The Basis for Resistance to -Lactam Antibiotics by Penicillin-binding Protein 2a of Methicillin-resistant Staphylococcus aureus*

Received for publication, March 31, 2004, and in revised form, June 1, 2004Published, JBC Papers in Press, June 28, 2004, DOI 10.1074/jbc.M403589200

Cosimo Fuda, Maxim Suvorov, Sergei B. Vakulenko, and Shahriar Mobashery

From the Department of Chemistry and Biochemistry, University of Notre Dame, Notre Dame, Indiana 46556

Penicillin-binding protein 2a (PBP2a) of Staphylococ-cus aureus is refractory to inhibition by available -lac-tam antibiotics, resulting in resistance to these antibi-otics. The strains of S. aureus that have acquired themecA gene for PBP2a are designated as methicillin-re-sistant S. aureus (MRSA). The mecA gene was cloned andexpressed in Escherichia coli, and PBP2a was purifiedto homogeneity. The kinetic parameters for interactionsof several -lactam antibiotics (penicillins, cephalospo-rins, and a carbapenem) and PBP2a were evaluated. Theenzyme manifests resistance to covalent modification by-lactam antibiotics at the active site serine residue intwo ways. First, the microscopic rate constant foracylation (k2) is attenuated by 3 to 4 orders of magnitudeover the corresponding determinations for penicillin-sensitive penicillin-binding proteins. Second, the en-zyme shows elevated dissociation constants (Kd) for thenon-covalent pre-acylation complexes with the antibiot-ics, the formation of which ultimately would lead toenzyme acylation. The two factors working in concerteffectively prevent enzyme acylation by the antibioticsin vivo, giving rise to drug resistance. Given the oppor-tunity to form the acyl enzyme species in in vitro exper-iments, circular dichroism measurements revealed thatthe enzyme undergoes substantial conformationalchanges in the course of the process that would lead toenzyme acylation. The observed conformationalchanges are likely to be a hallmark for how this enzymecarries out its catalytic function in cross-linking thebacterial cell wall.

Emergence of bacterial strains designated as methicillin-resistant Staphylococcus aureus (MRSA)1 from the 1960s to thepresent has created clinical difficulties for nosocomial infec-tions worldwide (1). The genetic determinant for this resistanceis mecA, which is not native to S. aureus but has been acquiredby it many times over the past 40 years from unknown sources(2). The gene product of mecA is a penicillin-binding protein(PBP) designated PBP2a. S. aureus normally produces fourPBPs (3), enzymes that are anchored on the cytoplasmic mem-brane, the functions of which are the assembly and regulationof the latter stages of the cell wall biosynthesis (4, 5). Whereasthese four PBPs are susceptible to modification by -lactamantibiotics, an event that leads to bacterial death, PBP2a is

refractory to the action of all available -lactam antibiotics.PBP2a is capable of taking over the functions of the four typicalPBPs of S. aureus in the face of the challenge by -lactamantibiotics.

The pharmaceutical industry responded by initiating re-search programs in the discovery of novel -lactams that willinhibit PBP2a. A few cephalosporins have been identified, ofwhich a handful has now advanced into clinical trials for MRSAtreatment (68). Also, the clinical urgency has been met in thepast few years by the introduction of Synercid (a combination ofquinupristin and dalfopristin) (9), daptomycin (10), and lin-ezolid (an oxazolidinone) (11) for treatment of MRSA. However,resistance to all of these agents exists, and the recent emer-gence of variants of MRSA resistant to linezolid (12) and gly-copeptide antibiotics (1316) has created a situation in whichcertain strains of S. aureus are either treatable only with asingle class of antibiotics or are simply not treatable, which isa disconcerting situation clinically.

As -lactams (penicillins, cephalosporins, carbapenems, etc.)arguably remain the most important antibiotics clinically (55%of all antibiotics used globally belong to this class), it is imper-ative to understand the molecular mechanisms for resistance tothese antibiotics. This mechanistic knowledge, along withstructural information (17), should prove indispensable in de-vising strategies to circumvent the clinical problem presentedby MRSA. In this vein, we report herein our cloning, expres-sion, and purification of PBP2a of S. aureus. Kinetics werecarried out with a series of -lactam antibiotics to explore theirinteractions with PBP2a. Furthermore, we report on our re-sults in understanding the incremental steps in the catalyticprocess of PBP2a. The enzyme undergoes a substantial confor-mational change in the course of its interactions with -lactamantibiotics, which should have implications for the catalyticevents of PBP2a in cross-linking of the bacterial cell wall.

