desorption Ionization (MALDI)

5.3.2 Electron Absorption Spectroscopy (EAS)

5.3.3 1D and 2D Nuclear Magnetic Resonance Analysis of B12CA

5.4 Conjugation of Benzylamine to B12CA

5.4.1 Synthesis of the Conjugate

5.4.2 Purification of the Conjugate

5.4.3 Identification of B12CABA

5.5 Conclusion

6 Expression of C-Peptide

6.1 Introduction

6.2 Recombinant Expression of C-peptide

6.2.1 SUMO System

6.2.2 Amplification of C-peptide

6.2.3 Ligation

6.2.4 Induction

6.2.5 Purification

6.2.6 Cleavage of SUMO

6.2.7 The Addition of Factor Xa

6.3 Conclusion

V

7 Future Research

7.1 C-peptide Expression and Confirmation

7.2 Oral Delivery of C-peptide

8 References

Appendix A: Publication from this Research “Site-Selective Oxidation of Vitamin B12 Using 2-Iodoxybenzoic Acid”

VI

Acknowledgements

I want to thank Professor Robert Doyle for all of his encouragement, help, and

guidance over the last three years. Without him, I could not have done any of this

work. You have truly helped me to accomplish more than I could have ever imagined

and have motivated me to continue to make research a part of my career.

Thank you to Dr. Susan Clardy-James for all of the scientific training you

have given me. I could not have completed all of this work and research without you

as my mentor.

Thank you to everyone in the Doyle Group. It has truly been a pleasure

working alongside all of you. Each and every one of you has helped me in some way

and I know there are amazing things to come in all of your futures.

To Professor Kallmerten, thank you for being the first to make me realize why

I love chemistry and the sciences. I cannot thank you enough for all of your guidance

throughout the last four years.

And finally a big thank you to my family and friends. It means so much when

you are all there to support me. I could not have achieved any of this without you all

in my life. You have motivated me to continue to work hard and push myself and

achieve the unimaginable.

1

1 Diabetes

1.1 Diabetes

Diabetes is a group of diseases categorized by high levels of blood glucose.

This can be a result of defective insulin production, use, or a combination of both.

The two main types of diabetes are type 1 and type 2. 1


The onset of type 1 diabetes is due to the destruction of pancreatic beta cells

by the body’s immune system. Because these cells are the body’s only source of

insulin production, people with type 1 diabetes must receive insulin via an outside

source, usually an injection or a pump. Type 1 diabetes usually develops during

childhood or young adulthood and accounts for about 5% of all diagnosed cases of

diabetes. 1


Type 2 diabetes usually begins when the body’s cells cannot use insulin

properly. The demand for insulin in the body then rises, which eventually causes the

pancreas to lose its ability to produce it. Aging, obesity, and family history are all

associated with the onset of type 2 diabetes. 1

1.2 Diabetes in the Unite States

The Center for Disease Control and Prevention (CDC) reports diabetes as the

seventh most common cause of death. It affects 25.8 million people or 8.3% of the

population in the United States. Diabetes is also the primary cause of kidney failure

and is a major contributor to stroke and heart disease. The CDC estimates that in 2010

2

in the United States about 1.9 million people over the age of 20 were newly

diagnosed with diabetes. 1

1.3 Current Treatments

Diet, insulin, and oral medication are the main forms of treatment used to

regulate blood glucose levels in people with diabetes. People with type 1 diabetes

must have insulin to sustain life. However, many people with type 2 diabetes are able

to manage their disease by just eating healthy, exercising, and losing weight in

combination with oral medication. 12% of adults diagnosed with diabetes take insulin

only, 14% take insulin and oral medication, 58% take only oral medication, 16% do

not take either one. Self-management and education are also key aspects of the

treatment of diabetes.1

2 Vitamin B12

2.1 Structure

B12, a water-soluble organometallic compound, is the largest and most

complex of all of the vitamins. 2 B12 consists of a corrin ring with the metal cobalt(III)

at its center. 3 Cobalt has 6 coordination sites, 4 being occupied by nitrogens in the

corrin ring. The fifth site is occupied by a ligand on the ! side. In the active forms of

B12 in the human body, the ! ligand is a methyl group or a 5-deoxyadenosyl group

and the compounds are called methylcobalamin and 5-deoxyadenosylcobalamin,

respectively. In the form of B12 usually present in dietary supplements, the ! ligand is

a cyanide group and the compound is called cyanocobalamin. In the body,

cyanocobalamin is converted to its active forms.4 The 6th coordination site is occupied

by 5,6-dimethylbenzimidazole, which is linked to a 5 carbon sugar. This 5 carbon

3

sugar is linked to a phosphate group that is attached to an amide group in the corrin

ring. 3 This structure can be seen in Figure 1 below.

Figure 1 Structure of Vitamin B12

2.2 B12 Uptake Pathway

B12 is an essential vitamin that cannot be synthesized by the human body. The

average adult diet consists of an intake of 1-5 µg of B12 a day. Once ingested,

proteases and the acidic environment of the gastrointestinal tract begin to break B12’s

peptide bonds in order to extract it from food.

B12’s uptake pathway (Figure 2) begins with the binding of B12 to salivary

haptcorrin (HC). The acidic conditions (pH<3) cause HC to have a high affinity for

B12. HC is then able to protect B12 from acid hydrolysis, which would normally occur

in an environment with such a low pH. Then the HC and B12 complex moves from the

stomach into the first section of the small intestine or the duodenum. The pH in the

4

duodenum is higher than that of the stomach (>5.5), decreasing HC’s affinity for B12.

Enzymes from the pancreas also begin to digest HC, which frees the B12 to then bind

to intrinsic factor (IF). IF, a second transport protein, is produced in the gastric

mucosa and the pancreas. The IF and B12 complex binds to its receptor, cubilin, to be

transported across the intestinal enterocyte. B12 then appears in the blood bound to

transcobalamin II (TC II). The cells take up this complex of TC II and B12. B12 is

finally freed from this complex after a lysozyme degrades TC II.5

55!!

and the intestinal IF dependent cubam complex. HC is important for the protection of B12 in the

mouth/stomach and facilitates the transport of B12 to the intestines, where the second transport

protein IF transports the B12 across the intestinal wall with the aid of the cubam complex (see

section 1.4.7)."

F igure 18. A basic representation of the B12 dietary uptake pathway.

Previously, Petrus et al. reported on the development and characterization of an orally

active B12-insulin conjugate with hypoglycemic properties in the streptozotocin (STZ)-induced

diabetic rat model.#$ The oral administration of the B12-insulin conjugate resulted in a 4.7 fold

greater decrease in blood glucose levels compared to orally administrated insulin in the STZ rat

model. It was determined that the B12- ing ability was a result of the use

of the B12 uptake pathway. This determination was based on experimentation with co-

Figure 2: Representation of B12 uptake pathway

5

3 The Use of Vitamin B12 in Oral Delivery

3.1 Background

Many therapeutic peptides and proteins are currently given intravenously.

Although oral administration of these therapeutics would be an ideal alternative route

of delivery in order to increase patience compliance and comfort, two main barriers

stand in the way. First of all, the acidic environment of the gastrointestinal tract

would degrade any protein or peptide, leaving it in an inactive form. Second of all,

the body does not have a method or pathway to absorb these peptides and proteins

from the gastrointestinal tract into the bloodstream. 5 If these two problems could be

solved, then the oral delivery of peptides and proteins would be a feasible method to

deliver medications, improving the lives of many. For example, the ability to deliver

insulin orally would increase the ease at which it can be administered to those with

diabetes. This could significantly increase patient compliance, lowering the

complications and deaths each year caused by diabetes.

The utilization of the B12 uptake pathway described in section 2.2 has been a

method of oral delivery of peptides and protein receiving increasing attention over the

past decade. If proteins and peptides can be conjugated to B12, B12’s mechanism for

delivery within the body naturally has ways to protect the proteins and peptides from

the acidic environment in the gastrointestinal tract and allow them to be absorbed into

the bloodstream. 5

3.2 Conjugation Sites

When coupling B12 and a peptide, protein, or any other molecule, it is

important that both entities maintain their biological function in the body. The

6

functional sites of the peptide, protein, or molecule must still be intact in order to

work properly once it reaches the bloodstream. In addition, the sites on B12

recognized by the proteins in its uptake pathway must still be recognizable. There are

three major sites on B12 that are believed to not interfere with its recognition in its

uptake pathway. 5

1) The e peripheral propionamide on the corrin ring

2) The ribose 5’-hydroxy group

3) The phosphate unit on the " tail

These sites are highlighted in figure 3 below.

Figure 3: Potential sites of conjugation on B12

1

2

3

7

4 C-peptide

4.1 Background

C-peptide is a protein that contains 31 amino acids. It is part of the proinsulin

(Figure 4) produced from pre-proinsulin translated off the ribosome and is

synthesized by the beta cells of the pancreas. After C-peptide is cleaved from

proinsulin, Insulin is released into the body in its active form, along with an

equimolar amount of C-peptide. For a long time, C-peptide was thought to be

biologically inert and therefore people with diabetes only received injections of

supplemental insulin, not C-peptide. However, recent studies have suggested that C-

peptide may serve a regulatory role in the body by contributing to vascular

homeostasis in various tissues. Upon the administration of C-peptide, a number of

cellular responses occur in insulin dependent patients with diabetes, such as a “rise in

blood flow to the kidneys, muscle, skin, and nerves in the diabetic state.” 6 For

patients with diabetes, the lack of C-peptide in combination with high blood glucose

levels reduces microvascular circulation, which can eventually lead to complications

like neuropathy. 5,6

6!!

cleave between residue 32 and 33 at the C-peptide/B-chain junction and residue 65 and 66 at the

C-peptide/A-chain."" The removal of extra basic residues at the C-terminal end of the B-chain

and C-terminal end of C-peptide occurs by CPE.

F igure 3. The post-translational modifications of preproinsulin, which results in active

monomeric insulin and C-peptide.

Pancreatic cells secrete insulin in a tightly regulated fashion to ensure glucose

homeostasis."# The mechanism for insulin secretion is a complex process involving the

integration of intracellular and extracellular components and is still not completely understood

(see Figure 4). Nutrients, hormones, and neurotransmitters have all been shown to directly

Figure 4: Representation of Human Proinsulin

8

5 Site-Selective Oxidation of Vitamin B12

5.1 Background

As mentioned prior, there are several potential sites for conjugation to B12,

however conjugation has most successfully occurred at (1) the 5’-hydroxyl group of

the ribose and (2) the e propionamide of the peripheral corrin ring (Figure 5).

Fortunately, neither site interferes with the proteins of the B12 uptake pathway.

Although the carboxylic acid derivative of the e propionamide group has been made,

it is low yielding and difficult to purify. This is partially attributed to the

simultaneous synthesis of the b-, d-, and e- acid derivatives. The 5’-hydroxyl group of

the ribose of B12 is a versatile site that could potentially be used for the synthesis of a

variety of B12 conjugates. However, limited chemistry with the hydroxyl group can be

performed and the conjugates synthesized using this site are done through a

carbamate or ester bond shown in Figure 6. This presents stability issues and the

potential for degradation. The selective oxidation of the 5’-hydroxyl group of B12 to a

carboxylic acid was done using 2-iodoxybenzoic acid (IBX). This has the potential to

increase the chemistry available at B12’s 5’-position and the ability to form conjugates

through a more stable amide bond (Figure 6). 8,9

9

Figure 5: Sites available for conjugation to B12. This figure also shows potential B12

derivatives to Carboxylic Acids. The numbering is used for NMR.

