the analysis of pythium arrhenomanes- meloidogyne ... · root knot nematode-m. graminicola and...
TRANSCRIPT
Gent University
Faculty of Science
Department of Biology
Academic year: 2014 – 2015
The analysis of Pythium arrhenomanes-
Meloidogyne graminicola infection on rice
Md. Maniruzzaman Sikder
Promoter: Prof. Dr. Tina Kyndt
Supervisor: Ruben Verbeek
Thesis submitted to obtain the
degree of Master of Science in
Nematology
1
The analysis of Pythium arrhenomanes-Meloidogyne graminicola infection on rice
Md. Maniruzzaman Sikder1, 2 1 M.Sc. in Nematology, Department of Biology, Faculty of Sciences, Ghent University, K.L.
Ledeganckstraat 35, 9000 Gent, Belgium 2 Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Ghent University,
Coupure links 653, B-9000, Gent, Belgium
Summary: The root knot nematode-Meloidogyne graminicola and Oomycetes-Pythium arrhenomanes
have been known as main biotic factors behind yield decline in aerobic rice production. But, improved rice
grain yield have also been reported on rice cultivar-Apo and IR81413-BB-75-4 line in the presence of both
pathogens together compared to single infection. Present studies were carried out to evaluate the interaction
of P. arrhenomanes and M. graminicola on rice. Initially, a fluorescent labeling technique of M.
graminicola juveniles was tested to use for infection experiments, in order to be able to score the infection
under in vivo conditions, but this approach did not work in the rice root system. Infection experiments were
conducted on different rice cultivars, mutant (Jasmonic acid biosynthesis), overexpression transgenic line
(less auxin content) and chemical inhibitor treated plants. Based on developmental stages of root knot
nematodes, there was a synergistic interaction between M. graminicola and P. arrhenomanes on rice
cultivar-Nipponbare while in Palawan slightly antagonistic interaction was observed during double
infection. There was no interaction observed between both pathogens in cultivar-Apo and IR81413-BB-75-
3 line. The role of the Jasmonic acid (JA) signalling pathway in the interaction was unclear based on
infection experiments on Nihonmasari & JA-biosynthesis mutant (hebiba). However, in Nipponbare, the
JA biosynthesis gene was upregulated after P. arrhenomanes infection but a significant suppression of this
gene was found in root knot nematode infected plants. Auxin seems to be an important factor for nematode
development as a OsGH3.1 overexpression line (which contains less free auxin) was less susceptible to M.
graminicola infection. There was a significant reduction in the number of females in the OsGH3.1
overexpression line after single M. graminicola infection. However, female numbers in this line were
significantly increased in the presence of P. arrhenomanes in double infected plants, which suggests that
P. arrhenomanes complements the usually low auxin levels in the root of the OsGH3.1 overexpression line.
The basal expression level of OsGH3.1 was significantly higher (exemplifying lower free auxin content) in
the IR81413-BB-75-3 line compared to Nipponbare, which might explain the generally lower number of
galls as well as nematodes in the IR81413-BB-75-3 line. There was a very low amount of in planta P.
arrhenomanes DNA quantified in all of the samples, which indicates that the Synthetic Absorbent Polymer
(SAP) substrate system used in these here-described experiments might not be optimal for P. arrhenomanes
penetration and colonization of the root tissue, although disease symptoms were observed.
Keywords: Root knot nematodes, Oomycetes, Interaction, Synergism, Antagonism, Gene expression.
2
1 Background information
Rice (Oryza sativa L.) is the major food grain which meet the diets of over half of the world
population, mainly grown in tropical and subtropical regions (Han et al., 2007). Now, rice is
cultivated in 114 countries (Nicol et al., 2011) and estimated that 346 million acre of rice is being
grown throughout the world, in which 263 million acres are infested with damaging levels of plant
parasitic nematodes (Hollis Jr et al., 1984). Root-knot nematodes are the most destructive amongst
all plant parasitic nematodes (Karssen et al., 2006; Padgham & Sikora, 2007; Perry et al., 2009).
Among root knot nematodes, Meloidogyne graminicola is one the most damaging type of
nematode attacking rice roots (Bridge et al., 2005; Kyndt et al., 2014b). Introduction of water
saving rice production systems and the cultivation of aerobic rice varieties favors the buildup of
large populations of M. graminicola in rice fields (De Waele & Elsen, 2007). They causes
substantial damage on rice, depending on which cropping system is being used (Netscher & Erlan,
1993). They are responsible for great yield losses (20% to 70%) in many countries (Chantanao,
1962; Roy, 1973; Soriano et al., 2000; Soriano & Reversat, 2003; Padgham et al., 2004; Pokharel
et al., 2007). On the other hand, Oomycetes-Pythium spp. are one of the most common group of
seedling disease pathogens in rice-production areas. It is responsible for pre- and post-emergence
death, and causes 70% and 48% of average growth reductions of root and shoot respectively in
surviving seedlings (Cother & Gilbert, 1993; Eberle et al., 2007). It was found in 47% of soil
samples, sampled across rice fields of the Riverine Plain in New South Wales, Australia (Cother
& Gilbert, 1992). A number of isolates belonging to Pythium arrhenomanes, P. graminicola and
P. inflatum were recovered from affected aerobic rice fields in the Philippines in which all of the
isolates of P. arrhenomanes were found pathogenic to rice (Van Buyten et al., 2013); this species
was also found as pathogenic to rice seedlings in northern Japanese rice fields recently (Toda et
al., 2015). Root knot nematode-M. graminicola and Oomycetes-Pythium spp. have been
recognized as main biotic causes to yield decline in the aerobic rice production system (Kreye et
al., 2010a; Kreye et al., 2010b).
Combined nematode and fungal/or oomycetes infection (so called double infection) showed
increased damage and higher yield losses of plants compared to the single infection (Atkinson,
1892; Johnson & Littrell, 1970; Powell, 1971; Roberts et al., 1995; Bhattarai et al., 2009). Possible
explanation is that nematode infection influences gene expression in plants, aimed at suppressing
3
host defense pathways. Such manipulation of plant gene expression by the nematode might lead
to subsequent pathogen infections (Conrath et al., 2002; Bezemer & van Dam, 2005; Wurst & van
der Putten, 2007). Surprisingly, recent IRRI study found a reverse effect of double infection on
cultivar-Apo and IR81413-BB-75-4, where double infection of P. arrhenomanes and M.
graminicola was found to cause increased rice grain yield, compared to solely M. graminicola
infection on rice (Kreye et al., 2010b). These findings inspired to elucidate the mechanism of
interaction of P. arrhenomanes and M. graminicola on rice roots.
The expression of pathogenesis-related (PR) proteins in rice is mainly regulated by key
phytohormones such as Salicylic acid (SA), Jasmonic acid (JA) and Ethylene (ET) (Nahar et al.,
2011; De Vleesschauwer et al., 2012; Kyndt et al., 2012; Riemann et al., 2013; Tamaoki et al.,
2013; Uenoa et al., 2013; De Vleesschauwer et al., 2014; Kyndt et al., 2014a; Taniguchi et al.,
2014). Others phytohormones such as Abscisic acid (ABA), Auxin (AUX), Gibberellic acid (GA),
and Brassinosteroids (BR) either act as a virulence factor for pathogens to manipulate defense
signaling pathways or play a positive role in defense in rice to some extents (Ding et al., 2008;
Domingo et al., 2009; De Vleesschauwer et al., 2010; De Vleesschauwer et al., 2012; Nahar et al.,
2012; Jiang et al., 2013; Nahar et al., 2013; Qin et al., 2013; Van Buyten, 2013). The JA hormonal
pathway plays a key role in rice defense against biotrophic root pathogen M. graminicola (Nahar
et al., 2011; Kyndt et al., 2012; Kyndt et al., 2014a); while JA and ET pathway play a major role
in defense against necrotrophic pathogens (Geraats et al., 2002; Bari & Jones, 2009; De
Vleesschauwer et al., 2012). It is known that auxin is essential for giant cell initiation and
development by root knot nematodes (Karczmarek et al., 2004). On the other hand, Pythium spp.
are capable to produce IAA by themselves, have potential to induce endogenous AUX level and
have ability to regulate auxin signaling (Rey et al., 2001; Van Buyten, 2013). Unfortunately, the
molecular mechanism of hormonal pathways in rice underlying the interaction of M. graminicola
and P. arrhenomanes is unclear.
Present study was undertaken with following objectives- I) to evaluate gall and nematode
development in rice roots under in vivo condition, II) to study the interaction of P. arrhenomanes
and M. graminicola on different rice cultivars, mutant and transgenic line, III) to investigate the
role of hormone signaling pathways (more specifically: JA, SA, ET and Auxin) during single and
double infection on rice roots, IV) to quantify in planta Pythium arrhenomanes DNA, and V) to
4
search for genes coding for necrosis and ethylene inducing peptide 1 (Nep1) like proteins (NLPs)
in P. arrhenomanes.
2 Materials and Methods
2.1 Plant Material and Growth Conditions
Different rice (Oryza sativa L.) cultivars-Nipponbare (provided by USDA), Palawan 1 & 2
(traditional upland rice cultivar, originated in IRRI; Palawan-2, GID 48535), Apo and IR81413-
BB-75-3 (provided by IRRI; called IR line in this thesis), were used in interaction experiments. In
addition, hebiba (JA biosynthesis mutant line) and its corresponding wild-type CV Nihonmasari,
OsGH3.1 -overexpression line (which accumulates less auxin) and its corresponding wild-type cv.
Bomba (obtained from USDA) were also used in interaction experiment. Rice seeds were surface
sterilized (4% NaOCl), subsequently rinsed with sterile water three times, germinated on wet paper
towel for 4 days at 30°C in an incubator and transplanted into Synthetic Absorbent Polymer (SAP)
substrate medium in a PVC tube at 1 plant/SAP tube (Reversat et al., 1999). Plants were grown at
26°C temperature under 12h/12h light regime with 70% to 75% relative humidity in the growth
chamber; and were fertilized with 10mL of Hoagland solution (an artificial nutrient source) per
plant twice per week.
