supplementary information for · supplementary information for maize sugary enhancer1 (se1) is a...

Supplementary Information for

Maize sugary enhancer1 (se1) is a novel gene affecting endosperm starch metabolism

Xia Zhanga,b,1, Karl J. Haro von Mogela,1, Vai S. Lora,1, Candice N. Hirschc, Brian De Vriesa, Heidi F.

Kaepplera, William F. Tracya, Shawn M. Kaepplera,d,2

corresponding author：Shawn M. Kaeppler

Email: [email protected]

This PDF file includes:

Supplementary text

Figs. S1 to S15

Tables S1 to S7

Captions for dataset S1

References for SI reference citations

Other supplementary materials for this manuscript include the following:

Dataset S1

www.pnas.org/cgi/doi/10.1073/pnas.1902747116

Supplementary Information Text

Materials and Methods

Carbohydrate Assay

Kernels collected at 22 DAP (immature stage) and 45 DAP (mature stage) from the center of three different

primary ears of W822GSe and W822Gse isolines were used for sugar and polysaccharide assays. The leaf

below the flag leaf from three random plants was sampled over a 24-h time course at 3h intervals for the

carbohydrate assay. Total sugars (mainly Sucrose, D-fructose, and D-glucose) and polysaccharides were

determined in 100 mg lyophilized kernel samples with the Megazyme Sucrose, D-Fructose, and D-Glucose

assay kit (Cat: K-SUFRG, Megazyme, Ltd., Bray, Ireland) and Megazyme K-TSTA assay kit (Cat: K-TSTA),

respectively. Leaf carbohydrates were analyzed at the Great Lakes Bioenergy Research Center (GLBRC) at

Michigan State University as previously described (1). Student T-test and Bonferroni correction were used to

test statistical significance.

Genetic Analysis

To detect the presence and absence of maize sugary enhancer1 (se1) deletion, a codominant PCR marker was

developed using three oligonucleotide primers, a common forward primer (5’-

CGCCTACAGCTTAGCTTCTCC-3’) combined with a Se1-specific reverse primer (5’-

ATCATCGAGAGAGCGCTCCT-3’) and a se1-specific reverse primer (5’-CTCCCTCTCTCCCTCCAAT-

3’). The Se1-specific reverse primer lies inside the region deleted from the se1 allele, and the se1-specific

primer aligns beyond the deletion region. A touch-down PCR was amplified with HotStarTaq DNA

Polymerase (Qiagen), where the initial annealing temperature was set at 62°C and decreased by 0.2°C over

20 cycles, then followed by 25 cycles of 94°C for 45 s, 52°C for 45 s, 72°C for 1 min. Amplification produces

distinct bands for Se1 (276 bp) and se1 (388 bp) that can distinguish homozygotes and heterozygotes.

To verify that the su1 allele in W822Se is su1-ref, the su1 allele was cloned and sequenced. Total RNA

was extracted from 20DAP W822Se kernels using Total RNA Plant Mini Kit (IBI Scientific). cDNA libraries

were generated using SuperScriptTM IV First-Strand Synthesis kit (Thermo Fisher Scientific). RT-PCR was

performed using the forward primer: 5’-GGTCACATACAATAGCAAGTAC-3’ and reverse primer: 5’-

CATGAGACGGCAGAATCTGT-3’ with Phusion™ High-Fidelity DNA Polymerase (Thermo Fisher

Scientific). PCR products were column-cleaned using Gel/PCR DNA Fragment Extraction Kit (IBI

Scientific). “A” overhangs were added to the PCR products using (2X) Platinum™ II Hot-Start PCR Master

Mix (Thermo Fisher Scientific), TA cloned into pCR2.1 (Thermo Fisher Scientific), and transformed into E.

coli DH5α. Plasmids were isolated from E. coli using Hi-Speed Plasmid Mini Kit (IBI Scientific) and sent to

Massachusetts General Hospital DNA Core facility for Sanger sequencing.

Homology Analysis of Se1 and its Spatial-temporal Expression

RNA was extracted from roots, whole seedling, stem and shoot apical meristem (SAM), the base of a V5 leaf,

internode, silk, endosperm at 12 DAP, and whole kernels at 4, 8, 12, 16, 20, and 24 DAP using Trizol regent.

RNA samples were reverse transcribed with SuperScript ® III Reverse Transcriptase (Thermo Fisher

Scientific). PCR was conducted at linearity phase of the exponential reactions with gene specific primers

(primer sequences in SI Appendix, Table S6). Published RNA-seq data by Chen et al (2) and profiles compiled

in qTeller (www.qTeller.com) was further investigated to examine Se1 expression.

