of May 17, 2018.This information is current as

Typesat Least Six Structurally Distinct Receptor

EncodingA Highly Diverse Multigene Family The Chicken Leukocyte Receptor Complex:

Thomas W. GöbelSchmitt, Martien A. M. Groenen, Louis Du Pasquier and Birgit C. Viertlboeck, Felix A. Habermann, Ramona

http://www.jimmunol.org/content/175/1/385doi: 10.4049/jimmunol.175.1.385

2005; 175:385-393; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/175/1/385.full#ref-list-1

, 22 of which you can access for free at: cites 47 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2005 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

The Chicken Leukocyte Receptor Complex: A Highly DiverseMultigene Family Encoding at Least Six Structurally DistinctReceptor Types1

Birgit C. Viertlboeck,* Felix A. Habermann,† Ramona Schmitt,* Martien A. M. Groenen,‡

Louis Du Pasquier,§ and Thomas W. Gobel2*

The chicken Ig-like receptors (CHIR) have been described as two Ig domain molecules with long cytoplasmic tails containinginhibitory motifs. In this study, we demonstrate that CHIR form a large family, with multiple members showing great sequencevariability among members as well as a great diversity in domain organization and properties of the transmembrane and cyto-plasmic segments. We characterize various novel receptor types with motifs indicative of inhibitory, activating, or both functions.In addition to the inhibitory receptors with two ITIM, receptors with a single immunoreceptor tyrosine-based switch motif orreceptors lacking a cytoplasmic domain were isolated. Activating receptors with a short cytoplasmic domain and a transmembranearginine assembled with the newly identified chicken Fc�RI� chain. Three bifunctional receptor types were characterized com-posed of one or two C2-type Ig-like domains, a transmembrane region with a positively charged residue and combinations ofcytoplasmic motifs such as ITIM, immunoreceptor tyrosine-based switch motif, and YXXM. RT-PCR revealed distinct expressionpatterns of individual CHIR. All receptor types shared a conserved genomic architecture, and in single Ig domain receptors apseudoexon replaced the second Ig exon. Southern blot analyses with probes specific for the Ig1 domain were indicative of a largemultigene family. Of 103 sequences from the Ig1 domain of a single animal, 41 unique sequences were obtained that displayedextensive variability within restricted Ig regions. Fluorescence in situ hybridization localized the CHIR gene cluster to micro-chromosome 31 and identified this region as orthologous to the human leukocyte receptor complex. The Journal of Immunology,2005, 175: 385–393.

I nhibitory receptors have been the focus of intensive researchin the past years (1, 2). They can be grouped into type Itransmembrane molecules belonging to the Ig family and in

C-type lectin family members. The unifying feature of these re-ceptors is their ability to attenuate cellular activation by cytoplas-mic ITIM, a 6-aa sequence composed of (I/V/L/S)-X-Y-X-X-(L/V), in which X denotes any amino acid (3). The ligation of thereceptors leads to Src family kinase-mediated tyrosine phosphor-ylation and successive recruitment of Src homology domain phos-phatases, such as Src homology region 2 domain-containing phos-phatase-1 (SHP-1),3 SHP-2, and SHIP. These phosphatasesdephosphorylate a number of intracellular substrates and neutralizestimulatory signals mediated by activating receptors (4, 5).

Certain receptors such as KIR2DL5, 2B4, CD150, and Ly-9have a cytoplasmic immune receptor tyrosine-based switch motif

(ITSM), a modification of the ITIM, in which the first amino acidis replaced by a threonine. The ITSM recruits both the signalinglymphocyte achration molecule-associated protein signaling lym-phocyte achration molecule-associated protein and SHP-2 (6, 7).

Inhibitory receptors are frequently expressed on the cell surfacein combination with activating counterparts that share a highlyhomologous extracellular domain, but lack the cytoplasmic ITIM.Instead, a positively charged transmembrane residue such as a ly-sine present in most activating killer Ig-like receptors (KIR) or anarginine found in the leukocyte Ig-like receptors (LILR) mediatesthe association to adaptor molecules that transduce signals into thecell after ligand binding. These adaptors are shared by a widerange of cell surface receptors such as the TCR and FcR. Theactivating KIR associate with the DAP12 signaling molecule,whereas the LILR use the Fc�RI� chain (8). The pairs of inhibitoryand activating receptors may recognize different ligands, but theycan also bind highly related ligands, and the cellular response isdetermined by the strength of the opposing signals.

KIR2DL4 and NKp44 are unique primate NK cell receptorsbecause they have a positively charged transmembrane residue anda single cytoplasmic ITIM. KIR2DL4 is expressed on all NK cells,and it has been shown to bind to the nonclassical HLA-G moleculeexpressed on fetally derived trophoblast cells (9). AlthoughKIR2DL4 is capable of inducing cytotoxicity in previously acti-vated NK cells, in resting NK cells it only triggers IFN-� secretion(10). Mutations of the charged transmembrane residue convertedKIR2DL4 to an inhibitory receptor (11). NKp44 is associated withthe disulfide-linked homodimeric adaptor protein DAP12, and it isonly expressed by activated NK cells. It has been demonstratedthat the presence of the cytoplasmic ITIM does not inhibit theNKp44-mediated NK cell activation (12, 13).

*Institute for Animal Physiology, University of Munich, Munich, Germany; †Chair ofAnimal Breeding, Technical University of Munich, Freising, Germany; ‡AnimalBreeding and Genetics Group, Wageningen University, Wageningen, Netherlands;and §Institute of Zoology, University of Basel, Basel, Switzerland

Received for publication February 28, 2005. Accepted for publication April 12, 2005.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by grants from the Deutsche Forschungsgemeinschaft(489/3-3, 489/3-4).2 Address correspondence and reprint requests to Dr. Thomas W. Gobel, Institute forAnimal Physiology, Veterinarstrasse 13, 80539 Munchen. E-mail address:thomas.goebel@tiph.vetmed.uni-muenchen.de3 Abbreviations used in this paper: SHP, Src homology region 2 domain-containingphosphatase; BAC, bacterial artifical chromosome; CHIR, chicken Ig-like receptor;DAPI, 4�,6�-diamidino-2-phenylindole; FISH, fluorescence in situ hybridization; GC,germinal center; ITSM, immunoreceptor tyrosine-based switch motif; KIR, killer cellIg-like receptor; LILR, leukocyte Ig-like receptor; LRC, leukocyte receptor complex.