2.2 Maintenance of Pathogens
The Meloidogyne graminicola culture (originally isolated in the Philippines) was maintained on
rice cultivar-Nipponbare and tropical Asian wild type grasses-Echinocloa crus-galli. Root systems
of 3 month old infected plants were cut into pieces and nematodes were extracted using the
modified Baermann method (Luc et al., 2005). Second stage juveniles were collected after 48 hours
of incubation. The pure culture of Pythium arrhenomanes (P60, isolated from rice field in
Philippines) was given by Phytopathology laboratory, Department of Crop Protection, Ghent
University, Belgium; and culture was maintained on PDA (Potato Dextrose Agar) medium and 3-
4 days old culture was used to inoculate rice seedlings.
2.3 Infection Assay and susceptibility scoring
In each infection assay, there were four different treatments performed with the above mentioned
rice cultivars: single infection of both pathogens, a double infection (M. graminicola plus P.
arrhenomanes) and an uninfected control (mock). Four days old rice seedlings were transplanted
5
on SAP media and a single plug of P. arrhenomanes (Appendix, Figure 1) was used to infect rice
seedlings on day 9 (single infection) after making hole in the SAP media near roots, about 1 ml of
nematode suspension containing 250 second-stage juveniles of M. graminicola were used to infect
rice seedlings on day 11 (single infection), double infection with both pathogens (P. arrhenomanes
on day 9 and M. graminicola on day 11), and mock infection was done on control plants with agar
block/water.
To evaluate susceptibility to root knot nematode infection, root samples were harvested on day 12.
Root samples were boiled in 0.8% acetic acid solution containing 0.013% acid fuchsin for 3
minutes, followed by rinsing with running tap water, de-stained in acid glycerol (1.5 ml of 37%
HCl plus 500 ml of Glycerol). Effect of pathogens were evaluated by measuring the shoot and root
length of the plants, counting the number of galls, total number of nematodes per root system, and
the number of nematode developmental stages (J2, J3/J4, female and eggmass) per plant (Figure
1).
Figure 1. Developmental stages of M. graminicola in rice roots
2.4 Fluorescent labelling of nematodes
Nematodes were purified on a 100% sucrose solution followed by washing with sterile water. For
PKH26 labeling, a total of 45,000 second stage juveniles (J2) of M. graminicola were resuspended
in 1.5 ml of sterile water prior to addition of 2 µl PKH26 (stock solution 1 × 10–3 M) from the
MINI26 PKH26 Red Fluorescent Cell Linker Kit (Sigma-Aldrich). The suspension was mixed by
inverting several times, then incubated for 15 minutes in the dark at room temperature. Nematodes
were rinsed three times by repeated transfers to 30 ml of sterile water to remove excess dye,
followed by centrifuging (375 × g for 3 min). Stained and non-stained nematodes were observed
on standard microscopy glass slides using confocal microscope. PKH26 stained nematodes and
unstained nematodes were immediately used to inoculate rice roots. After 12 days, roots were put
J2 J3/J4 Female and Eggmass Gall
6
on glass slides and observed under the confocal microscope. In parallel, roots of similarly treated
plants were boiled in acid fuchsin to check the infectivity and nematode development of the stained
nematodes inside the rice roots.
2.5 Chemical Treatments
JA & SA biosynthesis inhibitor SHAM (2-Hydroxybenzenecarbohydroxamic acid) and JA
biosynthesis inhibitor DIECA (Diethyldithiocarbamic acid diethylammonium salt), were used on
rice cultivar Nihonmasari. These chemical inhibitors were dissolved in 1mL of pure ethanol prior
to diluting in water containing 0.02% (v/v) Tween 20 in which the concentrations of SHAM (200
mM) and DIECA (100 mM) were prepared. Infection was similar as described above, with the
addition of the chemical treatment on day 10, in which rice shoots were sprayed with chemical
inhibitors (SHAM and DIECA) using vaporizers; SHAM was also used as root drench in a separate
trial.
2.6 RNA Extraction, cDNA Synthesis, and qRT-PCR
On day 12 of the infection assay, root samples were harvested for gene expression studies on rice
cv. Nipponbare and IR line. Root RNA was extracted using RNeasy Plant Mini Kit (Qiagen)
following the manufacturer’s instructions and RNA concentration was measured using the Nano
Drop 2000c UV-Vis spectrophotometer (Thermo Scientific). Extracted RNA was treated with
DNaseI to eliminate residual DNA. A total of 3 microgram of RNA was treated with 2 µl of DNaseI
(1 unit per µl; Fermentas), 1 µl of RiboLock RNase Inhibitor (40 unit per µl; Fermentas), and 1.8
µl of 10x DNaseI buffer with MgCl2 (Fermentas) in a total volume of 18 µl (including water). The
mixture was incubated at 37°C for 30 min followed by addition of 2 µl of 25 mM EDTA
(Fermentas) and incubated at 65°C for 10 min to terminate the reaction.
First strand cDNA synthesis was carried out in three steps: (1) addition of 4µl of RNAse free water,
1 µl of oligo(dT) (700 ng/µl), and 2 µl of 10 mM deoxyribonucleotide triphosphates (dNTPs,
Invitrogen), in a total volume of 27 µl including 20 µl of DNase treated RNA which was incubated
at 65°C temperature for 5 minutes; (2) addition of 8 µl of 5x first strand buffer (Invitrogen) and 4
µl of 0.1 M DDT (dithiothreitol) which was incubated at 42°C for 2 minutes followed by put on
ice; and (3) addition of 1 µl of SuperScript II Reverse Transcriptase (200 unit per µl; Invitrogen)
which was incubated at 42°C for 2 hours. The solution was diluted to 100 µl by adding 60 µl of
water, and the cDNA quality was checked using 5 µl of 5x MyTaq reaction buffer (preoptimized
7
conc. of dNTPs and MgCl2, BIOLINE), 5 µl of cDNA template, 1 µl of forward and reverse
primers (10µM) each for reference gene OsExpnarsai, 0.15 µl of Taq-polymerase (5u/μl,
BIOLINE), 12.85 µl of water in a total volume of 25 µl. The programme was 95°C for 5 minutes,
95°C for 45s, 55°C for 45s, 72°C for 30s (repeated 40X), 72°C for 5 minutes. Products were
checked on a 1.5% agarose gel (0.5x TAE).
For qRT-PCR analysis, each reaction contained 1 µl of cDNA, 1 µl of forward and reverse primer
(10 µM) each, 7 µl sterile water and 10µl of 2xSensi MixTM SYBR No-ROX Mastermix (BIOLINE)
in a total volume of 20µl. A list of primers used for qRT-PCR is presented in Table 1. Each
treatment was evaluated in two biological replicates (4 plants in each biological replicate) and
three technical replicates. The PCR reactions were conducted in the Rotor-Gene 3000 (Corbett
Life Science) using Rotor gene Disc (Qiagen), and results were generated using Rotor Gene
software. All qRT-PCR were conducted under the following conditions: hold temperature at 95°C
for 10 min, and 40 cycles at 95°C for 25s, 58°C for 25s, and 72°C for 20s. A melting curve was
generated to test the amplicon specificity.
Table 1. An overview of the selected target and reference genes with their Gene Bank Locus
number and the primer pairs used for qRT-PCR
Gene studied Forward primer (5′-3′) Reverse primer (3′-5′) Locus number
Reference OsExpnarsai AGGAACATGGAGAAGAACAAGG CAGAGGTGGTGCAGATGAAA LOC_Os07g02340
Reference OsEXP TGTGAGCAGCTTCTCGTTTG TGTTGTTGCCTGTGAGATCG LOC_Os03g27010
Reference OsEIF5C CACGTTACGGTGACACCTTTT GACGCTCTCCTTCTTCCTCAG LOC_Os11g21990
PR-10 OsPR10 CCCTGCCGAATACGCCTAA CTCAAACGCCACGAGAATTTG LOC_Os12g36880
JA
biosynthesis OsAOS2 CAATACGTGTACTGGTCGAATGG AAGGTGTCGTACCGGAGGAA LOC_Os03g12500
SA
biosynthesis OsICS1 TGTCCCCACAAAGGCATCCTGG TGGCCCTCAACCTTTAAACATGCC LOC_Os09g19734
Auxin
Biosynthesis OsYUCCA-1 GCACAACCTCGAGTGCTACC CGTCCACTTCCTTGTTCACC LOC_Os01g46290
Auxin
response OsGH3.1 GCAATGGAACAAAAGCAAGGA CAGATCATCACCCTCTAGCTTCAA LOC_Os01g57610
ET
biosynthesis OsACS1 GATGGTCTCGGATGATCACA GTCGGGGGAAAACTGAAAAT LOC_Os03g51740
ET response OsEIN2b TAGGGGGACTTTGACCATTG TGGAAGGGACCAGAAGTGTT LOC_Os07g06130
2.7 Quantification of P. arrhenomanes DNA in rice roots by qPCR
Root samples were collected from single P. arrhenomanes and double (M. graminicola and P.
arrhenomanes) infection in both Nipponbare and IR line. In addition, some root samples were
included from a raised bed interaction study performed by Ruben Verbeek at IRRI in the period
8
January – May, 2015 (samples given by Ruben Verbeek, PhD. Student, Ghent University, Belgium)
to compare infection pressure between SAP system and soil system. Root tissue was finely crushed
in liquid nitrogen. DNA was extracted using DNeasy Plant Mini Kit (Qiagen) according to
manufacturer’s instruction. Primers specific for the Internal Transcribed Spacer (ITS)-region of
the ribosomal DNA of P. arrhenomanes PT 60 (ITS60 F(5′-3′): ATTCTGTTACGCGTGGTCTT
CCG; ITS60 R(3′-5′): ACCTCACATCTGCCATCTCTCTCC were used to quantify in planta P.
arrhenomanes DNA (Van Buyten & Hofte, 2013). Rice specific primers 400F (5′-3′): TTCTCCT
CCCAATCGTCTCG and 401R (3′-5′): TTAGGTGGAGGGAGCGAATC were used to normalize
the Pythium DNA. Each reaction contained 1 µl of DNA, 1 µl of forward and reverse primer (10
µM) each, 7 µl sterile water and 10µl of 2xSensi MixTM SYBR No-ROX Mastermix (BIOLINE)
in a total volume of 20µl. Three technical replicates were used for all samples. Standard curve
based on dilution series (1 ng, 0.1 ng, 0.01ng, 0.001ng) were run to quantify plant and Pythium
DNA. The standard curve with R2 value of 0.9981 and a slope (y=-0.3081x+4.9047) were
generated. The reactions were conducted in CFX Connect™ Real-Time PCR Detection System
using 96-Well PCR Plates (BIO-RAD). qPCR were conducted using following thermal cycles: 10
min at 95°C, and 45 cycles of 25s at 95°C, 58°C for 25s, and 72°C for 20s. To test the amplicon
specificity, a melting curve was generated by gradually increasing the temperature to 95°C. The
qPCR data were analyzed using the CFX Manager™ software.
