supplementary information - nature · procedure by damha and co-workers.s3 typically, 10 l of...

© 2010 Macmillan Publishers Limited. All rights reserved.

nature chemistry | www.nature.com/naturechemistry 1

Supplementary informationdoi: 10.1038/nchem.575

S1

Loading and Selective Release of Cargo in DNA Nanotubes

with Longitudinal Variation

Pik Kwan Lo, Pierre Karam, Faisal A. Aldaye, Christopher K. McLaughlin, Graham D. Hamblin, Gonzalo Cosa & Hanadi F. Sleiman*

Department of Chemistry, McGill University, 801 Sherbrooke Street West, Montreal,

QC H3A 2K6, Canada. E-mail: [email protected]




S2

Contents

I. General S3

II. Instrumentation S3

III. Synthesis of template 8 and 11 S4

IV. Construction of triangular rung 1 and 2 S8

V. Assembly and characterizations of large-small triangular-shaped

DNA nanotubes 3 S10

VI. Assembly and characterizations of large-small DNA nanotubes 4 with encapsulated gold

nanoparticles S22

VII. Assembly and characterizations of nanotubes 5 and 6 for selective release of gold

nanoparticles in response to specific external DNA strands S31

VIII. Characterization of partially single-stranded DNA nanotubes S33

IX. Assembly and UV-vis spectroscopic studies of nanotubes 14 S34

X. Assembly and UV-vis spectroscopic studies of nanotubes 13a S37

XI. Supplementary videos of nanotubes 3 and 6 - description S39

XII. References S39




S3

I. General

Acetic acid, boric acid, cyanogen bromide (5M in acetonitrile), formamide, 4-

morpholineethanesulfonic acid (MES), MgCl2·6H2O, StainsAll®, and

tris(hydroxymethyl)aminomethane (Tris) were used as purchased from Aldrich. 5-

Ethylthiotetrazole, 2000Å phosphate-CPG with a loading density of 5.4 mol/g, and

reagents used for automated DNA synthesis were purchased from ChemGenes.

Exonuclease VII (ExoVII; source: recombinant), and sephadex G-25 (super fine DNA

grade) were used as purchased from Amersham Biosciences. Microcon® size-exclusion

centrifugal filter devices (YM10) are purchased from Millipore. RubyRed mica sheets

for AFM are purchased from Electron Microscopy Sciences. Etched silicon cantilevers

(OMCL-AC160TS) for AFM imaging were used as purchased from Olympus. 300 mesh

copper coated carbon grids for transmission electron microscopy imaging were purchased

from Electron Microscopy Sciences. Gold nanoparticles coated with citrate were

purchased from Ted. Pella. Inc.

II. Instrumentation

Standard automated oligonucleotide solid-phase syntheses were performed on a

Perspective Biosystems Expedite 8900 DNA synthesizer. UV/vis quantifications were

conducted on a Varian Cary 300 biospectrophotometer. Gel electrophoresis experiments

were carried out on an acrylamide 20 X 20 cm vertical Hoefer 600 electrophoresis unit.

Electroelutions were performed using a Centrilutor® electroeluter from Millipore.

Temperature controlled hybridizations were conducted using a Flexigene Techne 60 well

thermocycler. AFM images were either acquired on a Digital Instruments “Dimension

3100” or on an E-scope microscope (Santa Barbara, CA). Transmission electron

microscopy (TEM) images were obtained using a FEI Tecnai 12 120 kV electron

microscope.




S4

III. Synthesis of template 8 and 11

The construction of templates 8 is carried out according to a previously reported method

by Sleiman and co-workers. S1 The construction of template 11 involves the initial

synthesis of the two linear analogues 10a and 10b, followed by their subsequent

templated hybridization and chemical ligation (Scheme S1). The linear analogues of 10a

and 10b are synthesized on a 2000Å phosphate-CPG with a loading density of 15 mol/g

using standard oligonucleotide synthetic protocols. The coupling of vertex 13 is

conducted using a trityl protected amidite derivative, with extended coupling and

deprotection times of 15 and 2 minutes. A trityl protected amidite derivative is prepared

according to a previously reported method by Sleiman and co-workers.S2 In this case, for

example, 61 and 62 bases of the appropriate sequence are synthesized and are embedded

with two units of vertex 1 at positions 10 and 51 in 10a as well as one unit of vertex 13 at

positions 31 in 10b. A 5 phosphate group is then synthetically incorporated to facilitate

subsequent chemical ligation.

Scheme S1 Templates 8 and 11

(top) DNA of the appropriate length, sequence, and number of 13 molecules is (i) synthesized on phosphate-CPG to generate two linear analogues of 10a and 10b, (ii) which is then hybridized using a complementary DNA template, and (iii) chemically ligated to yield the single-stranded DNA template 11.