!"##"$ %

!"##"$&'()*&)+),('-)./0'12('34.35.6'(27'4.89:.;<'4=.:*>3130?@)4A3',.%,'1.&'()*&)+),('-)./0'12('34.35.6'(27'4.89:%&'()*+!($,-./(0"'1*/(20"*34*5"$)'#"2)1*6"78$(9*/4*:"$;88,1*<87"$#*=4*68-!">6"?($#0")#*8@*+9"02'#$-1*+")#"$*@8$*%A2")A"*(),*B"A9)8!8C-1*%-$(A&'"*D)2E"$'2#-1*%-$(A&'"1*FG*HIJKK.KHLL1*D%M*N(O PHQIHRSKKIKLTLU*V.0(2!W $?,8-!"X'-$4",&

!"#"$%"&'()*+,-+.,)./(0##"12"&(342"5(5"%$6$78'(9)+,:+.,).

%@<(B2,(C.<"(A#28)*8@*E2#(02)*5HJ*Q5HJS*;2#9*"OA"''*J.28,8O-7").Y82A*(A2,*(),*J.9-,$8O-?-$2,2)"*!"(,'*#8*'"!"A#2E"*8O2,(#28)*8@*#9"R .9-,$8O-!*C$8&?*8@*#9"*$278'"*#(2!*8@*5HJ*2)*(*ILZ*2'8!(#",*-2"!,4B9"* (A2,* ,"$2E(#2E"* ;('* ?&$2@2",* 2)* 8)"* '#"?* 7-* [=3+* A9$80(.#8C$(?9-*(),*A9($(A#"$2Y",*7-*\M36].B^N*0(''*'?"A#$80"#$-1H[*F\<*(),*J6*Q[%_+*(),*[\5+S*F\<4*B9"*)";*A($78O-!2A(A2,*,"$2E(#2E"*2'*?"$@"A#!-*'&2#",*#8*0(`"*'#(7!"*(02,".7('",*5HJ728A8)a&C(#"'4*

D)?.E3B1<C.E2#(02)'1*8O2,(#28)1*J.28,8O-7")Y82A*(A2,1*A($78O-!2A(A2,'1*A87(!(02)

])#"$"'#*2)*&'2)C*E2#(02)*5HJ*Q5HJS*@8$*#9"*8$(!*,"!2E"$-*8@?"?#2,"'* (),* ?$8#"2)'H* 9('* ")A8&$(C",*&'* #8* @&$#9"$* "O.?!8$"*#9"*(E(2!(7!"*A8)a&C(#"*'2#"'*8@*5HJ4*\8,2@2A(#28)'*8@5HJ* #9(#*(!!8;*@8$*08$"* @(A2!"1*92C9"$*-2"!,2)C*8$*'#(7!"728A8)a&C(#"*@8$0(#28)*;2#9*A8)#2)&",*$"A8C)2#28)*7-*5HJ,2"#($-*&?#(`"*(),*#$()'?8$#*?$8#"2)'*9(E"*7"")*"O?!8$",7-* )&0"$8&'* C$8&?'4JbK* %"E"$(!* @&)A#28)(!* C$8&?'* ($"(E(2!(7!"*8)*5HJ*@8$*A8)a&C(#28)1*2)A!&,2)C*#9"*R .9-,$8O.-!*C$8&?*8@* #9"*$278'"* #(2!1* #9"*A87(!#Q]]]S* 28)1* #9"*?98'.?9(#"*082"#-1* (),* '&2#(7!-*08,2@2",* ?$8?28)(02,"'* 8@@#9"*A8$$2)*$2)C4R*M!!*'&A9*08,2@2A(#28)'*'&@@"$*@$80*2''&"'2)A!&,2)C*$",&A",*8$*A80?!"#"*!8''*8@*2)#"$(A#28)*;2#9*8)"8$*08$"*8@*#9"*5HJ*72),2)C*?$8#"2)'1*'#(72!2#-*2''&"'*#9(#*$".'&!#*@$80*#9"*?$8,&A#28)*8@*"'#"$*8$*A($7(0(#"*78),'1*!8;-2"!,2)C* A8)a&C(#28)* $"(A#28)* ,&"* #8* #9"* )(#&$"* 8@* #9"@&)A#28)(!* C$8&?1* 8$* $"c&2$"* ?$87!"0(#2A* ?&$2@2A(#28)* 8@#9"* 08,2@2",* 5HJ* @8$* '&7'"c&")#* A8)a&C(#28)4JbK* B9"'"!202#(#28)'*9(E"*7"")*;"!!*2)E"'#2C(#",d*(),*(*$"E2";*8@'&A9*'2#"'*9('*7"")*$"?8$#",1T*98;"E"$1* 2)*7$2"@*@8$*?&$.?8'"'*8@*?"$'?"A#2E"*@8$*#9"*;8$`*,"'A$27",*9"$"2)W*+8).a&C(#28)*$"'&!#2)C*2)*#9"*$"A8C)2#28)*8@*(!!*#9$""*#$()'?8$#?$8#"2)'*9('*7"")*08'#*'&AA"''@&!*;2#9*5HJ*(#*#;8*0(a8$'2#"'W* Q2S* #9"* ?"$2?9"$(!* A8$$2)* $2)C* ".?$8?28)(02,"1* (),Q22S*#9"*R .9-,$8O-!*C$8&?*8@*#9"*$278'"*&)2#*8@*#9"*(.e#(2!f4B9"*'2,"*A9(2)*".A($78O-!2A*(A2,*,"$2E(#2E"*QN2C&$"*HS*(!.!8;'*@8$*(*E($2"#-*8@*08,2@2A(#28)'1g*7&#*#9"*'-)#9"'2'*8@#9"*,"$2E(#2E"*2'*!8;*-2"!,2)C*(),*$"c&2$"'*!(78$28&'*?&$2.@2A(#28)1*#9"*$"'&!#1*2)*?($#1*8@*#9"*@8$0(#28)*8@*7.*(),*,.A($78O-!2A*(A2,* 2'80"$'* 2)*(,,2#28)*#8*#9"*,"'2$",*".2'8.0"$4h* B9"* R .9-,$8O-!* C$8&?* 9('* 7"")* A2#",* ('* 7"2)C* (08$"* E"$'(#2!"* '2#"* (AA8$,2)C* #8* '#$&A#&$"b(A#2E2#-* $"!(.#28)'92?'1* 98;"E"$1* #9"* A8)a&C(#"'* 9(E"* #-?2A(!!-* 7"")'-)#9"'2Y",*('*0")#28)",*(78E"1*#9$8&C9*A($7(0(#"*8$*"'.#"$*78),'4*

F'=GB).9 *=8#")#2(!*'2#"'*(E(2!(7!"*@8$*A($78O-!2A*(A2,*@8$0(#28)*#9(#(!'8*0(2)#(2)1*(#*!"('#*2)*?($#1*5HJ*&?#(`"*?$8#"2)*$"A8C)2#28)*(),*72),.2)C*($"*2),2A(#",*2)*$",4*B9"*(#80*)&07"$2)C*'A9"0"*&'",*@8$*F\<,2'A&''28)*2'*(!'8*2),2A(#",*

B9"*C8(!*8@*#92'*;8$`*;('*#8*A$"(#"*(*'20?!"*$8&#"*@8$*#9"?$8,&A#28)*8@*(*R .A($78O-!2A*(A2,*,"$2E(#2E"*8@*5HJ*;2#9@(A2!"* ?&$2@2A(#28)* #8* &!#20(#"!-* ?$8,&A"* '#(7!"* (02,".!2)`",*728A8)a&C(#"'*(#*#92'*8?#20(!*?8'2#28)*@8$*A8)a&C(.#28)1*"'?"A2(!!-*2)*$"C($,*#8*2)#$2)'2A*@(A#8$*72),2)C*QA$2#2.A(!* @8$* 8$(!* &?#(`"* 8@* 5HJ* 728A8)a&C(#"'S4HL* ["$"2)1* ;"$"?8$#*#9"*&'"*8@*#9"*9-?"$E(!")#*28,2)"*$"(C")#1*J.28,8O-.7")Y82A*(A2,*Q]5iS*@8$* #9"*'"!"A#2E"*8O2,(#28)*8@*#9"R .9-,$8O-!*C$8&?*8@*5HJ*#8*#9"*A8$$"'?8),2)C*A($78O-!2A(A2,4*B92'*2'*#9"*@2$'#*#20"*]5i*9('*7"")*&#2!2Y",*@8$*#9"*8O.2,(#28)*8@*'&A9*(*08!"A&!"*('*5HJ*(),*"O?(),'*#9"*$()C"*8@&'"*8@*#92'*")E2$8)0")#(!!-*@$2"),!-*8O2,2Y2)C*(C")#4HH*

B9"*5HJ*,"$2E(#2E"*;('*'-)#9"'2Y",*#9$8&C9*(*08,2@2A(.#28)*8@*#9"*0"#98,*,"E"!8?",*7-*j2())2'*"#*(!41*;92A9*2).A8$?8$(#"'*#9"*(,,2#28)*8@*()*^.)&A!"8?92!"*#8*(2,*]5i*2)#9"*#$()'@8$0(#28)*8@*(*?$20($-*(!A898!*2)#8*(*A($78O-!2A(A2,* Q%A9"0"* HS4HJ* B9"* &'"* 8@* ;.9-,$8O-'&AA2)202,"QF[%S*;('*2)2#2(!!-*(##"0?#",*7&#*$"'&!#",*2)*#9"*@8$0(.#28)*8@*(*?$8,&A#*02O#&$"*@$80*;92A9*2#*;('*)8#*?8''27!"#8*2'8!(#"*#9"*A($78O-!2A*(A2,1*!2`"!-*,&"*#8*#9"*@8$0(#28)8@*#9"*(A#2E(#",*F[%*"'#"$1*;92A9*9('*7"")*$"?8$#",*('*(,802)(#2)C*?$8,&A#*8@*#92'*$"(A#28)4HJ*B9"$"@8$"1*J.9-,$8O-.?-$2,2)"*Q[G=S*;('*&'",*('*#9"*^.)&A!"8?92!"4*B8*8?#2.02Y"*#9"*$"(A#28)*A8),2#28)'1*(*'"$2"'*8@*"O?"$20")#'*;"$"?"$@8$0",*2)*;92A9*#9"*A8.8O2,()#1*#"0?"$(#&$"1*(),*#20";"$"*E($2",*QB(7!"*HS4*B9"*7"'#*$"'&!#*;('*87#(2)",*2)*#9"

!"#$%&& JLHJ1*JI1*LLLMbLLL6M,E()A",*8)!2)"*?&7!2A(#28)W HH4Lh4JLHJLhI d . R J H K H K I T . J L h d6^]W HL4HLRRk'.LLIJ.HIHTHdLU*M$# ]6W %B.JLHJ.<LRJK.3l j"8$C*B92"0"*m"$!(C**%#&##C($#*n*F";*G8$`

Dow

nloa

ded

by: S

yrac

use

Uni

vers

ity L

ibra

ry. C

opyr

ight

ed m

ater

ial.

