tapi-1 · 2020. 6. 23. · tapi-1 inhibits ectodomain shedding of tnf-ɑ, l-selectin, and p55...

3
1 | www.apexbt.com TAPI-1 Cat. No.: B4686 CAS No.: 171235-71-5 Formula: C26H37N5O5 M.Wt: 499.6 Synonyms: Target: Proteases Pathway: MMP Storage: Store at -20°C In Vitro ı24.98mg/mL in DMSO Preparing Stock Solutions Mass 1mg 5mg 10mg Solvent Concentration 1 mM 2.0016 mL 10.0080 mL 20.0160 mL 5 mM 0.4003 mL 2.0016 mL 4.0032 mL 10 mM 0.2002 mL 1.0008 mL 2.0016 mL Please refer to the solubility information to select the appropriate solvent. Shortsummary TACE/ADAM17 inhibitor IC₅₀ & Target In Vitro Cell Viability Assay Cell Line: human pulmonary mucoepidermoid carcinoma cell line, NCI -H292 cells Preparation method˖ The solubility of this compound in DMSO is > 10 mM. General tips for obtaining a higher concentration: Please warm the tube at 37 °C for 10 minutes and/or shake it in the ultrasonic bath for a while. Stock solution can be stored below -20°C for several months. Reacting conditions: 30 min, 30 μM [1] Applications: TAPI-1, tumor necrosis factor ɑ protease inhibitor-1, is an inhibitor of TACE Product Name: TAPI-1 Revision Date: 01/10/2020 Product Data Sheet Solvent & Solubility Biological Activity 1 | www.apexbt.com T API - 1 Cat. No.: B468 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 6 6 CAS No.: 17 17 7 7 17 7 7 7 17 17 17 17 1 17 17 7 17 1712 12 12 12 12 12 12 12 12 235 35 35 35 35 35 35 35 35 35 5 35 5 - - - - - - 71 7 7 7 7 7 7 7 7 7 7 7 - 5 Formula: C2 C C2 C2 C2 C2 C C C2 C2 C2 C2 C2 C C26H37N5O5 M.Wt: 499.6 Synonyms: T arget: Proteases Pathway: MMP Storage: Store at - 20°C In Vitro ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı 24.98mg/mL in DMSO Preparing Stock Solutions Mass 1mg 5mg 10mg Solvent Concentration 1 mM 2.0016 mL 10.0080 mL 20.0160 mL 5 mM 0.4003 mL 2.0016 mL 4.0032 mL 1 0 mM 0.2002 mL 1.00 0 0 0 0 0 0 0 0 008 08 08 08 08 08 08 8 08 08 08 08 0 m m m m m m m m m m mL L L L L L L L L L 2.0016 mL Plea a a a a a a a ase se s se se se se se se e e se e e e e r r r r r r r r r ref ef ef ef ef ef ef ef f e e e e ef e ef e er er er er er er er er er er t t t t t t t t t t to o o o o o o o o o o t t th t t t e solubility information to select the appropriate solvent nt nt t nt t t t nt t. Shortsummary TACE/ADAM17 inhibitor IC ₅₀ & Target In Vitro Cell Viability Assay Cell Line: e: e: e: e: e: e: e e e human pulmonary mucoepidermoid carcino no no no no o no no no n ma ma ma ma ma ma ma ma ma ma m m m c c c c c c c c c c ce el el e el el el el el e el el el el e el e e el e l l l l l l l l l l l l l l l li li li li li li li li li li li lin ne n n n n n n n , NCI - H292 cells Pr Pr Pr Pr r Pr Pr Pr Pr Pr P P ep ep ep ep ep ep e ep ep ep ep epar ar a ar ar ar ar ar ar a at at a at at t t t at at t t t at a at t t at ati i i i i io io io i i io io io io io io io o o o o ion n n n n n n n n n n n n method ˖ The solubility of this compound in D D D D D D DMS MS MS MS MS MS S MS MS MS MS MS MS M MS M O O O O O O O O O O O O O O O O O O O O is is is is is is is is is i i i > > > > > > > > > > > > 1 1 1 1 1 1 1 1 1 1 1 1 10 0 0 0 0 mM. General tips for obtaining a higher concentration: Please war ar ar ar r ar ar r r ar rm m m m m m m m m m m m m m m th th th th th th th th th th th th h he tube at 37 °C for 10 minutes and/or shake it in the ultrasonic bath for a while. Stock solution can be stored below - 20°C for several months. Reacting conditions: 30 min, 30 μM [1] Applications: TAPI - 1, tumor necrosis factor ɑ protease inhibitor - 1, is an inhibitor of TACE Product Name : TAPI - 1 Revision Date: 0 1 / 1 0 / 0 20 20 et Product Data Shee Solvent & Solu u u u u ub b b b b bi i i i i il l l l l l l l li i i it t t t t t t ty y y y y y y y y y Biologica a a al l l l l l A A A A A A Activity

Upload: others

Post on 26-Jan-2021

8 views

Category:

Documents


0 download

TRANSCRIPT

  • 1 | www.apexbt.com

    TAPI-1Cat. No.: B4686

    CAS No.: 171235-71-5

    Formula: C26H37N5O5

    M.Wt: 499.6

    Synonyms:

    Target: Proteases

    Pathway: MMP

    Storage: Store at -20°C

    In Vitro

    24.98mg/mL in DMSO

    Preparing

    Stock Solutions

    Mass

    1mg 5mg 10mgSolvent

    Concentration

    1 mM 2.0016 mL 10.0080 mL 20.0160 mL

    5 mM 0.4003 mL 2.0016 mL 4.0032 mL

    10 mM 0.2002 mL 1.0008 mL 2.0016 mL

    Please refer to the solubility information to select the appropriate solvent.