S5

The blue, green and orange strands denote different sequences. (bottom) Single-stranded and cyclic small DNA templates triangle 8 and linear template 11, embedded with vertex 13. The DNA strands are cleaved and deprotected from the solid-support in a concentrated

solution of ammonium hydroxide (55 °C, 12 hrs), purified using 24% 7 M urea

polyacrylamide gel electrophoresis, extracted into 3 mL of water (16 hrs, 37 °C), and

desalted using Sephadex G-25 column chromatography. Quantification is carried by

UV/vis analysis using Beer’s law (Atotal = Avertex + ADNA), in which the extinction

coefficient of the vertex at 260 nm is calculated to be 2.30 X 105 L mol-1 cm-1. Table S1

summarizes the sequences of the linear 10a and 10b, and of the template strand used to

link them.

Table S1 Sequence of 10a, 10b and template strands.

Sequences (5 '- 3') 10a CAGTAATCTT-13-CTTGAAGGTAGGAAACGACATCT

TTGCCGCCGATTTGTGTT-13-TATTGGTCAT-phosphoate

10b TAGGTTGAAAGGTTTGCTGGGAGGACTGATT-13-

GAAGCCTTTCGCGTGACTTCTATTGGTATCT-phosphate Template TTTCAACCTAATGACCAATA

The clean isolation of the linear analogues of 10a, 10b and the template strand is

demonstrated using 24% polyacrylamide gel electrophoresis (Fig. S1). The gel is

visualized following staining in a solution of StainsAll® for two hours (12.5 mg

StainsAll® in 125 mL of distilled water and 125 mL of formamide).




S6

Figure S1 Template strand, and the linear analogues of 10a and 10b. Denaturing PAGE analysis of the linear analogues of 10a (lane 2) and 10b (lanes 3), and of the template strand used to link them (lane 1).

The templated hybridization of the two linear 10a and 10b is monitored using 10%

native PAGE, and is found to occur quantitatively for the hybridization product.

Generally, 1.1 X 10-10 moles of each of the linear strands, and 1.1 X 10-10 moles of the

template strand are mixed in 10 L of TAMg buffer (40 mM Tris, 20 mM acetic acid,

12.5 mM MgCl2·6H2O; pH 7.8), and are left incubating at 0 °C for 10 minutes. As seen

in Fig. S2, the templated hybridization of the linear analogue of 10a and 10b (lane 2 and

3), occurs quantitatively (lane 4).




S7

Figure S2 Assembly of template 11. Native PAGE analysis reveals the clean templated hybridization product (lane 4) of linear strands 10a and 10b (lane 2 and lane 3) and the complementary template strand (lane 1).

Ligations using cyanogen bromide are conducted according to a previously reported

procedure by Damha and co-workers.S3 Typically, 10 L of cyanogen bromide (5 M in

acetonitrile) is added to the pre-cyclized template in 30 L of the ligation buffer MES

(250 mM MES, 20 mM MgCl2, pH 7.6), and is left incubating at 0°C for 15 minutes.

The resulting mixture is then recovered using Microcon® size-exclusion centrifugal filter

devices (YM10), and analyzed using denaturing PAGE. As seen in Fig. S3, the linear 11

results in a single other band of relatively slower mobility.




S8

Figure S3 Chemical ligation of 11. Denaturing PAGE analysis reveals the generation of chemically ligated product 11 as a single band of relatively retarded electrophoretic mobility when the assemblies of 10a and 10b (lane 1 and 2) are chemically ligated using cyanogen bromide (lane 3). IV. Construction of triangular rung 1 and 2

The construction of the triangular rung 1 and 2 is conducted using a number of

complementary strands CS and rigidifying strands RS (Scheme S2). 2, for example, is

constructed from one unit of the template 11, three complementary strands containing

sticky-end overhang cohesions CS1’-CS3’, and from three rigidifying strands that serve

to orient each of these sticky-ends into one of two lateral directions RS1-RS3.

Scheme S2 Construction of 1 and 2.




S9

Assemblies are typically conducted by combining all DNA strands in the correct molar

ratios ~ 3.8 M (concentration of DNA strands is 3.8 M, in 1.15 x 10-10 mole in volume 30 L

with 2uL TAMg buffer), and by incubating at 70 °C for 5 minutes followed by slowly

cooling to 5 °C over a period of 12 hours. Table S2 summarizes the sequences of the

strands used to construct 1 and 2 from 8 and 11, respectively. This process is monitored

sequentially and is found to occur quantitatively at each step leading to, and including,

the construction of the triangular-shaped rung 2 (Fig. S4).

Table S2 Sequences of CS and RS.

