www.sciencemag.org/cgi/content/full/330/6003/499/DC1

Supporting Online Material for

Two Pairs of Neurons in the Central Brain Control Drosophila Innate Light Preference

Zhefeng Gong,* Jiangqu Liu, Chao Guo, Yanqiong Zhou, Yan Teng, Li Liu*

*To whom correspondence should be addressed. E-mail: zfgong@moon.ibp.ac.cn (Z.G.);

liuli@sun5.ibp.ac.cn (L.L.)

Published 22 October 2010, Science 330, 499 (2010)

DOI: 10.1126/science.1195993

This PDF file includes:

Materials and Methods Figs. S1 to S13 Table S1 References Description of Movies S1 to S3

Other Supporting Online Material for this manuscript includes the following: (available at www.sciencemag.org/cgi/content/full/330/6003/499/DC1)

Movies S1 to S3

1

Two pairs of neurons in central brain control Drosophila

innate light preference

Supporting online Material

Zhefeng Gong1*, Jiangqu Liu1,2, Chao Guo1,2,Yanqiong Zhou1,2, Yan Teng3 & Li Liu1*

1 State Key Laboratory of Brain and Cognitive Science, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, P. R. China

2 Graduate University of the Chinese Academy of Sciences, Beijing 100039, P. R. China

3 Protein Science Core Facility Center, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, P. R. China

* To whom correspondence should be addresses. E-mail: zfgong@moon.ibp.ac.cn or liuli@sun5.ibp.ac.cn

This document provides Supporting Online Material for the above report in Science as

following:

Materials and methods

Figs. S1 to S13

Table S1

Supporting references and notes

2

Materials and methods

Fly stocks

All flies were raised at 25 °C on standard medium and 12 hour : 12 hour light/dark cycles of

culture. Aside from the fly strain of yw, the following transgenic flies were used:

Chromosome 1: NP867-Gal4, UAS-Dscam-GFP;

Chromosome 2: UAS-TNTG, UAS-NaChBac, UAS-mCD8-GFP, UAS-syt-GFP,

LexAop-CD4::spGFP11, pdf-LexA, UAS-GCAMP3.0;

Chromosome 3: NP394-Gal4, NP423-Gal4, UAS-dORK∆C, UAS-CD4::spGFP1-10,

elav-Gal80;

Chromosomes 1 and 3: UAS-shits.

Construction of transgenic flies

The following PCR primers were used to amplify the corresponding sequences for the

construction of pdf-lexA (S1, S2) and pdf-DTI (S1, S3) transgenic flies (pdf promoter region,

DTI coding sequence and LexA::VP16 sequence respectively from the genomic DNA of yw,

UAS-DTI and Or83b-LexA::VP16).

pdffor: GCCCGCGGGGTGGTTTCTATGAAAGTGGGTG

pdfback: AAAAGCTTCTTGTCCAGGTTCCATCTTTCAG

LexAfor: CCAAGCTTATGAAAGCGTTAACGGCCAG

VPback: CGCCTAGGCTACCCACCGTACTCGTCAA

DTIfor: AAGCTTATGGATCCTGATGATGTTGTTGATTC

DTIback: TTAGAGCTTTAAATCTCTGTAGGTAGTTTG

SV40for: AGGCGGCCGCGATCTTTGTGAAGGAACCTTACTTC

SV40back: AGCTGCAGGATCCAGACATGATAAGATACATTGA

3

EcoRI and HindIII sites were added to PCR primers for the pdf promoter, and HindIII and AvrII

sites were added to the PCR primers for LexA::VP16(LV) and DTI. These PCR products were

cloned separately into the pGEMT vector (Promega, Inc) in the appropriate directions to give

pdf-T, LV-T and DTI-T plasmids. The HindIII/AvrII fragment of LV-T and DTI-T were then

cloned into the HindIII/SpeI site of pdf-T to give pdf-LV-T and pdf-DTI-T. The SacII/NotI

fragment of pdf-LV-T and pdf-DTI-T were subsequently cloned into the SacII/NotI site of

pTARG (a gift from R. Jiao), which contained the SV40 sequence cloned into the NotI/PstI site,

to generate pdf-LexA::VP16-pTARG and pdf-DTI-pTARG which were then used for germline

transformation.

Behavioral analysis

The 10 min phototaxis assay was performed at 24 ± 0.5 °C, following the protocol of Mazzoni

et al. (S4) with modifications. A cool white light source (Leike Inc.) was used to illuminate

from above at a light intensity of 550 lux (Figs. S12 and S13) in most of the phototaxis tests. In

a few cases, the light source was placed beneath the test plate and the cover that divided the

plate into light and dark halves was also placed under the test plate. Unless otherwise specified,

early to middle 3rd instar larvae of 72-96 hours after egg laying (AEL) were tested with a light

source placed above the test plate.