EXPERIMENTAL PROCEDURES

Cloning of PBP2aChromosomal DNA of S. aureus ATCC706986was isolated using a DNeasy tissue kit (Qiagen). The mecA gene wasamplified without the sequence encoding its 23-amino acid-long N-terminal anchoring region using two oligonucleotide primers, SAPBP-2a-1D (TAATCCATGGCTTCAAAAGATAAAGAAAT) and SAPBP2a-R(TAATAAGCTTCTGTTTTGTTATTCATCTATAT). These primers con-tain recognition sequences for the restriction endonucleases NcoI andHindIII (italicized) that were utilized for cloning of the PCR productinto the corresponding sites of expression vector pET24d(). Recombi-nant plasmid was initially used to transform competent cells of Esche-richia coli JM83. Both DNA strands of the mecA gene from severaltransformants were sequenced, and recombinant plasmid was used totransform competent cells of E. coli BL21(DE3).

Site-directed MutagenesisTo produce mutants of PBP2a, the mecAgene was recloned from the pET24d() vector into the smaller vectorpUC19 using sites for the restriction endonucleases XbaI and HindIII.The QuikChange site-directed mutagenesis kit (Stratagene, La Jolla,CA) was utilized to produce three mutant derivatives of PBP2a. To

* This work was supported by National Institutes of Health GrantGM61629. The costs of publication of this article were defrayed in partby the payment of page charges. This article must therefore be herebymarked advertisement in accordance with 18 U.S.C. Section 1734solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 574-631-2933;Fax: 574-631-6652; E-mail: mobashery@nd.edu.

1 The abbreviations used are: MRSA, methicillin-resistant Staphylo-coccus aureus; PBP, penicillin-binding protein.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 39, Issue of September 24, pp. 4080240806, 2004 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org40802

by guest on February 9, 2015http://w

ww

.jbc.org/D

ownloaded from

obtain the K406A mutant two mutagenic primers, MecS/A-d (CCAGG-TTCAACTCAAGCAATATTAACAGCAATG) and MecS/A-r (CATTGCT-GTTAATATTGCTTGAGTTGAACCTGG), that include the codon GCA(in bold) for alanine instead of that for lysine (AAA) were used. Twoother mutagenic primers, SaurY519PD (GCTGATTCAGGTTTCGGAC-AAAGTGAAAT) and SaurY519PD (ATTTCACTTTGTCCGAAACCTG-AATCAGC), that contain the TTC codon for phenylalanine (in bold)were used to introduce the Y519F mutant derivative of PBP2a. Thedouble mutant enzyme, K406A/Y519F, was produced by introducing asecond substitution into the K406A mutant derivative. After mutagen-esis the nucleotide sequence for each of the genes producing mutantenzymes was verified, and these genes were recloned between the NcoIand HindIII sites of the pET24d() expression vector.

Expression of Wild-type PBP2a and Its Mutant Variants K406A,K406A/Y519F, and Y519F in E. coliThe wild-type PBP2a andK406A, K406A/Y519F, and Y519F mutant variants were each ex-pressed using the same method. E. coli BL21 (DE3) was transformedwith the plasmid pET24d(), which contained the wild-type and mu-tant mecA gene in its multiple cloning site. A 3-ml overnight seedculture was used to inoculate 500 ml of the LB medium supplementedwith kanamycin (30 g/ml). Cells were grown at 37 C with shaking(120 rpm) until the A600 reached 0.8 (about 6 h) followed by theaddition of 0.4 mM isopropyl--D-thiogalactopyranoside to induce ex-pression. The bacterial culture was then incubated at 25 C for another20 h. Cells were harvested by centrifugation at 5500 g for 10 min at4 C, and the pellet was suspended in 10 mM Tris/HCl buffer, pH 8(buffer A).

