Gent University

Faculty of Science

Department of Biology

Academic year: 2014 – 2015

The analysis of Pythium arrhenomanes-

Meloidogyne graminicola infection on rice

Md. Maniruzzaman Sikder

Promoter: Prof. Dr. Tina Kyndt

Supervisor: Ruben Verbeek

Thesis submitted to obtain the

degree of Master of Science in

Nematology

1

The analysis of Pythium arrhenomanes-Meloidogyne graminicola infection on rice

Md. Maniruzzaman Sikder1, 2 1 M.Sc. in Nematology, Department of Biology, Faculty of Sciences, Ghent University, K.L.

Ledeganckstraat 35, 9000 Gent, Belgium 2 Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Ghent University,

Coupure links 653, B-9000, Gent, Belgium

Summary: The root knot nematode-Meloidogyne graminicola and Oomycetes-Pythium arrhenomanes

have been known as main biotic factors behind yield decline in aerobic rice production. But, improved rice

grain yield have also been reported on rice cultivar-Apo and IR81413-BB-75-4 line in the presence of both

pathogens together compared to single infection. Present studies were carried out to evaluate the interaction

of P. arrhenomanes and M. graminicola on rice. Initially, a fluorescent labeling technique of M.

graminicola juveniles was tested to use for infection experiments, in order to be able to score the infection

under in vivo conditions, but this approach did not work in the rice root system. Infection experiments were

conducted on different rice cultivars, mutant (Jasmonic acid biosynthesis), overexpression transgenic line

(less auxin content) and chemical inhibitor treated plants. Based on developmental stages of root knot

nematodes, there was a synergistic interaction between M. graminicola and P. arrhenomanes on rice

cultivar-Nipponbare while in Palawan slightly antagonistic interaction was observed during double

infection. There was no interaction observed between both pathogens in cultivar-Apo and IR81413-BB-75-

3 line. The role of the Jasmonic acid (JA) signalling pathway in the interaction was unclear based on

infection experiments on Nihonmasari & JA-biosynthesis mutant (hebiba). However, in Nipponbare, the

JA biosynthesis gene was upregulated after P. arrhenomanes infection but a significant suppression of this

gene was found in root knot nematode infected plants. Auxin seems to be an important factor for nematode

development as a OsGH3.1 overexpression line (which contains less free auxin) was less susceptible to M.

graminicola infection. There was a significant reduction in the number of females in the OsGH3.1

overexpression line after single M. graminicola infection. However, female numbers in this line were

significantly increased in the presence of P. arrhenomanes in double infected plants, which suggests that

P. arrhenomanes complements the usually low auxin levels in the root of the OsGH3.1 overexpression line.

The basal expression level of OsGH3.1 was significantly higher (exemplifying lower free auxin content) in

the IR81413-BB-75-3 line compared to Nipponbare, which might explain the generally lower number of

galls as well as nematodes in the IR81413-BB-75-3 line. There was a very low amount of in planta P.

arrhenomanes DNA quantified in all of the samples, which indicates that the Synthetic Absorbent Polymer

(SAP) substrate system used in these here-described experiments might not be optimal for P. arrhenomanes

penetration and colonization of the root tissue, although disease symptoms were observed.

Keywords: Root knot nematodes, Oomycetes, Interaction, Synergism, Antagonism, Gene expression.

2

1 Background information

Rice (Oryza sativa L.) is the major food grain which meet the diets of over half of the world

population, mainly grown in tropical and subtropical regions (Han et al., 2007). Now, rice is

cultivated in 114 countries (Nicol et al., 2011) and estimated that 346 million acre of rice is being

grown throughout the world, in which 263 million acres are infested with damaging levels of plant

parasitic nematodes (Hollis Jr et al., 1984). Root-knot nematodes are the most destructive amongst

all plant parasitic nematodes (Karssen et al., 2006; Padgham & Sikora, 2007; Perry et al., 2009).

Among root knot nematodes, Meloidogyne graminicola is one the most damaging type of

nematode attacking rice roots (Bridge et al., 2005; Kyndt et al., 2014b). Introduction of water

saving rice production systems and the cultivation of aerobic rice varieties favors the buildup of

large populations of M. graminicola in rice fields (De Waele & Elsen, 2007). They causes

substantial damage on rice, depending on which cropping system is being used (Netscher & Erlan,

1993). They are responsible for great yield losses (20% to 70%) in many countries (Chantanao,

1962; Roy, 1973; Soriano et al., 2000; Soriano & Reversat, 2003; Padgham et al., 2004; Pokharel

et al., 2007). On the other hand, Oomycetes-Pythium spp. are one of the most common group of

seedling disease pathogens in rice-production areas. It is responsible for pre- and post-emergence

death, and causes 70% and 48% of average growth reductions of root and shoot respectively in

surviving seedlings (Cother & Gilbert, 1993; Eberle et al., 2007). It was found in 47% of soil

samples, sampled across rice fields of the Riverine Plain in New South Wales, Australia (Cother

& Gilbert, 1992). A number of isolates belonging to Pythium arrhenomanes, P. graminicola and

P. inflatum were recovered from affected aerobic rice fields in the Philippines in which all of the

isolates of P. arrhenomanes were found pathogenic to rice (Van Buyten et al., 2013); this species

was also found as pathogenic to rice seedlings in northern Japanese rice fields recently (Toda et

al., 2015). Root knot nematode-M. graminicola and Oomycetes-Pythium spp. have been

recognized as main biotic causes to yield decline in the aerobic rice production system (Kreye et

al., 2010a; Kreye et al., 2010b).

Combined nematode and fungal/or oomycetes infection (so called double infection) showed

increased damage and higher yield losses of plants compared to the single infection (Atkinson,

1892; Johnson & Littrell, 1970; Powell, 1971; Roberts et al., 1995; Bhattarai et al., 2009). Possible

explanation is that nematode infection influences gene expression in plants, aimed at suppressing

3

host defense pathways. Such manipulation of plant gene expression by the nematode might lead

to subsequent pathogen infections (Conrath et al., 2002; Bezemer & van Dam, 2005; Wurst & van

der Putten, 2007). Surprisingly, recent IRRI study found a reverse effect of double infection on

cultivar-Apo and IR81413-BB-75-4, where double infection of P. arrhenomanes and M.

graminicola was found to cause increased rice grain yield, compared to solely M. graminicola

infection on rice (Kreye et al., 2010b). These findings inspired to elucidate the mechanism of

interaction of P. arrhenomanes and M. graminicola on rice roots.

The expression of pathogenesis-related (PR) proteins in rice is mainly regulated by key

phytohormones such as Salicylic acid (SA), Jasmonic acid (JA) and Ethylene (ET) (Nahar et al.,

2011; De Vleesschauwer et al., 2012; Kyndt et al., 2012; Riemann et al., 2013; Tamaoki et al.,

2013; Uenoa et al., 2013; De Vleesschauwer et al., 2014; Kyndt et al., 2014a; Taniguchi et al.,

2014). Others phytohormones such as Abscisic acid (ABA), Auxin (AUX), Gibberellic acid (GA),

and Brassinosteroids (BR) either act as a virulence factor for pathogens to manipulate defense

signaling pathways or play a positive role in defense in rice to some extents (Ding et al., 2008;

Domingo et al., 2009; De Vleesschauwer et al., 2010; De Vleesschauwer et al., 2012; Nahar et al.,

2012; Jiang et al., 2013; Nahar et al., 2013; Qin et al., 2013; Van Buyten, 2013). The JA hormonal

pathway plays a key role in rice defense against biotrophic root pathogen M. graminicola (Nahar

et al., 2011; Kyndt et al., 2012; Kyndt et al., 2014a); while JA and ET pathway play a major role

in defense against necrotrophic pathogens (Geraats et al., 2002; Bari & Jones, 2009; De

Vleesschauwer et al., 2012). It is known that auxin is essential for giant cell initiation and

development by root knot nematodes (Karczmarek et al., 2004). On the other hand, Pythium spp.

are capable to produce IAA by themselves, have potential to induce endogenous AUX level and

have ability to regulate auxin signaling (Rey et al., 2001; Van Buyten, 2013). Unfortunately, the

molecular mechanism of hormonal pathways in rice underlying the interaction of M. graminicola

and P. arrhenomanes is unclear.

Present study was undertaken with following objectives- I) to evaluate gall and nematode

development in rice roots under in vivo condition, II) to study the interaction of P. arrhenomanes

and M. graminicola on different rice cultivars, mutant and transgenic line, III) to investigate the

role of hormone signaling pathways (more specifically: JA, SA, ET and Auxin) during single and

double infection on rice roots, IV) to quantify in planta Pythium arrhenomanes DNA, and V) to

4

search for genes coding for necrosis and ethylene inducing peptide 1 (Nep1) like proteins (NLPs)

in P. arrhenomanes.

2 Materials and Methods

2.1 Plant Material and Growth Conditions

Different rice (Oryza sativa L.) cultivars-Nipponbare (provided by USDA), Palawan 1 & 2

(traditional upland rice cultivar, originated in IRRI; Palawan-2, GID 48535), Apo and IR81413-

BB-75-3 (provided by IRRI; called IR line in this thesis), were used in interaction experiments. In

addition, hebiba (JA biosynthesis mutant line) and its corresponding wild-type CV Nihonmasari,

OsGH3.1 -overexpression line (which accumulates less auxin) and its corresponding wild-type cv.

Bomba (obtained from USDA) were also used in interaction experiment. Rice seeds were surface

sterilized (4% NaOCl), subsequently rinsed with sterile water three times, germinated on wet paper

towel for 4 days at 30°C in an incubator and transplanted into Synthetic Absorbent Polymer (SAP)

substrate medium in a PVC tube at 1 plant/SAP tube (Reversat et al., 1999). Plants were grown at

26°C temperature under 12h/12h light regime with 70% to 75% relative humidity in the growth

chamber; and were fertilized with 10mL of Hoagland solution (an artificial nutrient source) per

plant twice per week.

2.2 Maintenance of Pathogens

The Meloidogyne graminicola culture (originally isolated in the Philippines) was maintained on

rice cultivar-Nipponbare and tropical Asian wild type grasses-Echinocloa crus-galli. Root systems

of 3 month old infected plants were cut into pieces and nematodes were extracted using the

modified Baermann method (Luc et al., 2005). Second stage juveniles were collected after 48 hours

of incubation. The pure culture of Pythium arrhenomanes (P60, isolated from rice field in

Philippines) was given by Phytopathology laboratory, Department of Crop Protection, Ghent

University, Belgium; and culture was maintained on PDA (Potato Dextrose Agar) medium and 3-

4 days old culture was used to inoculate rice seedlings.

