Vol. 158, No. 3JOURNAL OF BACTERIOLOGY, June 1984, p. 934-9420021-9193/84/060934-09$02.00/0Copyright © 1984, American Society for Microbiology

Structure of an Escherichia coli tRNA Operon Containing LinkedGenes for Arginine, Histidine, Leucine, and Proline tRNAs

LILIAN M. HSU,t HARRY J. KLEE,t JOHN ZAGORSKI, AND MAURILLE J. FOURNIER*Department of Biochemistry, University of Massachusetts, Amherst, Massachusetts 01003

Received 12 December 1983/Accepted 15 March 1984

A plasmid containing a gene for the most abundant Escherichia coli leucine isoacceptor tRNA,tRNALeU(anticodon CAG) was isolated from the Clarke-Carbon bank of cloned E. coli DNA. The clone contains a12.3-kilobase DNA insert which was mapped by F' DNA hybridization analysis to the region 82 to 89 min onthe chromosome. The cloned tDNALeU corresponds to the minor of two chromosomal regions containingdifferent amounts of DNA complementary to tRNAcAeu&. Sequencing of the tDNA region revealed it tocontain a multimeric transcription unit consisting of four different tRNA genes. The genes are in thearrangement 5'-leader-tRNAc73-57 base pairs-tRNAgusG-20 base pairs-tRNALAeuG-42 base pairs-tRNAUGG-3'. Coordinate expression of the component tRNAs in vivo and the absence of intercistronic promotersindicated that all four tDNAs reside in the same operon. The tDNA sequence is bounded by a promoterelement showing good agreement with the procaryotic consensus sequence and a GC-rich stem-loopelement that corresponds to a rho-independent terminator. The promoter region contains a GC-richsequence that agrees with a suggested consensus stringency control element and two domains possessingdyad symmetry which flank the Pribnow box and include the putative stringency control region.

The resolution of many fundamental questions abouttRNA biosynthesis will require in depth structure-functionstudies with isolated genes. To this end we describe here theisolation and sequence analysis of an Escherichia coli tran-scription unit containing genes for four different tRNAs. Atthe onset of this work we decided to study the biosynthesisof the major leucine tRNA isoacceptor, tRNAlLeu (anticodonCAG). Reasons for choosing this particular species includedthe fact that it constitutes a highly abundant tRNA apparent-ly subject to unique regulatory control (7, 21) and might alsopossess interesting nontranslational functions (52). Of addedinterest was the knowledge that this isoacceptor is derivedfrom atypically large precursor molecules (24), probablyfrom two genetic loci (23).The high relative abundance of tRNALeU, at about 3 to 6%

of the total tRNA (21), is a direct reflection of the frequencywith which its codon is utilized in translation (13, 19, 20). Itfollows then that regulation of the level of tRNA LeU shouldhave a direct effect on the protein-synthesizing activity in thecell. An interesting example supporting this view is theinvasion of E. coli by T2 and T4 phages. After infection, aphage-encoded endonuclease is produced that specificallyand rapidly cleaves tRNALeu into half molecules (59). Theresult is an impairment of host protein synthesis and afavoring of translation of the CUG-deficient phage mRNAs(26).

Cellular levels of tRNA in E. coli are known to be subjectto both stringent control and metabolic regulation (35, 50).However, the mechanisms of these control systems are notyet known, nor is it known to what extent the synthesis ofindividual tRNAs is subject to both control phenomena.Despite this lack of information, the control of tRNA1eUsynthesis does appear to be unique among E. coli tRNAs. Inthis regard, tRNA eu synthesis has been shown to escape

* Corresponding author.t Present address: Program in Biochemistry, Mount Holyoke

College, South Hadley, MA 01075.t Present address: Department of Microbiology, University of

Washington, Seattle, WA 98195.

stringent control in at least two conditions. In one case it wasdetermined that trimethoprim allows synthesis to persistwhen bulk tRNA production is otherwise inhibited; thisagent is known to interfere with C1 metabolism and cause theaccumulation of methyl-deficient tRNA (21). Stringent con-trol of tRNALeu was also observed to be preferentiallycompromised during amino acid starvation of a hisT straindeficient in a tRNA pseudouridylate synthetase (7). Under-modified tRNALeU is produced in both situations, suggestingthe possibility of autoregulation and a potential regulatoryrole for base modification.With regard to the aforementioned unique biological roles,

it had been established at the time this work was initiatedthat leucine tRNA can participate in unique nontranslationalroles. Although the relevant isoacceptors have yet to beidentified, it has been clearly demonstrated that tRNALeUand tRNAPhe can donate amino acids in the post translation-al modification of certain proteins (52). Also unique was thedemonstrated involvement of leucine tRNA in the regulationof branched-chain amino acid transport (39).

In this report we describe the isolation of a clone from anE. coli DNA library which corresponds to the minor of twochromosomal loci containing genes for tRNALeu. The clonedDNA was mapped and the tDNA region was sequenced. Theresults showed the tRNALeu coding sequence to be part of atetrameric tRNA gene operon containing linked genes fortRNAcc&, tRNAU'sG, tRNACAeG, and tRNAPuo.

MATERIALS AND METHODSBacterial strains and culture conditions. The Clarke-Car-

bon bank of E. coli transformants harboring ColE1-E. colihybrid plasmids was the source of cloned E. coli DNAfragments (6). Chromosomal DNA was prepared from E. coliCS520 (HfrC trpA58 metB glyV sup-58). Except whereindicated, E. coli JA200 (F+ AtrpE5 recA thr leu lac I) wasthe source of tRNA and leucine-tRNA synthetase. ColicinEl was prepared from E. coli W3110(ColE1) by the methodof Schwartz and Helinski (42). The colony bank and afore-mentioned strains were obtained from J. Carbon, transmit-ted via J. Calvo. F'-containing E. coli strains KLF33(JC1553)

934

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

E. COLI Arg-His-Leu-Pro tRNA OPERON 935

with the episome F133 and KLF11(JC1553)(F111) were ob-tained from B. Bachmann of the E. coli Genetic StockCenter at Yale University. F'-containing strains were grownin Vogel-Bonner medium supplemented with 0.5% glucoseand 50 to 100 ,ug of each required amino acid per ml (31). Allother cultures were grown in standard L broth or M-9medium supplemented with glucose and Casamino Acids(31). Growth at 37°C was monitored by measuring theabsorbance at 600 nm in a Gilford spectrophotometer.