Sequence (5' - 3') CS1 GCTCGTATAGGATTAGGTTTGCTGCAAACCA

ATATGTCGTTTCCATAGTATTGCATGACGCTGG CS2 CACTCTAAAAGGAACTCTTGTACCTTCAAGA

GATTACTGACCAGATCGAATGTAAGTTGA CS3 GGTTGATCTCGAAAGGCTGGCCGATTTGTGTTA

TTGGTCATTAGGTTGAAGTGATGTGATAAGG CS1' ATGTGTACTAAGCCAGGTTTGCTGAATCAGTCCTCCCAGCAAA

CCTTTCAACCTAATGACCAATAATAGTATTGCATGTGTGAAG CS2' CTCAGACCCAGGAACTCTTGAACACAAATCGGCGGCAAA

GATGTCGTTTCCTACCTTCAAGCCAGATCGAAATTCCACGAC CS3' ATGACCTGTAGAAAGGCTGGAAGATTACTGAGATACCAATAG

AAGTCACGCGAAAGGCTTCTTAGGTTGAAATTTGCTCTCAGTT RS1 TTCAACCTAA TT CAGCAAACCT RS2 GCAATACTAT TT CAAGAGTTCC RS3 TTCGATCTGG TT CCAGCCTTTC




S10

Figure S4 Construction of 1 and 2. (a) The single- stranded and cyclic template 8 (lane 1) is sequentially titrated with the complementary strands CS1-CS3 (lanes 2-4, respectively), and with the RS1-RS3 strands to quantitatively generate a fully assembled triangular rung 1 (lane 5) (b) The strand 11 (lane 1) is sequentially titrated with the complemetary strands CS1’-CS3’ (lane 2-4, respectively), and with the RS1-RS3 strands to quantitatively generate a fully triangular rung 2.

V. Assembly of large-small triangular shaped DNA nanotubes 3.

Assemblies are typically conducted in 2 L of TAMg buffer, and involve addition of the

double-stranded linking strands to the already assembled rungs 1 or 2 at 50 °C, for 10

minutes, followed by slow cooling to 5 °C over a period of 10 hours. The linking strands

are mixed with their respective rungs, in the correct molar ratio, to generate an assembly

with a final concentration of DNA strands 4.4 M in base-pairs. Table S3 summarizes the

sequences used to assemble 3. For DNA, concentration = concentration in base-pairs and

number of moles = number of moles of base-pairs.




S11

Start with: Concentration ( M) Volume ( L) no. of nmole

DNA rungs 3.8 30 0.115 Linker duplexes 25 6 0.15

Gold nanoparticles 0 0 0 Mg-containing Buffer 12500 2 25

H2O 0 22 0 Final numbers after mixing:

Concentration ( M) DNA rungs 1.9

Linker duplexes 2.5 Gold nanoparticles 0

Mg-containing Buffer 0.4 mM

Table S3 Sequence of LS and dsLS.

Sequence (5' - 3') LS1 AATCCTATACGAGCACATCACCTTGGAACTGAGAGCAAAT LS2 TTTTAGAGTGTCACCTTGGTTGGCTGCTCACTTCACACAT LS3 GAGATCAACCTCACCTTGGTTGGCTGCTCAGTCGTGGAAT

dsLS1 CCAAGGTGATGT dsLS23 TGAGCAGCCAACCAAGGTGA

LS1' GGCTTAGTACACATCATACTCGTCTACACATGATTCGG LS2' TGGGTCTGAGCATACTCGTCGGTTCCAATACTGGACAT LS3' TACAGGTCATCATACTCGTCGGTTCCAAGAGTCTGGGT

dsLS1' GACGAGTATG dsLS23' TTGGAACCGACGAGTATG

LS1'' CACTACACTATTCCACATCACCTTGGTTGGCTGCTCATCCTTATC

ACATCAC

LS2'' TACTGCGACGAACATCACCTTGGTTGGCTGCTCATACGGTTATCA

ACTTACA

LS3'' ACATTCAACTAACATCACCTTGGTTGGCTGCTCATACGGTTAGCA

GCGTCAT dsLS1'' ATGAGCAGCCAACCAAGGTGATGT dsLS23'' TAACCGTATGAGCAGCCAACCAAGGTGATGTT

* Underline sequences are reversed phase synthesis




S12

(i) AFM characterization of large-small DNA nanotubes 3

AFM sample preparation typically involves the deposition of 5 L of the self-

assembled mixture onto freshly cleaved mica (dimensions 2 X 2 cm), followed by

evaporation to achieve complete dryness (typically 30 mins in a fumehood). Whenever

possible, imaging is conducted within 24 hours to minimize time-dependant sample

degradation. AFM images are acquired in air, and at room temperature. “Tapping mode”

(i.e. intermittent contact imaging) is performed at a scan rate of 1 Hz using etched silicon

cantilevers with a resonance frequency of ~ 70 kHz, a spring constant of ~ 2 N/m, and a

tip radius of < 10 nm. All images are acquired with medium tip oscillation damping (20-

30%).