Transcriptome Analysis

Developing endosperm of W822GSe and W822Gse plants at six developmental stages (2-d intervals from 11-

21 DAP) was isolated by miRNeasy Mini Kit (Cat: 217004, Qiagen). Library construction for mRNA

sequencing were performed at the University of Wisconsin Biotechnology Center (Madison, WI) using the

Illumina TruSeq RNA Library Preparation Kit. Twenty-four samples including two biological replicates each

sample were multiplexed in two lanes and sequenced using an Illumina 2000 to generate 100-nucleotide single

end sequence reads. For RNA-seq data analysis, adapter sequences were removed from reads using Cutadapt

version 1.8.1 (3) requiring a minimum length of 30 bp, and subsequently trimmed to a maximum length of

101 bp using the fastx_trimmer program within the FASTX toolkit version 0.0.14

(http://hannonlab.cshl.edu/fastx_toolkit/index.html). Single end reads were then mapped to the B73 v2

reference genome assembly (4) using Bowtie2 version 2.2.4 (5) and TopHat2 version 2.0.13 (6) requiring a

minimum intron size of 10 and a maximum intron size of 60,000 and allowing reads to map to a maximum of

20 locations. All other mapping parameters were set to the default values. Transcript abundance estimates

measured as fragments per kilobase of exon model per million fragments mapped were determined using

Cufflinks2 version 2.2.1 (7) with a maximum intron size of 60,000, and providing the genome sequence for

bias correction. Transcript abundance counts for the longest transcript were generated with HTSeq version

0.5.3 (8) at the gene level using the union mode and a minimum mapping quality of 20 with non-strand specific

counting. Raw sequence reads used for SNP identification and transcriptome analysis are available through

the National Center for Biotechnology Information Sequence Read Archive under BioProject PRJNA287265.

Construct Design and the Development of Transgenic Maize

Following transformation and regeneration, T0 transgenic plants were grown in University of Wisconsin-

Madison Walnut Street Greenhouse and out-crossed with B73, resulting in BC1 kernel propagation. Kernels

were sorted based the wrinkled kernel phenotype and RFP signal using Nightsea Dual Fluorescent Protein

Flashlight. Transgenic maize lines that did not exhibit the wrinkled kernel phenotype was sorted based on RFP

signal. Transgenic maize lines that did not exhibit the wrinkled kernel phenotype or have RFP signal were

discarded. Sorted transgenic kernels and non-transgenic sibling were field grown during the Summer of 2016

and 2017 at the University of Wisconsin-Madison West Madison Agriculture Research Station, Madison, WI,

USA. Field-grown BC1 plants were crossed with B73 to obtain BC2 progenies, which were advanced to BC2F1

through self-pollination. BC2F1 progenies were referred as BC2 ○X in Figures and Table. Kernels were

harvested at 20 DAP. Husks were peeled back on ears that were still on the mother plant and transgenic and

http://www.qteller.com/

non-transgenic kernels were identified based on RFP signal. Kernels were isolated and flash frozen in liquid

nitrogen for downstream gene expression and maltose analysis.

Expression of Se1 and Su1 in Transgenic Maize

RNA was extracted using Plant Mini Total RNA Kit (IB47342, IBI Scientific) from 20 DAP kernels harvested

from self-pollinated BC2 transgenic lines and control. RNA was pretreated with DNase (Invitrogen TURBO

DNA-free Kit, AM1907) and first-strand cDNA was synthesized with SuperScriptTM IV First-Strand Synthesis

kit (Thermo Fisher Scientific). Gene specific primers were listed in (primer sequences in SI Appendix, Table

S6). A touchdown PCR was used for amplification of Se1 using AccuPrimeTM GC-Rich DNA polymerase

(12337016, Invitrogen), where the initial annealing temperature was set at 68°C and decreased by 1°C over

14 cycles, then followed by 45 cycles of 94°C for 30 s, 72°C for 1 min. Amplification of Su1 and endogenous

reference Actin 1 were conducted with Phusion High-Fidelity DNA polymerase (F530S, Thermo Scientific).

Fig. S1

Fig. S1. Sequence alignment of su1-ref cloned from W822GSe with Su1 (Zm00001d049753) in B73

RefGen_v4. Translated amino acid sequence is shown under the nucleotide sequence. Arrow points to the

single nucleotide polymorphism (T to C change) in su1-ref, which causes an amino acid change from

tryptophan (W) in Su1 to arginine (R) in su1-ref.

Fig. S2

Fig. S2. Mature leaf starch from a 24-hour time course for W822GSe and W822Gse NILs. Means are

indicated by symbols, and bars indicate one standard deviation from the mean. Time is in 24 hour notation,

with sunrise at 5:30 AM and sunset at 20:30 PM.

Fig. S3

A

B

C

Fig. S3. The spatiotemporal expression of Se1. (A), Expression of Se1 by RT-PCR in diverse tissues of B73.