2.3 Infection Assay and susceptibility scoring

In each infection assay, there were four different treatments performed with the above mentioned

rice cultivars: single infection of both pathogens, a double infection (M. graminicola plus P.

arrhenomanes) and an uninfected control (mock). Four days old rice seedlings were transplanted

5

on SAP media and a single plug of P. arrhenomanes (Appendix, Figure 1) was used to infect rice

seedlings on day 9 (single infection) after making hole in the SAP media near roots, about 1 ml of

nematode suspension containing 250 second-stage juveniles of M. graminicola were used to infect

rice seedlings on day 11 (single infection), double infection with both pathogens (P. arrhenomanes

on day 9 and M. graminicola on day 11), and mock infection was done on control plants with agar

block/water.

To evaluate susceptibility to root knot nematode infection, root samples were harvested on day 12.

Root samples were boiled in 0.8% acetic acid solution containing 0.013% acid fuchsin for 3

minutes, followed by rinsing with running tap water, de-stained in acid glycerol (1.5 ml of 37%

HCl plus 500 ml of Glycerol). Effect of pathogens were evaluated by measuring the shoot and root

length of the plants, counting the number of galls, total number of nematodes per root system, and

the number of nematode developmental stages (J2, J3/J4, female and eggmass) per plant (Figure

1).

Figure 1. Developmental stages of M. graminicola in rice roots

2.4 Fluorescent labelling of nematodes

Nematodes were purified on a 100% sucrose solution followed by washing with sterile water. For

PKH26 labeling, a total of 45,000 second stage juveniles (J2) of M. graminicola were resuspended

in 1.5 ml of sterile water prior to addition of 2 µl PKH26 (stock solution 1 × 10–3 M) from the

MINI26 PKH26 Red Fluorescent Cell Linker Kit (Sigma-Aldrich). The suspension was mixed by

inverting several times, then incubated for 15 minutes in the dark at room temperature. Nematodes

were rinsed three times by repeated transfers to 30 ml of sterile water to remove excess dye,

followed by centrifuging (375 × g for 3 min). Stained and non-stained nematodes were observed

on standard microscopy glass slides using confocal microscope. PKH26 stained nematodes and

unstained nematodes were immediately used to inoculate rice roots. After 12 days, roots were put

J2 J3/J4 Female and Eggmass Gall

6

on glass slides and observed under the confocal microscope. In parallel, roots of similarly treated

plants were boiled in acid fuchsin to check the infectivity and nematode development of the stained

nematodes inside the rice roots.

2.5 Chemical Treatments

JA & SA biosynthesis inhibitor SHAM (2-Hydroxybenzenecarbohydroxamic acid) and JA

biosynthesis inhibitor DIECA (Diethyldithiocarbamic acid diethylammonium salt), were used on

rice cultivar Nihonmasari. These chemical inhibitors were dissolved in 1mL of pure ethanol prior

to diluting in water containing 0.02% (v/v) Tween 20 in which the concentrations of SHAM (200

mM) and DIECA (100 mM) were prepared. Infection was similar as described above, with the

addition of the chemical treatment on day 10, in which rice shoots were sprayed with chemical

inhibitors (SHAM and DIECA) using vaporizers; SHAM was also used as root drench in a separate

trial.

2.6 RNA Extraction, cDNA Synthesis, and qRT-PCR

On day 12 of the infection assay, root samples were harvested for gene expression studies on rice

cv. Nipponbare and IR line. Root RNA was extracted using RNeasy Plant Mini Kit (Qiagen)

following the manufacturer’s instructions and RNA concentration was measured using the Nano

Drop 2000c UV-Vis spectrophotometer (Thermo Scientific). Extracted RNA was treated with

DNaseI to eliminate residual DNA. A total of 3 microgram of RNA was treated with 2 µl of DNaseI

(1 unit per µl; Fermentas), 1 µl of RiboLock RNase Inhibitor (40 unit per µl; Fermentas), and 1.8

µl of 10x DNaseI buffer with MgCl2 (Fermentas) in a total volume of 18 µl (including water). The

mixture was incubated at 37°C for 30 min followed by addition of 2 µl of 25 mM EDTA

(Fermentas) and incubated at 65°C for 10 min to terminate the reaction.

First strand cDNA synthesis was carried out in three steps: (1) addition of 4µl of RNAse free water,

1 µl of oligo(dT) (700 ng/µl), and 2 µl of 10 mM deoxyribonucleotide triphosphates (dNTPs,

Invitrogen), in a total volume of 27 µl including 20 µl of DNase treated RNA which was incubated

at 65°C temperature for 5 minutes; (2) addition of 8 µl of 5x first strand buffer (Invitrogen) and 4

µl of 0.1 M DDT (dithiothreitol) which was incubated at 42°C for 2 minutes followed by put on

ice; and (3) addition of 1 µl of SuperScript II Reverse Transcriptase (200 unit per µl; Invitrogen)

which was incubated at 42°C for 2 hours. The solution was diluted to 100 µl by adding 60 µl of

water, and the cDNA quality was checked using 5 µl of 5x MyTaq reaction buffer (preoptimized

7

conc. of dNTPs and MgCl2, BIOLINE), 5 µl of cDNA template, 1 µl of forward and reverse

primers (10µM) each for reference gene OsExpnarsai, 0.15 µl of Taq-polymerase (5u/μl,

BIOLINE), 12.85 µl of water in a total volume of 25 µl. The programme was 95°C for 5 minutes,

95°C for 45s, 55°C for 45s, 72°C for 30s (repeated 40X), 72°C for 5 minutes. Products were

checked on a 1.5% agarose gel (0.5x TAE).

For qRT-PCR analysis, each reaction contained 1 µl of cDNA, 1 µl of forward and reverse primer

(10 µM) each, 7 µl sterile water and 10µl of 2xSensi MixTM SYBR No-ROX Mastermix (BIOLINE)

in a total volume of 20µl. A list of primers used for qRT-PCR is presented in Table 1. Each

treatment was evaluated in two biological replicates (4 plants in each biological replicate) and

three technical replicates. The PCR reactions were conducted in the Rotor-Gene 3000 (Corbett

Life Science) using Rotor gene Disc (Qiagen), and results were generated using Rotor Gene

software. All qRT-PCR were conducted under the following conditions: hold temperature at 95°C

for 10 min, and 40 cycles at 95°C for 25s, 58°C for 25s, and 72°C for 20s. A melting curve was

generated to test the amplicon specificity.

Table 1. An overview of the selected target and reference genes with their Gene Bank Locus

number and the primer pairs used for qRT-PCR

Gene studied Forward primer (5′-3′) Reverse primer (3′-5′) Locus number

Reference OsExpnarsai AGGAACATGGAGAAGAACAAGG CAGAGGTGGTGCAGATGAAA LOC_Os07g02340

Reference OsEXP TGTGAGCAGCTTCTCGTTTG TGTTGTTGCCTGTGAGATCG LOC_Os03g27010

Reference OsEIF5C CACGTTACGGTGACACCTTTT GACGCTCTCCTTCTTCCTCAG LOC_Os11g21990

PR-10 OsPR10 CCCTGCCGAATACGCCTAA CTCAAACGCCACGAGAATTTG LOC_Os12g36880

JA

biosynthesis OsAOS2 CAATACGTGTACTGGTCGAATGG AAGGTGTCGTACCGGAGGAA LOC_Os03g12500

SA

biosynthesis OsICS1 TGTCCCCACAAAGGCATCCTGG TGGCCCTCAACCTTTAAACATGCC LOC_Os09g19734

Auxin

Biosynthesis OsYUCCA-1 GCACAACCTCGAGTGCTACC CGTCCACTTCCTTGTTCACC LOC_Os01g46290

Auxin

response OsGH3.1 GCAATGGAACAAAAGCAAGGA CAGATCATCACCCTCTAGCTTCAA LOC_Os01g57610

ET

biosynthesis OsACS1 GATGGTCTCGGATGATCACA GTCGGGGGAAAACTGAAAAT LOC_Os03g51740

ET response OsEIN2b TAGGGGGACTTTGACCATTG TGGAAGGGACCAGAAGTGTT LOC_Os07g06130

2.7 Quantification of P. arrhenomanes DNA in rice roots by qPCR

Root samples were collected from single P. arrhenomanes and double (M. graminicola and P.

arrhenomanes) infection in both Nipponbare and IR line. In addition, some root samples were

included from a raised bed interaction study performed by Ruben Verbeek at IRRI in the period

8

January – May, 2015 (samples given by Ruben Verbeek, PhD. Student, Ghent University, Belgium)

to compare infection pressure between SAP system and soil system. Root tissue was finely crushed

in liquid nitrogen. DNA was extracted using DNeasy Plant Mini Kit (Qiagen) according to

manufacturer’s instruction. Primers specific for the Internal Transcribed Spacer (ITS)-region of

the ribosomal DNA of P. arrhenomanes PT 60 (ITS60 F(5′-3′): ATTCTGTTACGCGTGGTCTT

CCG; ITS60 R(3′-5′): ACCTCACATCTGCCATCTCTCTCC were used to quantify in planta P.

arrhenomanes DNA (Van Buyten & Hofte, 2013). Rice specific primers 400F (5′-3′): TTCTCCT

CCCAATCGTCTCG and 401R (3′-5′): TTAGGTGGAGGGAGCGAATC were used to normalize

the Pythium DNA. Each reaction contained 1 µl of DNA, 1 µl of forward and reverse primer (10

µM) each, 7 µl sterile water and 10µl of 2xSensi MixTM SYBR No-ROX Mastermix (BIOLINE)

in a total volume of 20µl. Three technical replicates were used for all samples. Standard curve

based on dilution series (1 ng, 0.1 ng, 0.01ng, 0.001ng) were run to quantify plant and Pythium

DNA. The standard curve with R2 value of 0.9981 and a slope (y=-0.3081x+4.9047) were

generated. The reactions were conducted in CFX Connect™ Real-Time PCR Detection System

using 96-Well PCR Plates (BIO-RAD). qPCR were conducted using following thermal cycles: 10

min at 95°C, and 45 cycles of 25s at 95°C, 58°C for 25s, and 72°C for 20s. To test the amplicon

specificity, a melting curve was generated by gradually increasing the temperature to 95°C. The

qPCR data were analyzed using the CFX Manager™ software.