Preparation of DNA. Cleared lysates enriched for plasmidDNA were prepared by the procedure of Sidikaro andNomura (45), and where indicated, plasmid DNAs werepurified by CsCl gradient centrifugation (45). ChromosomalDNA was isolated by the Marmur method (29).Colony screening procedure. In the first round of screen-

ing, cleared lysates were prepared from 50-ml culturescontaining a mixture of 12 colonies. The lysates were phenolextracted, and the DNA was concentrated by precipitationwith ethanol and resolubilized in 300 Rl of lx SSC (SSC is0.015 M sodium citrate plus 0.15 M sodium chloride [pH7.0]). Duplicate 25-,ul portions of each DNA sample werespotted onto 1.0-cm-diameter nitrocellulose filters (MilliporeHAWP 304). DNA was denatured directly on the filters byspotting 25 ,ul of 0.5 N NaOH. The filters were washedsuccessively for 5 min each in 0.5 M Tris-hydrochloride (pH7.5)-l x SSC-95% ethanol. Washing was accomplished byplacing the disks on top of Whatman 3 MM filter papersaturated with the appropriate solution. After the final washthe filters were air dried and baked in a vacuum oven at 80°Cfor 1 h.

Hybridization of radiolabeled probe tRNA to the filterswas done according to the procedure of Gillespie andGillespie (12). Typically, ca. 105 cpm of [32PItRNALeu la-beled to a specific activity of ca. 107 cpm/,ug was used per mlof hybridization solution. The extent of hybridization wasdetermined by liquid scintillation counting.

Restriction enzyme analyses. Restriction enzymes wereobtained from New England Biolabs, Bethesda ResearchLaboratories, and P-L Biochemicals and digestions wereperformed as recommended by the supplier. Digestions werestopped by making samples 4% sucrose-10 mM EDTA-0.05% bromophenol blue. The DNA digests were fractionat-ed by electrophoresis in 1% agarose gels by the Tris-acetatebuffer system of Helling et al. (15). DNA fragments weretransferred from the gels to nitrocellulose filters by theprocedure of Southern (53). Hybridization of radiolabeledtRNAe was done in 6x SSC-0.2% sodium dodecyl sulfatefor 16 h at 65°C, after which the filters were washed for 3 h in6x SSC at 650C, rinsed in 2x SSC, air dried, and autoradio-graphed at -85°C with Kodak XR-1 film and DuPont Cronexintensifying screens. Restriction maps were obtained byelectrophoretic analyses of single and double digests ofplasmid DNA followed by hybridization with radiolabeledtRNALeu. Fine mapping was achieved by the method ofSmith and Birnstiel (51).

Aminoacylation and RPC-5 column analyses. Unfractionat-ed tRNAs from plasmid-containing (pLC25-25) and noncon-taining (JA200) cells were prepared by the method of Four-nier and Peterkofsky (11). Aminoacylation and RPC-5column chromatography were done as described by Kitch-ingman and Fournier (27, 28), and unfractionated aminoacyl-tRNA synthetase was prepared by the method of Muenchand Berg (32). For the quantitation of leucine tRNA synthe-tase activities, protein concentrations were determined bythe procedure of Bradford (3), and enzyme activity wasmeasured in reactions which were 100 mM sodium cacody-

late (pH 8.2), 60 mM MgC92, 4 mM ATP, 4 mM NH4CI, 2.5mM ,-mercaptoethanol, and 15 ,uM [3H]leucine and con-tained 1 absorbance unit at 260 nm (A260) of unfractionatedtRNA and a limiting amount of enzyme as determined inpreliminary assays. Acylation assays for histidine and pro-line were carried out under similar conditions, except thereaction mixtures were 50 mM Tris-hydrochloride (pH 7.5),18 mM MgCl2, 4 mM ATP, 10 mM ,-mercaptoethanol, 5 mMNH4Cl, and radioactive amino acid at 10 to 50 ,uM. Allreactions were done at 37°C.

Preparation of radiolabeled tRNALeu. tRNALeu (anticodonCAG; Plenum Scientific) with an amino acid acceptor activi-ty of at least 1,600 pmol per A260 was treated with bacterialalkaline phosphatase (electrophoretic grade, Sigma Chemi-cal Co.) at 0.005 U/±g of tRNA (47). Phosphatase-treatedtRNA was then labeled by using T4 phage polynucleotidekinase (from C. 0. Yehle and Boehringer-Mannheim) and[y-32P]ATP (2,000 Ci/mmol; New England Nu,lear Corp.) asdescribed by Simoncsits et al. (48). After labeling, the tRNAwas recovered by electrophoresis through a 10% polyacryl-amide-7 M urea gel (8). The gel area corresponding to intact

LeuAexrctRNA, was excised, extracted with 2x SSC, and subject-ed to chromatography on DEAE-celluose (57). Specificactivities obtained were routinely ca. 107 cpm/p.g.

Scanning of autoradiograms. Autoradiograms from South-ern analyses were scanned at 450 nm on a Gilford 240spectrophotometer with a linear transport unit. Quantitationof the hybridization results was performed by cutting andweighing the tracings from the densitometric scans. At leasttwo films of different exposure were analyzed to ensure thatband intensities accurately reflected the levels of radioactiv-ity.

Determination of plasmid copy numbers. Portions (50 ml)of a 200-ml culture of JA200(pLC25-25) in M-9 medium wereremoved at 0, 4, 8, and 16 h after the addition of chloram-phenicol (150 ,ug/ml). At mid-log phase (A60 = 0.5), suitabledilutions from each portion were plated on L agar todetermine the cell count. Cleared lysates were preparedfrom the remainder of the culture samples (45). Portions ofeach cleared lysate were then electrophoresed on agarosegels together with known amounts of a standard plasmidDNA. The gels were stained with ethidium bromide andphotographed, and the negatives were optically scanned asdescribed above. The yields of plasmid DNA were estimatedby comparison of the band intensities with those of thestandard DNA samples.DNA sequencing. The procedure of Maxam and Gilbert

(30) was used to determine the sequence of the tRNAoperon. The results were derived from analyses of bothstrands carried out with overlapping sets of restrictionfragments. 32P-end-labeled DNA fragments were subjectedto strand separation (55) or cleaved with a second restrictionenzyme before analysis. Routinely, about 7,000 Cerenkovcpm was used per chemical modification-cleavage reaction,with the ensuing electrophoretic separation carried out on0.3-mm-thick gels. Autoradiography was at -80°C for 2 to 3days with Kodak XAR-5 film and an intensifying screen(DuPont Hi-Plus). The strategy of the sequencing is depictedin Fig. 4.