Zm00001d013265 was used as an expression standard (std.). The larger 250 bp band in the control genomic

DNA lane includes a small intron, whose absence from the other lanes excludes DNA contamination in

these samples. gDNA, genomic DNA. DAP, days after pollination. (B)-(C), Se1 expression in published

RNA-seq data by Chen et al (B) and profiles compiled in qTeller (C). Em, embryo. En, endosperm. S, whole

seed tissues.

Se1

std.

Se1

(Z

m00001d007657)

expre

ssio

n (

RP

KM

) Se1

(Z

m00001d007657)

expre

ssio

n (

FP

KM

)

Chen et al 2012 (Lai lab)

Fig. S4

Fig. S4. Principal component analysis (PCA) of metabolite profile from Ultra-Performance Liquid Chromatography - MS (UPLC-MS) analysis. PC1, PC2 and

PC3: principal component 1, principal component 2 and principal component 3. Each point represents a metabolite profile of a biological replicate at one

development stage. For instance, se1-11-1 represents metabolite profile of replicate 1 for se1 at 11 DAP.

Se1

se1

Se1

se1 Se1

se1

Fig. S5.

Fig. S5. Venn diagram of the results from the two-way ANOVA. The numbers show the sums of significant

main effects of genotype and time and their interaction referring to 61 annotated metabolites determined by

GC-MS (FDR adjusted p < 0.05).

Fig. S6. The hierarchically clustered heat map of metabolites projected by major metabolite family for se1 and Se1. Each row represents a metabolite feature

and each column represents a sample. The row Z-score or scaled expression value of each feature is plotted in red-blue color scale.

se1

Se1

Fig. S6.

Amino acids Organic acids Sugar acohols

Lipids and Fatty acid Phosphates Nucleotides, Amines and others

Class

methionine

indole-3-acetyl-aspartic acid

pyroglutamic acid

tyrosine

cysteine

threonine

alanine

ornithine

butyric acid

phenylalanine

leucine

aspartic acid

glutamine

asparagine

glutamic acid

glycine

valine

proline

serine

Class

isobutanoic acid

pyruvic acid

citric acid

isocitric acid

aconitic acid

gulonic acid

malic acid

fumaric acid

lactic acid

glyceric acid

dehydroascorbic acid

shikimic acid

quinic acid

Class

Glycerol

myo-inositol

galactinol

mannitol

threitol

Class

glyceric acid-3-phosphate

phosphoric acid

glycerol-3-phosphate

glycerophosphoglycerol

inositol-1-p

monomethylphosphate

ethanolaminephosphate

DAP 11 13 15 17 19 21 11 13 15 17 19 21

Class

sphingosine

aminobutyric acid

stearic acid

Class

Hydroxylamine

Pyridoxamine

Uracil

Benzene

adenosine

2-hydroxypyridine

Hydroquinone

Phosphoenolpyruvic

Gluanosine

putrescine

DAP 11 13 15 17 19 21 11 13 15 17 19 21 DAP 11 13 15 17 19 21 11 13 15 17 19 21

DAP 11 13 15 17 19 21 11 13 15 17 19 21 DAP 11 13 15 17 19 21 11 13 15 17 19 21 DAP 11 13 15 17 19 21 11 13 15 17 19 21

Fig. S7.

A

B

C

Fig. S7. Metabolic pathways with DEGs in W822GSe and W822Gse isoliness at 11 DAP (A), 15DAP (B),

and 19 DAP (C). Log2 ratios for 49, 482, and 1,542 DEGs in W822GSe and W822Gse were loaded into

MapMan. Among those, 4, 75, and 211 entities are visible in metabolic overviews for 11DAP, 15DAP, and

19DAP, respectively. Genes which were up and down-regulated are represented in red and green, respectively.

Each square represents an at least 1.5-fold differentially expressed gene.

Fig. S8.

Fig. S8. Segregation of wrinkled kernel phenotype (red arrows) on Se1Su1-RNAi_1 BC1 (A), Se1Su1-RNAi_1

BC2 (B), and Se1Su1-RNAi_1 BC2 ○X (C) progeny ears. Visualization of individual kernels with red

fluorescent protein (RFP) and wrinkled phenotype of Se1Su1-RNAi_1 BC1 (D), Se1Su1-RNAi_1 BC2 (E),

and Se1Su1-RNAi_1 BC2 ○X (F). “+/+” are kernels with both RFP and wrinkled phenotype. “+/-” are

kernels exhibiting only RFP. “-/-” are kernels showing no RFP and wrinkled phenotype. Blank panels are

kernel phenotypes absent in specific events. ○X are self-pollinated ears.

Fig. S9.