The Journal of Immunology

Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

In humans, various Ig-like inhibitory receptor families are foundat different chromosomal locations. The leukocyte receptor com-plex (LRC; human chromosome 19q13.4) comprises several fam-ilies, such as the LILR, KIR, leukocyte-associated Ig-like recep-tors, and the natural cytotoxicity receptor NKp46 (14, 15). Thetriggering receptors expressed by myeloid cell gene cluster withthe NKp44 gene are located on chromosome 6 �10 megabase pairfrom the MHC class II region (16), and the related CMRF35 clus-ter is found on chromosome 17 (17). These families contain mul-tiple activating and inhibitory receptors with variable numbers ofIg-like extracellular domains. The different types of the Ig domainspresent in the various receptors allow further classification intosingle V-type receptors (NKp30, NKp44), C2-type receptors(LILR, KIR), and combinations like in Siglec (N-terminal IgV andmultiple IgC2) (18).

The characterization of homologous gene families in other non-mammalian vertebrates has been limited to the fish and thechicken. Novel immune type receptors have been analyzed in de-tail in various fish such as pufferfish, zebrafish, and channel catfish.These receptors have a unique combination of an IgV and a V-likeIgC2 domain and differ in this aspect to all receptors found inmammals. The novel immune type receptors show extraordinaryvariation with multiple activating and inhibitory family members(19, 20). The function and potential ligands of these receptors arelargely unknown.

Recently, five chicken Ig-like receptor (CHIR) have been ana-lyzed in the chicken. All of them had two IgC2 domains and couldbe further classified into four inhibitory receptors (CHIR-B1 toCHIR-B4) and a single putative activating receptor CHIR-A (21)that has a positively charged histidine residue located at an atypicallocation in the transmembrane domain. The detailed analysis of theinhibitory receptor CHIR-B2 indicated that this receptor is mainlyexpressed on B lymphocytes and inhibits proliferation by highlyconserved signaling mechanisms (22).

In this study, we extend the analyses of the CHIR family bycharacterizing novel receptor types, including a typical activatingreceptor and a novel inhibitory receptor form that has an ITSM.Most importantly, we describe unique bifunctional receptors con-taining both activating and inhibitory motifs. Fluorescence in situhybridization (FISH) analyses clearly defined the CHIR gene clus-ter as orthologous to the LRC in mammals. The complexity ob-served in Southern blots and sequences of �100 CHIR Ig domainsrevealed an enormous degree of variability. These data suggest thatCHIR represent a unique receptor family with multiple diversifiedgenes that encode different receptor forms to modulate the immuneresponse.

Materials and MethodsAnimals

Chicken lines H.B19 (B19), H.B21 (B21), and M11 (B2) are homozygousfor the MHC allele, as indicated, and CB (B12) chickens represent a highlyinbred chicken line. M11 and CB chicken eggs were kind gifts from S.Weigend (Marieusee, Germany) and J. Plachy (Prague, Czech Republic),respectively. All chickens were hatched at the institute, and experimentswere performed at the age of 3–10 wk.

Expressed sequence tag (EST) database searches

CHIR-specific EST clones were identified by a BLAST search (22) withthe published CHIR-B sequences in the program (23) against the “Gallusgallus” EST databases. To identify the chicken Fc�RI� chain, the humanmRNA sequence was used for mining the EST database. Candidate se-quences were further analyzed using the DNASTAR Lasergene softwarepackage (GATC); Konstanz including sequence assembly programs. As-sembled sequences were used to identify putative coding sequences and todesign primers for PCR analysis.

Cell preparations and cloning procedures

Lymphocytes from bursa, thymus, spleen, and blood were prepared usingstandard procedures. T cells were activated with Con A by exposingsplenocytes to 10 �g/ml Con A for 24 h and harvested after 72 h. Intestinalintraepithelial lymphocytes were prepared as described before (24), andCD3�CD8� were FACS sorted from splenocytes and expanded in vitrowith chicken rIL-2 (25).

Cellular total RNA was prepared using either TRIzol (Invitrogen LifeTechnologies) or Absolutely RNA RT-PCR Miniprep kit (Stratagene), andcDNA synthesis was performed with the Revert H Minus First StrandcDNA Synthesis kit (MBI Fermentas). For cloning, Herculase EnhancedDNA Polymerase (Stratagene) was used for PCR at 2 min of denaturationat 95°C, 35 cycles of 10 s at 95°C, 30 s at primer specific temperature, 2min at 72°C, and a final extension time of 10 min at 72°C. For PCRexpression analyses, TaqDNA Polymerase (Brinkman Instruments) wasused at same conditions, but only 30 cycles of amplification. Primer se-quences and their specific temperatures for cloning and expression analysesare summarized in Table I. PCR products were cloned into a pcDNA3.1/V5-His TOPO Vector (Invitrogen Life Technologies); colonies werescreened by PCR; and plasmids from positive colonies were isolated usingthe NucleoSpin Plasmid Kit (Macherey-Nagel) and sequenced (GATC).Deduced amino acid sequences were further analyzed using PSORT(�http://psort.nibb.ac.jp/form2.html�) and PSIpred (�http://bioinf.cs.ucl.ac.uk/psipred/�) (26) for secondary structure prediction. The sequence vari-ability of the Ig1 domain was calculated using the Shannon Entropy function(27) (�http://immunax.dfci.harvard.edu/bioinformatics/Tools/svs.html�). Themodeling was performed using SWISS-Model (�http://swissmodel.expasy.org//SWISS-MODEL.html�).

The N-terminally FLAG-tagged Fc�RI� chain was cloned using primers554–555 with EcoRI sites and ligated in a modified pcDNA6/V5-His Avector with the chicken MHC class I signal peptide and an N-terminalFLAG epitope, as described previously (22). The N-terminally V5-taggedCHIR-A2 was cloned by linking PCR. Briefly, full-length CHIR-A2 cDNAwas used as template for primers 694–509 to introduce the 3� part of theV5 epitope in front of the IG1 domain, and the modified pcDNA6/V5-Hisvector was partly amplified with primers 306–693 to introduce the 5� partof V5 behind the MHCI signal peptide. Both PCR products were gel pu-rified with NucleoSpin ExtractII (Macherey-Nagel) and used as a templatewith primers 306–509. This PCR product was cloned into a pcDNA3.1/V5-His TOPO vector (Invitrogen Life Technologies), as described above.The FLAG-tagged human DAP12 was a gift from K. Campbell (Fox ChaseCenter, Philadelphia, PA).

Genomic DNA was prepared from B2, B12, B19, and B21 chickenerythrocytes with the Qiagen Genomic DNA kit, and 250 ng of B19 DNAwas used in PCR.

For Southern blot analysis, 10 �g of genomic DNA samples from B2,B12, B19, and B21 chicken was digested with PstI, SacI (MBI Fermentas),and Sau3AI (New England Biolabs); separated on 1% agarose gel; andblotted onto a Hybond N Membrane (Amersham Biosciences). The IG1domain of CHIR-A2 was cloned by PCR, and the resulting plasmid wasamplified and digested with BstXI (MBI Fermentas). The probe was 32Plabeled using the High Prime DNA Labeling kit (Roche) and hybridized tothe membrane using the QuickHyb Hybridization Solution (Stratagene) at60°C for 2 h.