10

Figure 6: Carbamate, Ester, and Amide Bond examples

5.1.1 2-Iodobenzoic Acid (IBX)

Hypervalent iodine reagents, like IBX, are used in many oxidation reactions.

Most iodinanes are advantageous for oxidations due to their availability, ability to

regenerate, mild reaction conditions, and stability in the presence of oxygen and

moisture. In literature it was found that the combination of IBX and N-

Hydroxysuccinimide (NHS) produces activated esters and carboxylic acids from

alcohols. NHS is used as an activating agent that helps to bring the oxidation state

from the alcohol to the aldehyde all the way to the desired to the carboxylic acid.

Although the use of IBX for an oxidation reaction is seen in literature, this is the first

Carbamate Bond

Ester Bond

Amide Bond

11

time it has been utilized for a molecule like B12, expanding its array of possible

reactions. 10

5.2 Synthesis of 5’-Carboxylic Acid of B12 Ribose Tail

Beginning with the method developed by Giannis et al., a reaction to

synthesize the B12 carboxylic acid derivative was created. This reaction uses an O-

nucleophile, NHS, in conjunction with IBX to oxidize primary alcohols. The initial

use of NHS with IBX for the oxidation of the 5’-hydroxyl group on the ribose of B12,

resulted in a mixture of products from which the carboxylic acid could not be

isolated. This mixture of products was likely due to the simultaneous formation of the

activated ester along with the carboxylic acid. The activated ester has been reported to

be the dominant product of this reaction.10 2-hydroxypyridine (HYP) was then used

in place of the NHS as the O-nucleophile, which provide better results. The proposed

reaction mechanism can be seen in Figure 7.

12

Figure 7: Proposed mechanism of the synthesis of B12CA using IBX and HYP

B12 (10.0mg, 0.007 mmol), IBX (5.37 mg, 0.019 mmol), and HYP (3.51 mg,

0.037 mmol) were dissolved in 1 mL of dimethyl sulfoxide (DMSO). Using these

reactants, a series of various experiments were conducted in order to optimize this

! !"#$%&'()*+&,-.#-/#&%" "#$$#%

!"#$%&&#&'(&0#'(0#123 4 5-6'7#89:-,-#;-'%&7##!/<//7&'/#=#>-?#@6'A

B'-.-CD-#6E#F"G -H<:I&%-C/.#6E#JKL#&C(#M -H<:I&%-C/.#6EN@O#:C#(:,-/9)%#.<%E6P:(-#Q3R!ST#&/#GU V$"

)*+,-,.( #O<'B6.-(#,-D9&C:.,#E6'#/9-#E6',&/:6C#6E#/9-#M *D&'W6P*)%:D#(-':I&/:I-#</:%:X:C7#JKL#&C(#N@O

89-.-#D6C(:/:6C.#'-.<%/-(#:C#/9-#6P:(&/:6C#6E#KYF#/6#/9-M *D&'W6P)%:D#&D:(#(-':I&/:I-#KYF$1#:C#/?6#96<'.#?:/9#&ZU[#):-%(#Q.--#/9-#!<BB6'/:C7#JCE6',&/:6CT"#J/#?&.#(-/-'*,:C-(#/9&/#&#ZU[#):-%(#?&.#6B/:,&%#E6'#/9-#JKL#'-&D/:6C:C#/9:.#D&.-"#1C#:CD'-&.-#:C#/-,B-'&/<'-0#JKL\N@O#'&/:6.06'#/:,-#'-.<%/-(#:C#&C#:CD'-&.-#:C#/9-#&,6<C/#6E#W)B'6(<D/.&C(\6'#(-D6,B6.:/:6C#6E# /9-#KYF# Q-.B-D:&%%)#&/# /-,B-'&*/<'-.#:C#-PD-..#6E#GU V$T0#'-(<D:C7#/9-#):-%(#&C(#D6,B%:*D&/:C7#B<':E:D&/:6C"#89-#ZU[#):-%(#:.#&BB'6P:,&/-%)#/9'--/:,-.#/9&/#B'-I:6<.%)#'-B6'/-(#E6'#/9-#B'-B&'&/:6C#6E#/9-#-*D&'W6P)%:D#&D:(#(-':I&/:I-0#?:/9#E&'#-&.:-'#.-B&'&/:6C#Q.--W-%6?T"]#89-#D'<(-#'-&D/:6C#,:P/<'-#?&.#B'-D:B:/&/-(#E'6,#3R!SW)#-/9-'#&((:/:6C#&C(# /9-#B'-D:B:/&/-#?&.# '-(:..6%I-(# :C?&/-'# B':6'# /6# B<':E:D&/:6C# W)# :6C# -PD9&C7-# D9'6,&/6*7'&B9)# <.:C7# &# !1L# D6%<,C"#1E/-'# &# M#,:C</-# 96%(# &/YUU[#?&/-'0#&#7'&(:-C/#E'6,#YUU[#?&/-'#/6#ZM[#R-$>2B96.B9&/-#W<EE-'# QBN F^#MU_MU#I\IT#6I-'#M#,:C</-.#?&.C-D-..&')#E6'#/9-#.-B&'&/:6C#&C(#-%</:6C#6E#KYF$1#Q`:7<'-

FT"#!%:79/#:CD'-&.-.#:C#BN#&W6I-#BN#F#'-.<%/-(#:C#&#'-(<D*/:6C#:C#/9-#&,6<C/#6E#B<'-#:.6%&/-(#B'6(<D/"#NOa$#B<':E:*D&/:6C# &%%6?-(# /9-# '-D6I-')# &C(# '-<.-# 6E# KYF# ./&'/:C7,&/-':&%0#&%W-:/#?:/9#/9-#6P:(:X-(#M *&%(-9)(-#&%.6#B'-.-C/Q`:7<'-#FT"#KYF$1#?&.#:(-C/:E:-(#&.#/9-#B-&A#&/#YZ"G#,:C*</-.#'-/-C/:6C#/:,-"#89-#B<':/)#6E#KYF$1#?&.#&/#%-&./#]M[0&.#&..&)-(#W)#bO*NOa$"#R1a3J*8S`#,&..#.B-D/'6,-*/')#&C&%).:.#6E#KYF$1#'-I-&%-(#/9-#&C/:D:B&/-(#,6%-D<%&':6C#B-&A#Q)\*#c#YZdZ"M#eR#2#$>fg^#`:7<'-#ZT"#

/0123,. & # 89-# bO*NOa$# .B-D/'&# 6E# M *D&'W6P)%:D# &D:(Q&b c YZ"G ,:CT#,6C:/6'-(#&/#ZGU C,"#hC'-&D/-(#KYF#&C(#M *&%(-9)(-D6*-%</-#&/#&b#c#D&"#M ,:C0#&.#:C(:D&/-(#W)#R1a3J*8S`#R!#Q.--#&%.6`:7<'- !Y#:C#/9-#!<BB6'/:C7#JCE6',&/:6CT

i%-D/'6C:D#&W.6'B/:6C#.B-D/'6.D6B)#Qi1!T#?&.#<.-(#/6#-.*/&W%:.9#/9-#6P:(&/:6C#./&/-#6E#/9-#,-/&%#D-C/-'#&.#$6QJJJT0?:/9#C6#:C(:D&/:6C#6E#(-':I&/:6C#6E#/9-#&P:&%#%:7&C(.#W6<C(/6#/9-#,-/&%#D-C/-'#Q $1ZGY c FjMUU R2YD,2Y^#.--#̀ :7<'-#dT89-#./'<D/<'-#6E#KYF$1#?&.#(-/-',:C-(#6C#/9-#W&.:.#6E#YN>Rb#Q.--#`:7<'-#!FT#&C(#YN2YZ$#9-/-'6C<D%-&'#QN!k$&C(#NRK$T#D6''-%&/:6C.#Q.--#`:7<'-.#!Z#&C(#!dT"#89-#YN>Rb#.B-D/'&#6E#KYF$1#'-I-&%-(#/9-#%6..#6E#/?6#B'6/6C.Q N c Z"jM#&C(#Z"]F#BB,T0#?9-C#D6,B&'-(#/6#/9-#.B-D/'<,6E#KYF#Q$>$W%^#.--#`:7<'-.#!F#&C(#!MT"#1#D6,B&':.6C#6E/9-#N!k$#6E#KYF#&C(#KYF$1#:C(:D&/-.#/9-#B'6/6C.#/9&/#&'-&W.-C/#:C#KYF$1#?-'-#6':7:C&%%)#&//&D9-(#/6#/9-#bM#D&'W6CQ $ c GZ"M#BB,^#.--#`:7<'-#!GT"#NRK$#?&.#&//-,B/-(#/6E<'/9-'#-./&W%:.9#/9-#B'-.-CD-#6E#&#D&'W6C)%#&/#/9-#bM#B6*.:/:6C#Q.--#`:7<'-#!dT0#96?-I-'0#:/#?&.#C6/#B6..:W%-#/6#&.*.:7C# /9-#bM# D&'W6C# E'6,# /9-#NRK$# .B-D/'&# W-D&<.-# :/

$456,.( #SB/:,:X&/:6C#6E#/9-#b-&D/:6C#$6C(:/:6C.

iC/') $6*6P:(&C/ 8-,B#QV$T 8:,-#Q9T @:-%(#Q[T

Y >6C- MU F Yj

F N@O MU F FZ

Z N@O MU Z FG

d N@O MU d Fl

M N@O MU M FF

G N@O GU F ZU

Dow

nloa

ded

by: S

yrac

use

Uni

vers

ity L

ibra

ry. C

opyr

ight

ed m

ater

ial.

13

reaction. Conditions such as the co-oxidant, temperature, and the time were varied.

These results can be seen in Figure 8 below.

Co-oxidant Temperature (°C) Time (hours) % Yield

None 50 2 17

HYP 50 2 23

HYP 50 3 26

HYP 50 4 28

HYP 50 5 22

HYP 60 2 30

After many reactions, the optimal conditions were determined to be 5

equivalents of HYP for every 2.6 equivalents of IBX in DMSO at 60°C. As shown in

Figure 8, it resulted in a 30% yield of the 5’-carboxylic acid derivative of B12

(B12CA) over a two hour time period. It was also noted that using a temperature

above 60°C or a time deviating from two hours for this reaction increased the amount

of byproducts and/or degradation of B12, making the B12CA difficult to purify and

reducing its yield. In addition, using an IBX:HYP ratio that differed from 2.6:5

equivalents resulted in an increase of byproducts, and therefore a decrease in percent

yield of the B12CA. When comparing the synthesis of the B12CA to that of the e-

Figure 8: Reaction Optimization

14

carboxylic acid derivative (Figure 5), the purification process was much easier and

the yield was almost three times as high.8, 11

In order to prepare the reaction product for purification, it was precipitated out

of the DMSO into diethyl ether. The ether was decanted and the solid product was

allowed to air dry. The solid product was then re-dissolved in water.

The purification process was done using high-performance liquid

chromatography (HPLC) and an Agilent SAX analytical column (5 µm, 9.4 X 250

mm), which utilized ion exchange chromatography. Solvent A was ultra purified

water and solvent B was a 50:50 mixture by volume of Acetonitrile (MeCN) and

phosphate buffer pH 2. Note that an increase in pH for solvent B resulted in a

decrease in the amount of purified B12CA.

