Cancer Cell, Volume 24

Supplemental Information

Transformation-Associated Changes in Sphingolipid

Metabolism Sensitize Cells to Lysosomal Cell Death

Induced by Inhibitors of Acid Sphingomyelinase Nikolaj H.T. Petersen, Ole D. Olsen, Line Groth-Pedersen, Anne-Marie Ellegaard, Mesut

Bilgin, Susanne Redmer, Marie S. Ostenfeld, Danielle Ulanet, Tobias H. Dovmark, Andreas

Lønborg, Signe D. Vindeløv, Douglas Hanahan, Christoph Arenz, Christer S. Ejsing, Thomas

Kirkegaard, Mikkel Rohde, Jesper Nylandsted, and Marja Jäättelä

Inventory of Supplemental Information

• Figure S1 – Related to Figure 2

• Table S1 – Related to Figure 5F

• Figure S2 – Related to Figure 5

• Figure S3 – Related to Figure 8

• Supplemental Experimental Procedures

• Supplemental References

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Cell Lines

NIH3T3 fibroblasts were transduced with an empty pBabe-puro retrovirus (provided by C.

Holmberg, University of Copenhagen, Denmark) or pBabe-puro encoding for c-srcY527F

(provided by S. Courtneidge, Van Andel Research Institute, Grand Rapids, MI) as described

previously (Fehrenbacher et al., 2004). HCT116 colon carcinoma cells and HCT116-derived

K-Ras-depleted Hkh2 cells (Ohmori et al., 1997) were kindly provided by S. Shirasawa

(Fukuoka University, Fukuoka, Japan). MCF7 human ductal breast carcinoma cells used

included a TNF-sensitive subclone (MCF7-S1) (Jäättelä et al., 1995), and its vector (MCF7-

pCEP) and BCL2 (MCF7-BCL2) expressing derivatives (Høyer-Hansen et al., 2007).

WEHI-vector (Wn-902) and WEHI-Hsp70 (Wn-912) cells are single cell clones of WEHI-S

mouse fibrosarcoma cells succesfully transfected with an empty vector or a vector encoding

for human Hsp70 (Jäättelä et al., 1992). Hspa1-transgenic (iMEF-Hsp70) and corresponding

wild type (iMEF-WT) iMEFs were created as described and used at passages 15-20

(Nylandsted et al., 2004). Human U-2-OS osteosarcoma, HeLa cervix carcinoma, SKOV3

ovarian carcinoma as well as PC3 and Du145 prostate carcinoma cells were obtained from

ATCC. Highly metastatic SKOV3.ip1 cell line derived by passaging SKOV3 cells in the

mouse peritoneal cavity (Yu et al., 1993) was kindly provided by Robert Strauss (Danish

Cancer Society Research Center, Copenhagen, Denmark).

Enzyme Activities

Total cellular ASM activity was measured by the cleavage of HMU-PC essentially as

described previously (van Diggelen et al., 2005). Briefly, cells were harvested in water on

ice and sonicated (15 cycles of 30 s using the Bioruptor Next Gen sonicator). The samples

were then spun down and adjusted to contain 1.0 µg/µL protein. HMU-PC was dissolved in

the substrate buffer (0.1 M sodium acetate buffer pH 4.5, containing 0.2% (w/v) sodium

taurocholate and 0.02% sodium azide) and mixed with the samples, which were incubated at

37° C for 2 - 3 h. The reaction was quenched with 0.2 M glycine–NaOH buffer (pH 10.7)

containing 0.2% (w/v) sodium dodecyl sulphate and 0.2% (w/v) Triton X-100. The

fluorescence of the formed HMU (ex. = 404 nm, em. = 460 nm) was measured employing

Varioscan and correlated to a standard curve of pure HMU.

Total cellular NSM activity was measured in lysates of subconfluent cells with Neutral

Sphingomyelinase Assay Service kit from Echelon (T-1800) according to manufacturers

protocol.

Surface Plasmon Resonance (BIAcore). For preparation of LUVs a lipid mixture

consisting of 10 mol% sphingomyelin, 50 mol% phosphatidylcholine, 20 mol% cholesterol

and 20 mol% BMP dissolved in organic solvents, was dried under a stream of argon and

rehydrated in 2 mM Tris/HCl buffer (pH 7.4)(Kolzer et al., 2004). The mixture was freeze-

thawed six times, first in liquid nitrogen and then in an incubator at 37° C. After ultrasound

bath for 5 min the mixture was passed 21 times through a polycarbonate membrane with a

pore diameter of 100 nm. Surface plasmon resonance measurements were performed using a

BIAcore 3000 system at 25° C. LUVs (total lipid concentration 0.25 mM) were immobilized

on the surface of a L1 sensor chip (BIAcore) in PBS (loading buffer). The running buffer

used was sodium acetate buffer (50 mM, pH 4.5). When acid sphingomyelinase (1 µM, 60

µl in running buffer) was injected directly on the liposome surface, response units between

4100– 5250 were obtained. After 10 min, the drugs of interest were injected in running

buffer at a flow rate of 20 µl/min at the concentrations indicated. After injection a

dissociation phase of 10 min was appended.