Fig. S9. Segregation of wrinkled kernel phenotype (red arrows) on Se1Su1-RNAi_2 BC1 (A), Se1Su1-RNAi_2

BC2 (B), and Se1Su1-RNAi_2 BC2 ○X (C) progeny ears. Visualization of individual kernels with red

fluorescent protein (RFP) and wrinkled phenotype of Se1Su1-RNAi_2 BC1 (D), Se1Su1-RNAi_2 BC2 (E),




Fig. S10.

Fig. S10. Segregation of wrinkled kernel phenotype (red arrows) on Se1Su1-RNAi_3 BC1 (A), Se1Su1-

RNAi_3 BC2 (B), and Se1Su1-RNAi_3 BC2 ○X (C) progeny ears. Visualization of individual kernels with

red fluorescent protein (RFP) and wrinkled phenotype of Se1Su1-RNAi_3 BC1 (D), Se1Su1-RNAi_3 BC2 (E),




Fig. S11.

Fig. S11. Segregation of wrinkled kernel phenotype (red arrows) on Su1-RNAi_1 BC1 (A), Su1-RNAi_1 BC2

(B), and Su1-RNAi_1 BC2 ○X (C) progeny ears. Visualization of individual kernels with red fluorescent

protein (RFP) and wrinkled phenotype of Su1-RNAi_1 BC1 (D), Su1-RNAi_1 BC2 (E), and Su1-RNAi_1 BC2

○X (F). “+/+” are kernels with both RFP and wrinkled phenotype. “+/-” are kernels exhibiting only RFP. “-

/-” are kernels showing no RFP and wrinkled phenotype. Blank panels are kernel phenotypes absent in specific

events. ○X are self-pollinated ears.

Fig. S12.







Fig. S13.







Fig. S14.

Fig. S14. Kernel phenotype of Se1-RNAi_1 BC1 (A), Se1-RNAi_1 BC2 (B), and Se1-RNAi_1 BC2 ○X (C)

progeny ears. Visualization of individual kernels with red fluorescent protein (RFP) of Se1-RNAi_1 BC1 (D),

Se1-RNAi_1 BC2 (E), and Se1-RNAi_1 BC2 ○X (F). “+/+” are kernels with both RFP and wrinkled

phenotype. “+/-” are kernels exhibiting only RFP. “-/-” are kernels showing no RFP and wrinkled phenotype.

Blank panels are kernel phenotypes absent in specific events.○X are self-pollinated ears.

Fig. S15.

Fig. S15. Kernel phenotype of Se1-RNAi_2 BC1 (A), Se1-RNAi_2 BC2 (B), and Se1-RNAi_2 BC2 ○X (C)

progeny ears. Visualization of individual kernels with red fluorescent protein (RFP) of Se1-RNAi_2 BC1 (D),

Se1-RNAi_2 BC2 (E), and Se1-RNAi_ BC2 ○X (F). “+/+” are kernels with both RFP and wrinkled

phenotype. “+/-” are kernels exhibiting only RFP. “-/-” are kernels showing no RFP and wrinkled phenotype.

Blank panels are kernel phenotypes absent in specific events.○X are self-pollinated ears.

Table S1. Kernel Carbohydrates of mature, dry lyophilized seed at 45 days after pollination (DAP) from 2006

and 2007 sources (n=6, 3 ears per genotype from each year), and immature kernels at 22 DAP from 2011

(n=3) for the W822GSe and W822GSe near isogenic lines. Shown are the means and standard deviations of

three samples from different ears for glucose, fructose, sucrose, total sugars, water-soluble polysaccharide

(WSP), starch, total polysaccharides, and total carbohydrates. Units are mg g-1, * P<0.05, **P<0.01.

Genotype DAP Glucose Fructose Sucrose

Total

Sugars WSP Starch

Total

Polysaccharides

Total

Carbohydrates

W822GSe 45 13.7±2.3 12.2±1.4 35.7±1.8** 61.6±3.6** 148.9±33.8** 414.2±21.2** 563.1±16.0** 624.7±16.6**

W822Gse 45 13.8±2.8 12.4±1.3 53.0±6.0** 79.1±9.1** 267.8±10.0** 222.8±9.4** 490.6±9.9** 569.7±13.0**

W822GSe 22 46.7±1.6 48.4±1.4 62.5±8.3 157.6±7.0 154.0±38.7* 350.1±15.2** 504.0±23.7** 661.6±30.2

W822Gse 22 53.5±4.6 52.2±4.0 77.1±18.5 182.7±26.7 263.9±22.6* 194.0±13.2** 457.9±12.2** 640.6±14.6

Table S2. Public primers used for mapping the Se1 gene. W822GSe and W822Gse were genotyped at 121

SSR markers, arranged by maize chromosome bin locations. UMC1736 (bold) was the only marker in this

screen that was identified as polymorphic between these two lines, and was linked to the se1 trait. Primer

sequences for the SSR markers are available at maizeGDB.org.