With a flow rate of 1 mL/minute, 100% of solvent A was allowed to flow

through the HPLC and column for 5 minutes. This was followed by a gradient from

100% solvent A, 0% solvent B to 65% solvent A, 35% solvent B over 5 minutes. The

HPLC profile can be seen in Figure 9 below. 8,11

15

Figure 9: HPLC spectra of B12CA purification, monitored at 360 nm. The retention

time of the unreacted B12 and aldehyde was about 5 minutes and the B12CA was about

12 minutes.

The peak at a retention time of 5 minutes was identified as a mixture of

unreacted B12 and the ribose 5’-aldehyde B12 derivative. The peak with a retention

time of about 12 minutes was identified as B12CA, the desired product. The peak at

12 minutes, which was red in color, was collected and neutralized. It was mixed with

amberlite XAD4 resin and rocked overnight in order to remove any salt. The

amberlite resin turned red, suggesting the binding of the B12CA. The resin was

collected and washed with water to remove any excess salt. The resin was placed in

Methanol (MeOH), which would release the B12CA. The MeOH solution containing

the B12CA was collected and lyophilized to get rid of the MeOH and leave a red

powder product. 8,11

Time (minutes)

Abs

orba

nce

B12CA !

B12 and B12 5’-aldehyde "

16

5.3 Identification of B12CA

Various methods were chosen to support the identification of the synthesized

product as B12CA.

5.3.1 Matrix Assisted Laser Desorption Ionization (MALDI)

Matrix Assisted Laser Desorption Ionization Time-of-Flight (MALDI-ToF)

mass spectrometry was done using a Bruker Autoflex II Smartbeam machine with

laser intensity from 50-73%. A small sample of the purified product (B12CA) was

taken and mixed with a matrix containing "-cyano-4-hydroxycinnamic acid (CHCA)

in a 1:1 volume ratio of water and acetonitrile with 0.1% trifluoroacetic acid (TFA).

Angiotensin I was also added for use as an internal control, which has a mass to

charge ration (m/z) of 1296. The mass to charge ratio expected for a product

containing B12CA is m/z=1343.5 [M-CN]+. This peak was present in the MALDI

profile as shown in Figure 10, supporting the synthesis of B12CA.

17

Figure 10: MALDI-ToF of the reaction product. At m/z=1296.7 the expected

angiotensin peaks can be seen and at m/z=1343.5 the expected B12CA peaks can be

seen.

MADLI-ToF was also performed for the HPLC fractions with a retention time

of 5 minutes, which was speculated to be the unreacted B12 and 5’-aldehyde B12

derivative. The large group of peaks in Figure 11 is a mixture of the expected

MALDI-ToF pattern for B12 with m/z=1329.5 and the 5’-aldehyde B12 derivative with

m/z= 1327.5. This supports the identification of the HPLC fractions with a retention

time of 5 minutes.8,11

99 !

F igure 44. MALDI-ToF MS spectrum of HPLC peak at Tr =14 mins indicating 4 ([M-

CN]+ 1343.5 m/z) with angiotensin as an internal reference.

Electronic absorption spectroscopy (EAS) was used to determine the oxidation

state of the metal center, nature of the axial ligands bond to the metal center and yield of

CA361 = 27500 M-1 cm-1) (see Figure 45).

18

Figure 11: MALDI-ToF of the HPLC peak at 5 seconds. The expected angiotensin

peaks can be seen at m/z=1296.7, B12 at m/z=1329.5, and the 5’-aldehyde B12

derivative at m/z= 1327.5.

5.3.2 Electron Absorption Spectroscopy (EAS)

Electron Absorption Spectroscopy (EAS) was used to determine the yield of

the B12CA product. The spectrum is shown in Figure 12 below. The yield was

calculated using Beer-Lambert law in which A= #lc, where A is the absorption, # is !"#

#

!"#$%&'()!"#$%&'$!"!"!"#$%&'()*+#!"#$%&'#()*+#*,#!"!"#$%&'#%&(%)*+%&,#!"#$%&'()"*+!!!"#!%&$'()*#+,-./01!!"#!!"$!"#$%&#$'!"#$%&$'!(#$)!%&$'()*#+,-2/01!!!!"#$%&'"($")*+(),('-)+()+")$"&'."+/).'0'.'"1'2)#

#

!

"!!!

#!!!

$!!!

%"&! %'!! %'%! %'"! %''! %'#! %'(! %'$! %')! %'*!

19

the extinction coefficient, l is the path length, and c is the concentration. For B12CA

the extinction coefficient used was #=27500 M-1cm-1.

Figure 12: Electronic Absorption Spectrum of B12CA taken in 35% B from HPLC run

5.3.3 1D and 2D Nuclear Magnetic Resonance Analysis of B12CA

Using 1H Nuclear Magnetic Resonance (NMR) (Figure 13) and 1H-13C

heteronuclear (HSQC) (Figure 14), confirmation of the formation of B12CA was

further supported. Looking at the 1H NMR for the B12CA and comparing it to that of

a standard B12 Cyanocobalamin 1H NMR (Figure 15), it can be seen that 2 protons

were lost in the formation of B12CA. These protons are located at $H=3.75 and 3.92 in

the B12 Cyanocobalamin 1H NMR. In order to determine which two protons were lost,

a comparison of HSQC of standard B12 Cyanocobalamin and B12CA was done

(Figure 16). The signal that disappears at $H=63.3 in the HSQC of B12CA indicated

that the protons lost in going from B12 to B12CA were attached to the R5 carbon. 8, 11

100 !

F igure 45. Absorbance spectrum of 4 in 35 % HPLC mobile phase B.

4.2.2 1D and 2D N M R analysis of 4

The structure of 4 was determined by assignments obtained from 1H NMR (see

Figure 46) and 1H-13C heteronuclear (HSQC and HMBC) correlations (see Figures 47

and 48). The 1H NMR spectra of 4 H = 3.75 and 3.92),

when compared to the spectrum of B12 (CNCbl) (see Figure 49). A comparison of the

HSQC of B12 and 4 indicates the protons lost in 4 were originally attached to the R5

C = 63.3) (see Figure 50). HMBC was then chosen to further establish the

addition of a carbonyl at the R5 position (see Figure 48), however it was established that

the R5 carbon shows no connectivity to any of the ribose protons and so was assigned by

HSQC."#

20

Figure 13: 500 MHz 1H NMR of B12CA

Figure 14: 500 MHz 1H-13C HSQC NMR of B12CA

101 !

F igure 46. 500 MHz 1H NMR spectrum of 4.

.

F igure 47. 500 MHz 1H-13C HSQC NMR spectrum of 4.

101 !

F igure 46. 500 MHz 1H NMR spectrum of 4.

.

F igure 47. 500 MHz 1H-13C HSQC NMR spectrum of 4.

21

Figure 15: 500 MHz 1H NMR of B12

Figure 16: Zoomed in portion of 500 MHz 1H-13C HSQC NMR of B12 (left) and

B12CA (right). Note the loss of the protons at $H=3.75 and 3.92 when the carbon at R5

($H=63.3) is oxidized.

103 !

F igure 49. 500 MHz 1H NMR spectrum of B12 (CNCbl).

!"#

#

!"#$%&'()*#$%&'(%)#%*#+!,-#%*#./012&3%456(1#21(7#89%:;#2)7#<=>8#3%''%?;#@(A@6(A@'()A#'@B#6%CC#%*#:&%'%)C#8 +#D#EF">#2)7#EFGG;#7HB#'%#%4(72'(%)#2'#'@B#I.#12&3%)8 -#D#JKFL.;#()#'@B#<=>#./012&3%456(1#21(7F##

22

5.4 Conjugation of Benzylamine to B12CA

Benzylamine was chosen to conjugate to the B12CA. Benzylamine is a simple

amine-containing organic molecule and was chosen because of its easily identifiable

diagnostic peaks present in an NMR profile. This would help to characterize the R5

carbon even further. In addition, it would help to confirm the synthesis of the B12CA

by showing that a simple amine could be conjugated to the carboxylic acid at the 5’

position on the ribose of B12.

5.4.1 Synthesis of Conjugate

The B12CA and benzylamine were dissolved in dimethylformamide (DMF)

containing 1% water, along with 10 molar equivalents of ethyl-3-(3-

dimethylaminopropyl) carbodiimide (EDC) and 20 molar equivalents 1-

hydroxybenzotriazole (HOBt). This was left at room temperature for 1 hour to allow

the reaction to occur. During this time, the B12CA-benzylamine (B12CABA)

conjugate was synthesized with a 40% yield. The reaction is shown in figure 17

below.

Figure 17: The reaction of B12CA with benzylamine (1) to form B12CABA

using EDC and HOBt in DMF for 1 hour at room temperature.

105 !

F igure 51. Synthesis of 5.

5 was purified using the same purification method as established for the

carboxylic acid (see Figure 52) and characterized by MALDI mass spectrometry (see

Figure 53) as well as 1D (see Figure 54) and 2D NMR (see Figure 55 and 56).

F igure 52. Purification of the conjugate was established by RP-HPLC using an SAX

column with a gradient from 100% water to 35% MeCN: phosphate buffer pH 2.

1

23

5.4.2 Purification of Conjugate

Using the same HPLC method established to purify the B12CA from the

original reaction, the B12CABA was purified. This involved ion exchange with an

SAX column, a flow rate of 1 mL/minute, and 100% of solvent A flowing through the

HPLC and column for 5 minutes. This was followed by a gradient from 100% solvent

A, 0% solvent B to 65% solvent A, 35% solvent B over 5 minutes. Solvent A was

ultra purified water and solvent B was a 50:50 mixture by volume of Acetonitrile

(MeCN) and phosphate buffer pH 2. The profile obtained is shown in Figure 18.

Figure 18: HPLC profile of B12CABA

5.4.3 Identification of B12CABA

The B12CABA was plated for MALDI, again using CHCA in a 1:1 volume

ratio of water and acetonitrile with 0.1% TFA. Angiotensin I was used for an internal

control. The MALDI-ToF profile of B12CABA showed a mass to charge ratio of

m/z=1432.5, which is what was expected if the conjugations was successful (Figure

19). A close up of the benzylamine MALDI peaks can be seen in Figure 20.

105 !

F igure 51. Synthesis of 5.

5 was purified using the same purification method as established for the

carboxylic acid (see Figure 52) and characterized by MALDI mass spectrometry (see

Figure 53) as well as 1D (see Figure 54) and 2D NMR (see Figure 55 and 56).

F igure 52. Purification of the conjugate was established by RP-HPLC using an SAX

column with a gradient from 100% water to 35% MeCN: phosphate buffer pH 2.

24

Figure 19: MALDI-TOF of the B12CABA. The expected angiotensin peaks can be

seen at m/z=1296.7 and B12CABA at m/z=1432.6

25

Figure 20: Up close of figure 0 of the B12CABA m/z=1432.6.

Next, 1H NMR (Figure 21) of the B12CABA was done to further support the

synthesis of the B12CABA. Looking at the 1H NMR for the B12CABA and comparing

it to that of B12CA, the appearance of the set of peaks just below $H =7.5 is diagnostic

of the addition of the benzylamine.