Heat-shock treatment of UAS-shits-expressing flies: 3rd instar feeding larvae were collected in a

covered petri dish containing a small volume of water, which was then transferred to a 36 °C

incubator for 2 hours. The larvae were subject to the 10 min phototaxis assay immediately after

the heat-shock treatment.

Heat-shock treatment of tub-Gal80ts flies: eggs were collected at 25 °C. They were kept at

25 °C until a 12-hour heat-shock treatment period in a 32 °C incubator at 1st, 2nd or 3rd instar

larval stages. Heat-shock periods: 34-46 hours AEL for 1st instar; 58-70 hours AEL for 2nd instar;

72-84 hours AEL for early 3rd instar; 96-108 hours AEL for late 3rd instar. Larvae were tested in

the 10 min phototaxis assay shortly after the heat-shock treatment.

4

Immunohistology

Dissection and immunostaining of larvae was performed as described elsewhere (S5). Rabbit

anti-PDH (1:2000) (S6), mouse anti-FasII (1D4, 1:100, DSHB), mouse anti-Synapsin (3C11,

1:100, DSHB), mouse anti-rCD2 (1:400, Biolegend Inc. Cat# 201305) primary antibodies, and

goat anti-rabbit alexa555 conjugated (1:100, Invitrogen Inc.) and goat anti-mouse alexa555

conjugated (1:100, Invitrogen Inc.) secondary antibodies were used.

Single neuron clones were induced by incubating 12-hour old eggs in 37 °C water bath for 15

min. The heat-shocked eggs were then maintained at 25 °C until being dissected at 3rd instar

stage.

Calcium Imaging

Early to middle 3rd instar larvae were dissected following the methods described (S7) except

that a 4 cm petri dish was used instead of a cover slip. In brief, a 3rd instar larva of desired

genotype was dissected to remove the posterior part of the body. Guts and fat bodies as well as

salivary glands were removed from the anterior part. The dissected anterior part of larval body

including the CNS was invertedly positioned in a hole drilled in the bottom of the petri dish to

expose the CNS upward. If the larval continued moving, the body wall muscles were then

crushed with forceps to minimize the movement. The samples were then mounted in 1.5%

agarose (Sigma-Aldrich Inc. type VII) in adult hemolymph like (AHL) solution (S8) at

temperature of about 40~50 oC. The mounted samples were then cooled at room temperature for

3 minutes before imaging.

During the imaging, the visual stimuli were delivered in the following way: after localizing the

neuronal signal under the fluorescent microscope and confirming the localization with the two

photon microscopy, the sample was allowed to rest in darkness for 2 minutes but with random

infrared laser scanning used to track the localization of the cell body. Briefly after the beginning

of time series recording with the two photon microscopy, a pulse of white light was introduced

to the sample from beneath for 3 seconds.

5

Imaging was performed with an Olympus FV-500 two-photon laser-scanning microscope with

60x water immersion lens. The laser source was a Mai-Tai Ti:sapphire laser (Spectra-Physics)

tuned to wavelength 910 nm. Images were acquired at ~0.428 second/frame at a resolution of

256 x 256 pixels.

Image analysis: For analysis of the images, the region of interest encompassing the

NP394-neuron cell bodies was used for measuring change of fluorescence in each fly. The

intensity of fluorescence was digitized with ImageJ (Rasband, W.S., ImageJ, U. S. National

Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/, 1997-2008). The

average fluorescence intensity of the 14 frames before the light stimulation was set as the basal

level (F). The absolute change in fluorescence △F was obtained by subtracting the basal

fluorescence from the fluorescence intensity in each frame. △F/F was then used to measure the

ratio of fluorescence change. Pseudocolor image was generated with Matlab (the Mathworks)

by setting the basal fluorescence level in the region of interest as zero.

Statistics

Light avoidance performance index (PI) in the 10 min phototaxis test was calculated as:

PI = (number of larvae in the dark half - number of larvae in the light half) / (number of larvae

in the dark half + number of larvae in the light half).

PIs are shown as mean ± SEM. Student’s t-tests were used to assess the significance of

differences between PI scores and zero, and differences between PI scores.

6

Supporting figures

Figure S1. Larvae with TeTxLC expressed in NP394-Gal4 labeled neurons showed preference for light from early to late 3rd instar. Data are presented as mean ± SEM. ** p < 0.01; *** p < 0.001. n = 16 for all groups.