AFM analysis reveals the clean formation of the large-small triangular-shaped DNA

nanotubes in high yields (Fig. S5) It is of interest to note that sample preparation of the

DNA nanotubes for imaging using AFM resulted in nanotube assemblies that are always

somewhat embedded on the mica surface. Cross-sectional analysis of each raised feature

is conducted on the height images, and we found that the distance between each features

is measured to be ~ 71.5 nm. Given that bundling would most likely result in a number of

architectures of varying heights, this observed phenomenon is also believed to be a

consequence of aggregation of pre-formed DNA nanotubes during sample drying. In

addition to aggregated nanotubes, our AFM images clearly show some individual,

unassociated nanotubes (Supporting information, Figure S5e and f). This implies that the

individual nanotubes are stable and well-defined on their own, but that they associate

under the drying conditions of the experiment. This phenomenon is not expected to

occur in solution and for most applications of these materials. Indeed, confocal

fluorescence and TIRF images (see Figure 3d in the manuscript and the video in the

supporting materials) shows them to be unaggregated and unbundled.

Although it is difficult to obtain an accurate value for the diameter of either large or

small parts of nanotubes using height images in which the DNA assemblies are somewhat




S13

embedded, the relative ratio of the observed dimensions can be used to better ascertain

the formation of large-small triangular-shaped DNA nanotube assemblies of the expected

size. The theoretically calculated width of large part is ~14 nm, while that of small part

is ~ 6.8 nm. Therefore, the relative width ratio of large to small portion is theoretically

expected to be 2.05. The experimentally obtained cross-sectional height analysis of the

large part and small part using the height images is consistently found to be 2.8 nm and

1.4 nm for all nanotubes measured, which translates into a height ratio of large to small

parts of 2.0 (Figure S6). This value is in good agreement with the theoretically calculated

value of 2.05, and can be used to indirectly confirm the formation of large-small

triangular DNA nanotubes of the expected size.




S14

Figure S5 AFM characterization of 3. Phase images of AFM analysis of (a) 3, (b) regular size nanotubes and (c-f) height images of AFM analysis of 3 reveals the formation of extended one-dimensional DNA nanotube assemblies. Bar is1 m.




S15




S16




S17

Figure S6 (a) Height and (b) width analysis of 3. Cross-sectional analysis of large and small parts reveals a consistent height of 2.8 nm and 1.4 nm for each respective DNA nanotube. The relative height ratio between large and small parts is thus 2.

(ii) TEM characterization of large-small DNA nanotubes 3

Samples were adsorbed on freshly cleaved mica. These were air-dried overnight and,

rotary shadowed with Pt/C at an elevation of about 20° and stabilized with a thin layer of

carbon (15 nm). Replicas from the mica were floated onto the surface of distilled water,

collected on 300 mesh copper grids, and analysed in a FEI Tecnai 12 operated at an

acceleration voltage of 120kV.




S18




S19

Figure S7 TEM characterization of 3. (a) TEM analysis of 3 reveals the nanotubes with large-small feature longitudinally with reasonable separated distance ~ 65 m, of every loop. The relative width ratio of large part and small part is ~ 1.97 on average. This value is in good agreement with the theoretically calculated value of 2.05. (b) TEM analysis of regular size DNA nanotubes (Bar is 100 nm).




S20

(iii) (a) Confocal fluorescence microscopy imaging of 3 Cover-slip and chamber preparation: Coverslips were soaked in piranha solution (25%

H2O2 and 75% concentrated H2SO4) and sonicated for 1 h, followed by multiple water

(molecular biology grade), and acetone (high-performance liquid chromatography (HPLC)

grade) rinsing cycles. Dry and clean coverslips were then treated with vectabond/acetone

1% v/v solution (Vector Laboratories, Burlingame, CA) for 5 min and then rinsed with

H2O and left in dried state until used. To prevent any nonspecific binding, glass

coverslips were functionalized with poly(ethylene glycol) (PEG). The glass coverslips

were incubated with a 25% w/w methoxy-poly(ethylene glycol)-succinimidyl valerate

(PEG-SVA) solution (MW 5000, Laysan Bio Inc., Arab, AL) in a 0.1 M sodium

bicarbonate solution (HyClone, Logan, UT) for 3 h. The silicone template was removed,

excess PEG was rinsed with water, and the coverslips were dried under a N2 stream.