Primer Bin Primer Bin Primer Bin Primer Bin

unm1685 1.01 umc1947 2.08 umc2026 5.05 umc1799 7.05

bnlg1007 1.02 umc1992 2.08 bngl278 5.06 umc2190 7.06

bngl615 1.07 umc2005 2.08 bnlg1847 5.06 bnlg2037 8.01

phi094 1.09 umc2085 2.08 bnlg1306 5.07 phi119 8.02

umc1885 1.10 umc2202 2.08 bnlg1695 5.07 phi014 8.04

bngl131 1.11 bnlg1520 2.09 umc1225 5.08 phi121 8.04

phi064 1.11 bnlg1893 2.09 bnlg1043 6.00 bngl162 8.05

umc1605 1.12 umc1252 2.09 bnlg161 6.00 bngl666 8.05

umc1725 1.12 umc1256 2.09 umc1792 6.00 umc1384 8.07

umc1622 2.00 umc1551 2.09 bngl249 6.01 umc1279 9.00

umc2094 2.01 umc1736 2.09 bngl426 6.01 umc1647 9.00

umc1776 2.03 umc2184 2.09 umc1572 6.03 umc2128 9.02

phi109642 2.04 phi101049 2.10 nc010 6.04 umc2398 9.04

umc1658 2.06 umc2118 3.00 bnlg1443 6.05 umc1310 9.06

phi127 2.07 phi073 3.05 bnlg1617 6.05 umc1366 9.06

bnlg1169 2.08 bngl197 3.07 umc1859 6.06 umc1942 9.07

bnlg1316 2.08 bnlg1257 3.09 phi123 6.07 umc1277 9.08

bnlg1606 2.08 umc1288 4.02 umc1127 6.08 umc1239 10.00

bnlg1746 2.08 bnlg1126 4.03 umc2059 6.08 umc2399 10.00

bnlg1908a 2.08 bnlg1159 4.05 bnlg1642 7.00 umc1319 10.01

bnlg1940 2.08 bnlg1023 4.06 bnlg2132 7.00 umc2018 10.01

mmc0381 2.08 umc1651 4.07 mmp81 7.01 umc2034 10.02

npi298a 2.08 phi093 4.08 umc1159 7.01 umc2016 10.03

umc1230 2.08 umc2187 4.08 umc1270 7.01 umc1648 10.04

umc1464 2.08 bnlg1337 4.11 umc1632 7.01 bnlg1185 10.05

umc1516 2.08 umc1649 4.11 umc1428 7.02 umc1678 10.05

umc1604 2.08 bnlg105 4.12 bnlg1805 7.03 umc1061 10.06

umc1618 2.08 bnlg565 5.02 bnlg2271 7.03 umc1993 10.06

umc1633 2.08 phi008 5.03 bngl155 7.04

umc1745 2.08 dupssr10 5.04 umc1407 7.05

umc1798 2.08 umc1853 5.05 umc1760 7.05

Table S3. Genotypes of recombinant plants grown from wrinkled seeds on selfed segregating Se1/se1 heterozygous ears at markers used for genetic mapping.

Genotypes begin as heterozygous Se1/se1 on proximal marker AGT1, or distal marker UMC1736 and progress to homozygous se1/se1 at the se1 deletion marker.

Coordinates at the top of the table are relative to the maize B73 v2 reference genome sequence. RFLP, Restriction Fragment Length Polymorphism; SNP, Single

Nucleotide Polymorphism; GBS, Genotype by Sequencing; Indel, Insertion/Deletion. † Three of the plants were genotyped as Se1/se1 at all or nearly every

marker, including the deletion marker, which are likely the result of hetero-fertilization, and were excluded from the final analysis. †† All wrinkled seeds

genotyped from one ear shared identical genotypes through the region, suggesting recombination event occurred prior to this generation. These were counted as

one individual in the analysis. Blank cells reflect genotypes that could not be determined after multiple attempts. Genotypes are simplified as “Se/Se”, “Se/se”

and “se/se” for legibility.

Coord.