2.8 Statistical analysis

Data generated during the experiment were checked for normality and homogeneity of variance.

Data on shoot and root length of rice cultivars were found to be normal and were analyzed using

one-way ANOVA with Duncan’s Post-Hoc test in SPSS. Number of galls and total nematodes per

root system were also normally distributed which was analyzed using independent T-test in SPSS.

Data on developmental stages of M. graminicola were not normally distributed and homogeneity

of variance was not uniform, so Mann–Whitney (for 2 variables) non-parametric tests, SPSS were

performed. qRT-PCR data were analyzed using the REST 9 software (Pfaffl et al., 2002); this

software uses a permutation analysis between control group and sample to compare the relative

expression levels and to determine the statistical significance.

9

3 Results

3.1 Experiment on fluorescent labelling of nematodes

A fluorescent nematode staining technique as reported recently (Dinh et al., 2014), was tested out

in order to be able to quantify nematode development in living root tissues. The staining of the

nematodes was successful (Figure 2) and there was no adverse effect of staining on their

penetration (Figure 3 A) and similar pattern of the number of female in the rice roots (Figure 3 B).

Living infected roots were checked to see the fluorescence of the nematodes inside the root (Figure

4, A-B), but it was not possible to get a clear picture of the vascular bundles, in which nematode

development was expected (Figure 5).

Figure 2. (A) Non-stained J2 and (B) Fluorescent labeling (stained) second stage juveniles

of M. graminicola on glass slide under confocal microscope

A B

10

0

1

2

3

4

5

6

7

8

9

10

Control (Non-stain) Stained

Gall

/rro

t sy

stem

A

0

2

4

6

8

10

12

14

16

Control (Non-stain) Stained

Sta

ges

/root

syst

em

J2 J3/J4 Female Eggmass

B

Figure 3. (A). Number galls/root system. Independent sample T-test were done on number of

galls per root system between stained and non-stained of M. graminicola at Nipponbare. (B).

Developmental stages of M. graminicola between non-stain and stained nematodes at

Nipponbare. Mann–Whitney non-parametric tests were done on number of J2s, J3/J4 and

females between stained and non-stained of M. graminicola at Nipponbare. Bar represent

Mean±Standard error of 4 replicates

A

Figure 4. (A) Confocal microscopic view on the surface of the rice root; (B) Confocal

microscopic view little beneath to the surface of the rice root.

B

11

3.2 Interaction experiments on Nipponbare, Palawan, Apo and IR line

To evaluate the interaction between M. graminicola and P. arrhenomanes on different rice

cultivars, we compared the nematode development and gall formation in the roots infected only

with nematodes versus double-infected root systems. When the number of galls or development

was lower in the double infection versus single infection, the interaction was considered to be

antagonistic. When the number of galls or development was higher in the double infection versus

single infection, the interaction was considered to be synergistic.

In the first trial of the experiment, unusually slow nematode development was observed

irrespective of rice cultivars tested (Appendix, Figure 2). As the development of J2s of the

nematodes might be affected by an external influence, it was decided to leave this trial out of the

analysis.

In two other independent trials, shoot lengths were reduced significantly after single P.

arrhenomanes infection and after double infection compared to mock infected rice varieties

(Figure 6 & 9). There were no clear trends found based on the root length among treatments in the

rice cultivars tested, although root lengths were generally smaller in infected plants (Figure 7). In

Nipponbare, based on nematode development, there was synergistic effect between both pathogens,

i.e., the higher number of galls, total nematode counts and mean developmental stages were

Figure 5. Confocal microscopic

view in the middle of the rice root

12

observed in double infected (M. graminicola plus P. arrhenomanes) plants as compared to single

M. graminicola infected plants (Figure 8 & 10). In Palawan-2, there was a similar number of galls

found between single and double infection but total nematode counts and number of females were

lower in double infected plants compared to single M. graminicola infected plants, although this

effect was not spectacular (Figure 8B & 10). The interaction seemed to be slightly antagonistic in

Palawan-2. There was no difference observed between single M. graminicola infected and double

infected plants in cultivar-Apo and IR line rice cultivars in terms of number of galls (Figure 8A),

total nematodes counts per root system (Figure 8B) as well as developmental stages of RKN

(Figure 10). Interestingly, cultivar-Apo and IR line seemed to be less susceptible to the nematodes

as compared to Nipponbare and Palawan-2 (Figure 8B).

Figure 6. Shoot length of different rice cultivars after 12 days post infection (dpi) of M.

graminicola (single infection), 14 dpi of P. arrhenomanes (single infection) and double infection

(12 dpi of M. graminicola plus 14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error

of 6 replicates (2nd Trial) and 8 replicates (3rd Trial). Letter(s) on error bars are based on statistical

analysis (Duncan’s multiple range test) after one way ANOVA. Means followed by the same

letter(s) do not differ significantly (P > 0.05).

0

5

10

15

20

25

30

35

40

45

50

2nd Trial 2nd Trial 2nd Trial 2nd Trial 3rd Trial 3rd Trial

Nipponbare Palawan-2 Apo IR line Apo IR line

Sh

oo

t le

ng

th (

cm)

Mock Mg Py Mg+Py

a

b

a

c

ab b b

a ab b

a ab

b

a a b ba ab ab c

13

Figure 7. Root length of different rice cultivars after 12 dpi of M. graminicola (single infection),

14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M. graminicola plus

14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error of 6 replicates (2nd Trial) and 8

replicates (3rd Trial). Letter(s) on error bars are based on statistical analysis (Duncan’s multiple

range test) after one way ANOVA. Means followed by the same letter(s) do not differ significantly

(P > 0.05).

0

5

10

15

20

25

2nd Trial 2nd Trial 2nd Trial 2nd Trial 3rd Trial 3rd Trial

Nipponbare Palawan-2 Apo IR line Apo IR line

Ro

ot

len

gth

(cm

)

Mock Mg Py Mg+Py

aab

b b

ab

a aba ab

b ba a a

b

a a a aa

b a a

0

5

10

15

20

25

30

Nip

pon

bar

e

Pal

awan

-2

Ap

o

IR

Ap

o

IR

2nd Trial 3rd Trial

Ga

ll/r

oo

t sy

stem

Gall Mg Gall Mg+Py

A

0

20

40

60

80

100

120

Nip

pon

bar

e

Pal

awan

-2

Ap

o

IR

Ap

o

IR

2nd Trial 3rd Trial

Nem

ato

des

/ro

ot

syst

em

Mg Mg+Py

B

Figure 8. (A) Number of galls and (B) Number of nematodes/root system on different rice

cultivars at 12 dpi of M. graminicola. Bar represent Mean ± Standard error of 6 replicates (2nd

Trial) and 8 replicates (3rd Trial). Independent sample T-test were done on number of galls and

total nematode count per root system between single M. graminicola infected and double

infected (M. graminicola plus P. arrhenomanes) plants in each cultivar. Asterisks indicate

statistically significant different between Mg and Mg+Py (P < 0.05).

*

14

Nipponbare Palawan-2

Apo IR81413-BB-75-3

Figure 9. Response of different rice cultivar to root knot nematode-M. graminicola and

Oomycetes- P. arrhenomanes. Mock-without any pathogen inoculation; Mg-single M.

graminicola infection; Py-single P. arrhenomanes infection; Mg+Py-both M. graminicola

and P. arrhenomanes infection.

Mock Mg Py Mg+Py Mock Mg Py Mg+Py

Mock Mg Py Mg+Py Mock Mg Py Mg+Py

15

Figure 10. Developmental stages of M. graminicola at 12 dpi on different rice cultivars. Bar

represent as Mean ± Standard error 6 replicates (2nd Trial) and 8 replicates (3rd Trial). Mean value

of number of female is displayed in the bar. Mann–Whitney non-parametric tests were done on

number of females between single M. graminicola infected and double infected (M. graminicola

plus P. arrhenomanes) plants in each trial.

3.3 Role of JA on interaction of M. graminicola and P. arrhenomanes

In order to know the role of defense hormone-Jasmonic acid on interaction between biotrophic-M.

graminicola and Oomycetes-P. arrhenomanes, experiments were conducted on Nihonmasari

(wild-type), mutant line-hebiba (JA biosynthesis mutant) and JA pathway inhibitors (SHAM and

DIECA) treated Nihonmasari. In Nihonmasari and chemical inhibitor treated Nihonmasari, there

was significant reduction of shoot length in single P. arrhenomanes infected and double infected

(M. graminicola and P. arrhenomanes) plants compared to the control and single M. graminicola

infected plants (Figure 11 & 15). In most of the cases, reduction of root length were observed in

pathogen infected plants as compared to control plants (Figure 12). Based on number of galls per

root system, there was a synergistic effect in double infected roots in 2nd trial of Nihonmasari and

first trial of DIECA treated Nihonmasari (Figure 13). There was no statistical difference in the

number of total nematodes as well as the number of females per root system between single M.

graminicola infected and double infected plants (Figure 14 & 16). But, there was a lower mean

number of females observed in double infected plants compared to single M. graminicola infected

plants in first trial of Nihonmasari, hebiba (both trials), foliar applied DIECA, foliar sprayed and

root drenched SHAM. In case of the 2nd trail, Nihonmasari gave a synergistic effect (Figure 16).

56,00

64,6059,63 49,88

22,2018,80

30,75 30,25

16,00 15,25 18,13 18,63

0,00

20,00

40,00

60,00

80,00

100,00

120,00

Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py

2nd Trial 2nd Trial 2nd Trial 3rd Tial 2nd Trial 3rd Tial

Nipponbare Palawan-2 Apo IR

Sta

ges

/ro

ot

syst

em

J2 J3/J4 Female Eggmass

16

Since the interaction between both pathogens in Nihonmasari was not consistent (once synergism,

once slight antagonism) it is hard to draw conclusions from these experiments.