Cell lines, transfection, and staining

Human embryonic kidney 293T cells (28), the chicken B cell lines 2D8(29) and LSCC-RP-9, and the chicken T cell line UG-9 were maintained inRPMI 1640 medium with Glutamax (Invitrogen Life Technologies) sup-plemented with 10% FCS, 1% penicillin/streptomycin in a CO2 incubatorat 37°C and 40°C, respectively. Chicken macrophage cell lines BM-2 andHD11 were maintained in RPMI 1640 medium supplemented with 8%FCS, 2% chicken serum, and 1% penicillin/streptomycin at 40°C. The293T cells were transfected using the Metafectene reagent (Biontex), ac-cording to the manufacturer’s protocol. After 24 h of transient transfection,cells were used for staining with a mouse anti-V5 mAb (Invitrogen LifeTechnologies), followed by an incubation with an anti-mouse Ig-FITC con-jugate (Southern Biotechnology Associates), and analyzed with a FACScan(BD Biosciences) using the CellQuest software.

FISH

A 1.2-kb fragment of the genomic CHIR-A2 sequence spanning exons 1–5was amplified and labeled by PCR in 40-�l reactions containing 8 ng ofplasmid DNA as template; 1� PCR buffer (Qiagen); 2.5 mM MgCl2; 200�M each of dATP, dCTP, and dGTP; 160 �M dTTP; 500 nM primer 474and 509 (Table I); 0.05 U/�l HotStar Taq polymerase (Qiagen); and 16 �M

386 CHIR GENE FAMILY

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

tetramethylrhodamine TAMRA-dUTP (Applied Biosystems). The cyclingprofile was 15 min at 95°C, 25 cycles with 60 s at 94°C, 60 s at 60°C, and120 s at 72°C. Amplification products were partially digested with DNase(Sigma-Aldrich) to an average fragment size of 150 bp. To identify thechicken chromosome carrying CHIR-A2, the gene fragment was cohybrid-ized with two BAC probes in different colors: bacterial artifical chromo-some (BAC)-DNA from clones WAG-87P2 and WAG-27N2 were labeledwith biotin-dUTP (Roche) and DNP-dUTP (Applied Biosystems), respec-tively, by standard nick translation.

Individual probes were mixed and ethanol precipitated with 20-fold ex-cess of chicken cot-1-DNA and resuspended in hybridization buffer con-taining 50% (v/w) formamid, 2� SSC, and 10% dextrane sulfate. Finalconcentration of each probe was �10 ng/�l.

The probe mixture was denatured at 80°C for 5 min and cooled on iceuntil application to the slides. Probes were hybridized to metaphase spreadsfrom normal embryonic chicken fibroblasts. Before FISH, metaphasespreads were stained with 4�,6�-diamidino-2-phenylindole (DAPI) and im-aged, as described below. Hybridization for 16 h at 37°C was followed byhigh stringency washing for 2 � 5 min at 62°C in 0.1� SSC. Hybridizationof biotin-labeled probe was visualized with streptavidin-Cy5 (Rockland),while DNP was detected using goat anti-dinitrophenol antiserum (Sigma-Aldrich) and Cy5.5-conjugated anti-goat IgG antiserum (Rockland). Slideswere counterstained with DAPI and mounted with Vectashield antifadesolution (Vector Laboratories).

Fluorescence microscopy

Metaphase spreads were analyzed using an epifluorescence microscope(Zeiss Axioplan 2) equipped with a PlanApochromat �63/1.4 oil immer-sion objective and appropriate narrow bandpass filter sets (AHF Analysen-technik). Digital images were acquired by a peltier-cooled black and whitecharge-coupled device camera (AxioCam; Zeiss) using Axiovision soft-ware (Zeiss). Greyscale single channel images were overlaid to a red,green, blue image, assigning a false color to each channel.

ResultsNovel CHIR genes encoding activating, inhibitory, andbifunctional receptors

The EST database search for CHIR genes allowed the identifica-tion of highly conserved regions in the CHIR genes suited forRT-PCR amplification. Several cDNAs derived from PBL, spleen,

and in vitro IL-2-expanded CD3�CD8� cells were amplified usinga set of CHIR-specific primers (Table I). By cloning and sequenc-ing, five novel CHIR types were identified4 (Fig. 1A). CHIR can begrouped into inhibitory receptors (CHIR-B) with a long cytoplas-mic domain containing ITIM, activating receptors (CHIR-A) witha short cytoplasmic tail, and a positively charged transmembraneregion as well as bifunctional receptors (CHIR-AB) combininginhibitory and activating features. All isolated CHIR gene weregerminal center (GC) rich with �60% GC content.

The extracellular domains of CHIR-A, CHIR-B, and CHIR-AB3 genes have two C2-type Ig domains, while CHIR-AB1 andCHIR-AB2 have only a single Ig domain. The membrane-distalIg1 domain and the membrane-proximal Ig2 domain of a givenCHIR share only �20–25% amino acid identity. In contrast, theseparate comparison of all CHIR Ig1 and of all CHIR Ig2 domainsrevealed 60–90% amino acid identity.

Features of the transmembrane region can be used to furtherclassify the different CHIR. A positively charged amino acid (ar-ginine or lysine) was found in a typical position in all CHIR-A andCHIR-AB, which most likely mediates the association to an adap-tor molecule. Except CHIR-AB3, all CHIR had a conserved trans-membrane cysteine residue close to the extracellular domain withthe potential to mediate dimerization, which we have already dem-onstrated for CHIR-B2 (22). The analysis of the periodicity of the�-helical transmembrane region showed that the transmembranecysteine is situated opposite to the charged arginine or lysine, in-dicating that a cysteine-mediated dimerization would not interferewith the association of an adaptor molecule to the charged residue

4 The sequences presented in this article have been submitted to GenBank under thefollowing accession number(s): AF306851, CHIR-A1; AJ745093, CHIR-A2;AJ639839, CHIR-B4; AJ879908, CHIR-B5; AJ879910, CHIR-B6; AJ745094, CHIR-AB1; AJ745095, CHIR-AB2; AJ879909, CHIR-AB3; AJ745098, CHIR-A2 genomic;AJ879911, CHIR-B4 genomic; AJ745097, CHIR-AB1 genomic; AJ745096, CHIR-AB2 genomic; CHIR-Ig1 to CHIR-Ig41, AJ879951 to AJ879991.