Purification of Wild-type and Mutant PBP2aThe wild-type PBP2aand its mutants K406A, K406A/Y519F, and Y519F were each purifiedusing the same three-step purification protocol with an LP chromatog-raphy system (Pharmacia) at 4 C. Cells were disrupted by 30 cycles ofsonication (20 s of burst and 20 s of rest for each cycle) using a Bransonsonifer. The resulting supernatant was then centrifuged at 14,000 gfor 25 min using a Beckman-Coulter centrifuge. Pelletting, suspensionin buffer A, and sonication were each repeated three times to ensure ahigh yield. The resultant cell-free extract was loaded at 2 ml/min ontoa Q-Sepharose column (2.5 30 cm; 80 ml of High Q support resin,Bio-Rad) equilibrated with buffer A. The proteins were eluted with alinear gradient of 00.3 M NaCl in buffer A at 4 ml/min (total volume of800 ml). PBP2a eluted at 0.100.15 M NaCl as determined bySDS-PAGE.

The fractions containing PBP2a were combined, concentrated, andbrought to 1.5 M (NH4)2SO4 in buffer A. The combined solution was thenloaded at 2 ml/min onto a phenyl-agarose column (2.5 30 cm; 60 ml ofphenyl-agarose resin, Sigma) equilibrated with 1.5 M (NH4)2SO4 inbuffer A. The protein was eluted with a linear gradient of 1.50.5 M(NH4)2SO4 in buffer A at 4 ml/min (total volume of 600 ml). Thefractions containing PBP2a eluted at 1.20.8 M (NH4)2SO4 and wereidentified by SDS-PAGE.

The protein fractions were combined and concentrated, and thebuffer was exchanged to 0.2 M NaCl in buffer B (50 mM sodiumphosphate, pH 7.0) and loaded at 1.0 ml/min onto a Sepharose column(2.5 50 cm; 160 ml of High S support resin, Bio-Rad) equilibratedwith buffer B. The protein was eluted with a linear gradient of 0.21.0M NaCl in buffer B at 1.5 ml/min to a final volume of 1500 ml. PBP2awas eluted from the column at 0.60.8 M NaCl. The fractions werecombined, dialyzed against 25 mM Hepes in 1 M NaCl, pH 7.0. Theprotein concentration was determined with the BCA protein assay kit(Pierce). The yield from a 500-ml cell culture of either the wild-typePBP2a, the K406A mutant, or the Y519F mutant was 20 mg. Thedouble mutant K406A/Y519F yielded 10 mg from a 500-ml cellculture. Each was concentrated to 12 mg/ml. The wild-type andmutant proteins used in our experiments were all homogenous (datanot shown).

13C NMR ExperimentsThe wild-type PBP2a protein (5 mg) wasdialyzed against several changes of degassed 25 mM sodium acetatebuffer (pH 4.5) and then against degassed 50 mM sodium phosphate,0.15 mM NaCl, 0.1 mM EDTA, pH 7.0. Subsequently, the protein wasdialyzed against buffer containing 50 mM sodium phosphate, 0.15 mMNaCl, 10% D2O, and 20 mM NaH

13CO3 (the source of CO2). The proteinwas concentrated to 0.15 mM. The 13C NMR spectrum of the wild-typePBP2a protein indicated no modification of the protein by 13C-labeledcarbon dioxide. The procedure did not affect the quality of the proteinbecause the pseudo first-order rate constants for acylation of the proteinby nitrocefin with and without this treatment remained the same.

Determination of the Kinetic Parameters for Interactions of -LactamAntibiotics with the PBP2a ProteinPBP2a experiences acylation at

the active site serine, and the acyl enzyme species slowly undergoesdeacylation according to Equation 1.

E I -|0Ks

EIOk2

E-IOk3

E P (Eq. 1)

E represents PBP2a, EI is the non-covalent pre-acylation complex,E-I is the covalent acyl enzyme species, and P denotes the product ofhydrolysis of the -lactam antibiotic. The first-order rate constants forprotein acylation were determined for different -lactam compoundsusing a Cary 50 UV spectrophotometer (Varian Inc.) at room tempera-ture. The parameters for the reaction between PBP2a and nitrocefinwere determined directly by monitoring the formation of the acyl en-zyme species at 500 nM (500 15,900 cm

1 M1). The experimentswere carried out in 25 mM Hepes, 1 M NaCl (pH 7.0) buffer. Theobserved first-order rate constants (kobs) were measured at a proteinconcentration of 2.5 M with different concentrations of nitrocefin (20120 M) and monitored for 45 min each, at which time the protein wasinvariably acylated.

Nitrocefin (120 M) was used as the reporter molecule to determinethe apparent first-order rate constants for acylation by other non-chromogenic (or poorly chromogenic) -lactams at varying concentra-tions in competition experiments (18).