Figure 11. Shoot length of different rice cultivars after 12 dpi of M. graminicola (single infection),

14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M. graminicola plus

14 dpi of P. arrhenomanes). Bar represent as mean ± standard error of 8 replicates. Letter(s) on

error bars are based on statistical analysis (Duncan’s multiple range test) after one way ANOVA.

Means followed by the same letter(s) do not differ significantly (P > 0.05).

Figure 12. Root length of different rice cultivars after 12 dpi of M. graminicola (single infection),

14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M. graminicola plus

14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error of 8 replicates. Letter(s) on error

bars are based on statistical analysis (Duncan’s multiple range test) after one way ANOVA. Means

followed by the same letter do not differ significantly (P > 0.05).

0

5

10

15

20

25

30

35

1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial

Nihonmasari hebiba Nih+SHAM

(Foliar spray)

Nih+DIECA

(Foliar spray)

Nih+SHAM

(Root drench)

Sh

oo

t le

ng

th (

cm)

Mock Mg Py Mg+Py

a aab

b

a a

b b

ab a

bb

ab ab

ab a a

bc

a a

bb

a a

bb

0

5

10

15

20

25

1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial

Nihonmasari hebiba Nih+SHAM

(Foliar spray

Nih+DIECA

(Foliar spray)

Nih+SHAM

(Root drench)

Ro

ot

len

gth

(cm

)

Mock Mg Py Mg+Py

a

b b

c

a ababb

a

bc bc

a a a a aa

a a a ab b a

b bb

17

Figure 13. Number of galls/root system at 12 dpi of M. graminicola at Nihonmasari, hebiba and

chemical inhibitor treated Nihonmasari. Bar represent Mean ± Standard error of 8 replicates.

Independent sample T-test were done on number of galls per root system between single M.

graminicola infected and double infected (M. graminicola plus P. arrhenomanes) plants in each

trial under each cultivar. Asterisks indicate statistically significant different between Mg and

Mg+Py (P < 0.05).

Figure 14. Number of nematodes/root system at 12 dpi of M. graminicola at Nihonmasari, hebiba

and chemical inhibitor treated Nihonmasari. Bar represent as Mean ± Standard error of 8 replicates.

Independent sample T-test were done on total nematode count per root system between single M.

graminicola infected and double infected (M. graminicola plus P. arrhenomanes) plants in each

trial under each cultivar

0

5

10

15

20

25

30

35

40

45

1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial

Nihonmasari hebiba Nih+DIECA

(Foliar Spray)

Nih+SHAM

(Foliar Spray)

Nih+SHAM

(Root drench)

No

. o

f g

all

s/ro

ot

syst

em

Mg Mg+Py

* *

0

10

20

30

40

50

60

70

80

90

1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial

Nihonmasari hebiba Nihon+DIECA

(Spray)

Nihon+SHAM

(Spray)

Nihon+SHAM

(Root drench)

Nea

mto

des

/ro

ot

syst

em

Mg Mg+Py

18

Nihonmasari hebiba

SHAM sprayed Nihonmasari DIECA sprayed Nihonmasari

Figure 15. Response of Nihonmasari, hebiba and chemical inhibitor treated Nihonmasari to

root knot nematode-M. graminicola and Oomycetes- P. arrhenomanes. Mock-without any

pathogen inoculation; Mg-single M. graminicola infection; Py-single P. arrhenomanes

infection; Mg+Py-both M. graminicola and P. arrhenomanes infection.

Mock Mg Py Mg+Py Mock Mg Py Mg+Py

Mock Mg Py Mg+Py Mock Mg Py Mg+Py

19

Figure 16. Developmental stages of M. graminicola at 12 dpi at Nihonmasari, hebiba and chemical

inhibitor treated Nihonmasari. Bar represent as Mean ± Standard error of 8 replicates. Mean value

of number of female is displayed in the bar. Mann–Whitney non-parametric tests were done on

number of females between single M. graminicola infected and double infected (M. graminicola

plus P. arrhenomanes) plants in each trial for each cultivar.

3.4 Role of Auxin on interaction of M. graminicola and P. arrhenomanes

To evaluate the role of auxin, infection assay was done on overexpression OsGH3.1, a transgenic

line in which plants have less free auxin, and its wild-type Bomba. Both in wild type and the

OsGH3.1 overexpression line, there was significant reduction of shoot length in single P.

arrhenomanes infected and double infected (M. graminicola and P. arrhenomanes) plants

compared to control and single M. graminicola infected (Figure 17 & 21). But, both in wild type

and the OsGH3.1 overexpression line, there was significant reduction of root length in single M.

graminicola infected and double infected (M. graminicola and P. arrhenomanes) plants compared

to single P. arrhenomanes infected and control plants (Figure 18). There was no significant

difference found in the number of galls and total nematodes counts between single M. graminicola

infected and double infected (M. graminicola and P. arrhenomanes) plants (Figure 19 A-D).

However, there was a significantly higher number of females observed in double infected plants

compared to single M. graminicola infected plants in the OsGH3.1 overexpression line, while this

25,38 15,50

33,13

46,0024,00

7,83

48,6341,25

30,75

22,38

44,25 39,50

20,29

13,14

0,00

10,00

20,00

30,00

40,00

50,00

60,00

70,00

80,00

90,00

Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py

1st Trial 2nd Trial 1st Trial 2nd Trial 1st Trial 1st Trial 1st Trial

Nihonmasari hebiba Nih+DIECA

(Spray)

Nih+SHAM

(Spray)

Nih+SHAM

(Root drench)

Sta

ges

/ro

ot

syst

emJ2 J3/J4 Female Eggmass

20

was not observed in wild type Bomba (Figure 20). Bomba showed a slight antagonism between

the pathogens while a synergistic interaction was seen in the OsGH3.1 overexpression line (Figure

20).

Figure 17. Shoot length of Bomba and overexpression OsGH3.1 line after 12 dpi of M.

graminicola (single infection), 14 dpi of P. arrhenomanes (single infection) and double infection

(12 dpi of M. graminicola plus 14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error

of 8 replicates. Letter(s) on error bars are based on statistical analysis (Duncan’s multiple range

test) after one way ANOVA. Means followed by the same letter(s) do not differ significantly (P >

0.05).

Figure 18. Root length of Bomba and overexpression OsGH3.1 line after 12 dpi of M. graminicola

(single infection), 14 dpi of P. arrhenomanes (single infection) and double infection (12 dpi of M.

graminicola plus 14 dpi of P. arrhenomanes). Bar represent Mean ± Standard error of 8 replicates.

Letter(s) on error bars are based on statistical analysis (Duncan’s multiple range test) after one way

ANOVA. Means followed by the same letter(s) do not differ significantly (P > 0.05).

0

5

10

15

20

25

30

35

40

45

50

Bomba OsGH3.1

Sh

oo

t le

ng

th (

cm)

Mock Mg Py Mg+Py

a ab b

a a abb

0

5

10

15

20

25

Bomba OsGH3.1

Ro

ot

len

gth

(cm

)

Mock Mg Py Mg+Py

a a

b b

a ab b

21

Figure 19. (A) Gall/root system in Bomba, (B) Gall/root system in overexpression OsGH3.1 line,

(C) Total nematodes counts/root system in Bomba, (D) Total nematodes counts/root system in

overexpression OsGH3.1 line at 12 dpi of M. graminicola. Bar represent Mean ± Standard error

of 8 replicates. Independent sample T-test were done between single M. graminicola infected and

double infected (M. graminicola plus P. arrhenomanes) plants in each cultivar/ transgenic line.

Figure 20. Developmental stages of M. graminicola at 12 dpi at Bomba and overexpression

OsGH3.1 line. Bar represent mean ± standard error of 8 replicates. Mean value of the number of

female is displayed in the bar. Mann–Whitney non-parametric tests were done on number of

females between single M. graminicola infected and double infected (M. graminicola plus P.

arrhenomanes) plants in each cultivar/transgenic line. Asterisks indicate statistically significant

different between Mg and Mg+Py (P <0.05).

33,8830,86

22,75 36,25

0,00

10,00

20,00

30,00

40,00

50,00

60,00

Mg Mg+Py Mg Mg+Py

Bomba OsGH3.1

Sta

ges

per

ro

ot

syst

em

J2 J3/J4 Female Eggmass

*

0

5

10

15

20

Mg Mg+Py

Ga

ll/r

oo

t sy

stem

Bomba A

0

20

40

60

Mg Mg+Py

Nem

ato

de/

roo

t

syst

em

Bomba C

0

10

20

30

Mg Mg+Py

Ga

ll/r

oo

t sy

stem

OsGH3.1 line B

0

20

40

60

Mg Mg+Py

Nem

ato

de/

roo

t

syst

em

OsGH3.1 line D

22

3.5 Gene expression studies on Nipponbare and IR line

The gene expression was studied to elucidate the molecular mechanisms behind the interaction. In

Nipponbare (Figure 22), the transcript of OsPR10, a general pathogenesis-related gene, was

slightly down-regulated in M. graminicola infected roots while significantly up-regulated in P.

arrhenomanes infected roots. In double infected (P. arrhenomanes plus M. graminicola) roots,

this gene was up-regulated although less pronounced compared to single P. arrhenomanes infected

roots. The JA biosynthesis gene, OsAOS2 was downregulated in single M. graminicola infected

roots, but significantly upregulated in the presence of necrotrophic pathogen-P. arrhenomanes;

interestingly this gene was slightly suppressed in double infected roots. Transcripts of SA-

biosynthesis gene, OsICS1 was slightly down-regulated irrespective of the treatments. Expression

of auxin biosynthesis gene, OsYUCCA1 and auxin responsive gene, OsGH3.1 was not strongly

changed after infection. ET-biosynthesis gene, OsACS1 was down-regulated in all the treatments

but more pronounced in single P. arrhenomanes infected roots. Ethylene responsive gene,

A. Bomba B. Overexpression OsGH3.1 line

Figure 21. Response of Bomba and overexpression OsGH3.1 line to root knot nematode-M.

graminicola and Oomycetes- P. arrhenomanes. Mock-without any pathogen inoculation; Mg-

single M. graminicola infection; Py-single P. arrhenomanes infection; Mg+Py-both M.

graminicola and P. arrhenomanes infection.

Mock Mg Py Mg+Py Mock Mg Py Mg+Py

23

OsEIN2b was significantly up-regulated in all of the treatments in which more pronounced in

single M. graminicola infected roots.