RESULTSSouthern hybridization analysis of tRNA Leu DNA. From

measurements of individual tRNA levels in various F' epi-some and lambda lysogen strains, Ikemura and Ozeki wereable to identify two loci on the E. coli chromosome whichinfluence tRNAieu production (23). These loci map at 82 to

VOL. 158, 1984

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

936 HSU ET AL.

84 min and 90 to 93 min. Although it seemed likely that theseloci probably correspond to functional structural genes,Southern hybridization analyses were carried out to obtainmore direct information about the genomic organization ofthe tRNAlLeu DNA. Hybridization of 5' end-labeled[32PItRNAL eu to filter-bound genomic DNA cut with avariety of restriction enzymes revealed the occurrence oftwo distinct DNA segments complementary to the probe, amajor and a minor band (Fig. 1). The difference in intensitypresumably reflects concentration differences for the com-plementary tDNA sequences at the two loci.

Screening of a colony bank for tDNAILeu clones. The Clarke-Carbon collection of hybrid ColE1-E. coli plasmids wasscreened for tRNALeU clones by hybridization of radiola-beled tRNA,eu to plasmid-enriched DNA immobilized onnitrocellulose filters. To facilitate the task of screening the2,100 colonies in the library, the colonies were first screenedin groups of 12. Of the 175 pools, a single positive wasobtained, corresponding to clones pLC25-25 through 25-36.Under the hybridization conditions used, 4 to 5 times moretRNALeu was bound to the DNA from this group than wasbound to the other DNA pools. DNA was next preparedfrom each of the 12 candidate colonies and assayed fortDNALeu by the same hybridization procedure. One colony,pLC25-25, gave a positive result. Confirmation of this colo-ny as a tRNALeU clone came from results of Southernhybridization analyses, shown and described below.Chromosomal location of the cloned tDNA. To determine

which of the two tRNA,eu gene loci is present in pLC25-25,the Southern hybridization patterns of chromosomal andplasmid DNAs were compared. The restriction enzymesBamHI and PvuII were used since both cut within the clonedinsert to yield a fragment carrying the tDNA sequence. Theresults (tracks A and B, and D and E, Fig. 2) indicated thatthe tDNALe, sequence in pLC25-25 corresponds to theminor of the two chromosomal bands.An attempt to establish the chromosomal location of the

cloned tDNA was next made by quantitative analysis of

r. L

P*.}

FIG. 1. Autoradiograph of [32P]tRNALeu hybridized to restrictedE. coli K-12 chromosomal DNA. Chromosomal DNA was digested,fractionated by electrophoresis in 1.0% agarose gels, tranferred tonitrocellulose filters, and hybridized with [32P]tRNA'u as describedin the text. A HindIII digest of X DNA was included for sizemarkers. The results shown are for DNA digested with (A) Sall, (B)BamHI, (C) EcoRI, (D) HindlIl, (E) BglII, and (F) HinclI.

kbpA B ' D E F

10.6-

7.0 -

4.7 -

FIG. 2. Results for hybridization of [32P]tRNALeu with restrictedE. coli JA200 chromosomal DNA, pLC25-25 plasmid DNA, andDNA from the merodiploid strain KLF33(JC1553). Each reactioncontained either 7 ,ug of chromosomal or F' strain DNA or 0.5 ,ug ofplasmid DNA. Southern blot analyses were performed as describedin the text. Tracks A-C and D-F show the hybridization patternsobtained with BamHI and PvuIl digests, respectively, for E. coli K-12 chromosomal DNA (A, D), pLC25-25 plasmid DNA (B, E), andstrain KLF33(JC1553) total cell DNA (C, F). Sizes indicated for thehybridized bands were extrapolated from a nomogram constructedwith X DNA-HindIII molecular weight standards.

Southern blot patterns obtained with DNA from an assort-ment of F' episome-containing strains. Here it was reasonedthat DNA from merodiploids containing a greater than usualcontent of tDNALeU should hybridize more [32P]tRNALeuthan control DNA from a non-episome-bearing strain. Be-cause the earlier mapping results indicated that genes affect-ing tRNAI eU production map at 82 to 84 and 90 to 93 min(23), F' strains with duplications in these regions wereincluded in the analysis. The relative contents of restrictionfragments complementary to tRNAI eU were determined bydensitometric scans of autoradiograms.The radiograms from an analysis of KLF33(JC1553) DNA,

with a duplication of the 82- to 89-min region, are shown inFig. 2 (tracks C and F). The results obtained with a PvuIIdigest showed that the merodiploid DNA contains approxi-mately twice as much of the tDNALeU sequence in pLC25-25as does control chromosomal DNA. The ratio of the major tominor bands changed from ca. 2:1 for wild-type chromo-somal DNA to ca. 1:1 for F133-containing DNA. Similarresults were obtained with BamHI digests and also withDNA from strain KLF11(JC1553) with a larger duplicationspanning the region 81 to 91 min (results not shown). Sinceall DNA samples in each series were transferred togetherfrom the same gel, the observed change in ratio is presumednot to be due to variable efficiency offragment transfer to thefilters. Thus, these results suggest that the 82- to 89-minregion of the chromosome indeed contains structural DNAfor tRNAi eu.

In vivo expression of the cloned tDNA. To assess thefunctionality of the cloned tDNA, the leucine acceptoractivity and isoacceptor patterns were determined for tRNAisolated from recombinant strain pLC25-25 and the plasmid-free host, E. coli JA200. The leucine acceptor activities ofbulk tRNA prepared from JA200(pLC25-25) and host cellsgrown under identical conditions were 222 and 138 pmol perA260, respectively. This result shows that the transformants

J. BACTERIOL.

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

E. COLI Arg-His-Leu-Pro tRNA OPERON 937

contained some 60% more leucine tRNA, an indication thatthe cloned tDNA is expressed.The isoacceptor patterns for the leucine tRNAs from the

two strains were then compared to identify the tRNALeUspecies overproduced. Crude tRNA from the two cell typeswas aminoacylated with [14C]- or [3H]leucine, mixed, andcochromatographed on an RPC-5 column. Analysis of thenormalized elution profiles (Fig. 3) revealed that the pLC25-25 transformants contained 2.5 times as much tRNAleu(fractions 27 to 34) as the control strain.