The deacylation rate constants for wild-type PBP2a were determinedusing BOCILLIN FL as a reporter molecule (19). A typical reactionmixture (60 l) contained 15 M of PBP2a and a -lactam antibioticconcentration at least 2-fold higher than its Kd value. The mixture wasincubated at room temperature for 45 min in 25 mM Hepes, 1 M NaCl(pH 7.0) buffer. The excess -lactam was removed by passing themixture through a Micro Bio-Spin6 column (Bio-Rad). An aliquot (3l) of the mixture was diluted 5-fold with the same buffer and incubatedat room temperature for different time intervals. The amount of the freeprotein, liberated from the acyl protein species, was assayed by theaddition of BOCILLIN FL to afford a final concentration of 40 M andincubated for an additional 45 min at room temperature. SDS samplebuffer (15 l) was added to the reaction mixture, which was then boiledfor 3 min. The samples (30 l in total) were loaded onto a 10% SDS-polyacrylamide gel, which was developed and then scanned using aStorm840 Fluorimager.

Circular DichroismThe CD spectra of the wild-type PBP2a (6 M in25 mM Hepes, 1 M NaCl, pH 7.0) were recorded on a Jasco J-600instrument (Easton, MD, 5-mm path length) in the absence and pres-ence of 30 M oxacillin or 30 M ceftazidime. The -lactams had negli-gible CD readings compared with the protein. Regardless, the contri-bution of the -lactam substrate was subtracted in each case. Theproteins were incubated with the -lactam antibiotics at 25 C.

RESULTS AND DISCUSSION

PBP2a has been cloned and studied by others (2025). Wehave cloned this protein for our studies as well. The mecA genewas PCR-amplified from the chromosomal DNA of S. aureusATCC706986 without the 69 base pairs in the 5-region encod-ing the 23-amino acid-long N-terminal membrane anchor. Thegene was cloned between the NcoI and HindIII sites of theexpression vector pET24d(), and PBP2a was produced intra-cellularly after induction with isopropyl--D-thiogalactopyr-anoside. The gene was recloned into the XbaI and HindIII sitesof the smaller plasmid pUC19 to produce mutant variants ofthe mecA gene efficiently. Subsequent to mutagenesis, the cor-responding genes were recloned back between the NcoI andHindIII sites of the pET24d() vector, and the enzymes wereproduced intracellularly by isopropyl--D-thiogalactopyrano-side induction. PBP2a was purified to apparent homogeneity inthree chromatographic steps. We typically obtained 40 mg ofpure protein from a liter of culture.

We have evaluated the kinetics of interactions of threecephalosporins (nitrocefin, cefepime and ceftazidime), two pen-icillins (ampicillin and oxacillin), and one carbapenem (imi-penem) with PBP2a (Table I). PBP2a, as with virtually allother known PBPs, undergoes acylation with its peptidoglycansubstrate at an active site serine (Ser-403) for its transpepti-dase activity (cell wall cross-linking). The acyl enzyme speciesthen undergoes the transpeptidation reaction with another

The Basis for Resistance to -Lactams by PBP2a of MRSA 40803

by guest on February 9, 2015http://w

ww

.jbc.org/D

ownloaded from

strand of the peptidoglycan. -Lactam antibiotics subvert thisprocess by undergoing the enzyme acylation process, but theresulting complex is often stable such that the enzyme is inac-tivated, and the organism is deprived of its vital function.

The processes for interactions of -lactam antibiotics withPBP2a were sufficiently slow that the need for stopped-flowrapid kinetics was obviated. It is noteworthy that manifesta-tion of resistance is because of both a slow rate of enzymeacylation (k2 effect) as well as an absence of high affinity of theenzyme for -lactams in general (Kd effect). The t12 for enzymeacylation was in the range of 3 to 12 min with these antibiotics.This contrasts dramatically to t12 values of low milliseconds fortypical penicillin-sensitive PBPs (26, 27). The elevated dissoci-ation constants for the pre-acylation complexes ranged be-tween 180 and 1618 M, resulting in second-order rate con-stants (k2/Kd) of 119 M