Figure 22. Relative expression levels of seven different genes in root samples of Nipponbare with

single nematode infection (1 dpi of M. graminicola; Mg); single P. arrhenomanes infection (3 dpi

of P. arrhenomanes; Py); double infection (1 dpi of M. graminicola plus 3 dpi of P. arrhenomanes;

Mg+Py). Bars represent the mean of two biological replicates, each containing root samples of a

pool of four plants. Asterisks indicate statistically significant differential expression in comparison

with uninfected plants.

In IR line (Figure 23), transcripts of both general pathogenesis gene, OsPR10 and JA-biosynthesis

gene, OsAOS2 were found to be down-regulated both in single M. graminicola infected and single

P. arrhenomanes infected roots while in double infected roots, OsPR10 was upregulated and

OsAOS2 expression did not change. Transcripts of SA biosynthesis gene, OsICS1 and auxin

biosynthesis gene, OsYUCCA1 were down-regulated after all treatments. Transcripts of auxin

responsive gene, OsGH3.1 was upregulated in single M. graminicola infected as well as in double

infected roots but slightly down-regulated in single P. arrhenomanes infected roots. Interestingly,

both ethylene biosynthesis gene, OsACS1 and ethylene responsive gene, OsEIN2b were

upregulated in single P. arrhenomanes infected roots as well as in double infected roots, but the

expression of OsACS1 was not altered and OsEIN2b was slightly down-regulated after single

infection of M. graminicola.

0,25

0,5

1

2

4

8

16

OsPR10 OsAOS2 OsICS1 OsYUCCA1 OsGH3.1 OsACS1 OsEIN2b

Rel

ati

ve

exp

ress

ion

lev

el

Mg Py Mg+Py

*

*

**

* *

24

23. Relative expression levels of seven different genes in root samples of IR line with single

nematode infection (1 dpi of M. graminicola; Mg); single P. arrhenomanes infection (3 dpi of P.

arrhenomanes; Py); double infection (1 dpi of M. graminicola plus 3 dpi of P. arrhenomanes;

Mg+Py). Bars represent the mean of two biological replicates, each containing root samples of a

pool of four plants. Asterisks indicate statistically significant differential expression in comparison

with uninfected plants.

Figure 24. Basal expression levels of seven different genes in root samples of uninfected IR line

compared to uninfected Nipponbare (expression set at 1 for all genes). Bars represent

Mean±Standard error of two biological replicates (three technical replicates), each containing root

samples of a pool of four plants. Asterisks indicate statistically significant differential expression.

0,5

1

2

OsPR10 OsAOS2 OsICS1 OsYUCCA1 OsGH3.1 OsACS1 OsEIN2b

Rel

ati

ve

exp

ress

ion

lev

el

Mg Py Mg+Py

*

*

0,25

0,5

1

2

4

8

16

OsPR10 OsAOS2 OsICS1 OsYUCCA1 OsGH3.1 OsACS1 OsEIN2bBa

sal

exp

ress

ion

lev

el

*

*

*

*

25

IR line was observed to support the lower number of nematodes and gene expression pattern was

different as compared to Nipponbare. That was the reason behind to compare the basal gene

expression level between uninfected root samples of Nipponbare and IR line. Interestingly, basal

level of auxin responsive gene-OsGH3.1 was very higher in IR line compared to Nipponbare

(Figure 24). Basal expression of OsPR10 and OsEIN2b were also higher while expression of

OsAOS2, OsICS1 and OsACS1 were lower in IR line compared to Nipponbare roots (Figure 24).

3.6 In planta P. arrhenomanes DNA quantification in rice root samples

To evaluate infection pressure, rice root samples obtained from SAP system was use to quantify

P. arrhenomanes based on its DNA amplification. IRRI samples were included in this experiment

as positive control. Amplification of plant DNA and melting peak was similar in both samples

obtained from SAP system and IRRI raised bed which suggests DNA extraction seems to be fine

(Figure 25). However, Cq-values for the P. arrhenomanes target gene were very higher (more than

15 cycles different) for the SAP samples as compared to the IRRI samples (Figure 26). Moreover,

there was an unusual melting peak in samples obtained from the SAP system (Figure 26) while

IRRI samples gave as usual melting peak. After quantification using the standard curve, it was

confirmed that there was only a very low amount of in planta P. arrhenomanes DNA found in all

of the samples obtained from the SAP system, which is very low as compared to IRRI samples

(Figure 27).

Figure 25. Plant DNA amplification and melting peak of different sample obtained from IRRI

raised bed and SAP system.

IRRI sample

Sample from

SAP system

26

Figure 26. Pythium arrhenomanes DNA amplification and melting peak of different sample

obtained from IRRI raised bed and SAP system.

Figure 27. In planta quantification of Pythium arrhenomanes DNA (ng/µl) using q-PCR.

4 Discussion

The infective second-stage juveniles (J2s) of M. graminicola move through the soil amongst a

complex of repellent and attractant chemicals to find their host. After invasion of the young root

of the plant, J2s migrate to the root tip where they take a U-turn around in the meristem before

they can enter the stele. Subsequently, they move upwards in the vascular cylinder towards root

vascular cells which are transformed into large multinucleate feeding cells due to secretion of

0

0,1

0,2

0,3

0,4

0,5

0,6

0,7

Low Pythium

(Natural

infested soil)

High Pythium

(Py

inoculated)

Low Pythium

(Natural

infested soil)

High Pythium

(Py

inoculated)

Single

infection (Py)

Double

infection

(Mg+Py)

Single

infection (Py)

Double

infection

(Mg+Py)

Palawan-2 IR81413- BB-75-4 Nipponbare IR81413-BB-75-3

ng

/µl

IRRI samples

Samples from SAP system

IRRI sample

IRRI sample

Sample from

SAP system

Sample from

SAP system

27

effectors in the host cell, the so-called giant cells (Gheysen & Mitchum, 2011; Kyndt et al., 2013).

J2s become sedentary after establishing feeding sites and molt three times within the gall to

become either adult females or males through J3 and J4 stages (Karssen et al., 2013).

In present study, fluorescently labelled J2s of RKN with PKH26 were generated and infected on

rice roots, in order to try to see in vivo nematode development (J2, J3/J4, Female and Eggmass) in

rice roots. This experimental approach did not work due to thickness of the root and its non-

visibility inside the root by confocal microscope. Fluorescently labelled nematodes were used

successfully in the Arabidopsis root system, in which Meloidogyne chitwoodi, Heterodera

schachtii, Pratylenchus penetrans were used to infect roots of Arabidopsis to check nematode

behavior and development (Dinh et al., 2014). The positive result obtained with Arabidopsis could

be due to very thin cortex layer and transparent nature of Arabidopsis root system.

4.1 Interaction experiment

Present study was focused on the interaction of the Oomycetes-P. arrhenomanes and root knot

nematode-M. graminicola in different rice cultivars. In some cases, it has been reported that attack

by one pathogen make plants more vulnerable to another pathogen. On the other hand, plants might

react differently in which one pathogen could trigger defense in plants and as a result the plant

would become less suitable for the second pathogen.

Rice cultivar Nipponbare has been known as susceptible to M. graminicola (Nahar et al., 2011;

Kyndt et al., 2012; Nahar et al., 2012; Kyndt et al., 2014a) and to necrotrophic pathogen-P.

arrhenomanes (Van Buyten & Hofte, 2013). Similarly, in present study, this cultivar was found

to support a substantial number of galls and total nematodes counts. Shoot length was stunted

significantly due to P. arrhenomanes infection. After double infection, plants showed synergistic

interaction resulting in lower shoot length, significantly higher number of galls and total

nematodes compared to single M. graminicola infected roots. Similarly, shoot and root length of

sugarcane was significantly reduced due to single as well as combined effects of P. arrhenomanes

and nematodes (Mesocriconema xenoplax, Paratrichodorus minor and Tylenchorhynchus

annulatus) (Bond et al., 2004). In current study, a slight antagonistic interaction in Palawan-2 after

double infection in rice roots , which is contradictory with earlier reports (Kreye et al., 2010b) but

found as consistent with a recent study performed at IRRI under greenhouse conditions (Verbeek

et al., 2015). There are 12 different genotypes under the common name Palawan available in the

28

Philippines, this could be the reason to have different outcomes. In this study, Oryza sativa L.

cultivar ‘Palawan’ (GID 48535, IRRI) was used in 2nd trial. In present study, IR81413-BB-75-3

line has been used for interaction experiments, which is considered as a sister line of IR81413-

BB-75-4. In current study, nematode infection was not affected by P. arrhenomanes infection in

both Apo and IR line, indicating there is no interaction that affects the nematode population.

Interestingly, in our study, both of the cultivars were found to support a lower number of

nematodes compared to Nipponbare and Palawan-2. Rice cultivar-Apo has been reported as

tolerant (Kreye et al., 2010b) to both P. arrhenomanes and M. graminicola (especially when

infection done with J2s, but not with chopped roots) while IR81413-BB-75-4 line was categorized

as resistant to P. arrhenomanes and susceptible to M. graminicola (Kreye et al., 2010b).

To evaluate the role of Jasmonate (JA) on infection process, interaction experiment were also

conducted on rice cultivar-Nihonmasari and JA biosynthesis mutant-hebiba. Wild-type (First trial)

and mutant plants (hebiba), both foliar sprayed and root drenched SHAM on Nihonmasari showed

similar patterns based on galls and total nematode counts per root system. As wild-type

(Nihonmasari) gave opposite results between first and second trial, it is difficult to conclude the

role of JA on interaction based on experiment on Nihonmasari.

In current study, wild type rice cultivar-Bomba and a transgenic OsGH3.1 overexpression line

were also used to know the role of auxin in interaction of M. graminicola and P. arrhenomanes on

rice roots. It has been reported by several authors that levels of free IAA content are decreased in

overexpression OsGH3.1 transgenic line (Domingo et al., 2009), and in OsGH3-2 overexpression

line (Du et al., 2012). Interestingly, there was a faster nematode development and the higher

eggmass in wild-type compared to the transgenic line which indicates the role of auxin in the

nematode developmental process. There was a similar number of total nematode counts between

single M. graminicola infected and double infected roots both in wild type and mutant line which

suggest auxin does not play role in nematode penetration. However, in the transgenic line,

significantly more females were observed in double infected roots compared to single M.

graminicola infected roots which suggest that the presence of P. arrhenomanes might complement

the lower levels of auxin in this line, consequently leading to faster nematode development in the

double-infected plants compared to single nematode infected roots.