2.8 Statistical analysis
Data generated during the experiment were checked for normality and homogeneity of variance.
Data on shoot and root length of rice cultivars were found to be normal and were analyzed using
one-way ANOVA with Duncan’s Post-Hoc test in SPSS. Number of galls and total nematodes per
root system were also normally distributed which was analyzed using independent T-test in SPSS.
Data on developmental stages of M. graminicola were not normally distributed and homogeneity
of variance was not uniform, so Mann–Whitney (for 2 variables) non-parametric tests, SPSS were
performed. qRT-PCR data were analyzed using the REST 9 software (Pfaffl et al., 2002); this
software uses a permutation analysis between control group and sample to compare the relative
expression levels and to determine the statistical significance.
9
3 Results
3.1 Experiment on fluorescent labelling of nematodes
A fluorescent nematode staining technique as reported recently (Dinh et al., 2014), was tested out
in order to be able to quantify nematode development in living root tissues. The staining of the
nematodes was successful (Figure 2) and there was no adverse effect of staining on their
penetration (Figure 3 A) and similar pattern of the number of female in the rice roots (Figure 3 B).
Living infected roots were checked to see the fluorescence of the nematodes inside the root (Figure
4, A-B), but it was not possible to get a clear picture of the vascular bundles, in which nematode
development was expected (Figure 5).
Figure 2. (A) Non-stained J2 and (B) Fluorescent labeling (stained) second stage juveniles
of M. graminicola on glass slide under confocal microscope
A B
10
0
1
2
3
4
5
6
7
8
9
10
Control (Non-stain) Stained
Gall
/rro
t sy
stem
A
0
2
4
6
8
10
12
14
16
Control (Non-stain) Stained
Sta
ges
/root
syst
em
J2 J3/J4 Female Eggmass
B
Figure 3. (A). Number galls/root system. Independent sample T-test were done on number of
galls per root system between stained and non-stained of M. graminicola at Nipponbare. (B).
Developmental stages of M. graminicola between non-stain and stained nematodes at
Nipponbare. Mann–Whitney non-parametric tests were done on number of J2s, J3/J4 and
females between stained and non-stained of M. graminicola at Nipponbare. Bar represent
Mean±Standard error of 4 replicates
A
Figure 4. (A) Confocal microscopic view on the surface of the rice root; (B) Confocal
microscopic view little beneath to the surface of the rice root.
B
11
3.2 Interaction experiments on Nipponbare, Palawan, Apo and IR line
To evaluate the interaction between M. graminicola and P. arrhenomanes on different rice
cultivars, we compared the nematode development and gall formation in the roots infected only
with nematodes versus double-infected root systems. When the number of galls or development
was lower in the double infection versus single infection, the interaction was considered to be
antagonistic. When the number of galls or development was higher in the double infection versus
single infection, the interaction was considered to be synergistic.
In the first trial of the experiment, unusually slow nematode development was observed
irrespective of rice cultivars tested (Appendix, Figure 2). As the development of J2s of the
nematodes might be affected by an external influence, it was decided to leave this trial out of the
analysis.
In two other independent trials, shoot lengths were reduced significantly after single P.
arrhenomanes infection and after double infection compared to mock infected rice varieties
(Figure 6 & 9). There were no clear trends found based on the root length among treatments in the
rice cultivars tested, although root lengths were generally smaller in infected plants (Figure 7). In
Nipponbare, based on nematode development, there was synergistic effect between both pathogens,
i.e., the higher number of galls, total nematode counts and mean developmental stages were
Figure 5. Confocal microscopic
view in the middle of the rice root
12
observed in double infected (M. graminicola plus P. arrhenomanes) plants as compared to single
M. graminicola infected plants (Figure 8 & 10). In Palawan-2, there was a similar number of galls
found between single and double infection but total nematode counts and number of females were
lower in double infected plants compared to single M. graminicola infected plants, although this
effect was not spectacular (Figure 8B & 10). The interaction seemed to be slightly antagonistic in
Palawan-2. There was no difference observed between single M. graminicola infected and double
infected plants in cultivar-Apo and IR line rice cultivars in terms of number of galls (Figure 8A),
total nematodes counts per root system (Figure 8B) as well as developmental stages of RKN
(Figure 10). Interestingly, cultivar-Apo and IR line seemed to be less susceptible to the nematodes
as compared to Nipponbare and Palawan-2 (Figure 8B).
Figure 6. Shoot length of different rice cultivars after 12 days post infection (dpi) of M.
graminicola (single infection), 14 dpi of P. arrhenomanes (single infection) and double infection
(12 dpi of M. graminicola plus 14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error
of 6 replicates (2nd Trial) and 8 replicates (3rd Trial). Letter(s) on error bars are based on statistical
analysis (Duncan’s multiple range test) after one way ANOVA. Means followed by the same
letter(s) do not differ significantly (P > 0.05).
0
5
10
15
20
25
30
35
40
45
50
2nd Trial 2nd Trial 2nd Trial 2nd Trial 3rd Trial 3rd Trial
Nipponbare Palawan-2 Apo IR line Apo IR line
Sh
oo
t le
ng
th (
cm)
Mock Mg Py Mg+Py
a
b
a
c
ab b b
a ab b
a ab
b
a a b ba ab ab c
13
Figure 7. Root length of different rice cultivars after 12 dpi of M. graminicola (single infection),
14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M. graminicola plus
14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error of 6 replicates (2nd Trial) and 8
replicates (3rd Trial). Letter(s) on error bars are based on statistical analysis (Duncan’s multiple
range test) after one way ANOVA. Means followed by the same letter(s) do not differ significantly
(P > 0.05).
0
5
10
15
20
25
2nd Trial 2nd Trial 2nd Trial 2nd Trial 3rd Trial 3rd Trial
Nipponbare Palawan-2 Apo IR line Apo IR line
Ro
ot
len
gth
(cm
)
Mock Mg Py Mg+Py
aab
b b
ab
a aba ab
b ba a a
b
a a a aa
b a a
0
5
10
15
20
25
30
Nip
pon
bar
e
Pal
awan
-2
Ap
o
IR
Ap
o
IR
2nd Trial 3rd Trial
Ga
ll/r
oo
t sy
stem
Gall Mg Gall Mg+Py
A
0
20
40
60
80
100
120
Nip
pon
bar
e
Pal
awan
-2
Ap
o
IR
Ap
o
IR
2nd Trial 3rd Trial
Nem
ato
des
/ro
ot
syst
em
Mg Mg+Py
B
Figure 8. (A) Number of galls and (B) Number of nematodes/root system on different rice
cultivars at 12 dpi of M. graminicola. Bar represent Mean ± Standard error of 6 replicates (2nd
Trial) and 8 replicates (3rd Trial). Independent sample T-test were done on number of galls and
total nematode count per root system between single M. graminicola infected and double
infected (M. graminicola plus P. arrhenomanes) plants in each cultivar. Asterisks indicate
statistically significant different between Mg and Mg+Py (P < 0.05).
*
14
Nipponbare Palawan-2
Apo IR81413-BB-75-3
Figure 9. Response of different rice cultivar to root knot nematode-M. graminicola and
Oomycetes- P. arrhenomanes. Mock-without any pathogen inoculation; Mg-single M.
graminicola infection; Py-single P. arrhenomanes infection; Mg+Py-both M. graminicola
and P. arrhenomanes infection.
Mock Mg Py Mg+Py Mock Mg Py Mg+Py
Mock Mg Py Mg+Py Mock Mg Py Mg+Py
15
Figure 10. Developmental stages of M. graminicola at 12 dpi on different rice cultivars. Bar
represent as Mean ± Standard error 6 replicates (2nd Trial) and 8 replicates (3rd Trial). Mean value
of number of female is displayed in the bar. Mann–Whitney non-parametric tests were done on
number of females between single M. graminicola infected and double infected (M. graminicola
plus P. arrhenomanes) plants in each trial.
3.3 Role of JA on interaction of M. graminicola and P. arrhenomanes
In order to know the role of defense hormone-Jasmonic acid on interaction between biotrophic-M.
graminicola and Oomycetes-P. arrhenomanes, experiments were conducted on Nihonmasari
(wild-type), mutant line-hebiba (JA biosynthesis mutant) and JA pathway inhibitors (SHAM and
DIECA) treated Nihonmasari. In Nihonmasari and chemical inhibitor treated Nihonmasari, there
was significant reduction of shoot length in single P. arrhenomanes infected and double infected
(M. graminicola and P. arrhenomanes) plants compared to the control and single M. graminicola
infected plants (Figure 11 & 15). In most of the cases, reduction of root length were observed in
pathogen infected plants as compared to control plants (Figure 12). Based on number of galls per
root system, there was a synergistic effect in double infected roots in 2nd trial of Nihonmasari and
first trial of DIECA treated Nihonmasari (Figure 13). There was no statistical difference in the
number of total nematodes as well as the number of females per root system between single M.
graminicola infected and double infected plants (Figure 14 & 16). But, there was a lower mean
number of females observed in double infected plants compared to single M. graminicola infected
plants in first trial of Nihonmasari, hebiba (both trials), foliar applied DIECA, foliar sprayed and
root drenched SHAM. In case of the 2nd trail, Nihonmasari gave a synergistic effect (Figure 16).
56,00
64,6059,63 49,88
22,2018,80
30,75 30,25
16,00 15,25 18,13 18,63
0,00
20,00
40,00
60,00
80,00
100,00
120,00
Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py
2nd Trial 2nd Trial 2nd Trial 3rd Tial 2nd Trial 3rd Tial
Nipponbare Palawan-2 Apo IR
Sta
ges
/ro
ot
syst
em
J2 J3/J4 Female Eggmass
16
Since the interaction between both pathogens in Nihonmasari was not consistent (once synergism,
once slight antagonism) it is hard to draw conclusions from these experiments.