1 s1. The rate constants fordeacylation (k3) of the acyl enzyme species were exceedinglypoor, giving t12 values in the range of 26 to 77 h. Consideringthat S. aureus doubles its population size in 2030 min underfavorable growth conditions, the formation of the acyl enzymespecies is irreversible for practical purposes. In essence, thenon-covalent encounters between the antibiotics and PBP2aare not favorable (high Kd), and the rate constants for enzymeacylation are exceedingly poor (slow k2). Hence, formation ofthe acyl enzyme species would not take place in vivo for thesetwo reasons. The fact that the acyl enzyme species with -lac-tam antibiotics is extremely stable is irrelevant to the resist-ance problem, as the species would simply not form in vivo.Considering that PBP2a fulfills the critical physiological needsof the bacterium in the presence of -lactam antibiotics, the setof events that led to the evolution of this important resistanceenzyme to antibiotics is quite remarkable (28).

We hasten to add that the kinetic parameters that we reportherein are somewhat different from those reported by Lu et al.(29), who used a mass spectrometric approach for analysis ofkinetics. Whereas our Kd values are sufficiently high to pre-clude enzyme acylation when considering the in vivo situation,the corresponding numbers by Lu et al. (29) were substantiallyhigher than ours (high millimolar range).

The issue of activation of the active site serine is of interest.As will be discussed below, Ser-403 is well sheltered within theactive site and its side chain hydroxyl is in contact with the sidechain of Lys-406 (8). This arrangement of Ser-X-X-Lys for PBPsand related -lactamases is understood to be important for themechanisms of these enzymes (30). We have shown that whenthe corresponding lysine is mutated to alanine in the OXA-10-lactamase, the enzyme cannot undergo acylation by its sub-strate (31). A similar mutation in the penicillin-binding proteinBlaR from S. aureus was shown to attenuate the rate of proteinacylation by 6730-fold (32). The K406A mutant variant ofPBP2a underwent extremely sluggish acylation. The effect wasmostly on k2, which was attenuated by 80- to 130-fold for themutant variant (Table II). Whereas the magnitude of the effectis relatively small, this level of attenuation reduces the alreadysluggish rate of acylation to the range of 105 s1, which is the

basal level that was attained for the BlaR protein and not farfrom the undetectable levels seen for the same mutation in theOXA-10 enzyme. Hence, in the cases of the BlaR and theOXA-10 proteins the acylation rate constants were higher, sothe drops in their magnitudes were also larger on mutation.However, the basal level that we have observed for the lysine toalanine mutant variants in all three proteins were essentiallythe same.

Tyr-519 is another potentially basic residue within the activesite. It could potentially provide the activation if it were un-protonated in the side chain and if the side chain were toundergo rotation from the position seen in the x-ray structure.Mutant enzyme variants Y519F and K406A/Y519F gave ki-netic properties similar to the wild-type and to the K406Amutant, respectively. Therefore, this tyrosine residue does notplay a role in catalysis, and Lys-406 is the basic residue thatpromotes the active site serine for enzyme acylation (Table II).

It is noteworthy that at least one penicillin-binding protein isnow shown to be carboxylated in the side chain of its active sitelysine (product of carbon dioxide addition to the lysine sidechain amine) (16). In light of the reversibility of lysine carbox-ylation in proteins, there are known examples of lysine-carbox-ylated proteins that were identified by x-ray crystallography intheir non-carboxylated forms. Hence, there was a possibilitythat PBP2a might be carboxylated at Lys-406. We carried outthe diagnostic 13C NMR experiment for detection of proteinlysine carboxylation with PBP2a, as reported for other proteinspreviously (15, 16). The experiment showed that PBP2a is notcarboxylated at any lysine, and thus the crystal structure de-picts the correct structure for Lys-406.

As shown in Fig. 1A, the x-ray structure of PBP2a reveals thatthe active site of the enzyme is not an open cleft. Indeed, theaccess to the active site is not obvious from the x-ray structure.Lim and Strynadka (17) have shown that the acyl enzyme specieswith -lactam antibiotics largely maintains the active site in thesame conformation with small movements within the immediatevicinity of the ligand away from that seen in the native enzyme(Fig. 1, B and C). A conformational change to open the active sitewould appear to be necessary both for the turnover events withthe peptidoglycan substrate and for interactions with inhibitorssuch as -lactam antibiotics.