    Shortsummary TACE/ADAM17 inhibitor

    IC₅₀ & Target

    In Vitro

    Cell Viability Assay

    Cell Line: human pulmonary mucoepidermoid carcinoma cell line, NCI-H292 cells

    Preparation method The solubility of this compound in DMSO is > 10 mM. General tips for obtaining

    a higher concentration: Please warm the tube at 37 °C for 10 minutes and/or

    shake it in the ultrasonic bath for a while. Stock solution can be stored below

    -20°C for several months.

    Reacting conditions: 30 min, 30 μM [1]

    Applications: TAPI-1, tumor necrosis factor ɑ protease inhibitor-1, is an inhibitor of TACE

    Product Name: TAPI-1Revision Date: 01/10/2020

    Product Data Sheet

    Solvent & Solubility

    Biological Activity

    1 | www.apexbt.com

    TAPI-1Cat. No.: B46888888888866666666666

    CAS No.: 1717771777717171717117177171712121212121212121223535353533535353535355355------7177777777777 -5

    Formula: C2CC2C2C2C2CCC2C2C2C2C2CC26H37N5O5

    M.Wt: 499.6

    Synonyms:

    Target: Proteases

    Pathway: MMP

    Storage: Store at -20°C

    In Vitro

    24.98mg/mL in DMSO

    Preparing

    Stock Solutions

    Mass

    1mg 5mg 10mgSolvent

    Concentration

    1 mM 2.0016 mL 10.0080 mL 20.0160 mL

    5 mM 0.4003 mL 2.0016 mL 4.0032 mL

    10 mM 0.2002 mL 1.00000000000080808080808088080808080 mmmmmmmmmmmLLLLLLLLLL 2.0016 mL

    Pleaaaaaaaaasesesseseseseseseeeseeeeese rrrrrrrrrrefefefefefefefeffeeeeefeefe erererererererererer ttttttttttto oooooooooo ttthttt e solubility information to select the appropriate solventntnttnttttntt.

    Shortsummary TACE/ADAM17 inhibitor

    IC₅₀ & Target

    In Vitro

    Cell Viability Assay

    Cell Line:e:e:e:e:e:e:eee human pulmonary mucoepidermoid carcinononononoonononon mamamamamamamamamamammm ccccccccccceeleleeleleleleleeleleleleeleeele lllllllllllllll lilililililililililililinnennnnnnn , NCI-H292 cells

    PrPrPrPrrPrPrPrPrPrPP epepepepepepeepepepepepararaarararararara atataatattttatattttataatttatatiiiiiioioioiiioioioioioioioooooionnn n nnn nnnnnn method The solubility of this compound in DDDDDDDMSMSMSMSMSMSSMSMSMSMSMSMSMMSM OOOOOOOOOOOOOOOOOOOO isisisisisisisisisiii >>>>>>>>>>>> 111111111111100000 mM. General tips for obtaining

    a higher concentration: Please wararararrararrrarrmmmmmmmmmmmmmmm ththththththththththththhhe tube at 37 °C for 10 minutes and/or

    shake it in the ultrasonic bath for a while. Stock solution can be stored below

    -20°C for several months.

    Reacting conditions: 30 min, 30 μM [1]

    Applications: TAPI-1, tumor necrosis factor ɑ protease inhibitor-1, is an inhibitor of TACE

    Product Name: TAPI-1Revision Date: 01/10/ 02020

    etProduct Data Shee

    Solvent & Soluuuuuubbbbbbiiiiiillllllllliiiittttttttyyyyyyyyyy

    Biologicaaaallllll AAAAAAActivity

  • 2 | www.apexbt.com

    (TNF-α converting enzyme). TAPI-1 inhibits ectodomain shedding of TNF-ɑ,

    L-selectin, and p55 TNF-ɑ receptor. Pretreating cells with TAPI-1 inhibits

    PMA-induced EGFR phosphorylation. Besides, TAPI-1 could block TGF-ɑ

    release and block the production of mucin induced by PMA, PA sup, and LPS

    [1]. TAPI-1 is also a general matrix metalloproteinase (MMP) and ADAM

    inhibitor [2].

    In VivoAnimal experiment

    Applications:

    1. Zhou J, Sun J, et al. "MicroRNA-145 overexpression attenuates apoptosis and increases matrixsynthesis in nucleus pulposus

    cells." Life Sci. 2019 Mar 15;221:274-283.PMID:30797016

    2. Ellis-Connell AL, Balgeman AJ, et al. "ALT-803 transiently reduces SIV replication in the absence of antiretroviraltreatment." J Virol.