Figure 11. Shoot length of different rice cultivars after 12 dpi of M. graminicola (single infection),
14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M. graminicola plus
14 dpi of P. arrhenomanes). Bar represent as mean ± standard error of 8 replicates. Letter(s) on
error bars are based on statistical analysis (Duncan’s multiple range test) after one way ANOVA.
Means followed by the same letter(s) do not differ significantly (P > 0.05).
Figure 12. Root length of different rice cultivars after 12 dpi of M. graminicola (single infection),
14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M. graminicola plus
14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error of 8 replicates. Letter(s) on error
bars are based on statistical analysis (Duncan’s multiple range test) after one way ANOVA. Means
followed by the same letter do not differ significantly (P > 0.05).
0
5
10
15
20
25
30
35
1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial
Nihonmasari hebiba Nih+SHAM
(Foliar spray)
Nih+DIECA
(Foliar spray)
Nih+SHAM
(Root drench)
Sh
oo
t le
ng
th (
cm)
Mock Mg Py Mg+Py
a aab
b
a a
b b
ab a
bb
ab ab
ab a a
bc
a a
bb
a a
bb
0
5
10
15
20
25
1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial
Nihonmasari hebiba Nih+SHAM
(Foliar spray
Nih+DIECA
(Foliar spray)
Nih+SHAM
(Root drench)
Ro
ot
len
gth
(cm
)
Mock Mg Py Mg+Py
a
b b
c
a ababb
a
bc bc
a a a a aa
a a a ab b a
b bb
17
Figure 13. Number of galls/root system at 12 dpi of M. graminicola at Nihonmasari, hebiba and
chemical inhibitor treated Nihonmasari. Bar represent Mean ± Standard error of 8 replicates.
Independent sample T-test were done on number of galls per root system between single M.
graminicola infected and double infected (M. graminicola plus P. arrhenomanes) plants in each
trial under each cultivar. Asterisks indicate statistically significant different between Mg and
Mg+Py (P < 0.05).
Figure 14. Number of nematodes/root system at 12 dpi of M. graminicola at Nihonmasari, hebiba
and chemical inhibitor treated Nihonmasari. Bar represent as Mean ± Standard error of 8 replicates.
Independent sample T-test were done on total nematode count per root system between single M.
graminicola infected and double infected (M. graminicola plus P. arrhenomanes) plants in each
trial under each cultivar
0
5
10
15
20
25
30
35
40
45
1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial
Nihonmasari hebiba Nih+DIECA
(Foliar Spray)
Nih+SHAM
(Foliar Spray)
Nih+SHAM
(Root drench)
No
. o
f g
all
s/ro
ot
syst
em
Mg Mg+Py
* *
0
10
20
30
40
50
60
70
80
90
1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial
Nihonmasari hebiba Nihon+DIECA
(Spray)
Nihon+SHAM
(Spray)
Nihon+SHAM
(Root drench)
Nea
mto
des
/ro
ot
syst
em
Mg Mg+Py
18
Nihonmasari hebiba
SHAM sprayed Nihonmasari DIECA sprayed Nihonmasari
Figure 15. Response of Nihonmasari, hebiba and chemical inhibitor treated Nihonmasari to
root knot nematode-M. graminicola and Oomycetes- P. arrhenomanes. Mock-without any
pathogen inoculation; Mg-single M. graminicola infection; Py-single P. arrhenomanes
infection; Mg+Py-both M. graminicola and P. arrhenomanes infection.
Mock Mg Py Mg+Py Mock Mg Py Mg+Py
Mock Mg Py Mg+Py Mock Mg Py Mg+Py
19
Figure 16. Developmental stages of M. graminicola at 12 dpi at Nihonmasari, hebiba and chemical
inhibitor treated Nihonmasari. Bar represent as Mean ± Standard error of 8 replicates. Mean value
of number of female is displayed in the bar. Mann–Whitney non-parametric tests were done on
number of females between single M. graminicola infected and double infected (M. graminicola
plus P. arrhenomanes) plants in each trial for each cultivar.
3.4 Role of Auxin on interaction of M. graminicola and P. arrhenomanes
To evaluate the role of auxin, infection assay was done on overexpression OsGH3.1, a transgenic
line in which plants have less free auxin, and its wild-type Bomba. Both in wild type and the
OsGH3.1 overexpression line, there was significant reduction of shoot length in single P.
arrhenomanes infected and double infected (M. graminicola and P. arrhenomanes) plants
compared to control and single M. graminicola infected (Figure 17 & 21). But, both in wild type
and the OsGH3.1 overexpression line, there was significant reduction of root length in single M.
graminicola infected and double infected (M. graminicola and P. arrhenomanes) plants compared
to single P. arrhenomanes infected and control plants (Figure 18). There was no significant
difference found in the number of galls and total nematodes counts between single M. graminicola
infected and double infected (M. graminicola and P. arrhenomanes) plants (Figure 19 A-D).
However, there was a significantly higher number of females observed in double infected plants
compared to single M. graminicola infected plants in the OsGH3.1 overexpression line, while this
25,38 15,50
33,13
46,0024,00
7,83
48,6341,25
30,75
22,38
44,25 39,50
20,29
13,14
0,00
10,00
20,00
30,00
40,00
50,00
60,00
70,00
80,00
90,00
Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py
1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial
Nihonmasari hebiba Nih+DIECA
(Spray)
Nih+SHAM
(Spray)
Nih+SHAM
(Root drench)
Sta
ges
/ro
ot
syst
emJ2 J3/J4 Female Eggmass
20
was not observed in wild type Bomba (Figure 20). Bomba showed a slight antagonism between
the pathogens while a synergistic interaction was seen in the OsGH3.1 overexpression line (Figure
20).
Figure 17. Shoot length of Bomba and overexpression OsGH3.1 line after 12 dpi of M.
graminicola (single infection), 14 dpi of P. arrhenomanes (single infection) and double infection
(12 dpi of M. graminicola plus 14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error
of 8 replicates. Letter(s) on error bars are based on statistical analysis (Duncan’s multiple range
test) after one way ANOVA. Means followed by the same letter(s) do not differ significantly (P >
0.05).
Figure 18. Root length of Bomba and overexpression OsGH3.1 line after 12 dpi of M. graminicola
(single infection), 14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M.
graminicola plus 14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error of 8 replicates.
Letter(s) on error bars are based on statistical analysis (Duncan’s multiple range test) after one way
ANOVA. Means followed by the same letter(s) do not differ significantly (P > 0.05).
0
5
10
15
20
25
30
35
40
45
50
Bomba OsGH3.1
Sh
oo
t le
ng
th (
cm)
Mock Mg Py Mg+Py
a ab b
a a abb
0
5
10
15
20
25
Bomba OsGH3.1
Ro
ot
len
gth
(cm
)
Mock Mg Py Mg+Py
a a
b b
a ab b
21
Figure 19. (A) Gall/root system in Bomba, (B) Gall/root system in overexpression OsGH3.1 line,
(C) Total nematodes counts/root system in Bomba, (D) Total nematodes counts/root system in
overexpression OsGH3.1 line at 12 dpi of M. graminicola. Bar represent Mean ± Standard error
of 8 replicates. Independent sample T-test were done between single M. graminicola infected and
double infected (M. graminicola plus P. arrhenomanes) plants in each cultivar/ transgenic line.
Figure 20. Developmental stages of M. graminicola at 12 dpi at Bomba and overexpression
OsGH3.1 line. Bar represent mean ± standard error of 8 replicates. Mean value of the number of
female is displayed in the bar. Mann–Whitney non-parametric tests were done on number of
females between single M. graminicola infected and double infected (M. graminicola plus P.
arrhenomanes) plants in each cultivar/transgenic line. Asterisks indicate statistically significant
different between Mg and Mg+Py (P <0.05).
33,8830,86
22,75 36,25
0,00
10,00
20,00
30,00
40,00
50,00
60,00
Mg Mg+Py Mg Mg+Py
Bomba OsGH3.1
Sta
ges
per
ro
ot
syst
em
J2 J3/J4 Female Eggmass
*
0
5
10
15
20
Mg Mg+Py
Ga
ll/r
oo
t sy
stem
Bomba A
0
20
40
60
Mg Mg+Py
Nem
ato
de/
roo
t
syst
em
Bomba C
0
10
20
30
Mg Mg+Py
Ga
ll/r
oo
t sy
stem
OsGH3.1 line B
0
20
40
60
Mg Mg+Py
Nem
ato
de/
roo
t
syst
em
OsGH3.1 line D
22
3.5 Gene expression studies on Nipponbare and IR line
The gene expression was studied to elucidate the molecular mechanisms behind the interaction. In
Nipponbare (Figure 22), the transcript of OsPR10, a general pathogenesis-related gene, was
slightly down-regulated in M. graminicola infected roots while significantly up-regulated in P.
arrhenomanes infected roots. In double infected (P. arrhenomanes plus M. graminicola) roots,
this gene was up-regulated although less pronounced compared to single P. arrhenomanes infected
roots. The JA biosynthesis gene, OsAOS2 was downregulated in single M. graminicola infected
roots, but significantly upregulated in the presence of necrotrophic pathogen-P. arrhenomanes;
interestingly this gene was slightly suppressed in double infected roots. Transcripts of SA-
biosynthesis gene, OsICS1 was slightly down-regulated irrespective of the treatments. Expression
of auxin biosynthesis gene, OsYUCCA1 and auxin responsive gene, OsGH3.1 was not strongly
changed after infection. ET-biosynthesis gene, OsACS1 was down-regulated in all the treatments
but more pronounced in single P. arrhenomanes infected roots. Ethylene responsive gene,
A. Bomba B. Overexpression OsGH3.1 line
Figure 21. Response of Bomba and overexpression OsGH3.1 line to root knot nematode-M.
graminicola and Oomycetes- P. arrhenomanes. Mock-without any pathogen inoculation; Mg-
single M. graminicola infection; Py-single P. arrhenomanes infection; Mg+Py-both M.
graminicola and P. arrhenomanes infection.
Mock Mg Py Mg+Py Mock Mg Py Mg+Py
23
OsEIN2b was significantly up-regulated in all of the treatments in which more pronounced in
single M. graminicola infected roots.