Lysosomal Stability

To analyse the lysosomal integrity, we used a real time imaging method of cells stained with

acridine orange, a metachromatic weak base that accumulates in the acidic compartment of

the cells staining them red and sensitizing them to photo-oxidation (Kirkegaard et al., 2010).

The photo-oxidation-induced loss of the lysosomal pH-gradient and leakage of acridine

orange to the cytosol from individual lysosomes was quantified as an increase in green

(cytosolic) fluorescence. Cells stained with acridine orange were exposed to 489 nm light

from a 100-mW diode laser while laser scanning micrographs where captured every 0.5 s

(for U-2-OS cells) or 12 s (for MEFs) on a Zeiss LSM LIVE DUO confocal system in two

channels defined by bandpass filters for 495–555 nm (green) and LP650 nm (red) light. A

threshold in the green channel eliminating areas without cells in the recorded area was

identified and applied to all recorded movies, which were subsequently analyzed by the

integrated Zeiss LSM DUO software.

Purification of Lysosomes

Subconfluent cells were harvested and lysosomes were purified by Fe++-dextran

fractionation essentially as described previously (Diettrich et al., 1998). Briefly, cells were

loaded with Fe++-conjugated dextran (10 kDa) for 12 h, chased in fresh medium for 2 h and

treated as indicated. Cells were lysed in sucrose extraction buffer (250 mM sucrose, 20 mM

Hepes, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, and 1 mM pefabloc, pH

7.5) using a dounce homogenizer and centrifuged at 3000 g. The supernatant was loaded to a

MiniMACSTM column attached to a magnet (Miltenyi Biotec) and trapped lysosomes were

eluted in sucrose extraction buffer by removing the magnet and flushing with a plunger. The

yield was approximately 18% based on the measurements of N-acetyl-glucosaminidase

activities (Fehrenbacher et al., 2008). Cells and purified lysosomes were washed twice in

cold 155 mM Ammonium Acetate in Chromasolv® water (pH 8.0) and stored at -80º C.

Lipid mass spectrometry

Sample aliquots corresponding to 2 x 105 cells or lysosomes from 3 x 106 cells per 200 µL

were spiked with 10 µL internal standard mixture containing 85 pmol phosphatidylcholine

18:3/18:3, 60 pmol sphingomyelin 18:1;2/17:0;0, 45 pmol ceramide 18:1;2/17:0;0, 65 pmol

galactosylceramide 18:1;2/12:0;0 and 65 pmol lactosylceramide 18:1;2/12:0;0. The samples

were subsequently extracted with 990 µL chloroform/methanol (10:1, V/V) for 90 min as

previously described (Sampaio et al., 2011). The lower organic phase was collected and

evaporated. The lipid extract was dissolved in 100 µL chloroform/methanol (1:2, V/V).

Lipid extracts were analyzed in positive ion mode on a QSTAR Pulsar-i instrument (AB

Sciex) equipped with a TriVersa NanoMate (Advion Biosciences) as described previously

(Ejsing et al., 2006; Zech et al., 2009). Phosphatidylcholine and sphingomyelin species were

monitored by precursor ion scanning for head-group specific fragment ion having m/z

184.07. Ceramide, hexosylceramide, diosylceramide species were monitored by multiplexed

MS/MS analysis. Fragment ion enhancement (trapping of fragment ions in the collision cell)

was applied according to the instructions of the manufacturer and controlled by Analyst QS

1.1 software (AB Sciex). The lipid species were identified and quantified using LipidView

software (AB Sciex) as previously described (Ejsing et al., 2006).

Immunodetection

Primary antibodies used included murine monoclonal antibodies against acid ceramidase

(BD Bioscience, Franklin Lakes, NJ), MDR1/3 (Santa Cruz Biotechnology, Santa Cruz,

CA), Cathepsin B (Oncogene), a-tubulin (AbCam, Cambridge MA), MCM7 (DCS-141,

Neomarkers; kindly provided by Jiri Bartek), Lamp2 (Developmental Studies Hybridoma

Bank, Department of Biological Sciences, University of Iowa, Iowa City, IA) and GAPDH

(Biogenesis). Immunodetection of proteins separated by 10% SDS-PAGE and transferred to

nitrocellulose was performed using appropriate peroxidase-conjugated secondary antibodies

from Dako, ECL Western blotting reagents (Amersham) and Luminescent Image Reader

(LAS-1000Plus, Fujifilm).

RNA interference

All siRNAs were transfected with Oligofectamine or RNAi Max (Invitrogen) at 20 nM.

siRNAs were designed against following 5’ – 3’ sequences:

SMPD1-1: CCCGCACATGATGTCTGGCACCAGA (Kirkegaard et al., 2010),

SMPD1-2: GAGGATCGAGGAGACAAAGTGCATA (Kirkegaard et al., 2010),

SMPD1-3: CCCAAATGCTGCTGTGGTT,

ASAH1-1: TTCAGTGTAAGACTGAACAGTCCTG,

ASAH1-2: CTGTTCAGTCTTACACTGA,

ABCB1: GACCATAAATGTAAGGTTT,

Non-targeting control-1: CGACCGAGACAAGCGCAAG (Rohde et al., 2005), and

Non-targeting control-2: AllStar negative control from Qiagen.