    2017 Nov 8. pii: JVI.01748-17.PMID:29118125

    See more customer validations on www.apexbt.com.

    [1]. Shao MX, Ueki IF, Nadel JA. Tumor necrosis factor alpha-converting enzyme mediates MUC5AC mucin expression in cultured

    human airway epithelial cells. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11618-23.

    [2]. Chen CD, Podvin S, Gillespie E, Leeman SE, Abraham CR. Insulin stimulates the cleavage and release of the extracellular

    domain of Klotho by ADAM10 and ADAM17. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19796-801.

    FOR RESEARCH PURPOSES ONLY.NOT FOR HUMAN, VETERINARY DIAGNOSTIC OR THERAPEUTIC USE.Specific storage and handling information for each product is indicated on the product datasheet. Most APExBIO products are stable

    under the recommended conditions. Products are sometimes shipped at a temperature that differs from the recommended storage

    temperature. Shortterm storage of many products are stable in the short-term at temperatures that differ from that required for

    long-term storage. We ensure that the product is shipped under conditions that will maintain the quality of the reagents. Upon receipt

    of the product, follow the storage recommendations on the product data sheet.

    APExBIO Technologywww.apexbt.com

    7505 Fannin street, Suite 410, Houston, TX 77054.

    Product Citations

    References

    Caution

    2 | www.apexbt.com

    (TNF-α converting enzyme). TAPI-1 inhibits ectodomain shedding of TNF-ɑ,

    L-selectin, and p55 TNF-ɑ receptor. Pretreating cells with TAPI-1 inhibits

    PMA-induced EGFR phosphorylation. Besides, TAPI-1 could block TGF-ɑ

    release and block the production of mucin induced by PMA, PA sup, and LPS

    [1]. TAPI-1 is also a general matrix metalloproteinase (MMP) and ADAM

    inhibitor [2].

    In VivoAnimimmimmmmmmmalalalalalalalaalaa exexexexexxxxexexexexxxxxxexppppepepppepepepepppepepepeeppepepeep riririririririririririment

    ApApApApApApApApApAAAAAAAAAAA plplplplplpplplplplicicicicicicicicciciccataatatatatatatatatataa iiioii ns:

    1. Zhou J, Sun J, et al. "MicroRNA-145 overexpression attenuates apoptosis and increases matrixsynthesis in nucleus pulposus

    cells." Life Sci. 2019 Mar 15;221:274-283.PMID:30797016

    2. Ellis-Connell AL, Balgeman AJ, et al. "ALT-803 transiently reduces SIV replication in the absence of antiretroviraltreatment." J Virol.

    2017 Nov 8. pii: JVI.01748-17.PMID:::::::292929292929929292929118125

    See more customer validaaaaaaaaaaaatititittittitititit ononononononononononononssssssssssss oooooonoooooooo www.apexbt.com.

    [1]. Shao MX, Ueki IF, Nadel JA. Tumor necrosis factor alpha-converting enzyme mediates MUC5AC mucin expression in cultured

    human airway epithelial cells. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11618-23.

    [2]. Chen CD, Podvin S, Gillespie E, Leeman SE, Abraham CR. Insulin stimulates the cleavage and release of the extracellular

    domain of Klotho by ADAM10 and ADAM17. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19796-801.

    FOR RESEARCH PURPOPOPOPOPOPOPOPOPOPOPOSESESESESESEESESESESESSSS S SSSSSS SSSSSS OOOOONONONONONOONONOONONONONNONLYLLL .NOT FOR HUMAAN,N,N,N,N,N,N,,, VVVVVVVVVVVVVETETETETETETETTETETETETERERERERERERERERERERRERRININININININININININININARAAA Y DIAGNOSTIC OR THERAPEUTTIC USE.Specific storage aaaaaaaaaaaaaandndndndndndndnddndnddndndnnd hhhhhhhhhhhhhhhhhhhaananananananananaananaanaaanaa dld ing information for each product is indicatted on the product datasasasasasaasshhehhhhhhh et. Most APExBEE IO ble products are stab

    under the recommended conditions. Products are sometimes shipped at a temperature that differs from the recommended storageed at a temperature that differs from the recommended storag

    temperature. Shortterm storage of many products are stable in the sshort-term at temperatures that differ from that required for

    long-term storage. We ensure that the product is shipped under conditions that will maintain the quality of the reagents. Upon receipt e

    of the product, follow the storage recommendations on the product ddata sheet.

    APExBIO Teechnologywww.apexbt.comxbt com

    7505 Fannin street, Suite 410, Houston, TX 77054.

    Product Citations

    Referrrrreeeeeeennnnnncccccccccccceeeees

    Caution

  • 3 | www.apexbt.com

    Tel: +1-832-696-8203 | Fax: +1-832-641-3177 | Email: [email protected]

    3 | www.apexbt.com

    Tel: +1-832-696-8203 | Fax: +1-832-641-3177 | Email: [email protected]