Figure 22. Relative expression levels of seven different genes in root samples of Nipponbare with
single nematode infection (1 dpi of M. graminicola; Mg); single P. arrhenomanes infection (3 dpi
of P. arrhenomanes; Py); double infection (1 dpi of M. graminicola plus 3 dpi of P. arrhenomanes;
Mg+Py). Bars represent the mean of two biological replicates, each containing root samples of a
pool of four plants. Asterisks indicate statistically significant differential expression in comparison
with uninfected plants.
In IR line (Figure 23), transcripts of both general pathogenesis gene, OsPR10 and JA-biosynthesis
gene, OsAOS2 were found to be down-regulated both in single M. graminicola infected and single
P. arrhenomanes infected roots while in double infected roots, OsPR10 was upregulated and
OsAOS2 expression did not change. Transcripts of SA biosynthesis gene, OsICS1 and auxin
biosynthesis gene, OsYUCCA1 were down-regulated after all treatments. Transcripts of auxin
responsive gene, OsGH3.1 was upregulated in single M. graminicola infected as well as in double
infected roots but slightly down-regulated in single P. arrhenomanes infected roots. Interestingly,
both ethylene biosynthesis gene, OsACS1 and ethylene responsive gene, OsEIN2b were
upregulated in single P. arrhenomanes infected roots as well as in double infected roots, but the
expression of OsACS1 was not altered and OsEIN2b was slightly down-regulated after single
infection of M. graminicola.
0,25
0,5
1
2
4
8
16
OsPR10 OsAOS2 OsICS1 OsYUCCA1 OsGH3.1 OsACS1 OsEIN2b
Rel
ati
ve
exp
ress
ion
lev
el
Mg Py Mg+Py
*
*
**
* *
24
23. Relative expression levels of seven different genes in root samples of IR line with single
nematode infection (1 dpi of M. graminicola; Mg); single P. arrhenomanes infection (3 dpi of P.
arrhenomanes; Py); double infection (1 dpi of M. graminicola plus 3 dpi of P. arrhenomanes;
Mg+Py). Bars represent the mean of two biological replicates, each containing root samples of a
pool of four plants. Asterisks indicate statistically significant differential expression in comparison
with uninfected plants.
Figure 24. Basal expression levels of seven different genes in root samples of uninfected IR line
compared to uninfected Nipponbare (expression set at 1 for all genes). Bars represent
Mean±Standard error of two biological replicates (three technical replicates), each containing root
samples of a pool of four plants. Asterisks indicate statistically significant differential expression.
0,5
1
2
OsPR10 OsAOS2 OsICS1 OsYUCCA1 OsGH3.1 OsACS1 OsEIN2b
Rel
ati
ve
exp
ress
ion
lev
el
Mg Py Mg+Py
*
*
0,25
0,5
1
2
4
8
16
OsPR10 OsAOS2 OsICS1 OsYUCCA1 OsGH3.1 OsACS1 OsEIN2bBa
sal
exp
ress
ion
lev
el
*
*
*
*
25
IR line was observed to support the lower number of nematodes and gene expression pattern was
different as compared to Nipponbare. That was the reason behind to compare the basal gene
expression level between uninfected root samples of Nipponbare and IR line. Interestingly, basal
level of auxin responsive gene-OsGH3.1 was very higher in IR line compared to Nipponbare
(Figure 24). Basal expression of OsPR10 and OsEIN2b were also higher while expression of
OsAOS2, OsICS1 and OsACS1 were lower in IR line compared to Nipponbare roots (Figure 24).
3.6 In planta P. arrhenomanes DNA quantification in rice root samples
To evaluate infection pressure, rice root samples obtained from SAP system was use to quantify
P. arrhenomanes based on its DNA amplification. IRRI samples were included in this experiment
as positive control. Amplification of plant DNA and melting peak was similar in both samples
obtained from SAP system and IRRI raised bed which suggests DNA extraction seems to be fine
(Figure 25). However, Cq-values for the P. arrhenomanes target gene were very higher (more than
15 cycles different) for the SAP samples as compared to the IRRI samples (Figure 26). Moreover,
there was an unusual melting peak in samples obtained from the SAP system (Figure 26) while
IRRI samples gave as usual melting peak. After quantification using the standard curve, it was
confirmed that there was only a very low amount of in planta P. arrhenomanes DNA found in all
of the samples obtained from the SAP system, which is very low as compared to IRRI samples
(Figure 27).
Figure 25. Plant DNA amplification and melting peak of different sample obtained from IRRI
raised bed and SAP system.
IRRI sample
Sample from
SAP system
26
Figure 26. Pythium arrhenomanes DNA amplification and melting peak of different sample
obtained from IRRI raised bed and SAP system.
Figure 27. In planta quantification of Pythium arrhenomanes DNA (ng/µl) using q-PCR.
4 Discussion
The infective second-stage juveniles (J2s) of M. graminicola move through the soil amongst a
complex of repellent and attractant chemicals to find their host. After invasion of the young root
of the plant, J2s migrate to the root tip where they take a U-turn around in the meristem before
they can enter the stele. Subsequently, they move upwards in the vascular cylinder towards root
vascular cells which are transformed into large multinucleate feeding cells due to secretion of
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
Low Pythium
(Natural
infested soil)
High Pythium
(Py
inoculated)
Low Pythium
(Natural
infested soil)
High Pythium
(Py
inoculated)
Single
infection (Py)
Double
infection
(Mg+Py)
Single
infection (Py)
Double
infection
(Mg+Py)
Palawan-2 IR81413- BB-75-4 Nipponbare IR81413-BB-75-3
ng
/µl
IRRI samples
Samples from SAP system
IRRI sample
IRRI sample
Sample from
SAP system
Sample from
SAP system
27
effectors in the host cell, the so-called giant cells (Gheysen & Mitchum, 2011; Kyndt et al., 2013).
J2s become sedentary after establishing feeding sites and molt three times within the gall to
become either adult females or males through J3 and J4 stages (Karssen et al., 2013).
In present study, fluorescently labelled J2s of RKN with PKH26 were generated and infected on
rice roots, in order to try to see in vivo nematode development (J2, J3/J4, Female and Eggmass) in
rice roots. This experimental approach did not work due to thickness of the root and its non-
visibility inside the root by confocal microscope. Fluorescently labelled nematodes were used
successfully in the Arabidopsis root system, in which Meloidogyne chitwoodi, Heterodera
schachtii, Pratylenchus penetrans were used to infect roots of Arabidopsis to check nematode
behavior and development (Dinh et al., 2014). The positive result obtained with Arabidopsis could
be due to very thin cortex layer and transparent nature of Arabidopsis root system.
4.1 Interaction experiment
Present study was focused on the interaction of the Oomycetes-P. arrhenomanes and root knot
nematode-M. graminicola in different rice cultivars. In some cases, it has been reported that attack
by one pathogen make plants more vulnerable to another pathogen. On the other hand, plants might
react differently in which one pathogen could trigger defense in plants and as a result the plant
would become less suitable for the second pathogen.
Rice cultivar Nipponbare has been known as susceptible to M. graminicola (Nahar et al., 2011;
Kyndt et al., 2012; Nahar et al., 2012; Kyndt et al., 2014a) and to necrotrophic pathogen-P.
arrhenomanes (Van Buyten & Hofte, 2013). Similarly, in present study, this cultivar was found
to support a substantial number of galls and total nematodes counts. Shoot length was stunted
significantly due to P. arrhenomanes infection. After double infection, plants showed synergistic
interaction resulting in lower shoot length, significantly higher number of galls and total
nematodes compared to single M. graminicola infected roots. Similarly, shoot and root length of
sugarcane was significantly reduced due to single as well as combined effects of P. arrhenomanes
and nematodes (Mesocriconema xenoplax, Paratrichodorus minor and Tylenchorhynchus
annulatus) (Bond et al., 2004). In current study, a slight antagonistic interaction in Palawan-2 after
double infection in rice roots , which is contradictory with earlier reports (Kreye et al., 2010b) but
found as consistent with a recent study performed at IRRI under greenhouse conditions (Verbeek
et al., 2015). There are 12 different genotypes under the common name Palawan available in the
28
Philippines, this could be the reason to have different outcomes. In this study, Oryza sativa L.
cultivar ‘Palawan’ (GID 48535, IRRI) was used in 2nd trial. In present study, IR81413-BB-75-3
line has been used for interaction experiments, which is considered as a sister line of IR81413-
BB-75-4. In current study, nematode infection was not affected by P. arrhenomanes infection in
both Apo and IR line, indicating there is no interaction that affects the nematode population.
Interestingly, in our study, both of the cultivars were found to support a lower number of
nematodes compared to Nipponbare and Palawan-2. Rice cultivar-Apo has been reported as
tolerant (Kreye et al., 2010b) to both P. arrhenomanes and M. graminicola (especially when
infection done with J2s, but not with chopped roots) while IR81413-BB-75-4 line was categorized
as resistant to P. arrhenomanes and susceptible to M. graminicola (Kreye et al., 2010b).
To evaluate the role of Jasmonate (JA) on infection process, interaction experiment were also
conducted on rice cultivar-Nihonmasari and JA biosynthesis mutant-hebiba. Wild-type (First trial)
and mutant plants (hebiba), both foliar sprayed and root drenched SHAM on Nihonmasari showed
similar patterns based on galls and total nematode counts per root system. As wild-type
(Nihonmasari) gave opposite results between first and second trial, it is difficult to conclude the
role of JA on interaction based on experiment on Nihonmasari.
In current study, wild type rice cultivar-Bomba and a transgenic OsGH3.1 overexpression line
were also used to know the role of auxin in interaction of M. graminicola and P. arrhenomanes on
rice roots. It has been reported by several authors that levels of free IAA content are decreased in
overexpression OsGH3.1 transgenic line (Domingo et al., 2009), and in OsGH3-2 overexpression
line (Du et al., 2012). Interestingly, there was a faster nematode development and the higher
eggmass in wild-type compared to the transgenic line which indicates the role of auxin in the
nematode developmental process. There was a similar number of total nematode counts between
single M. graminicola infected and double infected roots both in wild type and mutant line which
suggest auxin does not play role in nematode penetration. However, in the transgenic line,
significantly more females were observed in double infected roots compared to single M.
graminicola infected roots which suggest that the presence of P. arrhenomanes might complement
the lower levels of auxin in this line, consequently leading to faster nematode development in the
double-infected plants compared to single nematode infected roots.