26

Figure 21: 500 MHz 1H NMR of B12CABA

1H-13C HSQC NMR (Figure 22) and 1H-13C HMBC NMR (Figure 23) were

also performed on the B12CABA to study the connectivity to the R5 carbon. From the

HMBC, it can be seen that the R5 carbon ($C=173.8 ppm) of B12CA is connected to

the two protons of CA of the benzyl amine ($H=4.42 and 4.50 ppm). The protons of

CA also show direct connectivity to CB ($C=140.8 ppm) and CC ($C= 131.4 ppm) of

the benzylamine. The numbering assignments of the atoms as well as the signal

assignments of the B12CABA for HSQC and HMBC can be seen in Figure 24. 8, 11 !"#

!"#$%&'()!"!""#$%&#!!"#$%"&'()*+,-"./"!"$!"#$%&'()!*"!)+*$,-.'("/)-,*!%-012"3,!#

#

#

27

Figure 22: 500 MHz 1H-13C HSQC NMR of B12CABA

Figure 23: 500 MHz 1H-13C HMBC NMR of B12CABA

!"#$

$

!"#$%&'()!"!""#$%&#!!%!"!"#$%!"&'(")*+,-./0!!"#$%%!"#$%&'()!*"!)+*$,-.'("/)-,!$

$

!"#$%&'()*+$&##$'()$"(%"*+$(',+$-.$&/%0123-45670$1078$39:)561;7:9<$

'

'

!"#$

$

!"#$%&'()!"!""#$%&#!!%!"!"#$%!"&'(")*+,-./0!!"#$%%!"#$%&'()!*"!)+*$,-.'("/)-,!$

$

!"#$%&'()*+$&##$'()$"(%"*+$(',+$-.$&/%0123-45670$1078$39:)561;7:9<$

'

'

28

Figure 24: A: Numbering assignments of B12CABA, B: Signal assignments of the

HSQC of B12CABA, C: Signal assignments of the HMBC of B12CABA

5.5 Conclusion

In conclusion, we have successfully made a derivative of B12 that could

increase the ease at which B12 conjugates are made. We have not only shown that IBX

can be used for the oxidation of B12, but this oxidation is site specific of the ribose 5’-

hydroxyl group. The B12CA is synthesized with a yield that triples the synthesis of the

carboxylic acid derivative of the propionamide or any other reported carboxylic acid

derivative of B12. It is also much easier to purify and quicker to make. The formation

of a derivative of B12 that has a carboxylic acid instead of a hydroxyl group available

for conjugation increases the chemistry that can be performed at the 5’ site. This will

allow higher yielding and more stable conjugates to be formed in the future. This

conjugate will be of significant use in the field of B12 conjugation chemistry. 8, 11

108 !

F igure 56. 500 MHz 1H-13C HMBC of 5.

F igure 57. Analysis of 5 by 2D heteronuclear NMR spectroscopy. A . The atom

numbering scheme for the benzylamine attached to the R5 of B12 by an amide bond. B .

29

NOTE: Section 5 information and images were all reproduced with permission and

acknowledgement to citations 8 and 11 in references.

6 Expression of C-peptide

6.1 Introduction

As mentioned prior, administration of C-peptide has the potential to reduce

diabetic neuropathy, a major complication that arises in many people with diabetes.

Currently a subcutaneous administration of C-peptide is being studied for use in

patients with diabetes7, however the ability to deliver C-peptide orally has the

potential to be more convenient for patients with diabetes and therefore increase

patient compliance. Utilization of the B12 uptake pathway by conjugating C-peptide to

the 5’-carboxylic acid derivate of B12 we have created (B12CA), could allow the oral

delivery of C-peptide.

6.2 Recombinant Expression of C-peptide

6.2.1 Sumo System

In order to create a conjugate of B12 and C-peptide, the first step was to

establish a method of expressing recombinant C-peptide. The system chosen to do so

with was a Small Ubiquitin-like Modifier (SUMO) system, made by the Lucigen

Corporation. The SUMO protein contains 100 amino acids and aids in the expression

of difficult target proteins by enhancing the protein’s solubility and expression. The

SUMO system contains a 6xHis-Sumo tag, which is used for purification. The SUMO

system also does not require purification of the PCR product or restriction enzymes

prior to ligation.

30

6.2.2 Amplification of C-peptide

The target protein, C-peptide was amplified using Polymerase Chain Reaction

(PCR). Three different PCR reactions were done with a 1:10, 1:5, and 1:1 volume to

volume ratio of DNA to water. The DNA used was a pUC57 plasmid containing the

target gene C-peptide, which was ordered. The primers were also designed (Figure

25) based on the instructions in the Lucigen SUMO manual in order to synthesize the

C-peptide PCR product with the correct flanking sequences needed for the ligation

into the SUMO containing vector.

Forward Primer: 5’-CGCGAACAGATTGGAGGTGCGGAAGATCTGCAAGTG-3’

Reverse Primer: 5’-GTGGCGCCCGCTCTATTATTGCAGAGAGCCTTCCAG-3’

Figure 25: Primers for C-peptide Insertion into the SUMO system

The PCR mixture consisted of 10 µL of the different DNA to water ratios

described above, 20 µL of sterile water, 5 µL of a 10 µM concentration of the forward

primer, 5 µL of a 10 µM concentration of the reverse primer, 5 µL of thermopol

buffer, 4 µL of dNTPs, and 1 µL of deep vent enzyme. The PCR conditions were 34

cycles of 94°C for 1 minute, 60°C for 1 minute and 74 °C for 20 seconds.

The 3 different PCR products were then run down a DNA agarose gel (0.5

grams of agarose, 50 mL of 1X TBE buffer, 2.5 µL of Ethidium Bromide) for 70

minutes at 70 Volts (Figure 26). C-peptide plus the flanking sequences added for

ligation contains about 100 base pairs and can be seen in all 3 lanes of the varied PCR

reactions near the 0.100 kilobase marker, supporting its synthesis.

31

Figure 26: Agarose Gel of PCR product. C-peptide plus the flanking sequences added

contain about 100 base pairs and can be seen at around the 0.100 kilobase marker in

all 3 lanes.

6.2.3 Ligation

The Lucigen Corporation Sumo kit contained a linearized pETite N-His

SUMO Kan vector, which includes the SUMO sequence. On each end of the

linearized sequence the flanking sequences are complementary to that of the C-

Markers PCR 1:10

PCR 1:5

PCR 1:1

Kilobases

0.1

0.2

32

peptide PCR product made, which helps to ligate the C-peptide and the vector. The

ligation was done by adding 2 µL of the pETite vector linearized DNA and 3 µL of

the PCR product to thawed chemically competent HI-Control 10G cells. Lucigen

Corporation optimizes these cells for a high efficiency transformation. The cells were

allowed to sit on ice for 30 minutes, then they were heat shocked by being placed in

water at 42°C for 45 seconds. 960 µL of recovery media was added to the cells and

then the cells were left on ice for 2 minutes. Finally the cells were placed at 37°C for

1 hour. The cells were then plated on LB Kanamycin (Kan) Agar plates and incubated

at 37°C overnight. Single colonies that grew on the plates were selected and grown in

5 mL of LB and 5 µL of Kan overnight at 37°C, 250 RPM. The plasmid was then

isolated and sent for sequencing. The sequence confirmed that a successful ligation

had occurred between the C-peptide and the pETite N-His SUMO Kan vector.

6.2.4 Induction

Following the successful ligation, SUMO C-peptide was expressed from the

pETite N-His SUMO Kan vector. Single colonies were selected and grown in 5 mL

of LB and 5 µL of Kan overnight at 37°C, 250 RPM. In the morning, 0.5 mL of this

culture was taken and placed in 50 mL LB broth with 50 µL of Kan. It was grown at

37°C, 250 RPM until the OD600 was 0.4-0.6. The cultures were then induced with

either 5 µL of 1 mM isopropylthiogalactoside (IPTG) or 5 µL of 0.1 mM IPTG,

giving the final concentration of IPTG in either culture as 0.1 mM and 0.01 mM,

respectively. Samples of each culture were taken prior to the addition of IPTG, at 1

hour after, 4 hours, and overnight. The samples were poured into falcon tubes,

centrifuged, and decanted. Each sample was redissolved in 20 mM tris-HCl, 150 mM

33

NaCl pH 7.2. The samples were then lysed by being sonicated on ice with 10 pulses,

2 minutes of incubation on ice, two times. They were then centrifuged and the

supernatant, containing the proteins, was collected.

6.2.5 Purification

The supernatant following the lysis was purified using Fast Protein Liquid

Chromatography (FPLC). A nickel resin HisTrap column was used, along with 20

mM Hepes, 0.5 M NaCl, pH 7.2 for solvent A and 20 mM Hepes, 0.5 M NaCL, pH

7.2 with 250 mM Imidizole for solvent B. 100% A was run through the column,

followed by 100% B. The histag in the sumo system first bound to the column during

the initial flow through of solvent A. It was then eluted as solvent B flowed through

the column and imidizole displaced it. The FPLC profile is shown in Figure 27.

Figure 27: FPLC profile of SUMO C-peptide system.

Flow Through

Eluted

34

6.2.6 Cleavage of SUMO

In order to cleave the SUMO protein from C-peptide, the eluted from the

FPLC purification was collected and boiled for 5 minutes with 1.5 µL of

Dithiothreitol (DTT). 0.5 µL of the SUMO protease was added. The mixture was left

at 30°C for 1 hour. The SUMO protease recognizes SUMO’s tertiary structure and

cleaves at its terminal carboxyl group. In theory, it should leave the target protein (C-

peptide) without any extra residues. However, an SDS-Page gel was done (Figure 28)

and showed that the C-peptide was not being cleaved from the SUMO system. If C-

peptide was cleaved from the SUMO protein, then after the digestion there should be

two bands, one for each the SUMO and C-peptide. In the gel in Figure 28, there is

only one band that did not change position after the digestion. SUMO is about 18 kDa

and C-peptide is about 3 kDa.

35

Figure 28: SDS-Page gel. Lane 1: Low range protein ladder markers, Lane 2: Pre-

induction control, Lane 3: Overnight induction crude, Lane 4: FPLC flow through,

Lane 5: FPLC eluted, Lane 6: After Dialysis, Lane 7: Digestion

Different conditions were changed in order to try and get the cleavage to

occur. This included varying the temperature, the use of DTT and urea, and the

protease concentration and type. However, after many attempts at cleavage of the

SUMO protein and C-peptide, it was decided that a different method of cleavage was

necessary.

kDa

40

25

15

10

4.6

36

6.2.7 The Addition of Factor Xa

Because the SUMO protease recognizes SUMO’s tertiary structure in order to

cleave the protein, it was decided a protease was needed that recognized a definitive

sequence and not a particular folding pattern. Factor Xa protease was chosen, which

cleaves after Arginine in the cleavage site Isoleucine-Glutamic Acid-Glycine-

Arginine (IEGR). New primers were designed to incorporate the factor Xa site into C-

peptide (Figure 29).

Forward Primer:

5’CGCGAACAGATTGGAGGTATTGAAGGCCGCGAAGCGGAAG3’

Reverse Primer:

5’ GTGGCGGCCGCTCTATTATTGCAGAGAGCCTTCCAG3’

Figure 29: Primers for C-peptide with Factor Xa

The PCR product was amplified as in section 6.2.2 and ligated as in section

6.2.3 into HI-control 10G cells. After many attempts, it was clear that the ligation was

not occurring. Instead, a DNA sequence was ordered that contained SUMO, a Factor

Xa cleavage site, and C-peptide (Figure 30). Two different restriction sites were also

added to each end in order to digestion and ligate this DNA sequence into a vector,

pET-15b. Based on the restriction sites available in pET-15b, Nde1 and BamH1 were

chosen as the restriction enzymes/sites. The DNA sequence arrived in pUC57.