Figure S2. Temporary expression of TeTxLC in NP394-Gal4 labeled neurons at different larval stages facilitates larval preference for light. The NP394-Gal4-driven TeTxLC expression repressed by temperature sensitive tub-Gal80ts at permissive temperature was enabled by heat-shock at restrictive temperature of 32 oC. The larvae were heat-shocked for 12 hours immediately before photoatxis test at different larval stages. Larvae were subjected to 12 hours of heat-shock at 1st instar (34-46 hours AEL), 2nd instar (58-70 hours AEL), early 3rd instar (72-84 hours AEL) and late 3rd instar (96-108 hours AEL). Data are presented as mean ± SEM. * p < 0.05; *** p<0.001. n = 16 for all groups.

7

Figure S3. Performance index of yw larvae at different developmental stages in the phototaxis assay. Light was delivered to larvae from above or below the test plate at intensity of 550 lux. Larvae in “light from above” assay generally demonstrated higher levels of light avoidance performance than those in “light from below” assay. Specifically at late 3rd instar (96 hours AEL and older), larvae showed neutral phototaxis in “light from below” assay. However, they exhibited significant light avoidance when light was from above. Data are presented as mean ± SEM. *** p < 0.001. n = 16 for all groups.

Figure S4. Hyperactivation of NP394-neurons prompted the late 3rd instar larvae to avoid light. NP394-Gal4 larvae with over-expression of NaChBac demonstrated higher levels of light avoidance than the controls in both the “light from above” and “light from below” assay. Data are presented as mean ± SEM. * p < 0.05; *** p < 0.001. n = 16 for all groups.

8

Figure S5. Expression pattern of NP394-Gal4, NP423-Gal4 and NP867-Gal4 in larval brains stained with anti-Synapsin. (A) NP394-Gal4, (B) NP423-Gal4, (C) NP867-Gal4. Gal4 expression visualized with mCD8-GFP is in green and anti-Synapsin is in magenta. Scale bars, 20 µm.

Figure S6. NP394-neurons are marked by NP394-Gal4 throughout the whole larval stages. (A) Cell bodies are labeled in 1st instar larva (36-48 hours AEL). (B-D) from 2nd instar larva (48-60 hours AEL, B) to early 3rd instar larva (72-84 hours AEL, C), the gross morphology of NP394-neurons did not change substantially. In late 3rd instar larva (108-120 hours AEL, D), the size of the neurons increases greatly while the gross morphology remained unchanged. Scare bars, 20 µm.

9

Figure S7. Single neuron morphology of NP394-neurons labeled with NP423-Gal4. Single neuron (green) in larval brains were stained with anti-rCD2 which labels the GFP negative NP394-neuron (A-C), or anti-Pdf (D-F), or anti-Synapsin (G-I). Anti-rCD2, anti-Pdf and anti-Synapsin are in magenta. Scale bars, 20 µm.

Figure S8. NP394-neurons are close to pdf neurons in all three Gal4 lines of NP394-Gal4, NP423-Gal4 or NP867-Gal4. The larval brains were labeled with anti-Pdf (magenta) and mCD8-GFP (green) in lines of NP394-Gal4 (A), NP423-Gal4 (B) or NP867-Gal4 (C). Arrows indicate overlapping regions between NP394-neurons and pdf neurons. Scale bars, 20 µm.

10

Figure S9. The main arborization regions of NP394-neurons might be postsynaptic sites. Compared with arborization regions labeled with mCD8-GFP (A-B), Syt-GFP labeling (C-D) in the corresponding regions of NP394-neurons was greatly reduced, whereas these regions were strongly labeled by Dscam-GFP (E-F). NP394-neurons (green) were labeled with NP423-Gal4. pdf neurons (magenta) were labeled with anti-Pdf. In (B, D and F), only the Gal4 expression signal is shown. The arrows indicate the arborization areas. Scale bars, 20 µm.

11

Figure S10. Only Gal4 or Pdf-lexA was unable to produce GRASP signal. The three Gal4 lines of NP394-Gal4 (A-B), NP423-Gal4 (C-D) or NP867-Gal4 (E-F) and pdf-lexA (G-H) were used to drive co-expression of UAS-CD4::GFP1-10 and lexAop-CD4::GFP11. No clear GFP signal was found in any case. The left column shows the merge of GFP (green) and anti-Pdf (magenta), while the right column shows GFP only. Scale bars, 20 µm.