Table I. Oligonucleotides

No.a Sequenceb Specificity Locationc

474s GGATCCATCATGGCACCAATGGCCGTGGCCCTC CHIR SP (I)453as AAGCCATTTAATCTCTTGCCCACC CHIR-B6 CY (V)d

509as GAATTCTAAATCCCTTCCCCACCCAG CHIR-A2 CY(V)551as GAATTCTCAGCGCGGTAAATCAGT CHIR-AB1/AB2 Ig1 (III)574as GCACACCGAGCACACTGGCAC CHIR-B4/B5/AB3 CY (VII)554s GAATTCCTGGCAGAGCCGGAGCTGTG Fc�RI� chain555as GAATTCGGTCCGAACTCAGGCTTTGTGC Fc�RI� chain306s AAGGATCCCTTGAGAGTGCAGCGGTGCGA MHC signal peptide694s CCTAACCCTCTCCTCGGTCTCGATTCTACGCAGCAATTGCCCCAA CHIR-A2-V5 construct693as ACCGAGGAGAGGGTTAGGGATAGGCTTACCGGCCGCCGCCCCGCA CHIR-A2-V5 construct650s TGCCCCGACCCTCCCTGT Ig1 domains Ig1 (III)651as CAGCTCCACGGGGTCACTC Ig1 domains Ig1 (III)652s CAATGGAACTCTGAGATTTGAC CHIR-AB1 Ig1 (III)653as TCGGGCATCTCAGGGGC CHIR-AB1 CY (V)654s TGGCACAATGGAACTCTGAGATTTAAG CHIR-AB2 Ig1 (III)655as CCAGAGGCTGCAGCCATTGAAGTA CHIR-AB2 TM (IV)656s GAGGGAAAGTGGAGATCCAGA CHIR-AB3 Ig1 (III)657as GAACAGAAGGCAGCAGCCC CHIR-AB3 Ig2 (IV)658s GAAGAAAAGTTGAGATCCAGC CHIR-B4 Ig1 (III)659as ACAGAAGGTAGGAGCCCC CHIR-B4 Ig2 (IV)660s CAAAATCCAACATACATCGAGCAG CHIR-B5 Ig1 (III)661as AACAGAAGGCAGCAGCCCCT CHIR-B5 Ig2 (IV)662s GCCAAGTACAGTGACAAGAAG CHIR-A2 Ig1 (III)663as GGGTGAAGGGAGATATGAGG CHIR-A2 Ig2 (IV)

a s and as indicate sense and antisense primers, respectively.b Restriction sites are underlined and the V5 epitope is indicated by bold italic letters; primers 652–663 used for mRNA expression analyses.c The location of the primers (exons in parentheses) is indicated.d CY, cytoplasmic; TM, transmembrane.

387The Journal of Immunology

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

(Fig. 1B). In contrast, the previously characterized CHIR-A1 mol-ecule lacks the conserved lysine or arginine, but has a positivelycharged histidine located 16 aa below the conserved cysteine (21).This would place both the cysteine and the histidine to the sameside of the �-helix, preventing either the dimerization or the as-sociation with an adaptor molecule. CHIR-A1 resembles in manyaspects CHIR-B6 (Fig. 1A), both of which lack an extended cyto-plasmic region and a prototypic charged transmembrane residue.

The formerly identified inhibitory receptors CHIR-B1 toCHIR-B4 all displayed two cytoplasmic ITIM (22); however, inCHIR-B5 an N-terminal ITIM and a C-terminal ITSM were found(Fig. 1A). CHIR-AB1 and 2 both contain a long cytoplasmic re-gion with a single ITIM located at the position of the C-terminalITIM of CHIR. Inspection of the position of the N-terminal ITIMrevealed a switch to a methionine at position �3 related to theconserved tyrosine that generated a YXXM motif, which is foundin activating signal molecules such as DAP10. Finally, CHIR-AB3displayed an ITIM and ITSM in combination with a positive trans-membrane residue.

Mining of chicken EST databases revealed that several cloneswith significant nucleotide sequence similarity to CHIR geneshave been sequenced (30). The EST clone Riken_19p13 (accessionAJ720544) resembles a full-length homologue of CHIR-AB1 shar-ing 96% nucleotide identity. It is composed of a 33-bp 5� untrans-

lated, a 657-bp coding sequence, and a 585-bp 3� untranslated thatlacks any typical polyadenylation signal (AATAAA or ATTAAA),but has several potential sites of the consensus NNTANA (31).

Collectively, by sequence analyses, CHIR can be classified intoat least six different forms, including inhibitory receptors withITIM and ITSM, receptors lacking a cytoplasmic domain, activat-ing type receptors with positively transmembrane residues, andmultiple forms with one or two Ig domains, charged transmem-brane residues, and a combination of YXXM, ITIM, and ITSM.

CHIR are expressed in different leukocytes

The cell type-specific expression of the various known Ig-like re-ceptors differs markedly. Some families such as KIR are restrictedto NK cells and CTLs. In contrast, LILR are expressed by a widerange of myeloid and lymphoid cells. To evaluate the cell type-specific expression pattern of CHIR, their nucleotide sequenceswere aligned, and regions with low sequence similarity were se-lected to design primers that were specific for seven individualCHIR genes (Table I). These primers were used in RT-PCR ofRNA from freshly isolated cells of chicken lymphoid organs, invitro IL-2-expanded cells, and several cell lines (Fig. 2). Ampli-fication of �-actin served as a control of cDNA integrity, andCHIR-containing plasmids were included to demonstrate the sizeof the amplicon. Each of the analyzed genes showed a different

FIGURE 1. Different CHIR structures. A, The alignment of the newly identified CHIR was performed using Clustal W. For comparison, CHIR-B4 andCHIR-A1 were included in the alignment. The various parts of the receptors (SP, signal peptide; TM, transmembrane; CY, cytoplasmic) were alignedseparately, and the location of the exon boundaries is indicated by vertical bars. The position of secondary structure elements such as Ig �-strandsand �-helices is displayed above the sequences. Positively charged transmembrane residues (boxed), ITIM (solid lines), ITSM (boxed), and YXXM (dashedboxes) are indicated. B, Model showing the �-helical transmembrane topology of different CHIR with cysteines and positively charged residues indicated.

388 CHIR GENE FAMILY

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

RNA expression pattern. Except CHIR-AB2, which was only de-tected in the macrophage cell line BM-2, all other CHIR geneswere found to be expressed in several tissues and cell lines (Fig. 2).The CHIR-B5-specific primers amplified two DNA species: the500-bp product observed in several tissues was obtained fromgenomic DNA (as verified by sequencing), whereas the 420-bpproduct was obtained from cDNA. Notably, no RNA expression ofany of the CHIR genes could be detected in bursa and thymus.These analyses provide evidence for restricted expression patternsof individual CHIR.

CHIR-A2 associates with the Fc�RI� chain

The positively charged transmembrane residue present in CHIR-Aand CHIR-AB suggested that these receptors interact with adaptormolecules such as DAP12 or Fc�RI�. Database mining allowed us toidentify an EST clone (accession BQ484203) with high sequencesimilarity to the human Fc�RI� chain. The deduced amino acidsequence of the chicken Fc�RI� gene shares �60% identity with thehuman homologue. The chicken DAP12 homologue could not befound in the databases. Because the adaptor molecules are usuallyconserved and allow cross-species interaction (32), the human DAP12gene was used in the assays instead of the chicken gene.