37

Figure 30: Ordered DNA sequence containing SUMO, Factor Xa, and C-peptide. A

shows a representation of the parts of the sequence and B shows the actual DNA

sequence

Once the DNA was received, both the DNA sequence and pET-15b were

digested to prepare for ligation. 4 µL of pET-15b, 1 µL Nde1 protease, 2 µL buffer 4,

and 11 µL of sterile water were mixed in one eppendorf tube. 4 µL of the ordered

DNA sequence in pUC57, 1 µL Nde1 protease, 2 µL buffer 4, and 11 µL of sterile

water were mixed in another eppendorf tube. Both were placed at 37°C for 30

minutes. Then to the pET-15b eppendorf tube, 1 µL Calf Intestinal Phosphatase (CIP)

and 1 µL of BamH1 were added To the DNA sequence eppendorf tube, 1 µL of sterile

water and 1 µL of BamH1 were added. Both reactions were placed back at 37°C for

60 minutes.

Using an agarose gel and the E.Z.N.A kit, the digested DNA (C-peptide) and

vector were purified and extracted. Molar ligations were performed in the following

ratios: 1:1 2 µL C-peptide/1 µL vector, 3:1 6 µL C-peptide/1 µL vector, 5:1 10 µL C-

A: Nde1His8SUMOFactorXaC-peptideBamH1StopCodon B: CATATGCATCACCATCACCATCACCATCACATATGCATCATCACCACCATCACGGGTCCCTGCAGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTTAACGTTCTTGTACGACGGTATTGAAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACCGCGAACAGATTGGAGGTATTGAAGGCCGCGAAGCGGAAGATCTGCAGGTGGGCCAGGTGGAACTGGGCGGCGGCCCGGGCGCGGGCAGCCTGCAGCCGCTGGCGCTGGAAGGCAGCCTGCAGGGATCCUAA

38

peptide/1 µL vector, 10:1 20 µL C-peptide/1 µL vector. To each of these, 2 µL of

buffer, 1 µL of T4 ligase, and enough sterile water to make each reaction mixture 21

µL were added to complete the ligation mixtures.

3 µL of each ligation mixture was then added to BL21(DE3) cells thawed on

ice to begin the transformation. The cells with the added ligation mixture were

incubated on ice for 30 minutes and then heat shocked for 45 seconds at 42°C. 960

µL of recovery media was added and the cells were allowed to sit on ice for 2

minutes. The cells were then plated on LB Ampicillin (AMP) Agar plates and grown

overnight at 37°C.

All of the plates grew as expected and twelve singles colonies were selected,

grown overnight in 5 mL LB, 5 µL AMP at 37°C, 250 rpm. The plasmid was isolated

from two of the cultures that had grown and sent for sequencing. The sequence

confirmed that a successful ligation had occurred between the C-peptide sequence

and the pET-15b vector.

The colonies with the correct sequences were selected, induced, and lysed as

in section 6.2.4. An SDS-Page gel was ran (Figure 31) of the various time points (pre-

induction, 1 hour after, 4 hours, overnight) and IPTG concentrations (0.1 mM and

0.01 mM). The gel did not show a band near 20-21 kDa, which is where the Sumo C-

peptide should appear. After multiple attempts, the cells did not appear to be lysing

properly, so a more effective method of lysing the cells is currently being developed

by increasing the length of sonication.

39

Figure 31: SDS-Page gel of SUMO, Factor Xa, and C-peptide system after induction

and lysis. Lane 1: Precision Plus Protein Standards, Lane 2: Pre-induction control .01

IPTG, Lane 3: 1 hour .01 IPTG, Lane 4: 4 hours .01 IPTG, Lane 5: O/N .01 IPTG,

Lane 6: PIC 0.1 IPTG, Lane 7: 1 hour 0.1 IPTG, Lane 8: 4 hours, 0.1 IPTG, Lane 9:

O/N 0.1 IPTG

6.3 Conclusion

Although the cleavage of C-peptide from the SUMO system has not yet been

achieved, this work shows that the recombinant expression of C-peptide is possible

utilizing Escherichia Coli cells. The ability to recombinantly express C-peptide is a

low cost alternative to other methods currently available. Once a method of cleavage

kDa

25

20

40

is developed, C-peptide can be expressed and we can begin utilizing it for oral

delivery experiments using B12.

7 Future Work

7.1 C-peptide Expression and Confirmation

Once the cells are lysed properly, a purification method to isolate the SUMO

Xa C-peptide will be developed. Using the Factor Xa protease, we will cleave C-

peptide from the SUMO system. We will then purify the C-peptide using Factor Xa

binding beads.

After the recombinant expression and purification of C-peptide is achieved, we

are going to run diagnostic tests that support its synthesis. This will include a

Western blot and an Enzyme-linked immune sorbent assay (ELISA), which uses

antibody recognition to confirm C-peptide’s presence. Also, Circular Dichroism (CD)

will be conducted to determine the folding state and MALDI-ToF will be performed

to support the presence of C-peptide by using its mass to charge ratio.

7.2 Oral Delivery of C-peptide

Using the 5’-carboxylic acid B12 derivative we have made, we are going to

conjugate C-peptide to B12. In order to make the oral delivery of C-peptide feasible,

C-peptide cannot lose its function when conjugated to B12. C-peptide needs to be

conjugated using its carboxyl terminus. Because a carboxylic acid and carboxylic acid

cannot be coupled, a linker will be used. We will use ethylenediamine to link the 5’-

carboxylic acid to the carboxyl terminus of C-peptide. Although this will add two

carbons, it should allow C-peptide to maintain its function in the body.

41

8 References

1. Centers for Disease Control and Prevention. National diabetes fact sheet: national estimates and general information on diabetes and prediabetes in the United States, 2011. Atlanta, GA: U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, 2011.

2. Truswell, A.S. Vitamin B12. Nutrition & Dietetics. 2007, 64, S120-S125 3. Herbert, V. Vitamin B-12: plant sources, requirements, and assay. Am J Clin

Nutr. 1988, 852-8. 4. Office of Dietary Supplements: National Institutes of Health. Dietary

Supplement Fact Sheet: Vitamin B12. http://ods.od.nih.gov/factsheets/VitaminB12-HealthProfessional/ (accessed March 30, 2013)

5. Petrus, Amanda K.; Fairchild, Timothy J.; and Doyle, Robert P. Traveling the Vitamin B12 Pathway: Oral Delivery of Protein and Peptide Drugs. Angew. Chem. Int. Ed. 2009, 48, 1022–1028.

6. Munte, C. E.; Vilela, L.; Kalbitzer, H. R.; Garratt, R. C. Solution structure of human proinsulin C-peptide. FEBS J. 2005, 272, 4284–4293.

7. Cebix. Biology of C-peptide. http://www.cebix.com/index.php/science/ (accessed April 8, 2013).

8. Clardy-James, S.; Bernstein, J. L.; Kerwood, D.; Doyle, R. P. Site Selective Oxidation of Vitamin B12 Using 2-iodoxybenzoic acid. Synlett, 2012, 23, 2363-2366.

9. Clardy, S. M.; Allis, D. G.; Fairchild, T. J.; Doyle, R. P. Vitamin B12 in Drug Delivery: breaking through the barriers to a B12 bioconjugate pharmaceutical. Expert Opin. Drug Del. 2011, 8, 127-140.

10. Shulze, A.; Giannis, A. IBX-Mediated Conversion of Primary Alcohols and Aldehydes to N-Hydroxysuccinimide Esters. Adv. Synth. Catal. 2004, 346, 252-256

11. Clardy-James, S. The Path to an Orally Administered Protein Therapeutic for the Treatment of Diabetes Mellitus. Ph.D. Dissertation, Syracuse University, Syracuse, NY, 2012.

42

Capstone Summary

Diabetes is a group of disease categorized by high levels of blood glucose

(sugar). Insulin is a hormone produced by the body that regulates blood glucose

levels. Therefore, diabetes can be a result of defective insulin production, use, or a

combination of both. The two main types of diabetes are type 1 and type 2.

Currently patients with diabetes receive most of their treatments/therapeutics,

including insulin, subcutaneously via an injection or pump. Although oral

administration of these therapeutics would be an ideal alternative route of delivery in

order to increase patience compliance and comfort, two main barriers stand in the

way. First of all, the acidic environment of the stomach and digestive system would

degrade any protein or peptide that was ingested, leaving it unable to function

properly in the body. Second of all, the body does not have a method or pathway to

absorb these peptides and proteins into the bloodstream so they would just stay in the

digestive system and would not function in the body. If these two problems could be

solved, then the oral delivery of peptides and proteins would be a feasible method to

deliver medications, improving the lives of many. The ability to deliver insulin orally

would increase the ease at which it can be administered to those with diabetes. This

could significantly increase patient compliance, lowering the complications and

deaths each year caused by diabetes.

Utilizing the Vitamin B12 uptake pathway is one proposed method of oral

delivery of protein therapeutics. The utilization of the B12 uptake pathway has been a

method of oral delivery of peptides and protein receiving increasing attention over the

43

past decade. If proteins and peptides can be linked or conjugated to B12, B12’s

pathway and mechanism for delivery within the body naturally has ways to protect

the proteins and peptides from the acidic environment in the gastrointestinal tract and

allow them to be absorbed into the bloodstream.

When coupling B12 and a peptide, protein, or any other molecule, it is

important that both entities maintain their biological function in the body. The

functional sites of the peptide, protein, or molecule must still be intact in order to

work properly once it reaches the bloodstream. In addition, the site on B12 recognized

by the proteins in its uptake pathways must still be recognizable. Therefore, vitamin

B12 only has select positions that a protein can be conjugated to.

Conjugation has most successfully occurred at (1) the 5’-hydroxyl group of

the ribose and (2) the e propionamide of the peripheral corrin ring. The 5’-hydroxyl

group of the ribose of B12 is a versatile site that could potentially be used for the

synthesis of a variety of B12 conjugates. However, limited chemistry with a hydroxyl

group can be performed and the conjugates synthesized using this site are done

through a carbamate or ester bond, which present stability issues. Also, it creates

potential for degradation or breaking of the bonds used to conjugate the two entities.

One way to solve this problem would be to change the hydroxyl group on B12 into a

group, such as a carboxylic acid, that allows for a greater variety of chemistry as well

as a more stable bond.

We investigated a way to synthesize a derivative of Vitamin B12 (B12) that

could increase the ease of its conjugation to proteins and peptides. The 5’-position of

the ribose tail of B12 was oxidized to a carboxylic acid using excess 2-iodoxybenzoic

44

acid (IBX) and 2-hydroxypyridine (HYP). The synthesis of this B12 derivative allows

for peptides, proteins, and other molecules to be conjugated to the 5’-position of the

ribose tail of B12 using a more stable amide bond instead of a carbamate bond.