12

Figure S11. The gross morphology of NP394-neurons was not significantly affected in the absence of pdf neurons. Arborization patterns of NP394-neurons in control (A-C) and pdf-DTI/+ larva (D-F) were almost indistinguishable. NP394-neurons (green) were labeled with NP394-Gal4 and mCD8-GFP. pdf neurons (magenta) in the brain hemispheres were missing in pdf-DTI larva. The left column shows the middle and right columns merged together, which showed the NP394-neurons (green) and pdf neurons (magenta) respectively. Scale bars, 20 µm.

13

Figure S12. Measurement of the spectrum of the cool white light source used in all behavioral experiments with an Ocean Optics USB2000+ light meter. The main peaks are at approximately 435 nm, 545 nm and 615 nm.

Figure S13. Performance index of yw 3rd instar larvae at different light intensities in the phototaxis assay. The light intensity of 550 lux that produced medium level of larval light avoidance performance was used for all the behavioral experiments. Data are presented as mean ± SEM. n = 16 for all groups.

14

Supporting table

Table S1. Expression of the Gal4 lines in 3rd instar larval tissues other than the CNS.

NP394-Gal4 NP423-Gal4 NP867-Gal4

Salivary Glands Yes Yes Yes

Guts Yes Yes No

Mouth / Pharynx Yes No Yes

Peripheral Nervous System No No No

Bolwig’s Organs / Bolwig’s Nerves No No No

15

Supporting references and notes

S1. S. C. P. Renn, J. H. Park, M. Rosbash, J. C. Hall, P. H. Taghert, A pdf neuropeptide gene mutation and ablation of PDF neurons each cause severe abnormalities of behavioral circadian rhythms in Drosophila. Cell 99, 791-802 (1999)

S2. S. L. Lai, T. Lee, Genetic mosaic with dual binary transcriptional systems in Drosophila. Nat. Neurosci. 9, 703-709 (2006)

S3. H. J. Bellen, D. D’Evelyn, M. Harvey, S. J. Elledge, Isolation of temperature-sensitive diphtheria toxins in yeast and their effects on Drosophila cells. Development 114, 787-796 (1992)

S4. E. O. Mazzoni, C. Desplan, B. Justin, Circadian pacemaker neurons transmit and modulate visual information to control a rapid behavioral response. Neuron 45, 293-300 (2005)

S5. S. Malpel, A. Klarsfeld, F. Rouyer, Larval optic nerve and adult extra-retinal photoreceptors sequentially associate with clock neurons during Drosophila brain development. Development 129, 1443-1453 (2002)

S6. H. Dircksen et al., The ultrastructure of nerve endings containing pigment-dispersing hormone (PDH) in crustacean sinus glands: identification by an antiserum against a synthetic PDH. Cell Tissue Res. 250, 377-387 (1987)

S7. K. Asahina, M. Louis, S. Piccinotti, L. B.Vosshall, A circuit supporting concentration-invariant odor perception in Drosophila. J Biol. 8, 9 (2009)

S8. J. W. Wang, A. M. Wong, J. Flores, L. B. Vosshall, R. Axel, Two-photon calcium imaging reveals an odor-evoked map of activity in the fly brain. Cell 112, 271-82 (2003)

Movie S1

NP394-neuron response to light stimulation in control larva

Real time movie shows GCAMP3.0 signal in a NP394-neuron cell body of a

UAS-GCAMP3.0/+;NP423-Gal4/NP423-Gal4 3rd instar larva upon a 3-second 550lux light

stimulation. The movie-playing speed is 0.856 second per frame, twice the speed of

imaging acquisition. The “full screen green” was caused by light stimulation. Frame size is

79.05 µm × 79.05 µm. (.avi format)

Movie S2

NP394-neuron response to light stimulation in larva without pdf neurons

Real time movie shows GCAMP3.0 signal in two NP394-neuron cell bodies of a

UAS-GCAMP3.0/pdf-DTI;NP423-Gal4/NP423-Gal4 3rd instar larva upon a 3-second

550lux light stimulation. The movie-playing speed is 0.856 second per frame, twice the

speed of imaging acquisition. The “full screen green” was caused by light stimulation.

Frame size is 79.05 µm × 79.05 µm. (.avi format)

Movie S3

NP394-neuron calcium imaging in control larva without light stimulation

Real time movie shows GCAMP3.0 signal in two NP394-neuron cell bodies of a

UAS-GCAMP3.0/+;NP423-Gal4/NP423-Gal4 3rd instar larva in absence of light

stimulation. The movie-playing speed is 0.856 second per frame, twice the speed of

imaging acquisition. No obvious response is observed. Frame size is 79.05 µm × 79.05 µm.

(.avi format)

1