The relatively slow nature of the kinetics of the interactionsof -lactam antibiotics with PBP2a indicated to us that theseinteractions might be studied by circular dichroism spectros-copy to explore the possibility of such protein conformationalchanges. We carried out these studies with oxacillin (a penicil-lin) and ceftazidime (a cephalosporin). Incubation of PBP2awith either oxacillin or ceftazidime resulted in dramatic con-formational changes in the protein (Fig. 2), most readily ob-served at the minima at 208 and 222 nm, which are because of-helices. As revealed in Fig. 2, A and C, the helix contentdecreased on exposure to the antibiotic, and a set of conforma-

TABLE IKinetics parameters for interactions of -lactam antibiotics

with the wild-type PBP2

-Lactams k2 k3 Kd k2/Kd

s1 103 s1 106 M M1 s1

Nitrocefin 3.7 0.3 7.2 0.1 192 24 19.0 3.0Cefepime 1.5 0.1 5.9 0.5 1618 145 0.9 0.1Ceftazidime 1.0 0.1 3.2 0.2 671 116 1.5 0.3Ampicillin 3.4 0.1 3.2 0.1 668 124 5.0 1.0Oxacillin 1.6 0.1 2.5 0.1 180 25 9.0 1.0Imipenem 1.7 0.1 3.3 0.3 603 93 2.8 0.4

TABLE IIKinetic parameters for the interactions of K406A, Y519F,

and K406A/Y519F mutant PBP2a variants withthree -lactam antibiotics

Enzyme Inhibitor k2 Kd k2/Kd

s1 105 M M1 s1 102

K406A Nitrocefin 4.5 0.1 200 70 22.0 9.0Ceftazidime 0.8 0.1 510 100 1.6 0.3Oxacillin 1.2 0.5 800 80 1.5 0.5

Y519F Nitrocefin 280 40 230 50 1200 300Ceftazidime 150 10 1400 220 250 20Oxacillin 260 20 590 15 440 25

K406A/Y519F Nitrocefin 5.2 1.1 200 60 27 10Ceftazidime 1.9 0.2 930 200 2.0 0.5Oxacillin 1.2 0.3 1100 60 1.1 0.2

The Basis for Resistance to -Lactams by PBP2a of MRSA40804

by guest on February 9, 2015http://w

ww

.jbc.org/D

ownloaded from

tional changes was noted within the first four t12 values foracylation (for virtually complete protein acylation). These con-formational changes continued for the duration of the monitor-ing for 3 days. In essence, the monitoring of the two wave-lengths in the course of the experiments (Fig. 2, B and D)indicated that substantial conformational flexibility exists inthe protein. The details of conformational changes were notidentical in the two cases, reflecting the differences in thestructures of the penicillin and cephalosporin used for theseexperiments. A fuller understanding of these differencesshould await structural-biological studies in the future.Whereas 30% of the enzymic activity was lost at the end of 3days of the CD experiment, the conformational state of theenzyme returned largely to the native state in both CD exper-iments. The relatively subtle conformational change seen forx-ray structures of the acyl enzyme species compared with thenative structure (8) would not account for our observations inthe CD experiments. Hence, the x-ray structure shows a com-plex that has settled, conformationally speaking, close to thenative state, such as the species that we observed near themiddle of the CD determinations (700 min for oxacillin and1400 min for ceftazidime). Based on the k3 values (Table I), bythe end of the CD experiment, the acyl enzyme species areexpected largely to have undergone hydrolysis to return to thenative state.

We underscore that these conformational changes are ex-pected to be operative during the typical turnover events bythis enzyme as well in light of the closed nature of the activesite. A volume in excess of 1000 3 is needed for the seques-tration of the two peptidoglycan residues within the active site

for the transpeptidase activity (33). The requisite conforma-tional change would be expected to create this space for thecatalytic events. Furthermore, these conformational changesmust take place substantially more rapidly for the case of thepeptidoglycan substrate. Although we cannot predict at thepresent what may precipitate these conformational changes, itis inherently intuitive that the polymeric peptidoglycan sub-

FIG. 1. Active site of PBP2a from the x-ray structure. A, a stereoview to the active site environment from the x-ray structure of PBP2ais rendered as a solvent-accessible surface (Connolly surface, green),whereas important residues in the active site are shown in a cappedsticks representation. A dotted Connolly surface (purple) is used todemonstrate the surface of the regions that cover the active site open-ing. B, a stereo view of the secondary structures (orange tube represen-tation) and various important residues for the native enzyme structureis depicted. C, the penicillin G/PBP2a acyl enzyme complex is shown.(Penicillin G is shown in yellow, and capped sticks are color-codedaccording to atom types; oxygen, nitrogen, and carbon are shown in red,blue, and white, respectively.) The perspectives are the same for allthree panels.