In conclusion, we have successfully made a form or derivative of B12 that

could increase the ease at which B12 conjugates are made. We have shown that IBX

can be used to specifically oxidize the 5’ site of B12. The B12 derivative synthesized

was done with a yield that triples the synthesis of any other reported carboxylic acid

derivative of B12. It is also much easier to purify and quicker to make. The formation

of a derivative of B12 that has a carboxylic acid instead of a hydroxyl group available

for conjugation increases the chemistry that can be performed at the 5’ site. This will

allow higher yielding and more stable conjugates to be formed in the future. This

conjugate will be of significant use in the field of B12 conjugation chemistry.

C-peptide is a protein that is part of the proinsulin. Proinsulin is the form of

insulin before it is activated for use as a hormone in the body. After C-peptide is

cleaved from proinsulin, Insulin is released into the body in its active form, along

with the same amount of C-peptide. For a long time, C-peptide was thought to be

biologically inactive and did not have a significant role in the body. People with

diabetes therefore only received injections of supplemental insulin, not C-peptide.

However, recent studies have suggested that C-peptide may serve a regulatory role in

the body by contributing to vascular homeostasis in various tissues. For patients with

diabetes, the lack of C-peptide in combination with high blood glucose levels reduces

circulation, which can eventually lead to complications like neuropathy. Neuropathy

is the disease or dysfunction of nerves. The administration of C-peptide has the

45

potential to reduce diabetic neuropathy. Diabetic neuropathy most commonly leads to

limb amputations. Currently a subcutaneous administration of C-peptide is being

studied for use in patients with diabetes, however the ability to deliver C-peptide

orally has the potential to be more convenient for patients with diabetes and therefore

increase patient compliance. Utilization of the B12 uptake pathway by conjugating C-

peptide to the 5’-carboxylic acid derivate of B12 we have created (B12 CA), could

allow the oral delivery of C-peptide.

We have successfully created a method to recombinantely express C-peptide

using Escherichia coli or a type of bacteria. We have expressed C-peptide using a

SUMO system. The SUMO system is added in order to purify C-peptide and extract it

for use. The problem we are currently facing is cleaving or cutting C-peptide from the

SUMO system. Currently we are investigating alternative methods to solve this

problem. After this is completed, the next step will be conjugating C-peptide to B12

for oral delivery studies.

LETTER 2363

letterSite-Selective Oxidation of Vitamin B12 Using 2-Iodoxybenzoic Acid Site-Selective Oxidation of Vitamin B12Susan Clardy-James, Jaime L. Bernstein, Deborah J. Kerwood, Robert P. Doyle*Department of Chemistry, Center for Science and Technology, Syracuse University, Syracuse, NY 13244-4100, USAFax +1(315)4434070; E-mail: [email protected]: 18.06.2012; Accepted after revision: 31.07.2012

Abstract: Reaction of vitamin B12 (B12) with excess 2-iodoxyben-zoic acid and 2-hydroxypyridine leads to selective oxidation of the5 -hydroxyl group of the ribose tail of B12 in a 30% isolated yield.The acid derivative was purified in one step by HPLC chroma-tography and characterized by MALDI-TOF mass spectrometry,1H NMR and 2D (HSQC and HMBC) NMR. The new carboxylicacid derivative is perfectly suited to make stable amide-based B12bioconjugates. Key words: vitamins, oxidation, 2-iodoxybenzoic acid, carboxylicacids, cobalamin

Interest in using vitamin B12 (B12) for the oral delivery ofpeptides and proteins1 has encouraged us to further ex-plore the available conjugate sites of B12. Modifications ofB12 that allow for more facile, higher yielding or stablebioconjugate formation with continued recognition by B12dietary uptake and transport proteins have been exploredby numerous groups.2�–4 Several functional groups areavailable on B12 for conjugation, including the 5 -hydrox-yl group of the ribose tail, the cobalt(III) ion, the phos-phate moiety, and suitably modified propionamides offthe corrin ring.5 All such modifications suffer from issuesincluding reduced or complete loss of interaction with oneor more of the B12 binding proteins, stability issues that re-sult from the production of ester or carbamate bonds, lowyielding conjugation reaction due to the nature of thefunctional group, or require problematic purification ofthe modified B12 for subsequent conjugation.2�–4 Theselimitations have been well investigated6 and a review ofsuch sites has been reported,7 however, in brief for pur-poses of perspective for the work described herein: Con-jugation resulting in the recognition of all three transportproteins has been most successful with B12 at two majorsites: (i) the peripheral corrin ring e-propionamide, and(ii) the 5 -hydroxyl group of the ribose unit of the a-�‘tail�’.The side chain e-carboxylic acid derivative (Figure 1) al-lows for a variety of modifications,8 but the synthesis ofthe derivative is low yielding and requires laborious puri-fication, the result, in part, of the formation of b- and d-carboxylic acid isomers in addition to the desired e-iso-mer.9 The 5 -hydroxyl group has been cited as being amore versatile site according to structure�–activity rela-tionships, however, the conjugates have typically beensynthesized as mentioned above, through carbamate or es-ter bonds.

Figure 1 Potential sites available for carboxylic acid formation thatalso maintain, at least in part, B12 uptake protein recognition and bind-ing are indicated in red. The atom numbering scheme used for NMRdiscussion is also indicated

The goal of this work was to create a simple route for theproduction of a 5 -carboxylic acid derivative of B12 withfacile purification to ultimately produce stable amide-linked bioconjugates at this optimal position for conjuga-tion, especially in regard to intrinsic factor binding (criti-cal for oral uptake of B12 bioconjugates).10 Herein, wereport the use of the hypervalent iodine reagent, 2-iodoxy-benzoic acid (IBX) for the selective oxidation of the5 -hydroxyl group of B12 to the corresponding carboxylicacid. This is the first time IBX has been utilized for the ox-idation of such a molecule as B12 and expands the range ofuse of this environmentally friendly oxidizing agent.11 The B12 derivative was synthesized through a modifica-tion of the method developed by Giannis et al., which in-corporates the addition of an O-nucleophile to aid IBX inthe transformation of a primary alcohol into a carboxylicacid (Scheme 1).12 The use of N-hydroxysuccinimide(NHS) was initially attempted but resulted in the forma-tion of a product mixture from which it was not possibleto isolate the carboxylic acid, likely due to the formationof the activated NHS ester, which has been reported as adominating product of this reaction.12 Therefore, 2-hydroxy-pyridine (HYP) was used as the O-nucleophile. To opti-mize the reaction conditions, a series of experiments wereperformed in which the co-oxidant, temperature, and timewere varied (Table 1). The best result was obtained in the

SYNLETT 2012, 23, 2363�–2366Advanced online publication: 11.09.20120 9 3 6 - 5 2 1 4 1 4 3 7 - 2 0 9 6DOI: 10.1055/s-0032-1317160; Art ID: ST-2012-R0524-L© Georg Thieme Verlag Stuttgart · New York

Dow

nloa

ded

by: S

yrac

use

Uni

vers

ity L

ibra

ry. C

opyr

ight

ed m

ater

ial.

2364 S. Clardy-James et al. LETTER

Synlett 2012, 23, 2363�–2366 © Georg Thieme Verlag Stuttgart · New York

presence of 2.6 equivalents of IBX and 5 equivalents ofHYP in dimethyl sulfoxide (DMSO) at 60 °C.

Scheme 1 Purposed mechanism for the formation of the 5 -carbox-ylic derivative utilizing IBX and HYP

These conditions resulted in the oxidation of B12 to the5 -carboxylic acid derivative B12CA in two hours with a30% yield (see the Supporting Information). It was deter-mined that a 30% yield was optimal for the IBX reactionin this case. An increase in temperature, IBX/HYP ratios,or time resulted in an increase in the amount of byproductsand/or decomposition of the B12 (especially at tempera-tures in excess of 60 °C), reducing the yield and compli-cating purification. The 30% yield is approximately threetimes that previously reported for the preparation of the e-carboxylic acid derivative, with far easier separation (seebelow).9 The crude reaction mixture was precipitated from DMSOby ether addition and the precipitate was redissolved inwater prior to purification by ion exchange chromato-graphy using a SAX column. After a 5 minute hold at100% water, a gradient from 100% water to 35% MeCN�–phosphate buffer (pH 2; 50:50 v/v) over 5 minutes wasnecessary for the separation and elution of B12CA (Figure

2). Slight increases in pH above pH 2 resulted in a reduc-tion in the amount of pure isolated product. HPLC purifi-cation allowed the recovery and reuse of B12 startingmaterial, albeit with the oxidized 5 -aldehyde also present(Figure 2). B12CA was identified as the peak at 13.6 min-utes retention time. The purity of B12CA was at least 95%,as assayed by RP-HPLC. MALDI-TOF mass spectrome-try analysis of B12CA revealed the anticipated molecularion peak (m/z = 1343.5 [M �– CN]+; Figure 3).

Figure 2 The RP-HPLC spectra of 5 -carboxylic acid(tR = 13.6 min) monitored at 360 nm. Unreacted B12 and 5 -aldehydeco-elute at tR = ca. 5 min, as indicated by MALDI-TOF MS (see alsoFigure S1 in the Supporting Information)

Electronic absorption spectroscopy (EAS) was used to es-tablish the oxidation state of the metal center as Co(III),with no indication of derivation of the axial ligands boundto the metal center ( CA

361 = 27500 M�–1cm�–1; see Figure 4)The structure of B12CA was determined on the basis of 1HNMR (see Figure S2) and 1H�–13C heteronuclear (HSQCand HMBC) correlations (see Figures S3 and S4). The 1HNMR spectra of B12CA revealed the loss of two protons( H = 3.75 and 3.92 ppm), when compared to the spectrumof B12 (CNCbl; see Figures S2 and S5). A comparison ofthe HSQC of B12 and B12CA indicates the protons that areabsent in B12CA were originally attached to the R5 carbon( C = 63.5 ppm; see Figure S6). HMBC was attempted tofurther establish the presence of a carbonyl at the R5 po-sition (see Figure S4), however, it was not possible to as-sign the R5 carbon from the HMBC spectra because it

Table 1 Optimization of the Reaction Conditions

Entry Co-oxidant Temp (°C) Time (h) Yield (%)

1 None 50 2 17

2 HYP 50 2 23

3 HYP 50 3 26

4 HYP 50 4 28

5 HYP 50 5 22

6 HYP 60 2 30

Dow

nloa

ded

by: S

yrac

use

Uni

vers

ity L

ibra

ry. C

opyr

ight

ed m

ater

ial.