In addition to overproducing the major tRNA Leu isoaccep-tor, the tDNA clone also contained more of the subspecieseluting in fractions 35 to 40. It is not known whether thismaterial corresponds to a genetically unique species or avariant of a normal species. Some have suggested it is simplya nuclease-nicked form of tRNAIeu (18), but this materialcould also be a modification-deficient form known to elute inthis region (27, 28). Both possibilities are consistent with theobservation that the presence of this species is variable andoften undetected (Fournier et al., unpublished data). Thus,the increase in leucine acceptor activity in pLC25-25 trans-formants is the result of higher levels of tRNA Leu andpossibly a second minor but unique tRNALeU.

Effect of tRNAIeu gene dosage on tRNA eU and leucyl-tRNAsynthetase levels. To gain insight into the regulation oftRNA eu synthesis, the effect of gene dosage on the tRNAleUlevel was examined. Because replication of the ColEl plas-mid is under relaxed control, plasmid copy number can beamplified simply by culturing with chloramphenicol. tRNAsynthesis continues under this condition, although the newlysynthesized species are modification deficient (28). To deter-mine the extent to which tRNALeu production is correlatedwith gene dosage, tRNA Leu and plasmid DNA levels werecompared for cells cultured in chloramphenicol for 4, 8, and16 h. The results of these determinations showed that theplasmid copy number increased from a low of 2 to 4 in theabsence of chloramphenicol to about 100 per cell after 16 h ofexposure to the drug. The intracellular concentrations oftRNAleu largely in the form of modification-deficient spe-cies with normal acylation behavior (28), do not increaseproportionately with the plasmid DNA. Whereas the ColEltDNA content increased about 25- to 50-fold over the 16-hperiod, the level of tRNA Leu increased by less than a factorof two.Because there is an apparent stoichiometric relationship

between bacterial tRNAs and cognate aminoacyl-tRNAsynthetases, it is generally believed that their levels arecoordinated (4). To determine whether the tRNALeu increasein pLC25-25 transformants has any effect on the cellularlevel of leucyl-tRNA synthetase, the relative amounts ofsynthetase in transformed and nontransformed cells werecompared. No difference was observed in the relative con-tents of synthetase when S-100 extracts from the two typesof cells grown in L broth medium were assayed. This resultimplies that synthetase is not limiting under normal growthconditions.

Restriction map of pLC25-25. The molecular size ofpLC25-25 DNA was determined by agarose gel electropho-resis to be about 18.7 kilobases (kb). This corresponds to aDNA insert of 12.3 kb in the ColEl vector. A retriction mapconstructed as a prerequisite to DNA sequencing is shown inthe upper portion of Fig. 4. The tDNALeu coding region wasinitially localized by Southern hybridization analyses to a1.9-kb BamHI-EcoRI fragment near one end of the insert.This fragment was subsequently fine mapped by the proce-dure of Smith and Birnstiel (51).

6 l

i2

0

8E

4 I'i

o o 20 30 40 50 60 70 80

Fract ion NumberFIG. 3. Reversed-phase chromatography (RPC-5) of leucine

tRNA from E. coli JA200 and JA200(pLC25-25). The tRNA sampleswere aminoacylated in vitro separately with ["4C]- or [3H]leucine,mixed, and cochromatographed as described in the text. Theresulting isoacceptor profiles were normalized for the total activityin peaks 4 and 5. Dashed line, 14C, JA200 tRNA; solid line, 3H,JA200(pLC25-25) tRNA.

To determine whether other tRNA genes are encoded inthe cloned insert, parallel hybridizations with pLC25-25DNA were performed with [3PtRNAleantolE.citRNA. The results indicated that only the 1.9-kb BamHl-EcoRI fragment contains tDNA sequences (results notshown). Subsequent sequencing revealed that this fragmentcontained three other tRNA cistrons in addition to that fortRNAL . We do not know whether the unsequenced portionof this fragment contains other tRNA genes.DNA sequence analysis. A nucleotide sequence of about

650 base pairs (bp) from the mid-portion of the BamHl-EcoRI fragment has been de'termined by the Maxam-Gilbertmethod (30). The sequencing strategy used is shown in thelower portion of Figure 4 and the sequence spanning thetDNA region is shown in Fig. S. The tRNALeu cistron wasreadily identified because of the availability of the RNAsequence (9). Inspection of the flanking sequences revealedthe occurrence of three other tDNAs in 'close proximity,corresponding to arginine, histidine, and proline tRNAs. Ofthe three additional encoded RNAs, sequence informationwas available only for the histidine species (49). The identi-ties of the arginine and proline tRNA genes were deducedfrom the anticodons of the encoded sequences. The fourtDNAs are in the order 5'-tRNMUb - tRNAguiG -

tRNA&A`G - tRNAUFrGOG-3'. A hypothetical secondary foldingscheme for a transcript from this region is shown in Fig. 6.Because the tRNAArg gene occurs first, it is appropriate torefer to this transcription unit as the tRNAArg operon.The DNA was next examined for promoter and terminator

elements with a view to defining the transcription system(s).No promoter-like sequences occur between the tDNAs,suggesting that all four are part of the same transcriptionunit. The presumptive promoter was identified 21 nucleo-tides upstream of the tRNAArg sequence. The sequencescomprising the -35 and -10 domains TAGACA (nucleo-tides 83 to 88, Fig. 5) and TATTAT (nucleotides 106 to 111)are both in good agreement with the consensus sequence forprocaryotic promoters (-35:TTGACA and -10:TATAAT

VOL. 158, 1984

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

938 HSU ET AL.

E o0 -mII .-

0 E0

do

I 1 - -.= _ --~~~~~1935 bp ~-

, -- 3 5 --_PrL%I 1.U .

A v

Hga I Ava 11 Hga IAlu I

DdeII

Hoe11 IIII

Hhah I

Hinf I I !

MsplI II

Pvu11LSau3A I

Taq I

J 651 bp l

100 bp

,- 51 *5'i

,3 3' 5':

500 400 300 200 100 *1 -100:

* 15 * 5' 3_ 5' * 5' e 5'

FIG. 4. Restriction map of pLC25-25 and sequencing strategy. The shaded segments in the restriction map, shown in the upper portion ofthe figure, represent the tRNA gene region, and the open bar represents the ColEl vector DNA. The tDNA was localized by hybridization tomapped restriction fragments. The sequencing strategy is depicted in the lower portion of the figure.