29
4.2 Gene expression studies
The gene expression levels have been studied on rice cultivar-Nipponbare and IR81413-BB-75-3
line after single and double infections to elucidate the role of hormonal pathways in the interaction.
Biosynthesis and/or responsive genes of JA, SA, Auxin, and ET pathway were studied together
with general pathogenesis-related gene OsPR10. In current study, there was a down regulation of
the transcripts of general pathogenesis gene, OsPR10 in single M. graminicola infected roots, both
in Nipponbare and IR line, which is consistent with previous findings (Nahar et al., 2011). There
was a strong up-regulation of OsPR10 gene observed in single P. arrhenomanes infected roots in
Nipponbare which is also consistent with recent findings (Van Buyten, 2013). Interestingly, in
Nipponbare, OsPR10 was up-regulated after double infection but less pronounced than after single
P. arrhenomanes infection which suggests in double infection, P. arrhenomanes triggered the
expression of OsPR10 which is suppressed by M. graminicola. It was observed that the basal level
of OsPR10 was higher in IR-mock compared to Nipponbare-Mock, which could explain the lower
susceptibility of IR line to root knot nematode-M. graminicola.
In Nipponbare, there was a significant up-regulation of OsAOS2 (JA biosynthesis gene) transcripts
in single P. arrhenomanes infected roots. This results is consistent with recent findings in which
OsAOS2 gene was found to be strongly upregulated in rice seedlings after P. arrhenomanes
infection at one day post infection (Van Buyten, 2013). There was a down-regulation of OsAOS2
gene in single M. graminicola infected roots. Suppression of the JA pathway by root knot
nematodes has been reported in several studies (Nahar et al., 2011; Kyndt et al., 2012; Kyndt et
al., 2014a). In double infection, there was a down-regulation of this gene but less pronounced
compared to single M. graminicola infected roots which suggests P. arrhenomanes triggers JA
signaling in roots but M. graminicola suppresses the JA pathway in double infection. Expression
of OsAOS2 gene was different in IR line. This gene was suppressed in both single M. graminicola
infected and single P. arrhenomanes infected roots; there was no change in expression level in
double infection which suggest that there could be other signaling pathway or crosstalk with other
hormones involved in IR line.
In the current study, SA biosynthesis gene, OsICS1 was suppressed in all the treatments, i.e., in
single infection by P. arrhenomanes, single infected M. graminicola and double infection in both
Nipponbare and IR line suggest that necrotrophic pathogen-P. arrhenomanes and biotrophic
30
pathogen-M. graminicola might be able to suppress SA biosynthesis pathway in rice roots and SA
signaling does not play role in the interaction. Present findings on suppression of SA pathway by
M. graminicola is consistent with a previous study (Nahar et al., 2011) while suppression of SA
pathway due to P. arrhenomanes was found unclear in rice roots (Van Buyten, 2013).
Higher expression of auxin responsive gene, OsGH3.1 results in the degradation of free auxin
content. Basal level of OsGH3.1 was significantly higher in IR-mock compared to Nipponbare-
mock which suggest a lower free auxin content in roots of the IR line, which might result in the
lower number of galls, total nematode counts and slower nematode development in this line.
Similarly, overexpression of OsGH3.1 in rice led to lower auxin content consequently enhanced
resistant to fungal pathogens (Domingo et al., 2009). In the interaction experiment, a significantly
slower nematode development was also observed in single M. graminicola infected roots in
overexpression OsGH3.1 line compared to wild type (Bomba). On the other hand, Pythium spp.
are known to secrete IAA in the tomato rhizosphere to promote their invasion (Mojdehi et al.,
1990; Rey et al., 2001). The P. arrhenomanes isolate was shown to produce auxin under in vitro
conditions (Van Buyten, 2013). In present study, there was a significant higher number of females
observed in the double infection than single infection with M. graminicola in the OsGH3.1
overexpression line (which have lower auxin content) suggesting that P. arrhenomanes might
trigger IAA in double infected rice roots and as a result faster nematode development was observed.
Ethylene production is one of the earliest response to a wide variety of biotic or abiotic stresses by
plants (Abeles et al., 1992). Pythium sylvaticum, P. jasmonium, and P. irregulare did cause
significantly more disease symptoms in ethylene mutants (ein2-1) than in wild-type plants
suggesting the role of ET in plant defense (Geraats et al., 2002). Ethylene signaling and
biosynthesis mutants (OsEin2b RNAi) supported a higher number of root knot nematodes (RKN)
in the rice roots (Nahar et al., 2011). In Nipponbare, ET-biosynthesis gene, OsACS1 was down-
regulated while ethylene response gene, OsEIN2b was up-regulated in all of the treatments. On the
other hand, in the IR line both OsACS1 and OsEIN2b gene were up-regulated in single P.
arrhenomanes infected and double infected roots but suppressed in single M. graminicola infected
roots. Interestingly, basal level of OsEIN2b was significantly higher which might explain the role
of ethylene in immunity in IR line consequently the lower number of nematodes present in the root
system.
31
4.3 In planta Pythium arrhenomanes DNA quantification
In order to know infection pressure in SAP system, root samples harvested from Nipponbare and
IR line were used to quantify P. arrhenomanes based on DNA amplification. DNA extraction
seemed to be fine as plant DNA was amplified properly in all samples. However, for Pythium
target gene, there were very late Cq-values and an unusual melting peak, which indicates a very
low amount P. arrhenomanes in the root samples. This could be confirmed when samples were
compared to IRRI samples. This suggests that P. arrhenomanes might not enter into the root tissue
properly in SAP system. In contrast, the higher amount of in planta P. arrhenomanes DNA was
quantified in rice roots when infection was done on rice seedlings grown in Gamborg B5 medium
(Van Buyten & Hofte, 2013). It seems that the SAP system is not an optimal environment for P.
arrhenomanes to colonize inside the rice root. As only a single plug of P. arrhenomanes was added
in each SAP tube, the inoculum might be too low. Furthermore, the inoculum might not be
distributed properly in the whole SAP substrate. However, P. arrhenomanes did have an effect on
the plants, as observed by the significant reduction of shoot length on all of the cultivars tested. In
addition, influence on the nematode development in double infection in Nipponbare, Palawan-2,
and overexpression OsGH3.1 transgenic line indicates the presence of P. arrhenomanes in the
substrate.
Is NLP present in Pythium arrhenomanes?
Many fungi, bacteria and oomycetes secrete necrosis and ethylene inducing peptide 1 (Nep1) like
proteins (NLPs) which induce necrosis and immunity related responses (Pemberton & Salmond,
2004; Gijzen & Nurnberger, 2006; Feng et al., 2014; Oome & Van den Ackerveken, 2014). A
large NLP gene families have been found in genome sequence of Oomycetes genus-Phytophthora
(Tyler et al., 2006) which is highly diverse and expanded (Qutob et al., 2002; Gijzen &
Nurnberger, 2006; Kanneganti et al., 2006). NLP homologues have also been reported in Pythium
monospermum (Worle & Seitz, 2003; Tyler et al., 2006); P. aphanidermatum (Veit et al., 2001);
and P. ultimum (Levesque et al., 2010).
There was four primers designed, based on known nucleotide sequences encoding NLP (Necrosis
and ethylene inducing protein) in P. aphanidermatum. The primers are presented in Table 2. A
PCR gradient (55°C to 60°C) was performed to amplify the NLP homologues using P.
32
arrhenomanes genomic DNA. PCR products were run on 1.5% agarose gel having 2.5µl of Midori
Green Advance DNA stain (Nippon Genetics Europe GmbH) per 100 ml of agarose gel (Figure
28, I). Desired bands were cut out and purified using PCR purification kit (Qiagen). PCR products
were ligated to pGEM-T vector and heat-shocked in competent E. coli cells. Colony PCR was
carried out to find out positive colonies (Figure 28, II & III). Plasmids were isolated from positive
colonies using the plasmid purification kit (Fermentas). Plasmids were sent for sequencing after
addition of plasmid specific primers T7 and SP6.
There was no match with known NLP homologues after blast search in NCBI database. For
instance, one shorter sequence obtained from C2 colonies had similarity with Phytophothora
capsici (pectate lyse gene) and Phytophothora cinnamomi (alpha tubulin gene) which is not the
expected gene (Figure 29). This could be due to bad primer design or pick up of wrong bands from
gel or simply because NLP might not be present in P. arrhenomanes.
Table 2. List primers used to search for NLP gene in Pythium arrhenomanes
Primer code Primers
401 Py_aphNLP1F GATCAACCATGATGCTGTGC
402 Py_aphNLP1R ACGAGATCTTGGCGGTAATG
403 Py_aphNLP2F GGTACATGCCAAAGGACTCG
404 Py_aphNLP2R TTTTCGAGGAAGCCAGATGT
33
Figure 28. (I) PCR products of two primer pair combinations (401+402 and 403+402), desired
bands (A, B, and C) were cut out; (II) colony PCR of product C. Colonies 1 and 2 (C1 and C2)
were used to purify plasmid and sent for sequencing; (III) colony PCR of products A and B, in
which colonies (A3, A4, B2 and B3) were used to purify plasmid and sent for sequencing.
ITS
401+402
60°C 55°C
403+402
60°C 55°C Colony PCR C
C
1
C
2
A
B
C
Colony PCR A and B
A
3
A
4
B
2
B
3
I II
III
34
Figure 29. NCBI- Blast search result of one of the sequence data
5 Conclusion
The rice cultivars behaved different after single and double infection with biotrophic-M.
graminicola and necrotrophic-P. arrhenomanes. Based on nematode development, a synergistic
interaction found in Nipponbare and slightly antagonistic interaction observed in Palawan-2 while
there was no interaction found in Apo and IR line. In Nipponbare, P. arrhenomanes triggered JA
signaling in roots which seems to be suppressed by M. graminicola. Auxin seems to play an
important role in nematode development and P. arrhenomanes might be able to complement auxin
level in roots. OsGH3.1 was highly expressed, probably leading to less auxin level in IR line, and
consequently the lower number of nematode infection. In SAP system, P. arrhenomanes infection
pressure was very low and might not be optimal. The gene encoding NLPs was not detected in P.
arrhenomanes.