The adaptor molecules were tagged with a FLAG epitope tocheck for expression after transfection, while a V5 epitope wasattached to CHIR-A2 for surface staining. Single transfection ofCHIR-A2-V5 into 293-T cells did not induce surface expression ofCHIR-A as determined by negative anti-V5 staining. Followingcotransfection of CHIR-A2-V5 together with Fc�RI�-FLAG, the

anti-V5 mAb detected �19% of surface-positive cells (Fig. 3;mean fluorescence intensity 53 as compared with 14 in singletransfections). In contrast, the DAP12-FLAG construct was unableto restore surface expression of CHIR-A2 (Fig. 3). Both adaptorswere expressed well in the 293-T cells, as detected by anti-FLAGcontrol staining (data not shown). Similar experiments were per-formed with CHIR-AB1 and CHIR-AB2; however, both of thesemolecules were expressed on the cell surface without cotransfec-tion of an adaptor molecule, and the expression levels were notincreased after cotransfections (data not shown). In summary,CHIR-AB seems to be expressed without DAP12 or Fc�RI�;CHIR-A2 is associated with the Fc�RI� chain.

Single Ig domain CHIR have a pseudoexon instead of theIg2 domain

As a next step in the analysis of CHIR, PCR on genomic DNA wasperformed to characterize the genomic structure of the differentCHIR types. The genomic sequences isolated shared between 94and 98% identity with the cDNA sequences. All analyzed CHIRgenes displayed a highly conserved exon-intron organization (Fig.4). The signal peptide was encoded by two exons; each Ig domainwas located on a separate exon, followed by a transmembraneexon, and in the case of CHIR-B and CHIR-AB two cytoplasmicexons. All exon-intron boundary sequences followed the gt-agrule. The cytoplasmic exons were in phase 0, whereas all the otherswere in phase 1. Due to the relatively short introns, the entirelength of the inhibitory CHIR genes was �2000 bp, while theactivating CHIR genes lacking the cytoplasmic exons were �1200bp in size. Both exon and intron lengths were found to be highlyconserved (Fig. 4).

CHIR-AB1 and CHIR-AB2 genes have a pseudoexon in placeof exon 4, and therefore encode only a single Ig domain, which ismost homologous to the membrane distal Ig domain of CHIR-Aand CHIR-B. These pseudoexons are characterized by multiplemutations, such as frame shifts that are caused by alternative splic-ing sites, single nucleotide deletions before the triplet encoding thefirst conserved cysteine, and nucleotide insertions before the sec-ond conserved cysteine. These analyses collectively show that theCHIR resemble compact genes with highly conserved exon-intronstructures that are similar to other mammalian Ig-like receptors.

CHIR belong to a large, highly polymorphic family

The analyses of the CHIR genomic sequences revealed 94–98%identity with the cDNA sequences, and suggested the existence ofmultiple CHIR genes and/or various allelic forms is present in thechicken genome. To further substantiate this hypothesis, Southernblots with DNA samples from single animals of four differentchicken lines were performed (Fig. 5A). The 32P-labeled probespecific for the Ig1 domain of CHIR-A2 hybridized with multiple

FIGURE 2. Expression patterns of individual CHIR. RT-PCR expres-sion studies using oligonucleotides specific for highly diverse regions inCHIR. The expected size of the PCR product is indicated. A positive con-trol using cloned CHIR genes was included to differentiate between am-plification of cDNA as opposed to genomic DNA (upper band in CHIR-B5). �-Actin amplification served as cDNA quality control. Cell linesincluded macrophage lines (BM-2, HD11), B cell lines (2D8, RP-9), and aT cell line (UG-9).

FIGURE 3. CHIR-A2 associates with the Fc�RI�chain. The 293-T cells were transfected with the CHIR-A2-V5 construct alone (left panel), or in combinationwith the Fc�RI�-FLAG construct (middle panel) or theDAP12-FLAG construct (right panel). Twenty-fourhours after transfection, the surface expression ofCHIR-A2 was analyzed by staining with an anti-V5mAb (dark shaded area) and compared with a controlstaining with an irrelevant mAb (white line). The fre-quency of positive cells and the mean fluorescence in-tensity calculated for all cells are indicated.

389The Journal of Immunology

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

DNA fragments (14–24) even under highly stringent conditions.Besides common hybridization patterns found in all four chickenlines, there were multiple line-specific bands, indicative of thepolymorphic nature of the CHIR gene locus.

The Southern blot analysis provided further evidence for theexistence of a large number of CHIR genes in the chicken genome.Next, a primer pair was designed that binds to conserved parts inthe Ig1 domain. This primer pair indeed amplified the Ig1 domain

FIGURE 5. Extensive diversity of CHIR genes. A, Southern blot analysis of DNA isolated from one individual of four different chicken lines, asindicated. The restriction enzymes used for digestion are indicated below the blot. The blots were hybridized with the Ig1 domain of CHIR-A2. Arrowsindicate line-specific hybridization patterns. The migration of the size marker is shown. B, More than 100 Ig1 domain sequences from one chicken (PBL,M11, B2) were cloned and sequenced. Sequence variability of 41 different sequences was calculated using the Shannon entropy function. For orientation,the most abundant amino acid sequence and the predicted secondary structure are included. The A and G strands are missing from the figure, because theywere included in the PCR primers.

FIGURE 4. Genomic organization of CHIR genes. The exon-intron structure of four CHIR is schematically illustrated. The sizes are drawn to scale.Exons are represented by boxes, and introns by lines. The number of nucleotides and the positively charged transmembrane residues is indicated. The dottedboxes resemble the Ig pseudoexons.

390 CHIR GENE FAMILY

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

of all cloned CHIR genes as verified on plasmid DNA (data notshown). RNA from a single M11 chicken (B2 haplotype) was isolatedfrom PBL using a reagent kit that digests DNA to exclude genomicDNA contamination. RT-PCR amplification, plasmid cloning, and se-quencing of �100 clones revealed 41 unique sequences, which werefurther analyzed by calculating the variability using Shannon entropy(Fig. 5B). The variability was plotted against the predicted secondarystructure of the CHIR, which follows a C2-type Ig-fold with typicalareas of Ig � strands. Areas of highest variability were particularlypresent between the c and e strand and after the f strand (Fig. 5B).

In conclusion, a large number of different CHIR mRNAs en-coded by multiple genes that are characterized by variation hotspots in the Ig1 domain is expressed in individual animals.