[14, 41, 46]). These elements are separated by 17 bp, a

spacing that is apparently optimal for most bacterial genepromoters sequenced thus far (14). Results to be presentedelsewhere show that transcription does in fact commence inthis region in vitro.Between the Pribnow box and the transcriptional start

point is a GC-rich element that corresponds both in positionand composition to a suggested consensus domain for genesunder stringent control (56; L. M. Hsu, manuscript inpreparation). Of added interest in the promoter-initiationregion are sequence elements showing dyad symmetry.These elements, GGGGTGG and CCACCCC (pucleotides91 to 97 and 112 to 118, see Fig. 5), flank the Pribnow' boxand include the putative stringency control sequence. Thisparticular location suggests the possibility that the palin-dromic elements could be functionally important in regulat-ing transcription.A search for terminator-like elements revealed the pres-

ence of an excellent candidate immediately after thetRNAPro region. Five bases from the 3' end of the tDNA is a

30-bp sequence possessing the major structural features of a

rho-independent terminator. This region can be folded into aGC-rich stem-loop structure resembling the canonical hair-pin of the rho-independent terminator and is also succeededby a run ofT residues (eight of nine bases) where terminationis likely to occur (41). Preliminary results from in vitrotranscription assays support the conclusion that this elementdoes indeed correspond to a functional terminator.Taken together, these results indicate that the cloned

tRNALeu gene is part of a tetrameric tRNA gene operon.Encoded in the operon is a transcript of about 480 nucleo-tides with the structure 5'-leader-tRNAArs-57 bp-tRNAHis-20bp-tRNALeu-42 bp-tRNAPro-trailer-3'. Although the preciselocations of the transcriptional start and stop points are notyet known, initiation is presumed to occur at or adjacent toG120 of the sequence shown and termination at or nearT599. The assorted stem-loop structures flanking the individ-ual tRNA sequences in a primary transcript could corre-

spond to recognition sites for processing RNases.The putative full-length transcript has an overall GC

content of 54%, whereas the mature tRNAs contained withinit are 61% GC, consistent with the value for other E. colitRNAs. The GC content of the sequences deleted by proc-essing is only 40%, and especially low values of 25 and 24%occur for the intercistronic spacers flanking the tRNAILeusequence.

In vivo expression of the operon. On discovering that thecloned tRNALeU gene was part of a multigene sequence, we

measured the cellular levels of two other tRNAs encoded bythe cloned DNA. Amino acid acceptor assays for histidineand proline tRNAs showed that transformants containingpLC25-25 also overproduced these RNAs. As was the casefor tRNAI'eu, the acceptor activities for histidine and prolinewere enhanced threefold, supporting the conclusion that allfour tRNAs are cotranscribed from the same operon (resultsnot shown). RPC-5 column assays were not performed forthese species since earlier work had shown one main peak ofactivity for both RNAs (11). The simple RPC-5 column

z0o-I r- I

a .

J. BACTERIOL.

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

E. COLI Arg-His-Leu-Pro tRNA OPERON 939

5'- CGGGAAAGCG CATAAACTGGAGGAATAAG CA 6 CAAAACGCACAAACCG 50-35

TAACCAAACGCGCAATTTATTTAAAAAGGGAC T AGACAGAGGGGTGGGAA 1-10

GTCCGTATTATCCACCCCCGCAACGGCGCTAAGCGCCCGTAGCTCAGCTG 150ARG- GC G C C C GU A G C U C A G C U G

GATAGAGCGCTGCCCTCCGGAGGCAG A GGTCTCAGGTTCGAATCCTGTCG 220GAUAGAGCGCSGCCCUCCGGAGGCAGAGGUCUCAGGUUCGAASCCUGSCGGGCGCGCCAT T TAGTCCCGGCGCTTGAGCTGCGGTGGTAGTAATACCGCG 2506G CG C G C C A -3

TAACAAG ATTT GTAGTGGTGG CTATAGCTCAGTTGGTAGAGC CCTG GAT T 30HIS- G GUGGCT AU AG CU CA GUU GGU A GAG CCC UG GA UU

GTGATT CCAGTTGTCGTGGGTTCGAATCCCATTA GCCACC C CATTATTAG 3506 U 6 A S U C C A 6 U U 6 U C 6 U 6 6 6 U U C 6 A A S C C C A U S A 6 C C A C C C C A -3

AAG TTGTGACAATG CGAAGGTGGC GAATTGGTAGACGC G CTAG CTTCAG 400LEU- GC GA A G GU G6GC G6G A A 5U UG G U A 6 A C G C G CU AG C' U C A G

GTGTTAGTGTCCTTACGGACGTGGGGGTTCAAGTCCCCCCCCTCGCACCA 450GSGSSAGSGUCCUSACGGACGUGGGGGUUCAAGUCCCCCCCCSCGCACCA

CGACTTTAAAGAATTGAACTAAAAATTCAAAAAGCAGTATTTCGGCGAGT 500-3' PRO- C GG C GAGU

AGCGCAGCTTGGTAGCGCAACTGGTTTGGGACCAGTGGGTCGGAGGTTCG 550AGCGCAGCSSGGSAGCGCAACSGGUSSGGGACCAGSGGGSCGGAGGSSCG

AATCCTCTCTCGCCGACCAATTTTGAACCCCGCTTCGGCGGGGTTTTTTG 60A A U C C S C U CU C C C G A C C A -3

TTTTCTGTGCATTTCGTCACCCTCCCTTCGCAATAAACGCCCGTAATA-3' 650FIG. 5. Sequence of the E. coli tRNAArg operon. The DNA sequence was determined by the Maxam and Gilbert method as described in

the text. The DNA bases are shown in large type and the encoded tRNAs are shown in small type. The -35 and -10 domains of the promoterare marked with overlines. Regions exhibiting dyad symmetry are indicated with overline arrows.

profiles and threefold increase in acceptor activity suggestthat the tRNAHiS and tRNAPro genes cloned may be themajor source of these acceptor species.