A 3 l solution 4.4 M in DNA (in base-pairs) and 65 M in DNA-intercalator

dye PicoGreen (ensuring a dye/DNA base pair ratio in the range of 1 to 1.5) containing a

40 mM Tris, 20 mM acetic acid, 2 mM EDTA and 12.5 mM MgCl2 (pH=7.8 buffer) were

deposited onto a PEG functionalized slide and covered by a second one. The DNA

solution was drawn under the capillary forces created by the two slides.

Experimental setup: The imaging setup has been described previously.S4 The

samples were imaged using a stage-scanning confocal microscope setup. It consisted of a

closed-loop sample scanning stage model Nano LP100, Mad City Labs, (Madison, WI).

Continuous circularly polarized wave excitation at 488 nm (0.407 W/ m2) from an Ar+

laser model 35 LAL 030 (from Melles Griot) was introduced via an optical fiber and

directed by a dichroic beamsplitter (z488rdc DCLP, Chroma, Rockingham, VT) to the

sample via a high numerical aperture (N.A.) = 1.40 oil immersion microscope objective

(Olympus U PLAN SAPO 100X). Fluorescence emission from the sample was collected

by the objective and directed, through an HQ535/50 emission filter, to an avalanche

photodiode detector (Perkin Elmer Optoelectronics SPCM AQR-14, Vaudreuil, Quebec,

Canada). Images of the DNA nanotubes on the PEG functionalized surface were

acquired by collecting the intensity for 1 ms at each pixel for images of 256 x 256 pixels.

A home built LabView (National Instruments, Austin, TX) routine was used for the data




S21

acquisition and the stage positioning. A National Instruments NI-PCI- 6602 board was

used as a counter board.

Figure S8 Control fluorescence intensity image obtained for picogreen (no DNA) upon 488

nm excitation. A total of 3 L of a solution containing 65 M of the DNA intercalator dye

picogreen (Invitrogen) in 40 mM Tris, 20 mM acetic acid, 2 mM EDTA and 12.5 mM

MgCl2 (pH=7.8 buffer) were deposited onto the PEG functionalized slide and covered by

a second one. The picogreen solution (with no DNA) was drawn under the capillary

forces created by the two slides. The right bar illustrates the counts per millisecond per

pixel.

Figure S9 Observed length distribution for DNA nanotubes. Picogreen stained DNA

nanotubes were imaged upon 488 nm excitation. Images like those of Figure 3f were

acquired where from nanotube lengths were determined.




S22

(iii) (b) Total internal reflection fluorescence microscope (TIRF) imaging of 3

DNA nanotubes were imaged using a wide-field TIRF microscope equipped with a

Cascade 512B EMCCD camera. TIRF images corresponded to a sample area of 85 m x

85 m. Nanotubes labeled with picogreen were injected into a chamber preconditioned

with PEG to minimize interactions between the surface and the DNA.

Samples were excited with the 20 mW, 488 nm output of a cw Ar+ laser from

SpectraPhysics. An Olympus IX 71 microscope adapted with a commercial turnkey TIRF

module by Olympus was utilized. The excitation involved objective-based TIRF, the

exciting beam was directed by a dichroic beamsplitter (z488rdc DCLP, Chroma,

Rockingham, VT) to the sample via a high numerical aperture (N.A. = 1.45) oil

immersion objective (Olympus PLAN APO 60X). Images were magnified 1.6 fold and

captured using a back illuminated electron multiplying charge-coupled device (EMCCD)

camera Cascade 512B from Roper Scientific. Frames were captured every 75 ms. An

HQ535/50 emission filter from Chroma was utilized.

Nanotubes were observed to undergo Brownian motion along a fixed position,

presumably a point of interaction with the surface. This is readily observed from the

movies acquired with the TIRF setup both for the double stranded and partially single

stranded DNA (see supporting videos 1 and 2 for double-stranded nanotubes and video 3

for partially single-stranded nanotubes). Brownian motion would also account for the

somewhat smeared nanotube features observed in the confocal raster scan images.

VI Assembly of large-small DNA nanotubes 4 with encapsulated gold nanoparticles Assemblies are typically conducted in 60 L of solution mixture with 2 L TAMg buffer,

and involve addition of the double-stranded linking strands and gold nanoparticles (3:1 =

AuNP:DNA per strand which is calculated by their mole ratio) to the already assembled

rungs 1 and 2 (~ 3.8 M) at 50 °C, for 10 minutes, followed by the slow cooling to 5 °C

over a period of 10 hours. The linking strands are mixed with their respective rungs, in

the correct molar ratio, to generate DNA assembly with a final concentration of 4.4 M.