CHIR genes are located on microchromosome 31, which isorthologous to the human LRC region

Recently, a first draft of the chicken genome has been published(33). Searching the chicken genome database with various CHIRsequences revealed a large number of CHIR entries; however,none of them assigned to a chromosome. FISH analysis was usedto identify the chromosomal location of the CHIR gene cluster. Alabeled CHIR-A2-specific DNA probe strongly hybridized on asingle pair of microchromosomes and nowhere else in the genome.The identification of the tiny microchromosome pair required mo-lecular markers. Previous studies had already identified linkagegroup E64 defined by marker ROS0264 as orthologue to the hu-man chromosome region 19q13.4 (34, 35). Therefore, we isolatedtwo BAC clones (WAG-87P2 and WAG-27N2) including thismarker and performed triple-color FISH. Both BAC and theCHIR-A2-specific probe clearly cohybridized on the same micro-chromosome (Fig. 6). Two additional CHIR probes (CHIR-AB1and CHIR-B2) also stained the same microchromosome (data notshown). These results show that the CHIR gene locus is located onmicrochromosome 31, a region that is orthologous to the humanLRC region on 19q13.4.

DiscussionIn this study, we characterize five novel members of the CHIRfamily, including activating, inhibitory, and bifunctional receptors.Although some CHIR have prototypic ITIM or short cytoplasmicdomains, as found in typical inhibitory and activating receptors,respectively, others have variable cytoplasmic tails, such as a com-bination of ITIM and ITSM, like in KIR2DL5 (36), or an un-charged transmembrane region with a short cytoplasmic tail.

The CHIR-AB represent a novel receptor type, which combinesa positively charged transmembrane region and various cytoplas-mic motifs. Primate KIR2DL4 and NKp44 are the only receptorsidentified to date that also combine a positively charged transmem-brane residue with a single cytoplasmic ITIM (9, 12). In bothcases, these receptors seem to be activating rather than inhibitory(10, 13); however, their exact function remains elusive. The mul-tiple CHIR-AB genes are particularly interesting because they arecharacterized by various combinations of signaling motifs such asITIM, ITSM, and particularly an YXXM motif, which is present inthe DAP10 adaptor molecule and forms a potential SH2 domainbinding site for the p85 unit of the PI3K (37).

CHIR-B6 has striking similarity to the previously characterizedCHIR-A1 (21), both of which lack a cytoplasmic domain and aprototypic positively charged transmembrane residue. They aremost likely generated by introducing a premature stop codon lo-cated in intron 5 that has not been spliced correctly. The EST cloneBX262283 provides further evidence for this hypothesis, becauseit has an identical structure encoding the entire intron 5, includingthe stop codon, followed by the correctly spliced exons 6 and 7.

The CHIR gene family is located on a chromosome region,which is orthologous to the human LRC region on chromosome19q13.4. Data regarding the entire chicken LRC and adjacentgenes would be informative; however, in the first draft of thechicken genome project, the chicken microchromosome 31 couldnot be assembled, and consequently, all of the CHIR are not as-signed to a chromosome (33). Genome assemblies based on whole

FIGURE 6. CHIR gene cluster islocated on chromosome 31. A, In-verted DAPI staining. The tiny micro-chromosome pair carrying CHIR-A2(indicated by arrowheads) is onlyweakly stained by DAPI, which pref-erentially binds to AT-rich chromatin.B, The genomic CHIR-A2 clone(green signal) and BACs WAG-87P2(red signal) and WAG-27N2 (bluesignal), both assigned to linkagegroup E64, were hybridized to a chro-mosome spread from normal chickenembryonic fibroblasts. Chromosomeswere counterstained with DAPI. Scalebar 10 �m. C–F, Details from Bshowing the three separate fluores-cence signals and the overlay image.Scale bar 2 �m.

391The Journal of Immunology

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

genome shotgun data are known to frequently miss repetitive re-gions with gene families of highly related genes such as the CHIRgene cluster. The same effect is seen for the MHC gene cluster onchromosome 16, which also is mainly found in the ChrUn sectionof the assembly. In addition, it was shown (33) that the regionswith a high GC content also appeared to be underrepresented in thechicken genome assembly, which probably is a second reason thatchromosome 31 and the CHIR cluster are missing from theassembly.

The human LRC spans �1 Mb on chromosome 19q13.4 (14), asize typical of chicken microchromosomes. Intensity and size ofthe FISH signal suggest a large number of CHIR genes coveringthe microchromosome to a great extent. This may indicate that theCHIR gene cluster occupies the entire microchromosome. To date,we do not know how many different CHIR genes exist in thechicken. The analysis of mRNA from PBL from a single animalrevealed the expression of 41 different CHIR Ig1 domain se-quences in a single animal, and the number of CHIR genes mayconsiderably vary between individuals, as indicated by Southernblot analysis comparing genomic DNA from individuals from dif-ferent chicken lines. These results fit well to the mammalian LRC,in which the KIR genes are known to evolve very rapidly evenwithin a species (38, 39). Once the entire cluster has been se-quenced and analyzed in detail, it may be necessary to rename theCHIR according to the human genome organization nomenclatureas “leukocyte Ig-like receptor” (40).

The mammalian LRC encodes multiple distinct families of Ig-like inhibitory receptors, such as KIR, LILR, and leukocyte-asso-ciated Ig-like receptor (14). However, the low overall sequenceidentity of the CHIR to these mammalian receptor families doesnot allow simply clarifying the common ancestry. The high degreeof variability and the presence of two Ig domains closely resemblethe KIR situation, while LILR are less variable and display mul-tiple Ig domains. Vice versa the expression pattern in differentleukocytes, and the association with the Fc�RI� chain are featuresfound in LILR, but not KIR. Interestingly, the positive transmem-brane arginine residue in CHIR is only encoded by the AAG trip-let, which is identical with all primate KIR2DL4 and both bovineKIR2DS1, KIR3DS1, whereas all LILR use the CGC codon. Thepresence of a pseudoexon instead of a functional Ig exon is anotherfeature of KIR, but not LILR (41).

In an attempt to obtain more information regarding the CHIRstructure, we used comparative modeling of the tertiary structurewith SWISS-MODEL (Fig. 7). Strikingly, these programs revealeda folding that is similar to the LILRB1 structure (42). In particular,

�-helical secondary structures as observed in LILRB1 (pdb entrycode 1G0X) are also modeled between the c, e, and f �-strands inthe CHIR Ig1 domain (Figs. 1 and 7). The region between the cand e �-strands seems to be particularly variable based on theShannon entropy analysis and may thus be important for ligandbinding, as has been demonstrated for LILRB1 to be the respon-sible area for binding to MHCI �3 and to UL-18, a viral MHC-likemolecule (43).