FIG. 2. Circular dichroic spectra of PBP2a in the presence of-lactam antibiotics. A, the far-UV CD spectrum of the wild-typePBP2a () during oxacillin turnover at 1 h (E), 24 h (f), 48 h (), and72 h (). B, change in the molar ellipticity of the wild-type PBP2a at 208() and 222 nm (E) as a function of time during turnover of oxacillin. C,the far-UV CD spectrum of the wild-type PBP2a () during ceftazidimeturnover at 1 h (E), 24 h (f), 48 h (), and 72 h (). D, change in themolar ellipticity of the wild-type PBP2a at 208 nm () and 222 nm (E)as a function of time during turnover of ceftazidime.

The Basis for Resistance to -Lactams by PBP2a of MRSA 40805

by guest on February 9, 2015http://w

ww

.jbc.org/D

ownloaded from

strate would bind at a site outside of the immediate active siteto initiate the processes.

A pertinent question on activity should be whether trunca-tion by removal of the membrane anchor would affect activity.The conclusion from studies by others is that there is no con-sequential difference on activity with the loss of the membraneanchor (29). This is also entirely in accordance with the x-raystructure for PBP2a, which indicates that the point of insertioninto the membrane by the membrane-spanning portion is quitedistal to the catalytic domain (17).

In this study we have described the kinetics of interactions ofsix -lactam antibiotics with the PBP2a of S. aureus. We alsodocumented dramatic conformational changes for the proteinin the presence of these antibiotics within the time scale forthese turnover events. The function of PBP2a would appear tobe more complex than previously appreciated. In light of theclinical importance of this protein to resistance to -lactamantibiotics, a more complete understanding of these processesat the structural level is required. It is with such fuller under-standing of these events that we may be able to conceive ofstrategies for inhibition of this deleterious bacterial enzyme inthe near future.

REFERENCES

1. Pinho, M. G., de Lencastre, H., and Tomasz, A. (2001) Proc. Natl. Acad. Sci.U. S. A. 98, 1088610891

2. Enright, M. C., Robinson, D. A., Randle, G., Feil, E. J., Grundmann, H., andSpratt, B. G. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 76877692

3. Georgopapadakou, N. H., Dix, B. A., and Mauriz, Y. R. (1996) Antimicrob.Agents Chemother. 29, 333336

4. Bush, K., and Mobashery, S. (1998) Adv. Exp. Med. Biol. 456, 71985. Goffin, C., and Ghuysen, J. M. (2002) Microbiol. Mol. Biol. Rev. 66, 7027386. Entenza, J. M., Hohl, P., Heinze-Krauss, I., Glausner, M. P., and Moreillon,

P.,(2002) Antimicrob. Agents Chemother. 46, 1711777. Malouin, F., Blais, J., Chamberland, S., Hoang, M., Park, C., Chan, C.,

Mathias, K, Hakem, S., Dupree, K., Liu, E., Nguyen, T., and Dudley, M. N.(2003) Antimicrob. Agents Chemother. 47, 658664

8. Ishikawa, T., Matsunaga, N., Tawada, H., Kuroda, N., Nakayama, Y.,Ishibashi, Y., Tomimoto, M., Ikeda, Y., Tagawa, Y., Iizawa, Y., Okonogi, K.,Hashiguchi, S., and Miyake, A. (2003) Bioorg. Med. Chem. 11, 24272437

9. Drew, R. H., Perfect, J. R., Srinath, L., Kurkimilis, E., Dowzicky, M., andTalbot, G. H. (2000) J. Antimicrob. Chemother. 46, 775784

10. Richter, S. S., Kealey, D. E., Murray, C. T., Heilmann, K. P., Coffman, S. L.,and Doern, G. V. (2003) J. Antimicrob. Chemother. 52, 123127

11. Dailey, C. F., Dileto-Fang, C. L., Buchanan, L. V., Oramas-Shirey, M. P., Batts,D. H., Ford, C. W., and Gibson, J. K. (2001) Antimicrob. Agents Chemother.45, 23042308