AFM sample preparation typically involves the deposition of 5 L of the self-assembled

mixture onto freshly cleaved mica (dimensions 2 X 2 cm), followed by adequate




S23

evaporation to achieve complete dryness (typically 30 mins in a fumehood). Whenever

possible, imaging is conducted within 24 hours to minimize time-dependant sample

degradation. AFM images are acquired in air, and at room temperature. “Tapping mode”

(i.e. intermittent contact imaging) is performed at a scan rate of 0.5 Hz using etched

silicon cantilevers with a resonance frequency of ~ 70 kHz, a spring constant of ~ 2 N/m,

and a tip radius of < 10 nm. All images are acquired with medium tip oscillation

damping (20-30%). For DNA, concentration = concentration in base-pairs and number of

moles = number of moles of base-pairs.

Start with: Concentration ( M) Volume ( L) no. of nmole

DNA rungs 3.8 30 0.115 Linker duplexes 25 6 0.15

Gold nanoparticles 1.25 20 0.025 Mg-containing Buffer 12500 2 25

H2O 0 2 0 Final numbers after mixing:

Concentration ( M) DNA rungs 1.9

Linker duplexes 2.5 Gold nanoparticles 0.41

Mg-containing Buffer 0.4 mM




S24

(i) High resolution AFM characterization of large-small DNA nanotubes 4 with 15 nm gold nanoparticles

Figure S10 High resolution AFM characterization of 4 with 15 nm gold

nanoparticles. HR AFM analysis of 4 reveals the 15 nm AuNP sit inside the larger capsule of tubes alternating. The filled tubes bundle next to each other completely symmetrically, with their particles right next to each other laterally.




S25




S26

Figure S11 (a) Height and (b) width analysis of 4 with encapsulated 15 nm gold nanoparticles. Cross-sectional height and width analysis conducted on the filled portion of the tubes resulted in 2.9 times higher and 1.7 times longer than the unfilled one.

(ii) TEM characterization of large-small DNA nanotubes 4 encapsulated with 15 nm

gold nanoparticles

TEM sample preparation typically involves the deposition of 5 L of the self-assembled

mixture onto freshly carbon coated Cu grid, followed by adequate evaporation to achieve

complete dryness (typically overnight under vacuum).




S27

Figure S12 TEM image showed the positioning between two gold nanoparticles in an

approx. distance ~63 or 120 nm. (Bar is 100 nm).

(iii) Cryogenic electron microscopy (Cryo-EM) characterization of large-small DNA

nanotubes 4 encapsulated with 15 nm gold nanoparticles

Cryogenic electron microscopy (cryo-EM) experiments were performed on a Technai G2

F20 microscope operating at an accelerating voltage of 120 keV and equipped with a

Gatan Ultrascan 4k x 4k CCD camera. All measurements were taken under low dose




S28

conditions. Images were taken close to focus, due to the excellent contrast of the gold

nanoparticles, at 19 and 25K magnification. Cryo-EM samples were prepared by

depositing 5 L of the self-assembled mixture onto a Quantifoil grid followed by blotting

of excess liquid and immediate plunging into liquid ethane at liquid nitrogen temperature.

(iv) Spectroscopic measurements

UV-vis absorbance measurement was conducted on the nanotubes 4. UV/vis spectroscopy

showed a gold nanoparticle plasmon band at 525 nm. No longitudinal plasmon band at

lower energy (expected at ~ 650 nm) was detected. For the control experiments shown in

manuscript figure 4g, UV/vis studies showed a band at 525 nm, but this band tailed off at

higher wavelength (600 nm) in comparison to the encapsulation experiment of Figure

S14a. This red-shift is consistent with the gold nanoparticle aggregates that were also

observed by AFM for these control experiments.




S29

Thus we can conclude that: 1. The encapsulation experiment (Fig. S13a) shows a

plasmon band at 525 nm with a significantly smaller red-shifted tail in its UV/vis

spectrum, consistent with little aggregation of the gold nanoparticles. 2. In comparison,

control experiments showed AuNP aggregates, both by UV/vis and AFM. The absence of

this longitudinal band in our gold-peapoded nanotubes 4 can be ascribed to lack of

plasmon coupling between the gold nanoparticles because of a large interparticle distance

within a nanotube.

Figure S13. UV-vis measurements of the nanotubes with 15 nm Au nanoparticles. (a) encapsulation of the 15 nm particles in the large-small DNA nanotube; (b) control experiment: pre-assembly of the large small DNA nanotube, followed by addition of the 15 nm Au nanoparticles; (c) control experiment: assembly of the DNA nanotube with only small rungs in the presence of 15 nm Au nanoparticles; the green line shows a control experiment with the 15 nmAu nanoparticles with no added DNA.




S30

(v) AFM characterization of large-small DNA nanotubes with 5 nm gold nanoparticles




S31

Figure S14 (a) Height and (b) width analysis of nanotubes with encapsulated 5 nm gold nanoparticles. Cross-sectional height and width analysis conducted on the filled portion of the tubes resulted in 3 times higher and 1.5 times longer than the unfilled one.