229

,608

,58

5

229

,850

,32

8

229

,936

,45

1

229

,946

,57

8

229

,949

,60

1

229

,966

,24

8

229

,975

,45

4

229

,977

,33

1

229

,981

,91

7

229

,982

,95

8

229

,983

,83

5

229

,984

,09

7

229

,985

,04

6

229

,989

,91

6

230

,000

,90

0

230

,524

,88

4

230

,917

,24

9

230

,873

,13

8

Marker

Type RFLP SNP SNP GBS GBS RFLP SNP Indel GBS Deletion RFLP SNP Indel GBS RFLP SNP RFLP SSR

Marker

Name AGT1 ME 11 ME 61 ME 4 ME 68 MF 20 MG 12 MG 15 MF 29

MF 36F

30R

DEL 2R

MF

3933 MF 39

MG

7757 ME 37 MD 27 MC 4 MA 15

UMC

1736

Individual

Se/Se

control Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/Se Se/se Se/Se Se/Se Se/Se Se/Se

se/se

control se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 41 Se/se Se/se Se/se se/se se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 125 Se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 151 Se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 152 Se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 159 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 160 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 213 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

22 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

36 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

49 Se/se se/se se/se se/se se/se Se/Se se/se se/se se/se se/se se/se

60 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

62 Se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

129 Se/se Se/se Se/se Se/se Se/se Se/Se Se/se se/se se/se se/se se/se se/se se/se se/se se/se

184 Se/Se Se/Se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

210 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

250 Se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

257 Se/se Se/se Se/se se/se se/se se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

297 Se/se se/se se/se se/se Se/se Se/se se/se Se/Se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se


372 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se


522 Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/Se Se/Se Se/Se

338† Se/Se Se/se Se/se Se/se Se/se Se/se Se/se Se/Se Se/se Se/se† Se/se Se/se Se/se Se/se Se/Se Se/se se/se se/se

394 Se/Se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

399 Se/Se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

400 Se/Se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 197 Se/se Se/se se/se se/se se/se Se/se Se/Se se/se se/se se/se se/se se/se se/se Se/se se/se se/se

C 209 Se/se Se/se se/se se/se se/se Se/se Se/Se se/se se/se se/se se/se se/se se/se Se/se se/se se/se

549 Se/Se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/Se Se/Se Se/Se

550 Se/Se Se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/Se Se/Se Se/Se

552† Se/Se Se/se Se/se Se/se Se/se Se/se Se/se Se/Se Se/se Se/se† Se/se Se/se Se/se Se/se Se/Se Se/Se Se/Se Se/Se

569 Se/Se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

576 Se/Se Se/se Se/se Se/se Se/se Se/Se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se

C 51 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se

C 106 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se

C 173 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se

C 201 se/se se/se se/se se/se se/se se/se se/se Se/Se se/se se/se se/se se/se Se/se Se/se Se/Se Se/se Se/se Se/se

2 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se

10 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se

50 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/Se

79 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se

97 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/se

104 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/se

107 se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/se

110 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se

201† Se/Se Se/Se Se/se Se/se Se/se Se/se Se/se Se/Se Se/se Se/se† Se/se Se/se Se/se Se/Se Se/se Se/se Se/se

202 Se/Se Se/Se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/Se








357†† se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/se Se/se Se/Se Se/se Se/se Se/se

367†† se/se Se/Se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/se Se/Se Se/se Se/se Se/se

381 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/se


468 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/se Se/se



508 se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/se Se/Se Se/se Se/se Se/se


514 se/se se/se se/se se/se Se/se se/se se/se se/se se/se se/se se/se se/se se/se Se/Se Se/Se Se/se

Table S4. The annotated metabolites identified as having statistically significant effects for at least one

subject variable or interaction in Two-way ANOVA. Significance level was set at p < 0.05 (adjusted by false

discovery rate).

Metabolites Genotype

(se1/Se1)

Time

(DAP) Interaction (Genotype * Time)