29

4.2 Gene expression studies

The gene expression levels have been studied on rice cultivar-Nipponbare and IR81413-BB-75-3

line after single and double infections to elucidate the role of hormonal pathways in the interaction.

Biosynthesis and/or responsive genes of JA, SA, Auxin, and ET pathway were studied together

with general pathogenesis-related gene OsPR10. In current study, there was a down regulation of

the transcripts of general pathogenesis gene, OsPR10 in single M. graminicola infected roots, both

in Nipponbare and IR line, which is consistent with previous findings (Nahar et al., 2011). There

was a strong up-regulation of OsPR10 gene observed in single P. arrhenomanes infected roots in

Nipponbare which is also consistent with recent findings (Van Buyten, 2013). Interestingly, in

Nipponbare, OsPR10 was up-regulated after double infection but less pronounced than after single

P. arrhenomanes infection which suggests in double infection, P. arrhenomanes triggered the

expression of OsPR10 which is suppressed by M. graminicola. It was observed that the basal level

of OsPR10 was higher in IR-mock compared to Nipponbare-Mock, which could explain the lower

susceptibility of IR line to root knot nematode-M. graminicola.

In Nipponbare, there was a significant up-regulation of OsAOS2 (JA biosynthesis gene) transcripts

in single P. arrhenomanes infected roots. This results is consistent with recent findings in which

OsAOS2 gene was found to be strongly upregulated in rice seedlings after P. arrhenomanes

infection at one day post infection (Van Buyten, 2013). There was a down-regulation of OsAOS2

gene in single M. graminicola infected roots. Suppression of the JA pathway by root knot

nematodes has been reported in several studies (Nahar et al., 2011; Kyndt et al., 2012; Kyndt et

al., 2014a). In double infection, there was a down-regulation of this gene but less pronounced

compared to single M. graminicola infected roots which suggests P. arrhenomanes triggers JA

signaling in roots but M. graminicola suppresses the JA pathway in double infection. Expression

of OsAOS2 gene was different in IR line. This gene was suppressed in both single M. graminicola

infected and single P. arrhenomanes infected roots; there was no change in expression level in

double infection which suggest that there could be other signaling pathway or crosstalk with other

hormones involved in IR line.

In the current study, SA biosynthesis gene, OsICS1 was suppressed in all the treatments, i.e., in

single infection by P. arrhenomanes, single infected M. graminicola and double infection in both

Nipponbare and IR line suggest that necrotrophic pathogen-P. arrhenomanes and biotrophic

30

pathogen-M. graminicola might be able to suppress SA biosynthesis pathway in rice roots and SA

signaling does not play role in the interaction. Present findings on suppression of SA pathway by

M. graminicola is consistent with a previous study (Nahar et al., 2011) while suppression of SA

pathway due to P. arrhenomanes was found unclear in rice roots (Van Buyten, 2013).

Higher expression of auxin responsive gene, OsGH3.1 results in the degradation of free auxin

content. Basal level of OsGH3.1 was significantly higher in IR-mock compared to Nipponbare-

mock which suggest a lower free auxin content in roots of the IR line, which might result in the

lower number of galls, total nematode counts and slower nematode development in this line.

Similarly, overexpression of OsGH3.1 in rice led to lower auxin content consequently enhanced

resistant to fungal pathogens (Domingo et al., 2009). In the interaction experiment, a significantly

slower nematode development was also observed in single M. graminicola infected roots in

overexpression OsGH3.1 line compared to wild type (Bomba). On the other hand, Pythium spp.

are known to secrete IAA in the tomato rhizosphere to promote their invasion (Mojdehi et al.,

1990; Rey et al., 2001). The P. arrhenomanes isolate was shown to produce auxin under in vitro

conditions (Van Buyten, 2013). In present study, there was a significant higher number of females

observed in the double infection than single infection with M. graminicola in the OsGH3.1

overexpression line (which have lower auxin content) suggesting that P. arrhenomanes might

trigger IAA in double infected rice roots and as a result faster nematode development was observed.

Ethylene production is one of the earliest response to a wide variety of biotic or abiotic stresses by

plants (Abeles et al., 1992). Pythium sylvaticum, P. jasmonium, and P. irregulare did cause

significantly more disease symptoms in ethylene mutants (ein2-1) than in wild-type plants

suggesting the role of ET in plant defense (Geraats et al., 2002). Ethylene signaling and

biosynthesis mutants (OsEin2b RNAi) supported a higher number of root knot nematodes (RKN)

in the rice roots (Nahar et al., 2011). In Nipponbare, ET-biosynthesis gene, OsACS1 was down-

regulated while ethylene response gene, OsEIN2b was up-regulated in all of the treatments. On the

other hand, in the IR line both OsACS1 and OsEIN2b gene were up-regulated in single P.

arrhenomanes infected and double infected roots but suppressed in single M. graminicola infected

roots. Interestingly, basal level of OsEIN2b was significantly higher which might explain the role

of ethylene in immunity in IR line consequently the lower number of nematodes present in the root

system.

31

4.3 In planta Pythium arrhenomanes DNA quantification

In order to know infection pressure in SAP system, root samples harvested from Nipponbare and

IR line were used to quantify P. arrhenomanes based on DNA amplification. DNA extraction

seemed to be fine as plant DNA was amplified properly in all samples. However, for Pythium

target gene, there were very late Cq-values and an unusual melting peak, which indicates a very

low amount P. arrhenomanes in the root samples. This could be confirmed when samples were

compared to IRRI samples. This suggests that P. arrhenomanes might not enter into the root tissue

properly in SAP system. In contrast, the higher amount of in planta P. arrhenomanes DNA was

quantified in rice roots when infection was done on rice seedlings grown in Gamborg B5 medium

(Van Buyten & Hofte, 2013). It seems that the SAP system is not an optimal environment for P.

arrhenomanes to colonize inside the rice root. As only a single plug of P. arrhenomanes was added

in each SAP tube, the inoculum might be too low. Furthermore, the inoculum might not be

distributed properly in the whole SAP substrate. However, P. arrhenomanes did have an effect on

the plants, as observed by the significant reduction of shoot length on all of the cultivars tested. In

addition, influence on the nematode development in double infection in Nipponbare, Palawan-2,

and overexpression OsGH3.1 transgenic line indicates the presence of P. arrhenomanes in the

substrate.

Is NLP present in Pythium arrhenomanes?

Many fungi, bacteria and oomycetes secrete necrosis and ethylene inducing peptide 1 (Nep1) like

proteins (NLPs) which induce necrosis and immunity related responses (Pemberton & Salmond,

2004; Gijzen & Nurnberger, 2006; Feng et al., 2014; Oome & Van den Ackerveken, 2014). A

large NLP gene families have been found in genome sequence of Oomycetes genus-Phytophthora

(Tyler et al., 2006) which is highly diverse and expanded (Qutob et al., 2002; Gijzen &

Nurnberger, 2006; Kanneganti et al., 2006). NLP homologues have also been reported in Pythium

monospermum (Worle & Seitz, 2003; Tyler et al., 2006); P. aphanidermatum (Veit et al., 2001);

and P. ultimum (Levesque et al., 2010).

There was four primers designed, based on known nucleotide sequences encoding NLP (Necrosis

and ethylene inducing protein) in P. aphanidermatum. The primers are presented in Table 2. A

PCR gradient (55°C to 60°C) was performed to amplify the NLP homologues using P.

32

arrhenomanes genomic DNA. PCR products were run on 1.5% agarose gel having 2.5µl of Midori

Green Advance DNA stain (Nippon Genetics Europe GmbH) per 100 ml of agarose gel (Figure

28, I). Desired bands were cut out and purified using PCR purification kit (Qiagen). PCR products

were ligated to pGEM-T vector and heat-shocked in competent E. coli cells. Colony PCR was

carried out to find out positive colonies (Figure 28, II & III). Plasmids were isolated from positive

colonies using the plasmid purification kit (Fermentas). Plasmids were sent for sequencing after

addition of plasmid specific primers T7 and SP6.

There was no match with known NLP homologues after blast search in NCBI database. For

instance, one shorter sequence obtained from C2 colonies had similarity with Phytophothora

capsici (pectate lyse gene) and Phytophothora cinnamomi (alpha tubulin gene) which is not the

expected gene (Figure 29). This could be due to bad primer design or pick up of wrong bands from

gel or simply because NLP might not be present in P. arrhenomanes.

Table 2. List primers used to search for NLP gene in Pythium arrhenomanes

Primer code Primers

401 Py_aphNLP1F GATCAACCATGATGCTGTGC

402 Py_aphNLP1R ACGAGATCTTGGCGGTAATG

403 Py_aphNLP2F GGTACATGCCAAAGGACTCG

404 Py_aphNLP2R TTTTCGAGGAAGCCAGATGT

33

Figure 28. (I) PCR products of two primer pair combinations (401+402 and 403+402), desired

bands (A, B, and C) were cut out; (II) colony PCR of product C. Colonies 1 and 2 (C1 and C2)

were used to purify plasmid and sent for sequencing; (III) colony PCR of products A and B, in

which colonies (A3, A4, B2 and B3) were used to purify plasmid and sent for sequencing.

ITS

401+402

60°C 55°C

403+402

60°C 55°C Colony PCR C

C

1

C

2

A

B

C

Colony PCR A and B

A

3

A

4

B

2

B

3

I II

III

34

Figure 29. NCBI- Blast search result of one of the sequence data

5 Conclusion

The rice cultivars behaved different after single and double infection with biotrophic-M.

graminicola and necrotrophic-P. arrhenomanes. Based on nematode development, a synergistic

interaction found in Nipponbare and slightly antagonistic interaction observed in Palawan-2 while

there was no interaction found in Apo and IR line. In Nipponbare, P. arrhenomanes triggered JA

signaling in roots which seems to be suppressed by M. graminicola. Auxin seems to play an

important role in nematode development and P. arrhenomanes might be able to complement auxin

level in roots. OsGH3.1 was highly expressed, probably leading to less auxin level in IR line, and

consequently the lower number of nematode infection. In SAP system, P. arrhenomanes infection

pressure was very low and might not be optimal. The gene encoding NLPs was not detected in P.

arrhenomanes.