VII. Assembly of nanotubes 5 and 6 for selective release of gold nanoparticles in response to specific external DNA strands Table S4 Sequence of eraser strands.

Sequence (5' - 3') ES1 TTGGAACCGACGAGTATGTTCGTAGT ES1’ ACTACGAACATACTCGTCGGTTCCAA ES2’ TGATGCTTCATACTCGTCGGTTCCAA




S32

Assemblies are typically conducted in 60 L of solution mixture with 2 L TAMg buffer,

and involve addition of the modified double-stranded linking strands with 8-base

overhang (ES1) as well as the appropriate linking strands and 15 nm gold nanoparticles

(3:1 = AuNP:DNA per strand which is calculated by their mole ratio)) to the already

assembled rungs 1 and 2 at 50 °C, for 10 minutes, followed by the slow cooling to 5 °C

over a period of 10 hours. The linking strands are mixed with their respective rungs, in

the correct molar ratio, to generate an assembly with a final concentration of 3.0 X 10-6

mol L-1.

AFM sample preparation typically involves the deposition of 5 L of the self-assembled

mixture (concentration of 10 pM) onto freshly cleaved mica (dimensions 2 X 2 cm),

followed by adequate evaporation to achieve complete dryness (typically 30 mins in a

fumehood). Whenever possible, imaging is conducted within 24 hours to minimize time-

dependant sample degradation.

Stiff DNA nanotubes 5 were observed by AFM with the gold nanoparticles residing

inside the large cavities of the tubes, and organized into nanopeapod lines with identical

features as for 4. However, these nanotubes 5 now contain two short base overhangs

sticking out of each of their large capsules, such that a fully complementary DNA strand

ES1’ to these closing strands ES1 is expected to remove (“erase”) these from the

nanotubes, and result in a partially single-stranded nanotube architecture 6. When this

fully complementary “eraser” DNA strand ES1’ was added, AFM images show flexible

nanotubes that have lost much of their persistence length, consistent with their partially

single-stranded character. No encapsulated peapod gold nanoparticle architectures

remained after the addition of the ‘eraser’ strand.

As a control experiment, an incorrect sequence of eraser strand ES2’ was added. The

large small DNA nanotube 5 was kept in its doubled-stranded form with gold

nanoparticles encapsulated inside the tubes.




S33

Figure S15. AFM images of adding (a) correct ES1’ and (b) incorrect ES2’ sequence of eraser strand into the double-stranded DNA nanotubes 5 with 15 nm gold nanoparticles encapsulated (Bar is 1 m).

VIII. Confocal fluorescence microscopy imaging of large-small partially single-

stranded DNA nanotubes

Figure S16 Confocal fluorescence intensity images obtained for partially single stranded

DNA-nanotubes. Partially single stranded DNA nanotubes stained with the DNA intercalator

dye picogreen were excited with the 488 nm output of an Ar+ laser. The right bar illustrates the

counts per millisecond per pixel.




S34

IX Assembly and UV-vis spectroscopic studies of the encapsulation of gold

nanoparticles in nanotubes 14

Figure S17 (i) Three doubled-stranded linking strands (LS) of appropriate sequence were designed to assemble large triangular 2 together into triangular DNA nanotubes 14 with only large capsules in the presence of 20 nm AuNPs. (ii) control experiment: 20 nm AuNPs were added to the pre-formed DNA nanotubes 15.

The lack of observed interparticle coupled plasmon in our original system is expected

based on the large interparticle distance. Because we are not able to observe a

spectroscopic signature that is diagnostic of the encapsulated gold nanoparticles, kinetic

studies to monitor release of these nanoparticles were difficult to acquire

spectroscopically.

In order to confirm that the interparticle distance plays a significant role in the detection

of the longitudinal plasmon absorbance, we redesigned the architecture of the DNA

nanotubes. We assembled nanotubes using only the large triangular rung 2, and we used

20 nm AuNPs. This is expected to form nanotubes 14 with only large capsules along the

tube length as shown in Figure S17 (i). Encapsulated AuNPs within these host systems

would be close together (interparticle distance <5nm) and would be expected to show a

longitudinal plasmon band.




S35

Figure S18 AFM images on mica (dry samples). Scale bar is 1 m. AFM studies showed the co-existence of nanotubes with uniform raised features which

are ascribed to nanotubes encapsulating AuNPs, along with nanotubes with smaller

heights, which are assigned as ‘empty’ tubes (Fig. S18). In this system, no corrugation

along the tube is observed because of the uniform encapsulation potential of these hosts.

As was observed before, dried samples on mica showed a side-by-side organization of the

AuNP encapsulated nanotubes.