Uracil 2.86E-04 7.79E-19 8.33E-06

Citric acid 1.19E-07 8.69E-09 4.76E-05

Fumaric acid 9.69E-06 4.48E-19 8.09E-05

Galactinol 3.13E-04 1.22E-18 8.09E-05

Isocitric acid 8.44E-03 1.33E-16 1.55E-04

cis-Aconitic acid 4.76E-01 1.67E-08 2.40E-04

Hydroxylamine 8.27E-01 3.44E-17 2.40E-04

Phosphoric acid 5.73E-04 8.99E-15 2.68E-04

Sphingosine 2.49E-04 3.15E-07 6.03E-04

Proline 4.13E-05 5.72E-24 1.49E-03

Indol-3- Acetyl- L-

Aspartic Acid 2.56E-05 1.69E-07 1.65E-03

Guanosine 2.11E-03 2.50E-05 1.98E-03

myo-Inositol 9.69E-06 2.36E-10 1.98E-03

Sucrose 4.55E-09 1.73E-19 2.94E-03

2-Aminoisobutyric acid 1.27E-03 5.54E-21 5.12E-03

Ornithine 3.16E-04 1.41E-08 1.19E-02

Serine 6.66E-01 1.05E-06 1.19E-02

Maltose 7.02E-02 1.19E-04 2.58E-02

Glycine 1.80E-05 1.65E-17 3.39E-02

Benzene-1,2,3-triol 1.49E-01 5.09E-13 3.69E-02

Phosphoenolpyruvic

acid 1.61E-01 1.31E-12 4.22E-02

Glyceric acid-3-

phosphate 4.70E-01 2.53E-09 4.39E-02

Aspartic acid 6.98E-02 1.80E-14 4.40E-02

Putrescine 2.58E-01 2.38E-04 4.86E-02

Adenosine 2.02E-06 8.17E-07 5.51E-02

Mannitol 3.05E-02 1.80E-14 5.51E-02

Threitol 7.20E-01 7.49E-15 6.44E-02

Inositol-1-phosphate,

myo- 2.90E-02 8.61E-05 7.07E-02

Phenylalanine 4.88E-01 8.09E-10 7.20E-02

Alanine 9.67E-01 7.15E-06 8.17E-02

Valine 5.57E-07 2.60E-12 9.92E-02

Pyridoxamine 1.13E-01 4.19E-09 1.10E-01

Ethanolaminephosphate 4.50E-01 3.65E-08 1.42E-01

Butyric acid, 4-amino- 1.71E-02 1.63E-13 1.60E-01

Leucine 4.70E-01 1.40E-16 1.73E-01

Shikimic acid 1.52E-03 1.98E-20 1.73E-01

Glucose 9.34E-01 6.21E-20 1.78E-01

Hydroquinone 1.24E-13 9.96E-07 1.78E-01

Glycerophosphoglycerol 1.09E-05 3.37E-07 1.98E-01

Quinic acid 8.11E-05 1.31E-17 1.98E-01

Asparagine 4.88E-01 1.04E-06 2.04E-01

Fructose-6-phosphate 6.33E-02 5.90E-06 2.04E-01

Mannose-6-phosphate 6.54E-05 3.60E-08 2.04E-01

Glutamine 1.28E-01 5.17E-08 2.16E-01

Glucose-6-phosphate 8.27E-05 1.74E-06 2.57E-01

Dehydroascorbic acid 1.10E-02 1.47E-09 2.71E-01

Isobutanoic acid, 3-

amino- 3.59E-17 2.53E-09 2.72E-01

2-Hydroxypyridine 1.38E-11 3.61E-08 2.84E-01

Glycerol 6.61E-05 2.69E-13 2.84E-01

Lactic acid 2.46E-01 6.19E-20 2.94E-01

Pyruvic acid 2.89E-06 1.62E-03 3.10E-01

Malic acid 5.91E-04 5.98E-24 3.29E-01

Raffinose 3.13E-04 5.73E-07 3.63E-01

Gulonic acid, 2-oxo- 7.65E-01 7.80E-13 3.70E-01

Fructose 7.15E-01 3.44E-17 4.85E-01

Cysteine 2.42E-04 1.88E-13 4.90E-01

Glutamic acid 2.11E-02 1.08E-02 5.86E-01

Glycerol-3-phosphate 9.41E-04 4.33E-10 6.24E-01

Threonine 9.69E-06 6.78E-10 6.93E-01

Tyrosine 3.70E-01 4.48E-17 7.33E-01

Phosphoric acid

monomethyl ester 1.10E-02 8.50E-13 8.14E-01

Table S5. Summary of RNA-seq read alignment.

Sample TotalReads CleanedReads UniqueMapped DuplicateMapped TotalMapped PercentMapped

Se1 _11_rep1 13,316,103 13,315,937 9,765,081 940,227 10,705,308 80.4%

Se1 _11_rep2 14,671,180 14,670,847 10,688,884 1,037,631 11,726,515 79.9%

Se1 _15_rep1 13,859,565 13,859,404 10,007,890 1,060,729 11,068,619 79.9%

Se1 _15_rep2 14,365,538 14,365,417 10,423,279 1,084,571 11,507,850 80.1%

Se1 _19_rep1 14,702,532 14,702,422 9,510,696 1,371,921 10,882,617 74.0%

Se1 _19_rep2 14,536,239 14,536,118 9,528,726 1,349,609 10,878,335 74.8%

se1 _11_rep1 14,237,939 14,237,840 10,356,655 1,043,630 11,400,285 80.1%

se1 _11_rep2 14,844,146 14,844,006 10,823,523 1,019,570 11,843,093 79.8%

se1 _15_rep1 14,629,941 14,629,814 10,586,303 1,127,704 11,714,007 80.1%

se1 _15_rep2 14,849,450 14,849,321 10,285,128 1,575,233 11,860,361 79.9%

se1 _19_rep1 15,295,997 15,295,910 9,965,128 1,410,766 11,375,894 74.4%

se1_19_rep2 11,884,180 11,884,080 7,681,522 1,113,136 8,794,658 74.0%

Table S6. Primers used in RT-PCR

F: forward; R: reverse

Primer Name Primer Sequence (5’ -> 3’) Gene Model

Se1-F GAGATCGACCAGTTCTTCCC Zm00001d007657

Se1-R CTCCGCGCGCAGGAACAG Zm00001d007657

Su1-F GAAGGAGAATTTGCAAGTCTGTC Zm00001d049753

Su1-R CATGAGACGGCAGAATCTGT Zm00001d049753

Act1-F GGCCACGTACAACTCCATCA Zm00001d010159

Act1-R GGAGCTCGTTGTAGAAGGTG Zm00001d010159

Table S7. Segregation of RFP and/or wrinkled kernel phenotype with the ears of Se1Su1-RNAi in Fig. S8-