6 Future works

SAP system needs to be optimized for P. arrhenomanes colonization inside the roots.

Experiment related to auxin transgenic line (Ox-OsGH3.1) with corresponding wild type

need to be replicated independently.

35

qPCR need to be done on ethylene response genes (OsERF70 and OsEBP89) to know the

role of ethylene in immunity along with interaction experiment on ethylene transgenic line

(OsEin2b RNAi line), its corresponding wild-type rice cultivar, ET-biosynthesis inhibitors

(aminoethyoxyvinyl-glycine, AVG; aminooxyacetic acid, AOA) treated plants.

More experiment needed to confirm whether gene encoding NLPs is present or not in P.

arrhenomanes.

Histopathological studies needed to know details about infection in the root system.

It would be interesting to investigate the role of reactive oxygen species (ROS), phenolic

compounds and callose deposition in rice roots on the interaction of both pathogens.

7 Acknowledgement

I would like to express my profound gratitude and heartfelt appreciation to my respected promoter

Professor Tina Kyndt, Department of Molecular Biotechnology, Ghent University, Belgium for

her active guidance, constant encouragement and constructive suggestion during thesis. I express

my special thanks to Ruben Verbeek, PhD. Student, Ghent University for his consistent support

and supervision throughout the research works. I also express my appreciation to Professor

Godelieve Gheysen, Department of Molecular Biotechnology and Professor Monica Höfte,

Department of Crop Protection, Ghent University for their necessary co-operation and laboratory

facilities. I also give my heartiest thanks to staff members of Applied Molecular Genetics- Henok

Zemene, Shakhina Khanam, Zobaida Lahari, Lander Bauters; Lab Technicians- Lien De Smet and

Isabel Verbeke, Ilse Delaere (Laboratory of Phytopathology, Department of Crop Protection) who

helped me to learn some techniques. I am grateful to Prof. Wilfrida Decraemer, Nic Smol, Prof.

Wim Bert and Inge Dehennin for their excellent academic support throughout the Nematology

course. I express many thanks to VLIR-UOS authority for financial supports during master’s

programme.

8 References

Abeles, F. B., Morgan, P. W. & Saltveit, M. E. J. (1992). Ethylene in plant biology. San Diego,

CA, U.S.A., Academic Press Inc., pp.

Atkinson, G. F. (1892). Some diseases of cotton. Alabama Agricultural Experiment Station Bull

41, 65.

36

Bari, R. & Jones, J. (2009). Role of plant hormones in plant defence responses. Plant Molecular

Biology 69, 473-488.

Bezemer, T. M. & Van Dam, N. M. (2005). Linking aboveground and belowground interactions

via induced plant defenses. Trends in Ecology & Evolution 20, 617-624.

Bhattarai, S., Haydock, P. P. J., Back, M. A., Hare, M. C. & Lankford, W. T. (2009). Interactions

between the potato cyst nematodes, Globodera pallida, G. rostochiensis, and soil-borne

fungus, Rhizoctonia solani (AG3), diseases of potatoes in the glasshouse and the field.

Nematology 11, 631-640.

Bond, J. P., Mcgawley, E. C., & & Hoy, J. W. (2004). Sugarcane growth as influenced by

nematodes and Pythium arrhenomanes. Nematropica 34, 245-256.

Bridge, J., Plowright, R. A. & Peng, D. (2005). 4 Nematode Parasites of Rice. Plant parasitic

nematodes in subtropical and tropical agriculture, 87.

Chantanao, A. (1962). Nematodes of rice and some other plants in Thailand. Entomol. Plant Pathol.

Bull. Thail. 1, 1-15.

Conrath, U., Pieterse, C. M. J. & Mauch-Mani, B. (2002). Priming in plant-pathogen interactions.

Trends in Plant Science 7, 210-216.

Cother, E. & Gilbert, R. (1992). Distribution of Pythium arrhenomanes in rice-growing soils of

southern New South Wales. Australasian Plant Pathology 21, 79-82.

Cother, E. & Gilbert, R. (1993). Comparative pathogenicity of Pythium species associated with

poor seedling establishment of rice in Southern Australia. Plant Pathology 42, 151-157.

De Vleesschauwer, D., Van Buyten, E., Satoh, K., Balidion, J., Mauleon, R., Choi, I.-R., Vera-

Cruz, C., Kikuchi, S. & Höfte, M. (2012). Brassinosteroids antagonize gibberellin-and

salicylate-mediated root immunity in rice. Plant physiology 158, 1833-1846.

De Vleesschauwer, D., Xu, J. & Höfte, M. (2014). Making sense of hormone-mediated defense

networking: from rice to Arabidopsis. Frontiers in Plant Science 5, 1-15.

De Vleesschauwer, D., Yang, Y. N., Cruz, C. V. & Hofte, M. (2010). Abscisic Acid-Induced

Resistance against the Brown Spot Pathogen Cochliobolus miyabeanus in Rice Involves

MAP Kinase-Mediated Repression of Ethylene Signaling. Plant physiology 152, 2036-

2052.

De Waele, D. & Elsen, A. (2007). Challenges in tropical plant nematology. Annu. Rev. Phytopathol.

45, 457-485.

Ding, X., Cao, Y., Huang, L., Zhao, J., Xu, C., Li, X. & Wang, S. (2008). Activation of the indole-

3-acetic acid–amido synthetase GH3-8 suppresses expansin expression and promotes

salicylate-and jasmonate-independent basal immunity in rice. The Plant Cell Online 20,

228-240.

Dinh, P. T. Y., Knoblauch, M. & Elling, A. A. (2014). Nondestructive Imaging of Plant-Parasitic

Nematode Development and Host Response to Nematode Pathogenesis. Phytopathology

104, 497-506.

Domingo, C., Andres, F., Tharreau, D., Iglesias, D. J. & Talon, M. (2009). Constitutive Expression

of OsGH3.1 Reduces Auxin Content and Enhances Defense Response and Resistance to a

Fungal Pathogen in Rice. Molecular plant-microbe interactions 22, 201-210.

37

Du, H., Wu, N., Fu, J., Wang, S. P., Li, X. H., Xiao, J. H. & Xiong, L. Z. (2012). A GH3 family

member, OsGH3-2, modulates auxin and abscisic acid levels and differentially affects

drought and cold tolerance in rice. Journal of experimental botany 63, 6467-6480.

Eberle, M., Rothrock, C. & Cartwright, R. (2007). Pythium species associated with rice stand

establishment problems in Arkansas. BR Wells Rice Research Studies, 57-63.

Feng, B. Z., Zhu, X. P., Fu, L., Lv, R. F., Storey, D., Tooley, P. & Zhang, X. G. (2014).

Characterization of necrosis-inducing NLP proteins in Phytophthora capsici. Bmc Plant

Biology 14.

Geraats, B. P. J., Bakker, P. & Van Loon, L. C. (2002). Ethylene insensitivity impairs resistance

to soilborne pathogens in tobacco and Arabidopsis thaliana. Molecular plant-microbe

interactions 15, 1078-1085.

Gheysen, G. & Mitchum, M. G. (2011). How nematodes manipulate plant development pathways

for infection. Current opinion in plant biology 14, 415-421.

Gijzen, M. & Nurnberger, T. (2006). Nep1-like proteins from plant pathogens: Recruitment and

diversification of the NPP1 domain across taxa. Phytochemistry 67, 1800-1807.

Han, B., Xue, Y., Li, J., Deng, X.-W. & Zhang, Q. (2007). Rice functional genomics research in

China. Philosophical Transactions of the Royal Society B: Biological Sciences 362, 1009-

1021.

Hollis Jr, J., Keoboonrueng, S. & Nickle, W. (1984). Nematode parasites of rice. Plant and insect

nematodes., 95-146.

Jiang, C. J., Shimono, M., Sugano, S., Kojima, M., Liu, X. Q., Inoue, H., Sakakibara, H. &

Takatsuji, H. (2013). Cytokinins Act Synergistically with Salicylic Acid to Activate

Defense Gene Expression in Rice. Molecular plant-microbe interactions 26, 287-296.

Johnson, A. W. & Littrell, R. H. (1970). Pathogenicity of Pythium aphanidermatum to

chrysanthemum in combined inoculations with Belonolaimus longicaudatus or

Meloidogyne incognita. Journal of Nematology 2, 255.

Kanneganti, T. D., Huitema, E., Cakir, C. & Kamoun, S. (2006). Synergistic interactions of the

plant cell death pathways induced by Phytophthora infestans Nep1-like protein PiNPP1.1

and INF1 elicitin. Molecular plant-microbe interactions 19, 854-863.

Karczmarek, A., Overmars, H., Helder, J. & Goverse, A. (2004). Feeding cell development by cyst

and root‐knot nematodes involves a similar early, local and transient activation of a

specific auxin‐inducible promoter element. Molecular plant pathology 5, 343-346.

Karssen, G., Moens, M. & Perry, R. N. (2006). Root-knot nematodes. Plant nematology. CABI,

pp. 59-90.

Karssen, G., Wesemael, W. & Moens, M. (2013). Root Knot Nematodes. Plant nematology. 2nd

Edition ed., CABI, pp. 73-105.

Kreye, C., Bouman, B. a. M., Reversat, G., Fernandez, L., Vera Cruz, C., Elazegui, F., Faronilo,

J. E. & Llorca, L. (2010a). Biotic and abiotic causes of yield failure in tropical aerobic rice

(vol 112, pg 97, 2009). Field Crops Research 117, 266-266.

Kreye, C., Das, K., Pinili, M. S., Banaay, C. G., Elazegui, F. A., Steelandt, A., De Bruyne, L., Van

Buyten, E., Hofte, M., De Waele, D., Fernandez, L. C., Llorca, L., Faronillo, J., Vera Cruz,

38

C. M., Kumar, A. & Bouman, B. (2010b). Identification of the biological causes of yield

instability and decline in non-saturated rice field. 4th ADB Annual Review. Los Baños,

Philippines IRRI.

Kyndt, T., Denil, S., Bauters, L., Van Criekinge, W. & De Meyer, T. (2014a). Systemic

Suppression of the Shoot Metabolism upon Rice Root Nematode Infection. Plos One 9.