DISCUSSION

As noted earlier, the tRNAA`G isoacceptor is one of themost abundant tRNA subspecies in E. coli. This high relativeabundance is likely due to the existence of four gene copies.At this level, the gene dosage is the largest reported thus farfor any single E. coli tRNA. Interestingly, the four genesoccur at two loci in operons of different compositions. Amajor locus contains three tandem tRNAjeU genes as thesole encoded species (10), whereas the fourth gene is part ofthe tRNA operon described here. All four tRNALeU DNAsare identical in sequence.The close association of genes for tRNAHIS and tRNAlU

has been noted in earlier reports (5, 23, 40). By using A-lysogen induction, Ikemura and Ozeki were able to mapgenes for both species to the same locus at 82 to 84 min (23).Close proximity of these two genes was further suggested byresults from Southern hybridization analyses (5). In thecases of the other two tRNA genes, there have been noreports indicating that either occurs in this region of thechromosome. Ikemura and Ozeki did report the occurrenceof a gene in this region for an unidentified tRNA which theylabeled tRNA P. Although an arbitrary choice, this designa-tion has proven appropriate in view of our finding that one ofthe gehes in the tDNA cluster is for proline tRNA.One earlier report provides evidence for cotranscription of

the genes in the tRNAArg operon described here. By using atemperature-sensitive mutant with a defect in a processingenzyme called RNase E, Ray and Apirion observed theaccumulation of a 9.5S tRNA precursor containing se-quences for tRNAleu, tRNAHi , and a third, unidentifiedtRNA (40). Inspection of their Ti RNase oligonucleotidesequence data indicate that the third tRNA is the tRNAPro

species identified in the current study. The absence of afourth tRNA in the RNase E precursor (about 350 nucleo-tides in length) indicates that the tRNAArg sequence hadprobably already been released by prior processing.

In work to be reported elsewhere, we have obtainedevidence that all four genes in the operon are indeedcotranscribed (L. M. Hsu et al., manuscript in preparation).In vitro transcription of the 1.9-kb BamHI-EcoRI fragment(Fig. 4) yields transcripts of about 500 bases. This is the sizeexpected for a transcript defined by the putative promoterand terminator elements identified in our sequence analysis.Comparison of the tRNAArg and tRNAmet operons (34)

reveals a striking near-perfect homology of 13 nucleotidesspanning the region -4 to +9. Except for one mismatch, thesequence CCCCGCAACGGCG is identical in both operons.The underlined G is the transcriptional start point for thetRNAmet operon (34). Because of the similarity and compa-rable position of these sequences to the Pribnow box, itseems reasonable to suppose that transcription of thetRNAArg operon may also initiate at the same correspondingG residue.

Since this work was completed, Bossi and Ciampi havecloned a corresponding tRNA operon from Salmonella ty-phimurium (2). Characterization of the clone indicates con-servation of the gene sequences for the two species, al-though many sequence differences occur in the spacerregions.At this writing, the sequences of six other E. coli tRNA

gene systems have been described (1, 10, 17, 33, 43, 44, 54).Comparison of the tRNA'rg operon with the others showsthe -35 and -10 promoter domains in each operon to be ingood agreement and to agree with consensus sequences forall E. coli genes (14, 41, 46; H. Ozeki and M. J. Fournier,manuscript in preparation). Likewise, the GC-rich heptanu-cleotide sequence in the tRNAArg operon which correspondsto that believed to be involved in stringent control is in goodagreement with the consensus sequence first identified by

VOL. 158, 1984

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

940 HSU ET AL.

C C U uA GGG C A

AC U CC G tNAG

UC UC G

AU G C

G G A

C u G G

GAA C

GU

GCGCUUG

GCU

Akg

GA

CG UUU

U G C

U GG C GU G G~GC'U

C

C

G G C

U A u

U U C-G,,C.G

tRNAW

U U G AUG GA

AGG

C U CG G UU

GCGC CGAQ C

U GC

^ U C.G A

AU A U

GCG G

U A C U UU A A.GC U.G U AU..

C G*C G A U A A A AG G G

G CC A

AA U A

A CU A

G A GG U A

UA A.U G.~C UA C.U

G.C AGAA'CUG.CGU'A C,~~~-AC A. C

UA.C G.C CG t k

G.CUG

hooothUGCG U G _C_A*C

U

C AU ACUUG' CC-A G C

GCCUUA U U' UG UC GA *U AG C.G

C C G.6 A U A

U ~~ G G C'UCisU U A G

tRNA U UCU

G.C UCAG. C

U A.

U U

FIG. 6. Sequence and hypothetical secondary structure of the tRA operon transcript. The sequence shown is for the region extendingfrom the promoter through the likely terminator element. The tRNAs are identified by name, and the processing sites at the 3' termini of themature tRNA sequences are indicated with arrows; the 5' termini correspond to the first paired base at the top of each acceptor stem.

Travers (56) and an updated consensus developed from newsequence and expression results (Hsu, in preparation).As noted above, the sequence CCACCCC after the Prib-

now box in the tRNAArg operon shows dyad symmetry witha heptanucleotide sequence GGGGTGG between the -35and -10 domains. The occurrence of these palindromicelements in the control region suggests that they may befunctionally relevant. The centers of the two elements are 22bp apart, corresponding to slightly more than two turns of aDNA B helix (Fig. 5). Similar features in the X PR and alaSpromoters have been shown conclusively to be binding sitesfor repressor proteins (25, 38). Examination of the othertRNA gene promoters reveals similar regions of symmetryfor other operons as well (Ozeki and Fournier, in prepara-tion).The high cellular abundance of tRNALeu (anticodon CAG)

has led to a number of studies of its participation in proteinsynthesis. In an early study, Wettstein made the interestingobservation that the tRNA Leu species was under-represent-ed on the ribosome when the pattern of leucine isoacceptorswas compared for ribosomal and supernatant tRNA prepara-tions (58). Similarly, an analysis of MS2 phage RNA transla-tion showed that tRNA L,U was not the predominant isoac-ceptor on the ribosome; rather, the tRNALeu and tRNA4eusubspecies were (16). Based on these observations, it wassuggested that tRNA Leu might serve a nontranslational role,perhaps regulatory in nature, in addition to participating in

protein synthesis. However, a recent extensive compilationof protein gene sequences has shown that the codons corre-sponding to tRNAceG are, in fact, the most frequently used(13). Furthermore, the bias for the tRNA LeU codon is strong-est by the ribosomal protein genes, which are among themost actively translated gene products in E. coli (36, 37).Thus, the cellular abundance of tRNALeU is directly reflectedin the usage of its codon. This relationship, shown veryconvincingly by Ikemura (19, 20), appears to hold for theother abundant tRNA species as well.