Although the CHIR ligands are currently unknown, some CHIRmay bind to MHC class I molecules, like most KIR and certainLILR. The chicken minimal essential MHC is characterized by lownumbers of different MHC class I molecules expressed, which maylead to the high susceptibility of some chicken strains to viruses(44). The CHIR repertoire on NK cells in combination with theMHC class I molecules expressed could be decisive for the sus-ceptibility of different chickens against viral infections. Moreover,it is tempting to speculate that in addition to physiological CHIRligands such as MHC class I or related proteins, the CHIR systemmay also be exploited by viral proteins as an immune evasionmechanism (45). This has been especially well documented forherpesviruses and the chicken Marek’s disease virus, as a memberof the �-herpesviruses may provide a source for viral ligands (46).It is interesting to note that T cell lines that have been transformedwith the Marek’s disease virus are resistant to NK cell lysis (47),thus suggesting that they may express virus-encoded ligand thattriggers inhibitory NK cell receptors.

As indicated by sequence characteristics, structural modeling,and expression patterns, the CHIR family displays features of bothKIR and LILR. The CHIR gene family is characterized by a mod-ular architecture combining great diversity in the extracellular Igdomain with different cytoplasmic domains that creates a uniquemultigene family with novel types of receptors that have not beenidentified in mammals. Future studies will now address individualCHIR, their ligands, cell-specific expression, and their functionalrole during immune responses.

AcknowledgmentsWe thank Dr. B. Kaspers for helpful comments, Dr. K. Campbell for theDAP12-FLAG construct, Drs. S. Weigend and J. Plachy for providingchicken eggs, and M. Lorenz for expert technical assistance.

DisclosuresThe authors have no financial conflict of interest.

References1. Ravetch, J. V., and L. L. Lanier. 2000. Immune inhibitory receptors. Science 290:

84–89.2. Long, E. O. 1999. Regulation of immune responses through inhibitory receptors.

Annu. Rev. Immunol. 17: 875–904.3. Burshtyn, D. N., W. Yang, T. Yi, and E. O. Long. 1997. A novel phosphotyrosine

motif with a critical amino acid at position �2 for the SH2 domain-mediatedactivation of the tyrosine phosphatase SHP-1. J. Biol. Chem. 272: 13066–13072.

4. Vivier, E., J. A. Nunes, and F. Vely. 2004. Natural killer cell signaling pathways.Science 306: 1517–1519.

5. Campbell, K. S., and M. Colonna. 2001. Human natural killer cell receptors andsignal transduction. Int. Rev. Immunol. 20: 333–370.

6. Shlapatska, L. M., S. V. Mikhalap, A. G. Berdova, O. M. Zelensky, T. J. Yun,K. E. Nichols, E. A. Clark, and S. P. Sidorenko. 2001. CD150 association witheither the SH2-containing inositol phosphatase or the SH2-containing proteintyrosine phosphatase is regulated by the adaptor protein SH2D1A. J. Immunol.166: 5480–5487.

7. Howie, D., M. Simarro, J. Sayos, M. Guirado, J. Sancho, and C. Terhorst. 2002.Molecular dissection of the signaling and costimulatory functions of CD150(SLAM): CD150/SAP binding and CD150-mediated costimulation. Blood 99:957–965.

8. Borrego, F., J. Kabat, D. K. Kim, L. Lieto, K. Maasho, J. Pena, R. Solana, andJ. E. Coligan. 2002. Structure and function of major histocompatibility complex(MHC) class I specific receptors expressed on human natural killer (NK) cells.Mol. Immunol. 38: 637–660.

9. Rajagopalan, S., and E. O. Long. 1999. A human histocompatibility leukocyteantigen (HLA)-G-specific receptor expressed on all natural killer cells. J. Exp.Med. 189: 1093–1100.

FIGURE 7. Protein model of CHIR-A2. The CHIR-A2 amino acid se-quence was modeled applying the SWISS-Model program using the firstapproach mode. �-strands are labeled. The �-helices between �-strands c,e, and f are indicated with arrows.

392 CHIR GENE FAMILY

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

10. Rajagopalan, S., J. Fu, and E. O. Long. 2001. Cutting edge: induction of IFN-�production but not cytotoxicity by the killer cell Ig-like receptor KIR2DL4(CD158d) in resting NK cells. J. Immunol. 167: 1877–1881.

11. Faure, M., and E. O. Long. 2002. KIR2DL4 (CD158d), an NK cell-activatingreceptor with inhibitory potential. J. Immunol. 168: 6208–6214.

12. Vitale, M., C. Bottino, S. Sivori, L. Sanseverino, R. Castriconi, E. Marcenaro,R. Augugliaro, L. Moretta, and A. Moretta. 1998. NKp44, a novel triggeringsurface molecule specifically expressed by activated natural killer cells, is in-volved in non-major histocompatibility complex-restricted tumor cell lysis.J. Exp. Med. 187: 2065–2072.

13. Campbell, K. S., S. Yusa, A. Kikuchi-Maki, and T. L. Catina. 2004. NKp44triggers NK cell activation through DAP12 association that is not influenced bya putative cytoplasmic inhibitory sequence. J. Immunol. 172: 899–906.

14. Wilson, M. J., M. Torkar, A. Haude, S. Milne, T. Jones, D. Sheer, S. Beck, andJ. Trowsdale. 2000. Plasticity in the organization and sequences of human KIR/ILT gene families. Proc. Natl. Acad. Sci. USA 97: 4778–4783.

15. Trowsdale, J., R. Barten, A. Haude, C. A. Stewart, S. Beck, and M. J. Wilson.2001. The genomic context of natural killer receptor extended gene families.Immunol. Rev. 181: 20–38.

16. Colonna, M. 2003. TREMs in the immune system and beyond. Nat. Rev. Immu-nol. 3: 445–453.

17. Clark, G. J., B. Cooper, S. Fitzpatrick, B. J. Green, and D. N. Hart. 2001. Thegene encoding the immunoregulatory signaling molecule CMRF-35A localized tohuman chromosome 17 in close proximity to other members of the CMRF-35family. Tissue Antigens 57: 415–423.

18. Biassoni, R., C. Cantoni, D. Marras, J. Giron-Michel, M. Falco, L. Moretta, andN. Dimasi. 2003. Human natural killer cell receptors: insights into their molecularfunction and structure. J. Cell. Mol. Med. 7: 376–387.

19. Yoder, J. A., M. G. Mueller, K. M. Nichols, S. S. Ristow, G. H. Thorgaard,T. Ota, and G. W. Litman. 2002. Cloning novel immune-type inhibitory receptorsfrom the rainbow trout, Oncorhynchus mykiss. Immunogenetics 54: 662–670.

20. Yoder, J. A., R. T. Litman, M. G. Mueller, S. Desai, K. P. Dobrinski,J. S. Montgomery, M. P. Buzzeo, T. Ota, C. T. Amemiya, N. S. Trede, et al. 2004.Resolution of the novel immune-type receptor gene cluster in zebrafish. Proc.Natl. Acad. Sci. USA 101: 15706–15711.