12. Tsiodras, S., Gold, H. S., Sakoulas, G., Eliopoulos, G. M., Wennersten, C.,Venkataraman, L., Moellering, R. C., and Ferraro, M. J. (2001) Lancet 358,207208

13. Bartley, J. (2002) Infect. Control Hosp. Epidemiol. 23, 48014. Walsh, T. R., Bolmstrom, A., Qwarnstrom, A., Ho, P., Wootton, M., Howe,

R. A., MacGowan, A. P., and Diekema, D. (2001) J. Clin. Microbiol. 39,24392444

15. Centers for Disease Control and Prevention (2002) Morb. Mortal. Wkly. Rep.51, 931

16. Centers for Disease Control and Prevention (2004) Morb. Mortal. Wkly. Rep.53, 322323

17. Lim, D., and Strynadka, N. C. (2002) Nat. Struct. Biol. 9, 87087618. Graves-Woodward, K., and Pratt, R. F. (1998) Biochem. J. 332, 75576119. Zhao, G., Meier, T. I., Kahn, S. D., Gee, K. R., and Blaszczak, L. C. (1999)

Antimicrob. Agents Chemother. 43, 1124112820. Roychoudhury, S., Dotzlaf, J. E., Ghag, S., and Yeh, W. (1994) J. Biol. Chem.

269, 120671207321. Sun, Y., Bauer, M. D., and Lu, W. (1998) J. Mass Spectrom. 33, 1009101622. Pinho, M.G., Ludovice, A. M., Wu, S., and De Lencastre, H. (1997) Microb.

Drug Resist. 3, 40941323. Hackbarth, C. J., Miick, C., and Chambers, H. F. (1994) Antimicrob. Agents

Chemother. 38, 2568257124. Katayama, Y., Zhang, H. Z., Hong, D., and Chambers, H. F. (2003) J. Bacteriol.

185, 5465547225. Katayama, Y., Zhang, H. Z., and Chambers, H. F. (2004) Antimicrob. Agents

Chemother. 48, 45345926. Lu, W. P., Kincaid, E., Sun, Y., and Bauer, M. D. (2001) J. Biol. Chem. 276,

314943150127. Jamin, M., Hakenbeck, R., and Frere, J. M. (1993) FEBS Lett. 331, 10110428. Crisostomo, M. I., Westh, H., Tomasz, A., Chung, M., Oliveira, D. C., and de

Lencastre, H., (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9865987029. Lu, W. P., Sun, Y., Bauer, M. D., Paule, S., Koenigs, P. M., and Kraft, W. G.

(1999) Biochemistry 38, 6537654630. Wu, C. Y., Alborn, W. E., Flokowitsch, J. E., Hoskins, J., Unal, S., Blaszczak,

L. C., Preston, D. A., and Skatrud, P. L. (1994) J. Bacteriol. 176, 44344931. Golemi, D., Maveyraud, L., Vakulenko, S., Samama, J. P., and Mobashery, S.

(2001) Proc. Natl. Acad. Sci. U. S. A. 98, 142801428532. Golemi-Kotra, D., Cha, J. Y., Meroueh, S. O., Vakulenko, S. B., and

Mobashery, S. (2003) J. Biol. Chem. 278, 184191842533. Lee, W., McDonough, M. A., Kotra, L., Li, Z. H., Silvaggi, N. R., Takeda, Y.,

Kelly, J. A., and Mobashery, S. (2001) Proc. Natl. Acad. Sci. U. S. A. 98,14271431

The Basis for Resistance to -Lactams by PBP2a of MRSA40806

by guest on February 9, 2015http://w

ww

.jbc.org/D

ownloaded from

Vakulenko and Shahriar MobasheryCosimo Fuda, Maxim Suvorov, Sergei B.

aureusStaphylococcusof Methicillin-resistant

2aAntibiotics by Penicillin-binding Protein -LactamThe Basis for Resistance to

Enzyme Catalysis and Regulation:

doi: 10.1074/jbc.M403589200 originally published online June 28, 20042004, 279:40802-40806.J. Biol. Chem.

10.1074/jbc.M403589200Access the most updated version of this article at doi:

.JBC Affinity SitesFind articles, minireviews, Reflections and Classics on similar topics on the

Alerts:

When a correction for this article is posted When this article is cited

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/279/39/40802.full.html#ref-list-1This article cites 33 references, 20 of which can be accessed free at

by guest on February 9, 2015http://w

ww

.jbc.org/D

ownloaded from