In the context of codon usage, an interesting observationcan be made about the composition of the tRNAAg operonreported here. Of the four tRNAs encoded, tRNARjG,tRNA&A`G, and tRNAFUGG correspond to the major donorsfor their respective amino acids. In contrast, the tRNAMisoacceptor appears to be required only sparingly (13). IftRNA abundance is tied only to codon usage then thetRNAML&. isoacceptor should be present in low levels, thetRNAurGG, and tRNARUG species at intermediate levels, andthe tRNAeAG acceptor at high abundance. The preciseextent to which tRNA levels do correlate with codon needsis still unknown as are the steady-state levels of the individ-ual species. Should the correlation be high, the particularorganization of the tRNAArg operon would appear to pose adilemma in reaching the desired balance of tRNAs. Sincecotranscription of the operon would yield equimolaramounts of the component tRNAs, other means would be

J. BACTERIOL.

A

ucA

.. I

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

E. COLI Arg-His-Leu-Pro tRNA OPERON 941

needed to attain the disparate levels indicated. The possibili-ties for doing so include the occurrence of other gene copiesfor the more abundant tRNAs (true for tRNALeU, but un-known for the other three tRNAs) and differential expressionor turnover of the various species.The relatively small two- to fourfold overproduction of

tRNALeu observed in the current study when the gene copynumber was enhanced at least 25-fold suggests that tRNAproduction is carefully controlled. This result, also observedfor tRNA encoded in an rRNA operon (22), is in markedcontrast to the situation for our cloned E. coli 4.5S RNAgene (Hsu et al., submitted for publication). In this lattercase, RNA production appears to parallel gene dosage to aconsiderable degree, and concentrations some 15-fold overthe normal range have been obtained even without plasmidamplification. Although it is clear that tRNA is subject toboth stringent control and metabolic regulation, the molecu-lar mechanisms of these processes are not understood.Important benefits to be derived from the availability ofcloned operons such as the one described here include thepossibility of conducting in-depth analyses of the regulationof tRNA gene expression and also other aspects of itsbiosynthesis which have yet to be defined.

ACKNOWLEDGMENTSWe thank J. A. Carbon, J. M. Calvo, and B. Bachmann for kindly

providing the colony bank and episome-containing bacterial strains,C. 0. Yehle for polynucleotide kinase, R. Cedergren and JohnThompson for assistance with computer graphics procedures, andespecially John Carbon and Louise Clarke for advice regarding therecombinant DNA technology.

H.J.K. was supported by training grant GM07473 from theNational Institute of General Medical Sciences. The investigationwas supported by Public Health Service grant GM19351 from theNational Institute of General Medical Sciences.

LITERATURE CITED1. An, G., and J. D. Friesen. 1980. The nucleotide sequence of tuiB

and four nearby tRNA structural genes of Escherichia coli.Gene 12:33-39.

2. Bossi, L., and M. S. Ciampi. 1983. The expression of prokaryot-ic tRNA genes in frog oocytes. Nucleic Acids Res. 11:3207-3226.

3. Bradford, M. M. 1976. A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72:248-254.

4. Calendar, R., and P. Berg. 1966. Purification and physicalcharacterization of tyrosyl-RNA synthetase from E. coli andBacillus subtilis. Biochemistry 5:1681-1690.

5. Campen, R. K., G. L. Duester, W. M. Holmes, and J. M. Young.1980. Organization of transfer ribonucleic acid genes in theEscherichia coli chromosome. J. Bacteriol. 144:1083-1093.

6. Clarke, L., and J. Carbon. 1976. A colony bank containingsynthetic Col El hybrid plasmids representative of the entire E.coli genome. Cell 9:91-99.

7. Danchin, A., and L. Dondon. 1979. Regulatory features oftRNA leu expression in Escherichia coli K12. Biochem.Biophys. Res. Commun. 90:1280-1286.

8. Dingman, C. W., and A. C. Peacock. 1968. Analytical studies onnuclear ribonucleic acid using polyacrylamide gel electrophore-sis. Biochemistry 7:659-668.

9. Dube, S. K., K. A. Marcker, and A. Yudelevich. 1970. Thenucleotide sequence of a leucine transfer RNA from E. coli.FEBS Lett. 9:168-170.

10. Duester, G., R. K. Campen, and W. M. Holmes. 1981. Nucleo-tide sequence of Escherichia coli tRNA (Leu 1) operon andidentification of the transcription promoter signal. NucleicAcids Res. 9:2121-2139.

11. Fournier, M. J., and A. Peterkofsky. 1975. Formation of chro-matographically unique species of tRNA during amino acid

starvation of relaxed control E. coli. J. Bacteriol. 122:538-548.12. Gillespie, S., and D. Gillespie. 1971. RNA-DNA hybridization in

aqueous solutions and solutions containing formamide. Bio-chem. J. 125:481-487.

13. Gouy, M., and C. Gautier. 1982. Codon usage in bacteria:correlation with gene expressivity. Nucleic Acids Res. 10:7055-7074.

14. Hawley, D. K., and W. R. McClure. 1983. Compilation andanalysis of Escherichia coli promoter DNA sequences. NucleicAcids Res. 11:2237-2255.

15. Heiling, R., H. Goodman, and H. Boyer. 1974. Analysis ofendonuclease R * EcoRI fragments of DNA from lambdoidbacteriophages and other viruses by agarose-gel electrophore-sis. J. Virol. 14:1235-1244.

16. Holmes, W. M., E. Goldman, T. A. Miner, and G. W. Hatfield.1977. Differential utilization of leucyl-tRNAs by Escherichiacoli. Proc. Natl. Acad. Sci. U.S.A. 74:1393-1397.

17. Hudson, L., J. Rossi, and A. Landy. 1981. Dual functiontranscript specifying tRNA and mRNA. Nature (London)294:422-427.

18. Hurd, R. E., G. T. Robillard, and B. R. Reid. 1977. High-resolution nuclear magnetic resonance determination of transferRNA tertiary base pairs in isolation. 2. Species containing alarge variable loop. Biochemistry 16:2095-2100.

19. Ikemura, T. 1981. Correlation between the abundance of Esche-richia coli transfer RNAs and the occurrence of the respectivecodons in its protein genes. J. Mol. Biol. 146:1-21.

20. Ikemura, T. 1981. Correlation between the abundance of Esche-richia coli transfer RNAs and the occurrence of the respectivecodons in its protein genes: a proposal for synonymous codonchoice that is optimal for the E. coli translational system. J.Mol. Biol. 151:389-409.

21. Ikemura, T., and J. E. Dahlberg. 1973. Small ribonucleic acidsof Escherichia coli. II. Noncoordinate accumulation duringstringent control. J. Biol. Chem. 248:5033-5041.