6 Future works
SAP system needs to be optimized for P. arrhenomanes colonization inside the roots.
Experiment related to auxin transgenic line (Ox-OsGH3.1) with corresponding wild type
need to be replicated independently.
35
qPCR need to be done on ethylene response genes (OsERF70 and OsEBP89) to know the
role of ethylene in immunity along with interaction experiment on ethylene transgenic line
(OsEin2b RNAi line), its corresponding wild-type rice cultivar, ET-biosynthesis inhibitors
(aminoethyoxyvinyl-glycine, AVG; aminooxyacetic acid, AOA) treated plants.
More experiment needed to confirm whether gene encoding NLPs is present or not in P.
arrhenomanes.
Histopathological studies needed to know details about infection in the root system.
It would be interesting to investigate the role of reactive oxygen species (ROS), phenolic
compounds and callose deposition in rice roots on the interaction of both pathogens.
7 Acknowledgement
I would like to express my profound gratitude and heartfelt appreciation to my respected promoter
Professor Tina Kyndt, Department of Molecular Biotechnology, Ghent University, Belgium for
her active guidance, constant encouragement and constructive suggestion during thesis. I express
my special thanks to Ruben Verbeek, PhD. Student, Ghent University for his consistent support
and supervision throughout the research works. I also express my appreciation to Professor
Godelieve Gheysen, Department of Molecular Biotechnology and Professor Monica Höfte,
Department of Crop Protection, Ghent University for their necessary co-operation and laboratory
facilities. I also give my heartiest thanks to staff members of Applied Molecular Genetics- Henok
Zemene, Shakhina Khanam, Zobaida Lahari, Lander Bauters; Lab Technicians- Lien De Smet and
Isabel Verbeke, Ilse Delaere (Laboratory of Phytopathology, Department of Crop Protection) who
helped me to learn some techniques. I am grateful to Prof. Wilfrida Decraemer, Nic Smol, Prof.
Wim Bert and Inge Dehennin for their excellent academic support throughout the Nematology
course. I express many thanks to VLIR-UOS authority for financial supports during master’s
programme.
8 References
Abeles, F. B., Morgan, P. W. & Saltveit, M. E. J. (1992). Ethylene in plant biology. San Diego,
CA, U.S.A., Academic Press Inc., pp.
Atkinson, G. F. (1892). Some diseases of cotton. Alabama Agricultural Experiment Station Bull
41, 65.
36
Bari, R. & Jones, J. (2009). Role of plant hormones in plant defence responses. Plant Molecular
Biology 69, 473-488.
Bezemer, T. M. & Van Dam, N. M. (2005). Linking aboveground and belowground interactions
via induced plant defenses. Trends in Ecology & Evolution 20, 617-624.
Bhattarai, S., Haydock, P. P. J., Back, M. A., Hare, M. C. & Lankford, W. T. (2009). Interactions
between the potato cyst nematodes, Globodera pallida, G. rostochiensis, and soil-borne
fungus, Rhizoctonia solani (AG3), diseases of potatoes in the glasshouse and the field.
Nematology 11, 631-640.
Bond, J. P., Mcgawley, E. C., & & Hoy, J. W. (2004). Sugarcane growth as influenced by
nematodes and Pythium arrhenomanes. Nematropica 34, 245-256.
Bridge, J., Plowright, R. A. & Peng, D. (2005). 4 Nematode Parasites of Rice. Plant parasitic
nematodes in subtropical and tropical agriculture, 87.
Chantanao, A. (1962). Nematodes of rice and some other plants in Thailand. Entomol. Plant Pathol.
Bull. Thail. 1, 1-15.
Conrath, U., Pieterse, C. M. J. & Mauch-Mani, B. (2002). Priming in plant-pathogen interactions.
Trends in Plant Science 7, 210-216.
Cother, E. & Gilbert, R. (1992). Distribution of Pythium arrhenomanes in rice-growing soils of
southern New South Wales. Australasian Plant Pathology 21, 79-82.
Cother, E. & Gilbert, R. (1993). Comparative pathogenicity of Pythium species associated with
poor seedling establishment of rice in Southern Australia. Plant Pathology 42, 151-157.
De Vleesschauwer, D., Van Buyten, E., Satoh, K., Balidion, J., Mauleon, R., Choi, I.-R., Vera-
Cruz, C., Kikuchi, S. & Höfte, M. (2012). Brassinosteroids antagonize gibberellin-and
salicylate-mediated root immunity in rice. Plant physiology 158, 1833-1846.
De Vleesschauwer, D., Xu, J. & Höfte, M. (2014). Making sense of hormone-mediated defense
networking: from rice to Arabidopsis. Frontiers in Plant Science 5, 1-15.
De Vleesschauwer, D., Yang, Y. N., Cruz, C. V. & Hofte, M. (2010). Abscisic Acid-Induced
Resistance against the Brown Spot Pathogen Cochliobolus miyabeanus in Rice Involves
MAP Kinase-Mediated Repression of Ethylene Signaling. Plant physiology 152, 2036-
2052.
De Waele, D. & Elsen, A. (2007). Challenges in tropical plant nematology. Annu. Rev. Phytopathol.
45, 457-485.
Ding, X., Cao, Y., Huang, L., Zhao, J., Xu, C., Li, X. & Wang, S. (2008). Activation of the indole-
3-acetic acid–amido synthetase GH3-8 suppresses expansin expression and promotes
salicylate-and jasmonate-independent basal immunity in rice. The Plant Cell Online 20,
228-240.
Dinh, P. T. Y., Knoblauch, M. & Elling, A. A. (2014). Nondestructive Imaging of Plant-Parasitic
Nematode Development and Host Response to Nematode Pathogenesis. Phytopathology
104, 497-506.
Domingo, C., Andres, F., Tharreau, D., Iglesias, D. J. & Talon, M. (2009). Constitutive Expression
of OsGH3.1 Reduces Auxin Content and Enhances Defense Response and Resistance to a
Fungal Pathogen in Rice. Molecular plant-microbe interactions 22, 201-210.
37
Du, H., Wu, N., Fu, J., Wang, S. P., Li, X. H., Xiao, J. H. & Xiong, L. Z. (2012). A GH3 family
member, OsGH3-2, modulates auxin and abscisic acid levels and differentially affects
drought and cold tolerance in rice. Journal of experimental botany 63, 6467-6480.
Eberle, M., Rothrock, C. & Cartwright, R. (2007). Pythium species associated with rice stand
establishment problems in Arkansas. BR Wells Rice Research Studies, 57-63.
Feng, B. Z., Zhu, X. P., Fu, L., Lv, R. F., Storey, D., Tooley, P. & Zhang, X. G. (2014).
Characterization of necrosis-inducing NLP proteins in Phytophthora capsici. Bmc Plant
Biology 14.
Geraats, B. P. J., Bakker, P. & Van Loon, L. C. (2002). Ethylene insensitivity impairs resistance
to soilborne pathogens in tobacco and Arabidopsis thaliana. Molecular plant-microbe
interactions 15, 1078-1085.
Gheysen, G. & Mitchum, M. G. (2011). How nematodes manipulate plant development pathways
for infection. Current opinion in plant biology 14, 415-421.
Gijzen, M. & Nurnberger, T. (2006). Nep1-like proteins from plant pathogens: Recruitment and
diversification of the NPP1 domain across taxa. Phytochemistry 67, 1800-1807.
Han, B., Xue, Y., Li, J., Deng, X.-W. & Zhang, Q. (2007). Rice functional genomics research in
China. Philosophical Transactions of the Royal Society B: Biological Sciences 362, 1009-
1021.
Hollis Jr, J., Keoboonrueng, S. & Nickle, W. (1984). Nematode parasites of rice. Plant and insect
nematodes., 95-146.
Jiang, C. J., Shimono, M., Sugano, S., Kojima, M., Liu, X. Q., Inoue, H., Sakakibara, H. &
Takatsuji, H. (2013). Cytokinins Act Synergistically with Salicylic Acid to Activate
Defense Gene Expression in Rice. Molecular plant-microbe interactions 26, 287-296.
Johnson, A. W. & Littrell, R. H. (1970). Pathogenicity of Pythium aphanidermatum to
chrysanthemum in combined inoculations with Belonolaimus longicaudatus or
Meloidogyne incognita. Journal of Nematology 2, 255.
Kanneganti, T. D., Huitema, E., Cakir, C. & Kamoun, S. (2006). Synergistic interactions of the
plant cell death pathways induced by Phytophthora infestans Nep1-like protein PiNPP1.1
and INF1 elicitin. Molecular plant-microbe interactions 19, 854-863.
Karczmarek, A., Overmars, H., Helder, J. & Goverse, A. (2004). Feeding cell development by cyst
and root‐knot nematodes involves a similar early, local and transient activation of a
specific auxin‐inducible promoter element. Molecular plant pathology 5, 343-346.
Karssen, G., Moens, M. & Perry, R. N. (2006). Root-knot nematodes. Plant nematology. CABI,
pp. 59-90.
Karssen, G., Wesemael, W. & Moens, M. (2013). Root Knot Nematodes. Plant nematology. 2nd
Edition ed., CABI, pp. 73-105.
Kreye, C., Bouman, B. a. M., Reversat, G., Fernandez, L., Vera Cruz, C., Elazegui, F., Faronilo,
J. E. & Llorca, L. (2010a). Biotic and abiotic causes of yield failure in tropical aerobic rice
(vol 112, pg 97, 2009). Field Crops Research 117, 266-266.
Kreye, C., Das, K., Pinili, M. S., Banaay, C. G., Elazegui, F. A., Steelandt, A., De Bruyne, L., Van
Buyten, E., Hofte, M., De Waele, D., Fernandez, L. C., Llorca, L., Faronillo, J., Vera Cruz,
38
C. M., Kumar, A. & Bouman, B. (2010b). Identification of the biological causes of yield
instability and decline in non-saturated rice field. 4th ADB Annual Review. Los Baños,
Philippines IRRI.
Kyndt, T., Denil, S., Bauters, L., Van Criekinge, W. & De Meyer, T. (2014a). Systemic
Suppression of the Shoot Metabolism upon Rice Root Nematode Infection. Plos One 9.