S10, Su1-RNAi in Fig. S11-S13, and Se1-RNAi in Fig. S14-S15.

RNAi Transgenic Events +/+ (%) +/- (%) -/- (%) Total

Se1Su1-RNAi_1 BC1 75 (49) 78 (51) 153

Se1Su1-RNAi_1 BC2 179 (51) 171 (49) 350

Se1Su1-RNAi_1 BC2 ○X 72 (28) 124 (48) 63 (24) 259

Se1Su1-RNAi_2 BC1 90 (53) 80 (47) 170

Se1Su1-RNAi_2 BC2 206 (49) 208 (51) 415

Se1Su1-RNAi_2 BC2 ○X 64 (25) 126 (48) 70 (27) 260

Se1Su1-RNAi_3 BC1 28 (53) 25 (47) 53

Se1Su1-RNAi_3 BC2 200 (49) 206 (51) 406

Se1Su1-RNAi_3 BC2 ○X 90 (23) 186 (48) 112 (29) 388

Su1-RNAi_1 BC1 35 (51) 34 (49) 69

Su1-RNAi_1 BC2 164 (55) 136 (45) 298

Su1-RNAi_1 BC2 ○X 101 (24) 217 (52) 96 (23) 414

Su1-RNAi_2 BC1 78 (47) 89 (53) 167

Su1-RNAi_2 BC2 108 (51) 105 (49) 213

Su1-RNAi_2 BC2 ○X 84 (27) 160 (51) 72 (23) 316

Su1-RNAi_3 BC1 99 (47) 110 (53) 209

Su1-RNAi_3 BC2 131 (53) 114 (47) 245

Su1-RNAi_3 BC2 ○X 56 (24) 122 (53) 54 (23) 232

Se1-RNAi_1 BC1 92 (48) 98 (52) 190

Se1-RNAi_1 BC2 156 (55) 129 (45) 285

Se1-RNAi_1 BC2 ○X 119 (78) 34 (22) 153

Se1-RNAi_2 BC1 47 (48) 51 (52) 98

Se1-RNAi_2 BC2 245 (49) 252 (51) 497

Se1-RNAi_2 BC2 ○X 385 (76) 120 (24) 505

“+/+”, kernels with both RFP signal and wrinkled phenotype. “+/-”, kernels with RFP signal. “-/-”, kernels

with no RFP signal or wrinkled phenotype. BC1 and BC2 represent two successive generations of RNAi

transgenic plants that were crossed with B73. BC2 ○X indicates the self-pollinated ears of BC2 progeny. Two

or three independent transgenic events were analyzed for each RNAi transgene which were indicated by _1,

_2, and _3.

Additional data table S1 (separate file)

SI Appendix Dataset S1. Gene Ontology enrichment for W822Gse and W822GSe isoline.

References

1. R.S. Sekhon et al., Transcriptional and metabolic analysis of senescence induced by preventing

pollination in maize. Plant Physiol. 159(4):1730-1744 (2012).

2. J. Chen et al., Dynamic Transcriptome Landscape of Maize Embryo and Endosperm Development.

Plant Physiol. 166(1):252-264 (2014).

3. M. Martin, Cutadapt removes adapter sequences from high-throughput sequencing reads. 2011 17(1)

(2011).

4. P.S. Schnable et al., The B73 maize genome: complexity, diversity, and dynamics. Science

326(5956):1112-1115 (2009).

5. B. Langmead, S. Salzberg, Fast gapped-read alignment with Bowtie 2. Nat Methods 9:357 - 359

(2012).

6. D. Kim et al., TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions

and gene fusions. Genome Biol. 14(4):R36 (2013).

7. C. Trapnell, L. Pachter, S. Salzberg, TopHat: discovering splice junctions with RNA-Seq.

Bioinformatics 25:1105 - 1111(2009).

8. S. Anders, P.T. Pyl, W. Huber, HTSeq - a Python framework to work with high-throughput

sequencing data. Bioinformatics 31(2):166-169 (2015).

supplementary information for · supplementary information for maize sugary enhancer1 (se1) is a...

Documents