TEM images (Figure S19) showed many line patterns of 20 nm AuNP in very close

proximity, in comparison to the control of only 20 nm AuNPs or adding 20 nm AuNP to

the pre-formed large nanotubes 15 (Figure S17 (ii) above). This data confirms the

encapsulation of the 20 nm AuNP in the large capsules along the tube length in order to

form these uniform line patterns of particles with regular interparticle distances. Using

the TEM data, we found the percentage of encapsulated particles to be approximately

35%.

‘empty’ nanotube

‘filled’ nanotube

‘empty’ nanotube




S36

Figure S19 (a) TEM images show the linear pattern of gold nanoparticles in a close proximity. (b) control experiment: preassembly of nanotube 15 followed by AuNP addition does not show line patterns of these nanoparticles. Scale bar is 100 nm

UV-vis measurements were then carried out on these AuNP architectures. In this system,

we indeed found a decrease in the 525 nm band, along with a red-shifted, low-energy

shoulder peak at 650 nm (Figure S20). The absorption band at 525 nm is attributed to

the gold nanoparticle plasmon band and the longer wavelength band is associated with

the longitudinal plasmon band, which was only observed for these modified nanotubes 14

encapsulating gold nanoparticles at close distances. In comparison, a control experiment

20 nm AuNPs were added to pre-formed large nanotubes 15 shows only the 525 nm

plasmon band. (Figure S20).




S37

Figure S20 UV-vis measurements of the large nanotubes 13a with 20 nm encapsulated Au nanoparticles (a) black curve: encapsulation experiment with the large nanotube and 20 nm AuNPs; (b) red curve: control experiment, in which AuNPs were added to pre-formed nanotubes 15; (c) blue curve: control experiment showing 20 nm AuNPs with no DNA added X. Assembly and UV-vis spectroscopic studies of the release of gold nanoparticles of

nanotubes 13a

To study the kinetics of the release of the gold nanoparticles, we assembled the nanotubes

13a with two short base overhangs sticking out of each of their large capsules (Figure

S21a). When the fully complementary “eraser” DNA strand ES3’ was added, UV-vis

spectra were recorded at every 2 minutes (Figure S21b). Within 2 minutes, the 525 nm

gold nanoparticle plasmon band was increased in intensity, and a low-energy shoulder

centered at 650 nm was reduced in intensity. A continual increase in the 525 nm band

was observed after 4, 6, 8, 10, 12, and 15 minutes, along with a progressive blue-shift in

the lower-energy shoulder peaks. No further changes in the peaks were observed after 12

minutes. Corresponding TEM images indicated that AuNP lost their ordering with only

random arrangement and their distance are no longer consistent with their positioning

inside the nanotubes 13b after 12 minutes (Figure S21c).

Table S5 Sequences of eraser strands for large nanotubes 13a

Sequence (5' - 3') ES3 TGAGCAGCCAACCAAGGTGATTCGTAGT




S38

ES3’ ACTACGAATCACCTTGGTTGGCTGCTCA

a.

c.




S39

Figure S21 (a) Two linking strands that connect together triangular 2 into the large nanotubes were modified to contain an 8-base overhang. Assembly of triangles 2 and the appropriate linking strand as well as these new linking strands in the presence of 20 nm AuNP results in DNA nanotubes 13a. Selective opening of these DNA nanotubes 13a with specific added DNA strands ES3’, leading to nanotubes 13b in their single-stranded form that spontaneously release of their particle cargo. (b) Time–dependence UV-vis spectra of nanotubes 13a recorded at various times after addition of easer strand ES3’ at room temperature. i) 0 min, ii) 2 mins, iii) 4 mins, iv) 6 mins, v) 8 mins, vi) 10 mins, vii) 12 mins and viii) 15 mins. (c) TEM images showed the line pattern of gold nanoparticles in a close proximity in nanotubes 13a and the losing of ordering of gold nanoparticles after 15 minutes of addition of strand ES3’. Scale bar is 200 nm

XI. Total internal reflection fluorescence microscope (TIRF) videos - description

Supplementary Videos 1 and 2 show the double-stranded DNA nanotubes 3, and video 3

shows partially single-stranded DNA nanotubes 6. These were acquired using TIRF

microscopy (see p. S22 for details).

XII. References

S1. See references 45 in manuscript.

S2. See references 57, 58 and 59 in manuscript.

S3. Carriero, S. & Damha, M. J. Synthesis of lariat-DNA via the chemical ligation of

a dumbbell complex. Org. Lett. 5, 273-276 (2003).

S4 Ngo, A. T., Karam, P., Fuller, E., Burger, M. & Cosa, G. Liposome Encapsulation

of Conjugated Polyelectrolytes: Toward a Liposome Beacon. J. Am. Chem. Soc.

130, 457-459 (2008).

supplementary information - nature · procedure by damha and co-workers.s3 typically, 10 l of...

Documents