Kyndt, T., Fernandez, D. & Gheysen, G. (2014b). Plant-Parasitic Nematode Infections in Rice:

Molecular and Cellular Insights. Annual Review of Phytopathology 52, 135-153.

Kyndt, T., Nahar, K., Haegeman, A., De Vleesschauwer, D., Hofte, M. & Gheysen, G. (2012).

Comparing systemic defence-related gene expression changes upon migratory and

sedentary nematode attack in rice. Plant Biology 14, 73-82.

Kyndt, T., Vieira, P., Gheysen, G. & De Almeida-Engler, J. (2013). Nematode feeding sites:

unique organs in plant roots. Planta 238, 807-818.

Levesque, C. A., Brouwer, H., Cano, L., Hamilton, J. P., Holt, C., ....... & Buell, C. R. (2010).

Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original

pathogenicity mechanisms and effector repertoire. Genome Biology 11.

Luc, M., Sikora, R. A. & Bridge, J. (2005). Plant parasitic nematodes in subtropical and tropical

agriculture. Cabi, pp.

Mojdehi, H., Singleton, L., Melouk, H. & Waller, G. (1990). Reproduction of symptoms of a root

disease of wheat by toxic metabolites produced by two Pythium species and their partial

characterization. Journal of phytopathology 128, 246-256.

Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2011). The jasmonate

pathway is a key player in systemically induced defense against root knot nematodes in

rice. Plant physiology 157, 305-316.

Nahar, K., Kyndt, T., Hause, B., Hofte, M. & Gheysen, G. (2013). Brassinosteroids Suppress Rice

Defense Against Root-Knot Nematodes Through Antagonism With the Jasmonate

Pathway. Molecular plant-microbe interactions 26, 106-115.

Nahar, K., Kyndt, T., Nzogela, Y. B. & Gheysen, G. (2012). Abscisic acid interacts

antagonistically with classical defense pathways in rice-migratory nematode interaction.

New Phytologist 196, 901-913.

Netscher, C. & Erlan (1993). A root-knot nematode, Meloidogyne graminicola, parasitic on rice

in Indonesia. Afro-Asian Journal of Nematology 3, 90-95.

Nicol, J. M., Turner, S. J., Coyne, D. L., Den Nijs, L., Hockland, S. & Maafi, Z. T. (2011). Current

nematode threats to world agriculture. Genomics and Molecular Genetics of Plant-

Nematode Interactions. Springer, pp. 21-43.

Oome, S. & Van Den Ackerveken, G. (2014). Comparative and Functional Analysis of the Widely

Occurring Family of Nep1-Like Proteins. Molecular plant-microbe interactions 27, 1081-

1094.

Ottmann, C., Luberacki, B., Kufner, I., Koch, W., Brunner, F., Weyand, M., Mattinen, L., Pirhonen,

M., Anderluh, G., Seitz, H. U., Nurnberger, T. & Oecking, C. (2009). A common toxin

fold mediates microbial attack and plant defense. Proceedings of the National Academy of

Sciences of the United States of America 106, 10359-10364.

39

Padgham, J. & Sikora, R. (2007). Biological control potential and modes of action of Bacillus

megaterium against Meloidogyne graminicola on rice. Crop Protection 26, 971-977.

Padgham, J. L., Duxbury, J. M., Mazid, A. M., Abawi, G. S. & Hossain, M. (2004). Yield loss

caused by Meloidogyne graminicola on lowland rainfed rice in Bangladesh. Journal of

Nematology 36, 42-48.

Pemberton, C. L. & Salmond, G. P. C. (2004). The Nep1-like proteins - a growing family of

microbial elicitors of plant necrosis. Molecular plant pathology 5, 353-359.

Perry, R. N., Moens, M. & Starr, J. L. (2009). Meloidogyne species–a diverse group of novel and

important plant parasites. Root-knot nematodes. Cabi, pp. 483.

Pfaffl, M. W., Horgan, G. W. & Dempfle, L. (2002). Relative expression software tool (REST (c))

for group-wise comparison and statistical analysis of relative expression results in real-

time PCR. Nucleic Acids Research 30.

Pokharel, R. R., Abawi, G. S., Zhang, N., Duxbury, J. M. & Smart, C. D. (2007). Characterization

of isolates of Meloidogyne from rice-wheat production fields in Nepal. Journal of

Nematology 39, 221.

Powell, N. T. (1971). Interactions between nematodes and fungi in disease complexes. Annual

Review of Phytopathology 9, 253-274.

Qin, X., Liu, J. H., Zhao, W. S., Chen, X. J., Guo, Z. J. & Peng, Y. L. (2013). Gibberellin 20-

Oxidase Gene OsGA20ox3 Regulates Plant Stature and Disease Development in Rice.

Molecular plant-microbe interactions 26, 227-239.

Qutob, D., Kamoun, S. & Gijzen, M. (2002). Expression of a Phytophthora sojae necrosis-

inducing protein occurs during transition from biotrophy to necrotrophy. Plant Journal 32,

361-373.

Reversat, G., Boyer, J., Sannier, C. & Pando-Bahuon, A. (1999). Use of a mixture Molecular

cloning and characterization of a novel jasmonate inducible of sand and water-absorbent

synthetic polymer as substrate for the xenic culturing of plant-parasitic nematodes in the

laboratory. Nematology 1, 209–212.

Rey, P., Leucart, S., Desilets, H., Belanger, R. R., Larue, J. P. & Tirilly, Y. (2001). Production of

indole-3-acetic acid and tryptophol by Pythium ultimum and Pythium group F: Possible

role in pathogenesis. European journal of plant pathology 107, 895-904.

Riemann, M., Haga, K., Shimizu, T., Okada, K., Ando, S., Mochizuki, S., Nishizawa, Y.,

Yamanouchi, U., Nick, P., Yano, M., Minami, E., Takano, M., Yamane, H. & Iino, M.

(2013). Identification of rice Allene Oxide Cyclase mutants and the function of jasmonate

for defence against Magnaporthe oryzae. Plant Journal 74, 226-238.

Roberts, P. A., Frate, C. A., Matthews, W. C. & Osterli, P. P. (1995). Interactions of virulent

Meloidogyne incognita and Fusarium-wilt on resistant cowpea genotypes. Phytopathology

85, 1288-1295.

Roy, A. K. (1973). Reaction of some rice cultivars to the attack of Meloidogyne graminicola.

Indian J. Nematology 3, 72-73.

40

Soriano, I. R., Prot, J.-C. & Matias, D. M. (2000). Expression of tolerance for Meloidogyne

graminicola in rice cultivars as affected by soil type and flooding. Journal of Nematology

32, 309.

Soriano, I. R. & Reversat, G. (2003). Management of Meloidogyne graminicola and yield of

upland rice in South-Luzon, Philippines. Nematology 5, 879-884.

Tamaoki, D., Seo, S., Yamada, S., Kano, A., Miyamoto, A. & Shishido, H. (2013). Jasmonic acid

and salicylic acid activate a common defense system in rice. Signal. Behav. 8.

Taniguchi, S., Hosokawa-Shinonaga, Y., Tamaoki, D., Yamada, S., Akimitsu, K. & Gomi, K.

(2014). Jasmonate induction of the monoterpene linalool confers resistance to rice bacterial

blight and its biosynthesis is regulated by JAZ protein in rice. Plant Cell and Environment

37, 451-461.

Toda, T., Iwasa, A., Shinichi, F. & Furuya, H. (2015). Widespread occurrence of Pythium

arrhenomanes pathogenic to rice seedlings around Japanese rice fields. Plant Disease

Accepted for publication. dx.doi.org/10.1094/PDIS-01-15-0124-RE.

Tyler, B. M., Tripathy, S., Zhang, X. M., Dehal, P., ....... & Zhang, H. (2006). Phytophthora

genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science

313, 1261-1266.

Uenoa, Y., Yoshidaa., R., Mitsuko Kishi-Kaboshia, Akane Matsushitaa, Chang-Jie Jianga, Shingo

Gotoa, Akira Takahashia, &, H. H. & Takatsuji, H. (2013). MAP kinases phosphorylate

rice WRKY45. Plant signaling & behavior 8, e24510-3.

Van Buyten, E. (2013). Pythium spp. affecting aerobic rice cultivation in the Philippines:

characterization, virulence strategies and plant defense. PhD, Ghent University.

Van Buyten, E., Banaay, C. G. B., Cruz, C. V. & Hofte, M. (2013). Identity and variability of

Pythium species associated with yield decline in aerobic rice cultivation in the Philippines.

Plant Pathology 62, 139-153.

Van Buyten, E. & Hofte, M. (2013). Pythium species from rice roots differ in virulence, host

colonization and nutritional profile. Bmc Plant Biology 13, :203.

Veit, S., Worle, J. M., Nurnberger, T., Koch, W. & Seitz, H. U. (2001). A novel protein elicitor

(PaNie) from Pythium aphanidermatum induces multiple defense responses in carrot,

Arabidopsis, and tobacco. Plant physiology 127, 832-841.

Verbeek, R., De Waele, D., Vera Cruz, C. M., Höfte, M. & Kyndt, T. (2015). Interactions between

sedentary nematode-Meloidogyne graminicola and Oomycetes-Pythium arrhenomanes in

rice. Unpublished manuscript.

Worle, J. M. & Seitz, H. U. (2003). PmoNIE a PaNIE (Pythium aphanidermatum necrosis inducing

elicitor) like elicitor sequence from Pythium monospermum. Plant Physiology

(Unpublished), Locus number: AAQ89593; ZMBP,University of Tuebingen,Germany.

Wurst, S. & Van Der Putten, W. H. (2007). Root herbivore identity matters in plant-mediated

interactions between root and shoot herbivores. Basic and Applied Ecology 8, 491-499.

41

Appendix

Figure 1. The pure culture of P. arrhenomanes, cork borer of size 4 used to make agar plugs of

pathogen to infect rice seedlings.

Figure 2. Developmental stages of M. graminicola at 12 days post infection (dpi) at different rice

cultivars (First trial). Bar represent as Mean ± Standard error of 6 replicates.

0

20

40

60

80

100

120

140

160

Mg Mg+Py Mg Mg+Py Mg Mg+Py Mg Mg+Py

1st Trial 1st Trial 1st Trial 1st Trial

Nipponbare Palawan-1 Apo IR

Sta

ges

/root

syst

em

J2 J3/J4 Female Eggmass