RNA isolation, reverse transcription and realtime PCR.

Cells were lysed and total RNA isolated according to kit protocols of Nucleospin® RNA 2

(Macherey-Nagel) including a DNase digestion step. RNA (1 µg) from each sample was

used to synthesize 50 μL cDNA according to kit protocols using TaqMan® Reverse

transcription reagents (Applied Biosystems). Reverse transcription was performed on a

TGradient thermocycler (Biometra).

Realtime PCR was performed in 10 µl reactions with 0.4 μM final primer concentrations

according to the kit protocols of LightCycler® FastStart DNA MasterPLUS SYBR Green I

(Roche) and using the Lightcyler® 2.0 (Roche). The PCR programs were according to

Lightcycler® 2.0 protocol using a 2 s and 60° C annealing step. The ΔΔCt method was used

to calculate mRNA levels.

The SMPD1/Smpd1 and ASAH1/Asah1 mRNA expression relative to that of control mRNA

was analyzed by realtime PCR employing the following primers in human (hs) and murine

(mm) cells:

hsSMPD1-forward: 5’-GCCCAATCTGCAAAGGTCTA-3’,

hsSMPD1-reverse: 5’-TTCAGCAGATTGCACAGCTT-3’,

hsASAH1 forward: 5’-GTCTGAACCGCACCAGCCAAGAG-3’,

hsASAH1-reverse: 5’- TCAGGGCAGTCCCGCAGGTAAG-3’,

hsPPIB-forward: 5'-GGGAGATGGCACAGGAGGAAAG-3’,

hsPPIB-reverse: 5’-TGGGAGCCGTTGGTGTCTTTG-3’.

mmSmpd1-forward: 5’-ACACTCTGGCCGGTCAGTTCTTTGG-3’,

mmSmpd1-reverse: 5’-TGGTGTGCCTCCTGCTGCGT-3’,

mmAsah1-forward: 5’-CCTAGCCGCGGCAGTCACCT-3’,

mmAsah1-reverse: 5’-GTGTGCCACGGAACTGGTCCTCT-3’,

mmPpia-forward: 5’-CCTTGGGCCGCGTCTCCTT-3’,

mmPpia-reverse: 5’-CACCCTGGCACATGAATCCTG-3’,

mmHmbs-forward: 5’-GAGCTAGAAAACGCCCTG-3’, and

mmHmbs-reverse: 5’- GAGGTTTCCCCGAATACTC-3’.

mmSmpd3 forward and reverse: Qiantitect primer assay #QT00153573 (Qiagen)

SUPPLEMENTAL REFERENCES

Diettrich, O., Mills, K., Johnson, A. W., Hasilik, A., and Winchester, B. G. (1998). Application of

magnetic chromatography to the isolation of lysosomes from fibroblasts of patients with lysosomal

storage disorders. FEBS Lett 441, 369-372.

Jäättelä, M., Benedict, M., Tewari, M., Shayman, J. A., and Dixit, V. M. (1995). Bcl-x and Bcl-2

inhibit TNF and Fas-induced apoptosis and activation of phospholipase A2 in breast carcinoma

cells. Oncogene 10, 2297-2305.

Jäättelä, M., Wissing, D., Bauer, P. A., and Li, G. C. (1992). Major heat shock protein hsp70

protects tumor cells from tumor necrosis factor cytotoxicity. EMBO J 11, 3507-3512.

Kolzer, M., Werth, N., and Sandhoff, K. (2004). Interactions of acid sphingomyelinase and lipid

bilayers in the presence of the tricyclic antidepressant desipramine. FEBS Lett 559, 96-98.

Nylandsted, J., Gyrd-Hansen, M., Danielewicz, A., Fehrenbacher, N., Lademann, U., Høyer-

Hansen, M., Weber, E., Multhoff, G., Rohde, M., and Jäättelä, M. (2004). Heat shock protein 70

promotes cell survival by inhibiting lysosomal membrane permeabilization. The Journal of

experimental medicine 200, 425-435.

Rohde, M., Daugaard, M., Jensen, M. H., Helin, K., Nylandsted, J., and Jäättelä, M. (2005).

Members of the heat-shock protein 70 family promote cancer cell growth by distinct mechanisms.

Genes Dev 19, 570-582.

van Diggelen, O. P., Voznyi, Y. V., Keulemans, J. L., Schoonderwoerd, K., Ledvinova, J., Mengel,

E., Zschiesche, M., Santer, R., and Harzer, K. (2005). A new fluorimetric enzyme assay for the

diagnosis of Niemann-Pick A/B, with specificity of natural sphingomyelinase substrate. J Inherit

Metab Dis 28, 733-741.