Kyndt, T., Fernandez, D. & Gheysen, G. (2014b). Plant-Parasitic Nematode Infections in Rice:
Molecular and Cellular Insights. Annual Review of Phytopathology 52, 135-153.
Kyndt, T., Nahar, K., Haegeman, A., De Vleesschauwer, D., Hofte, M. & Gheysen, G. (2012).
Comparing systemic defence-related gene expression changes upon migratory and
sedentary nematode attack in rice. Plant Biology 14, 73-82.
Kyndt, T., Vieira, P., Gheysen, G. & De Almeida-Engler, J. (2013). Nematode feeding sites:
unique organs in plant roots. Planta 238, 807-818.
Levesque, C. A., Brouwer, H., Cano, L., Hamilton, J. P., Holt, C., ....... & Buell, C. R. (2010).
Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original
pathogenicity mechanisms and effector repertoire. Genome Biology 11.
Luc, M., Sikora, R. A. & Bridge, J. (2005). Plant parasitic nematodes in subtropical and tropical
agriculture. Cabi, pp.
Mojdehi, H., Singleton, L., Melouk, H. & Waller, G. (1990). Reproduction of symptoms of a root
disease of wheat by toxic metabolites produced by two Pythium species and their partial
characterization. Journal of phytopathology 128, 246-256.
Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2011). The jasmonate
pathway is a key player in systemically induced defense against root knot nematodes in
rice. Plant physiology 157, 305-316.
Nahar, K., Kyndt, T., Hause, B., Hofte, M. & Gheysen, G. (2013). Brassinosteroids Suppress Rice
Defense Against Root-Knot Nematodes Through Antagonism With the Jasmonate
Pathway. Molecular plant-microbe interactions 26, 106-115.
Nahar, K., Kyndt, T., Nzogela, Y. B. & Gheysen, G. (2012). Abscisic acid interacts
antagonistically with classical defense pathways in rice-migratory nematode interaction.
New Phytologist 196, 901-913.
Netscher, C. & Erlan (1993). A root-knot nematode, Meloidogyne graminicola, parasitic on rice
in Indonesia. Afro-Asian Journal of Nematology 3, 90-95.
Nicol, J. M., Turner, S. J., Coyne, D. L., Den Nijs, L., Hockland, S. & Maafi, Z. T. (2011). Current
nematode threats to world agriculture. Genomics and Molecular Genetics of Plant-
Nematode Interactions. Springer, pp. 21-43.
Oome, S. & Van Den Ackerveken, G. (2014). Comparative and Functional Analysis of the Widely
Occurring Family of Nep1-Like Proteins. Molecular plant-microbe interactions 27, 1081-
1094.
Ottmann, C., Luberacki, B., Kufner, I., Koch, W., Brunner, F., Weyand, M., Mattinen, L., Pirhonen,
M., Anderluh, G., Seitz, H. U., Nurnberger, T. & Oecking, C. (2009). A common toxin
fold mediates microbial attack and plant defense. Proceedings of the National Academy of
Sciences of the United States of America 106, 10359-10364.
39
Padgham, J. & Sikora, R. (2007). Biological control potential and modes of action of Bacillus
megaterium against Meloidogyne graminicola on rice. Crop Protection 26, 971-977.
Padgham, J. L., Duxbury, J. M., Mazid, A. M., Abawi, G. S. & Hossain, M. (2004). Yield loss
caused by Meloidogyne graminicola on lowland rainfed rice in Bangladesh. Journal of
Nematology 36, 42-48.
Pemberton, C. L. & Salmond, G. P. C. (2004). The Nep1-like proteins - a growing family of
microbial elicitors of plant necrosis. Molecular plant pathology 5, 353-359.
Perry, R. N., Moens, M. & Starr, J. L. (2009). Meloidogyne species–a diverse group of novel and
important plant parasites. Root-knot nematodes. Cabi, pp. 483.
Pfaffl, M. W., Horgan, G. W. & Dempfle, L. (2002). Relative expression software tool (REST (c))
for group-wise comparison and statistical analysis of relative expression results in real-
time PCR. Nucleic Acids Research 30.
Pokharel, R. R., Abawi, G. S., Zhang, N., Duxbury, J. M. & Smart, C. D. (2007). Characterization
of isolates of Meloidogyne from rice-wheat production fields in Nepal. Journal of
Nematology 39, 221.
Powell, N. T. (1971). Interactions between nematodes and fungi in disease complexes. Annual
Review of Phytopathology 9, 253-274.
Qin, X., Liu, J. H., Zhao, W. S., Chen, X. J., Guo, Z. J. & Peng, Y. L. (2013). Gibberellin 20-
Oxidase Gene OsGA20ox3 Regulates Plant Stature and Disease Development in Rice.
Molecular plant-microbe interactions 26, 227-239.
Qutob, D., Kamoun, S. & Gijzen, M. (2002). Expression of a Phytophthora sojae necrosis-
inducing protein occurs during transition from biotrophy to necrotrophy. Plant Journal 32,
361-373.
Reversat, G., Boyer, J., Sannier, C. & Pando-Bahuon, A. (1999). Use of a mixture Molecular
cloning and characterization of a novel jasmonate inducible of sand and water-absorbent
synthetic polymer as substrate for the xenic culturing of plant-parasitic nematodes in the
laboratory. Nematology 1, 209–212.
Rey, P., Leucart, S., Desilets, H., Belanger, R. R., Larue, J. P. & Tirilly, Y. (2001). Production of
indole-3-acetic acid and tryptophol by Pythium ultimum and Pythium group F: Possible
role in pathogenesis. European journal of plant pathology 107, 895-904.
Riemann, M., Haga, K., Shimizu, T., Okada, K., Ando, S., Mochizuki, S., Nishizawa, Y.,
Yamanouchi, U., Nick, P., Yano, M., Minami, E., Takano, M., Yamane, H. & Iino, M.
(2013). Identification of rice Allene Oxide Cyclase mutants and the function of jasmonate
for defence against Magnaporthe oryzae. Plant Journal 74, 226-238.
Roberts, P. A., Frate, C. A., Matthews, W. C. & Osterli, P. P. (1995). Interactions of virulent
Meloidogyne incognita and Fusarium-wilt on resistant cowpea genotypes. Phytopathology
85, 1288-1295.
Roy, A. K. (1973). Reaction of some rice cultivars to the attack of Meloidogyne graminicola.
Indian J. Nematology 3, 72-73.
40
Soriano, I. R., Prot, J.-C. & Matias, D. M. (2000). Expression of tolerance for Meloidogyne
graminicola in rice cultivars as affected by soil type and flooding. Journal of Nematology
32, 309.
Soriano, I. R. & Reversat, G. (2003). Management of Meloidogyne graminicola and yield of
upland rice in South-Luzon, Philippines. Nematology 5, 879-884.
Tamaoki, D., Seo, S., Yamada, S., Kano, A., Miyamoto, A. & Shishido, H. (2013). Jasmonic acid
and salicylic acid activate a common defense system in rice. Signal. Behav. 8.
Taniguchi, S., Hosokawa-Shinonaga, Y., Tamaoki, D., Yamada, S., Akimitsu, K. & Gomi, K.
(2014). Jasmonate induction of the monoterpene linalool confers resistance to rice bacterial
blight and its biosynthesis is regulated by JAZ protein in rice. Plant Cell and Environment
37, 451-461.
Toda, T., Iwasa, A., Shinichi, F. & Furuya, H. (2015). Widespread occurrence of Pythium
arrhenomanes pathogenic to rice seedlings around Japanese rice fields. Plant Disease
Accepted for publication. dx.doi.org/10.1094/PDIS-01-15-0124-RE.
Tyler, B. M., Tripathy, S., Zhang, X. M., Dehal, P., ....... & Zhang, H. (2006). Phytophthora
genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science
313, 1261-1266.
Uenoa, Y., Yoshidaa., R., Mitsuko Kishi-Kaboshia, Akane Matsushitaa, Chang-Jie Jianga, Shingo
Gotoa, Akira Takahashia, &, H. H. & Takatsuji, H. (2013). MAP kinases phosphorylate
rice WRKY45. Plant signaling & behavior 8, e24510-3.
Van Buyten, E. (2013). Pythium spp. affecting aerobic rice cultivation in the Philippines:
characterization, virulence strategies and plant defense. PhD, Ghent University.
Van Buyten, E., Banaay, C. G. B., Cruz, C. V. & Hofte, M. (2013). Identity and variability of
Pythium species associated with yield decline in aerobic rice cultivation in the Philippines.
Plant Pathology 62, 139-153.
Van Buyten, E. & Hofte, M. (2013). Pythium species from rice roots differ in virulence, host
colonization and nutritional profile. Bmc Plant Biology 13, :203.
Veit, S., Worle, J. M., Nurnberger, T., Koch, W. & Seitz, H. U. (2001). A novel protein elicitor
(PaNie) from Pythium aphanidermatum induces multiple defense responses in carrot,
Arabidopsis, and tobacco. Plant physiology 127, 832-841.
Verbeek, R., De Waele, D., Vera Cruz, C. M., Höfte, M. & Kyndt, T. (2015). Interactions between
sedentary nematode-Meloidogyne graminicola and Oomycetes-Pythium arrhenomanes in
rice. Unpublished manuscript.
Worle, J. M. & Seitz, H. U. (2003). PmoNIE a PaNIE (Pythium aphanidermatum necrosis inducing
elicitor) like elicitor sequence from Pythium monospermum. Plant Physiology
(Unpublished), Locus number: AAQ89593; ZMBP,University of Tuebingen,Germany.
Wurst, S. & Van Der Putten, W. H. (2007). Root herbivore identity matters in plant-mediated
interactions between root and shoot herbivores. Basic and Applied Ecology 8, 491-499.
41
Appendix
Figure 1. The pure culture of P. arrhenomanes, cork borer of size 4 used to make agar plugs of
pathogen to infect rice seedlings.
Figure 2. Developmental stages of M. graminicola at 12 days post infection (dpi) at different rice
cultivars (First trial). Bar represent as Mean ± Standard error of 6 replicates.
0
20
40
60
80
100
120
140
160
Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py
1st Trial 1st Trial 1st Trial 1st Trial
Nipponbare Palawan-1 Apo IR
Sta
ges
/root
syst
em
J2 J3/J4 Female Eggmass