LETTER Site-Selective Oxidation of Vitamin B12 2365

© Georg Thieme Verlag Stuttgart · New York Synlett 2012, 23, 2363�–2366

showed no connectivities to any of the ribose protons, andso was assigned by HSQC.13

A simple amine-containing organic molecule, benzyl-amine, was conjugated to the derivative to help with theidentification of the R5 carbon by NMR analysis. In thepresence of 10 equivalents of ethyl-3-(3-dimethylaminopro-pyl)-carbodiimide (EDC) and 20 equivalents 1-hydroxy-benzotriazole (HOBt) in N,N-dimethylformamide (DMF)with 1% water, the desired conjugate was produced at40% yield over the first hour (Scheme 2), thus establish-ing proof-of-concept for the new B12CA.The conjugate was purified by using the same purificationmethod established for the carboxylic acid (Figure 5) andcharacterized by MALDI mass spectrometry (Figure S7)as well as 1D (Figure S8) and 2D NMR (Figures S9 andS10) spectroscopy.With the addition of the benzylamine, connectivity to theR5 carbon was established by HMBC (Figure 6). Specifi-cally, the protons of CA ( H = 4.42 and 4.50 ppm) showeddirect connectivity to the R5 carbon ( C = 173.8 ppm) aswell as to CB ( C = 140.8 ppm) and CC ( C = 131.4 ppm)

of the benzylamine. The complete assignment of B12CAand B12CABA can be found in Table S1. In conclusion, we have developed a convenient site-spe-cific oxidation of B12 using IBX and HYP. This new car-boxylic acid derivative is highly suited to the production

Figure 3 MALDI-TOF MS spectrum of HPLC peak at tR = 13.6 min,indicating B12CA (m/z = 1343.5 [M �– CN]+) with angiotensin I (m/z =1296.5) as an internal reference

Figure 4 Absorbance spectrum of 5 -carboxylic acid derivative in35% HPLC mobile phase B

Scheme 2 Synthesis of 5 -carboxylic acid plus benzylamine

Figure 5 Purification of the conjugate was established by RP-HPLCusing an SAX column with a gradient from 100% water to 35%MeCN�–phosphate buffer pH 2

Figure 6Analysis of the B12 5 -carboxylic acid benzylamine deriva-tive by 2D heteronuclear NMR spectroscopy. (A) The atom number-ing scheme for the benzylamine attached to R5 of B12 by an amidebond. (B) Signal assignments made from HSQC. (C) Signal assign-ments made from HMBC (both 1H and 13C assignment for CA weremade on the basis of HSQC analysis)

Dow

nloa

ded

by: S

yrac

use

Uni

vers

ity L

ibra

ry. C

opyr

ight

ed m

ater

ial.

2366 S. Clardy-James et al. LETTER

Synlett 2012, 23, 2363�–2366 © Georg Thieme Verlag Stuttgart · New York

of bioavailable amide bound bioconjugates. The one-steppurification is simple and the synthesis results in a 30%yield within two hours, which is far in excess of any pre-viously reported B12 carboxylic acid derivative.9 The re-sulting derivative has the potential to form high-yieldingconjugates and we believe will be of considerable use inthe field of B12 conjugation.

AcknowledgmentR.P.D. gratefully acknowledges the W. M. Wrigley Jr. company(Chicago, IL) for funding this work and iLEARN program at Syra-cuse University for funding J.L.B. We would also like to acknow-ledge Professor John Chisholm (Department of Chemistry,Syracuse University) for his insight into IBX.

Supporting Information for this article is available online athttp://www.thieme-connect.com/ejournals/toc/synlett.Supporting InformationSupporting Information

References and Notes(1) (a) Fazen, C. H.; Valentin, D.; Fairchild, T. J.; Doyle, R. J.

J. Med. Chem. 2011, 54, 8701. (b) Petrus, A. K.; Vortherms, A. R.; Fairchild, T. J.; Doyle, R. P. ChemMedChem 2007, 12, 1717.

(2) (a) Smeltzer, C. C.; Cannon, M. J.; Pinson, P. R.; Munger, J. D.; West, F. G.; Grissom, C. B. Org. Lett. 2001, 3, 799. (b) Bauer, J. A.; Morrison, B. H.; Grane, R. W.; Jacobs, B. S.; Dabney, S.; Gamero, A. M.; Carnevale, K. A.; Smith, D. J.; Drazba, J.; Seetharam, B.; Lindner, D. J. J. Natl. Cancer I. 2002, 94, 1010. (c) Kunze, S.; Zobi, F.; Kurz, P.; Spingler, B.; Alberto, R. Angew. Chem. 2004, 116, 5135. (d) Bagnato, J. D.; Eilers, A. L.; Horton, R. A.; Grissom, C. B. J. Org. Chem. 2004, 69, 8987. (e) Mundwiler, S.; Spingler, B.; Kurz, P.; Kunze, S.; Alberto, R. Chem. Eur. J. 2005, 11, 4089. (f) Ruiz-Sanchez, P.; Mundwiler, S.; Medina-Molner, A.; Spingler, B.; Alberto, R. J. Organomet. Chem. 2007, 692, 1358. (g) Ruiz-Sanchez, P.; Mundwiler, S.; Alberto, R. Chimia 2007, 61, 190. (h) Ruiz-Sanchez, P.; Mundwiler, S.; Spingler, B.; Buan, N. R.; Escalante-Semerena, J. C.; Alberto, R. J. Biol. Inorg. Chem. 2008, 13, 335. (i) Mukherjee, R.; Donnay, E. G.; Radomski, M. A.; Miller, C.; Redfern, D. A.; Gericke, A.; Damron, D. S.; Brasch, N. E. Chem. Commun. 2008, 3783. (j) Ruiz-Sanchez, P.; Konig, C.; Ferrari, S.; Alberto, R. J. Biol. Inorg. Chem. 2011, 16, 33.

(3) (a) Collins, D. A.; Hogenkamp, H. P. C. J. Nucl. Med. 1997, 38, 717. (b) van Staveren, D. R.; Mundwiler, S.; Hoffmanns, U.; Pak, J. K.; Spingler, B.; Metzler-Notle, N.; Alberto, R. Org. Biomol. Chem. 2004, 2, 2593. (c) van Staveren, D. R.; Waibel, R.; Mundwiler, S.; Schubiger, P. A.; Alberto, R. J. Organomet. Chem. 2004, 689, 4803. (d) Spingler, B.; Mundwiler, S.; Ruiz-Sanchez, P.; van Staveren, D. R.; Alberto, R. Eur. J. Inorg. Chem. 2007, 18, 2641. (e) Waibel, R.; Treichler, H.; Schaefer, N. G.; van Staveren, D. R.; Mundwiler, S.; Kunze, S.; Kuenzi, M.; Alberto, R.; Nuesch, J.; Knuth, A.; Moch, H.; Schibli, R.; Schubiger, P. A. Cancer Res. 2008, 68, 2904.

(4) (a) McEwan, J. F.; Veitch, H. S.; Russell-Jones, G. J. Bioconjugate Chem. 1999, 10, 1131. (b) McGreevy, J. M.; Cannon, M. J.; Grissom, C. B. J. Surg. Res. 2003, 111, 38. (c) Wang, X.; Wei, L.; Kotra, L. Bioorg. Med. Chem. 2007, 15, 1780. (d) Viola-Villegas, N.; Rabideau, A. E.; Cesnavicious, J.; Zubieta, J.; Doyle, R. P. ChemMedChem 2008, 3, 1387. (e) Lee, M.; Grissom, C. B. Org. Lett. 2009, 11, 2499. (f) Siega, P.; Wuerges, J.; Arena, F.; Gianolio, E.; Fedosov, S. N.; Dreos, R.; Geremia, S.; Aime, S.; Randaccio, L. Chem. Eur. J. 2009, 15, 7980. (g) Viola-Villegas, N.; Rabideau, A. E.; Bartholoma, M.; Zubieta, J.; Doyle, R. P. J. Med. Chem. 2009, 52, 5253. (h) Clardy-James, S.; Allis, D. G.; Fairchild, T. J.; Doyle, R. P. MedChemComm 2012, 3, 1054.

(5) (a) Proinsias, K.; Giedyk, M.; Loska, R.; Chrominski, M.; Gryko, D. J. Org. Chem. 2011, 76, 6806. (b) Proinsias, K.; Sessler, J. L.; Kurcon, S.; Gryko, D. Org. Lett. 2010, 12, 4674. (c) Krautler, B. Biochem. Soc. Trans. 2005, 33, 806.

(6) (a) Wuerges, J.; Geremia, S.; Randaccio, L. Biochem. J. 2007, 403, 431. (b) Pathare, P. M.; Wilbur, D. S.; Heusser, S.; Quadros, E. V.; McLoughlin, P.; Morgan, A. C. Bioconjugate Chem. 1996, 7, 217. (c) Marchaj, A.; Jacobsen, D. W.; Savon, S. R.; Brown, K. L. J. Am. Chem. Soc. 1995, 117, 11640.

(7) (a) Nielsen, M. J.; Rasmussen, M. R.; Andersen, C. B. F.; Nexo, E.; Moestrup, S. K. Nat. Rev. Gastroenterol. Hepatol. 2012, 9, 345. (b) Gruber, K.; Puffer, B.; Krautler, B. Chem. Soc. Rev. 2011, 40, 4346. (c) Clardy, S.; Allis, D. G.; Fairchild, T. J.; Doyle, R. P. Expert Opin. Drug Deliv. 2010, 8, 127. (d) Brown, K. L. Chem. Rev. 2005, 105, 2075.

(8) (a) Russell-Jones, G. J.; Westwood, S. W.; Farnworth, P. G.; Findlay, J. K.; Burger, H. G. Bioconjugate Chem. 1995, 6, 34. (b) Wilbur, D. S.; Hamlin, D. K.; Pathare, P. M.; Heusser, S.; Vessella, R. L.; Buhler, K. R.; Stray, J. E.; Daniel, J.; Quadros, E. V.; McLoughlin, P.; Morgan, A. C. Bioconjugate Chem. 1996, 7, 461. (c) Alsenz, J.; Russell-Jones, G. J.; Westwood, S.; Levet-Trafit, B.; de Smidt, P. C. Pharm. Res. 2000, 17, 825.

(9) (a) Yamada, R.; Hogenkamp, H. P. C. J. Biol. Chem. 1972, 247, 6256. (b) Frenkel, E. P.; Kitchens, R. L.; Prough, R. J. Chromatogr. 1979, 174, 393. (c) Anton, D. L.; Hogenkamp, H. P. C.; Walker, T. E.; Matwiyoff, N. A. J. Am. Chem. Soc. 1980, 102, 2215. (d) Marques, H. M.; Scooby, D. C.; Victor, M.; Brown, K. L. Inorg. Chim. Acta 1989, 162, 151. (e) Shchavlinskii, A. N.; Neiman, A. V.; Lazareva, N. P.; Orlov, S. V. Pharm. Chem. J. 1995, 29, 722.

(10) (a) Allis, D. G.; Fairchild, T. J.; Doyle, R. P. Mol. Biosyst. 2010, 6, 1611. (b) Wuerges, J.; Garau, G.; Geremia, S.; Fedosov, S. N.; Petersen, T. E.; Randaccio, L. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 4386. (c) Fedosov, S. N.; Grissom, C. B.; Fedosova, N. U.; Moestrup, S. K.; Nexo, E.; Petersen, T. E. FEBS J. 2006, 273, 4742.

(11) Kirsch, S. F.; Duschek, A. Angew. Chem. Int. Ed. 2011, 50, 1524.

(12) (a) Mazitschek, R.; Mulbaier, M.; Giannis, A. Angew. Chem. Int. Ed. 2002, 41, 4059. (b) Schulze, A.; Giannis, A. Adv. Synth. Catal. 2004, 346, 252.

(13) (a) Calafat, A. M.; Marzilli, L. G. J. Am. Chem. Soc. 1993, 115, 9182. (b) Pagano, T. G.; Marzilli, L. G. Biochemistry 1989, 28, 7213.

Dow

nloa

ded

by: S

yrac

use

Uni

vers

ity L

ibra

ry. C

opyr

ight

ed m

ater

ial.

the conjugation of protein and peptide therapeutics to ... · simple amine-containing organic...

Documents