21. Dennis, G., Jr., H. Kubagawa, and M. D. Cooper. 2000. Paired Ig-like receptorhomologs in birds and mammals share a common ancestor with mammalian Fcreceptors. Proc. Natl. Acad. Sci. USA 97: 13245–13250.

22. Viertlboeck, B. C., R. P. Crooijmans, M. A. Groenen, and T. W. Gobel. 2004.Chicken Ig-like receptor B2, a member of a multigene family, is mainly ex-pressed on B lymphocytes, recruits both Src homology 2 domain containingprotein tyrosine phosphatase (SHP)-1 and SHP-2, and inhibits proliferation.J. Immunol. 173: 7385–7393.

23. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, andD. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of pro-tein database search programs. Nucleic Acids Res. 25: 3389–3402.

24. Gobel, T. W. F. 2000. Isolation and analysis of natural killer cells in chickens.Methods Mol. Biol. 121: 337–345.

25. Kaufman, J., S. Milne, T. W. Gobel, B. A. Walker, J. P. Jacob, C. Auffray,R. Zoorob, and S. Beck. 1999. The chicken B locus is a minimal essential majorhistocompatibility complex. Nature 401: 923–925.

26. McGuffin, L. J., K. Bryson, and D. T. Jones. 2000. The PSIPRED protein struc-ture prediction server. Bioinformatics 16: 404–405.

27. Kabat, E. A., T. T. Wu, and H. Bilofsky. 1977. Unusual distributions of aminoacids in complementarity-determining (hypervariable) segments of heavy andlight chains of immunoglobulins and their possible roles in specificity of anti-body-combining sites. J. Biol. Chem. 252: 6609–6616.

28. DuBridge, R. B., P. Tang, H. C. Hsia, P. M. Leong, J. H. Miller, and M. P. Calos.1987. Analysis of mutation in human cells by using an Epstein-Barr virus shuttlesystem. Mol. Cell. Biol. 7: 379–387.

29. Puehler, F., T. Gobel, U. Breyer, A. Ohnemus, P. Staeheli, and B. Kaspers. 2003.A sensitive bioassay for chicken interleukin-18 based on the inducible release ofpreformed interferon-�. J. Immunol. Methods 274: 229–232.

30. Caldwell, R. B., A. M. Kierzek, H. Arakawa, Y. Bezzubov, J. Zaim, P. Fiedler,S. Kutter, A. Blagodatski, D. Kostovska, M. Koter, et al. 2005. Full-lengthcDNAs from chicken bursal lymphocytes to facilitate gene function analysis.Genome Biol. 6: R6.

31. Zarudnaya, M. I., I. M. Kolomiets, A. L. Potyahaylo, and D. M. Hovorun. 2003.Downstream elements of mammalian pre-mRNA polyadenylation signals: pri-mary, secondary and higher-order structures. Nucleic Acids Res. 31: 1375–1386.

32. Gobel, T. W., and L. Bolliger. 1998. The chicken TCR �-chain restores thefunction of a mouse T cell hybridoma. J. Immunol. 160: 1552–1554.

33. Hillier, L. W., W. Miller, E. Birney, W. Warren, R. C. Hardison, C. P. Ponting,P. Bork, D. W. Burt, M. A. Groenen, M. E. Delany, et al. 2004. Sequence andcomparative analysis of the chicken genome provide unique perspectives on ver-tebrate evolution. Nature 432: 695–716.

34. Smith, J., I. R. Paton, F. Murray, R. P. Crooijmans, M. A. Groenen, andD. W. Burt. 2002. Comparative mapping of human chromosome 19 with thechicken shows conserved synteny and gives an insight into chromosomal evolu-tion. Mamm. Genome 13: 310–315.

35. Masabanda, J. S., D. W. Burt, P. C. O’Brien, A. Vignal, V. Fillon, P. S. Walsh,H. Cox, H. G. Tempest, J. Smith, F. Habermann, et al. 2004. Molecular cytoge-netic definition of the chicken genome: the first complete avian karyotype. Ge-netics 166: 1367–1373.

36. Vilches, C., R. Rajalingam, M. Uhrberg, C. M. Gardiner, N. T. Young, andP. Parham. 2000. KIR2DL5, a novel killer-cell receptor with a D0–D2 config-uration of Ig-like domains. J. Immunol. 164: 5797–5804.

37. Wu, J., Y. Song, A. B. Bakker, S. Bauer, T. Spies, L. L. Lanier, and J. H. Phillips.1999. An activating immunoreceptor complex formed by NKG2D and DAP10.Science 285: 730–732.

38. Vilches, C., and P. Parham. 2002. KIR: diverse, rapidly evolving receptors ofinnate and adaptive immunity. Annu. Rev. Immunol. 20: 217–251.

39. Parham, P. 2005. MHC class I molecules and KIRs in human history, health andsurvival. Nat. Rev. Immunol. 5: 201–214.

40. Wain, H. M., E. A. Bruford, R. C. Lovering, M. J. Lush, M. W. Wright, andS. Povey. 2002. Guidelines for human gene nomenclature. Genomics 79:464–470.

41. Vilches, C., M. J. Pando, and P. Parham. 2000. Genes encoding human killer-cellIg-like receptors with D1 and D2 extracellular domains all contain untranslatedpseudoexons encoding a third Ig-like domain. Immunogenetics 51: 639–646.

42. Chapman, T. L., A. P. Heikema, A. P. West, Jr., and P. J. Bjorkman. 2000.Crystal structure and ligand binding properties of the D1D2 region of the inhib-itory receptor LIR-1 (ILT2). Immunity 13: 727–736.

43. Willcox, B. E., L. M. Thomas, and P. J. Bjorkman. 2003. Crystal structure ofHLA-A2 bound to LIR-1, a host and viral major histocompatibility complexreceptor. Nat. Immunol. 4: 913–919.

44. Kaufman, J., J. Jacob, I. Shaw, B. Walker, S. Milne, S. Beck, and J. Salomonsen.1999. Gene organization determines evolution of function in the chicken MHC.Immunol. Rev. 167: 101–117.

45. Lodoen, M. B., and L. L. Lanier. 2005. Viral modulation of NK cell immunity.Nat. Rev. Microbiol. 3: 59–69.

46. Petherbridge, L., A. C. Brown, S. J. Baigent, K. Howes, M. A. Sacco,N. Osterrieder, and V. K. Nair. 2004. Oncogenicity of virulent Marek’s diseasevirus cloned as bacterial artificial chromosomes. J. Virol. 78: 13376–13380.

47. Sharma, J. M., and W. Okazaki. 1981. Natural killer cell activity in chickens:target cell analysis and effect of antithymocyte serum on effector cells. Infect.Immun. 31: 1078–1085.

393The Journal of Immunology

by guest on May 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from