22. Ikemura, T., and M. Nomura. 1977. Expression of spacer tRNAgenes in ribosomal RNA transcription units carried by hybridCol El plasmids in E. coli. Cell 11:779-793.

23. Ikemura, T., and H. Ozeki. 1977. Gross map location ofEscherichia coli transfer RNA genes. J. Mol. Biol. 117:419-446.

24. Ilgen, C., L. L. Kirk, and J. Carbon. 1976. Isolation andcharacterization of large transfer ribonucleic acid precursorsfrom Escherichia coli. J. Biol. Chem. 251:922-929.

25. Johnson, A., B. J. Meyer, and M. Ptashne. 1979. Interactionsbetween DNA-bound repressors govern regulation by theAphage repressor. Proc. Natl. Acad. Sci. U.S.A. 76:5061-5065.

26. Kano-Sueoka, T., and N. Sueoka. 1969. Leucine tRNA andcessation of Escherichia coli protein synthesis upon phage T2infection. Proc. Natl. Acad. Sci. U.S.A. 62:1229-1236.

27. Kitchingman, G., and M. J. Fournier. 1975. Unbalanced growthand the production of unique transfer ribonucleic acids inrelaxed-control Escherichia coli. J. Bacteriol. 124:1382-1394.

28. Kitchingman, G. R., and M. J. Fournier. 1977. Modification-deficient transfer ribonucleic acids from relaxed control E. coli:structures of the major undermodified phenylalanine and leu-cine tRNAs produced during leucine starvation. Biochemistry16:2213-2220.

29. Marmur, J. 1963. A procedure for the isolation of DNA frommicroorganisms. Methods Enzymol. 6:726-738.

30. Maxam, A. M., and W. Gilbert. 1982. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

31. Miller, J. 1972. Experiments in molecular genetics. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.

32. Muench, K., and P. Berg. 1966. Preparation of aminoacyl-RNAsynthetases from E. coli, p. 375-383. In G. Cantoni and D.Davies (ed.), Procedures in nucleic acids research, vol. 1.Harper & Row, Publishers, New York.

33. Nakajima, N., H. Ozeki, and Y. Shimura. 1981. Organizationand structure of an E. coli tRNA operon containing seven tRNAgenes. Cell 23:239-249.

34. Nakajima, N., H. Ozeki, and Y. Shimura. 1982. In vitro tran-scription of the supB-E tRNA operon of Escherichia coli. J.

VOL. 158, 1984

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

942 HSU ET AL.

Biol. Chem. 257:11113-11120.35. Neidhardt, F. C., and L. Eidlic. 1%3. Characterization of the

RNA formed under conditions of relaxed amino acid control inEscherichia coli. Biochem. Biophys. Acta 68:380-388.

36. Post, L. E., and M. Nomura. 1980. DNA sequences from the stroperon of Escherichia coli. J. Biol. Chem. 255:4660-4666.

37. Post, L. E., G. D. Strycharz, M. Nomura, H. Lewis, and R. P.Dennis. 1979. Nucleotide sequence of the ribosomal proteingene cluster adjacent to the gene for RNA polymerase subunit Pin Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 76:1697-1701.

38. Putney, S. D., and P. Schimmel. 1981. An aminoacyl-tRNAsynthetase binds to a specific DNA sequence and regulates itsgene transcription. Nature (London) 291:632-635.

39. Quay, S. C., R. P. Lawther, G. W. Hatfield, and D. L. Oxender.1978. Branched-chain amino acid transport regulation in mu-tants blocked in tRNA maturation and transcriptional termina-tion. J. Bacteriol. 134:683-686.

40. Ray, B. K., and D. Apirion. 1981. Transfer RNA precursors areaccumulated in Escherichia coli in the absence of RNase E.Eur. J. Biochem. 114:517-524.

41. Rosenberg, M., and D. Court. 1979. Regulatory sequencesinvolved in the promotion and termination of RNA transcrip-tion. Annu. Rev. Genet. 13:319-353.

42. Schwartz, S., and D. Helinski. 1971. Purification and character-ization of colicin El. J. Biol. Chem. 246:6318-6327.

43. Schwartz, I., R. A. Klotsky, D. Elseviers, P. Gallagher, M.Krauskopf, M. A. Q. Siddiqui, J. S. H. Wong, and B. A. Roe.1983. Molecular cloning and sequencing of PheU, a gene for E.coli tRNAPhe. Nucleic Acids Res. 11:4379-4389.

44. Sekiya, T., R. Contreras, H. Kupper, A. Landy, and H. G.Khorana. 1976. Escherichia coli tyrosine transfer ribonucleicacid genes. J. Biol. Chem. 251:5124-5140.

45. Sidikaro, J., and M. Nomura. 1975. In vitro synthesis of E3immunity protein directed by Col E3 plasmid DNA. J. Biol.Chem. 250:1123-1131.

46. Siebenlist, U., R. B. Simpson, and W. Gilbert. 1980. E. coli RNApolymerase interacts homologously with two different promot-ers. Cell 20:269-281.

47. Silberklang, M., A. Gillum, and U. RajBhandary. 1977. The useof nuclease P1 in sequence analysis of end group labeled RNA.Nucleic Acids Res. 4:4091-4108.

48. Simoncsits, A., G. Brownlee, R. Brown, J. Rubin, and H.Guilley. 1977. New rapid gel sequencing method for RNA.Nature (London) 269:833-836.

49. Singer, C. E., and G. R. Smith. 1972. Histidine regulation inSalmonella typhimurium: XIII nucleotide sequence of histidinetransfer ribonucleic acid. J. Biol. Chem. 247:2989-3000.

50. Skjold, A. C., H. Juarez, and C. Hedgcoth. 1973. Relationshipsamong deoxyribonucleic acid, ribonucleic acid, and specifictransfer ribonucleic acids in Escherichia coli 15T- at variousgrowth rates. J. Bacteriol. 115:177-187.

51. Smith, H. O., and M. Birnstiel. 1976. A simple method for DNArestriction site mapping. Nucleic Acids Res. 3:2387-2398.

52. Soffer, R. L. 1974. Aminoacyl-tRNA transferases. Adv. Enzy-mol. 40:91-139.

53. Southern, E. M. 1975. Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J. Mol. Biol.98:503-517.

54. Steege, D. A., and J. I. Horabin. 1983. Temperature-inducibleamber suppressor: construction of plasmids containing theEscherichia coli ser U- (sup D-) gene under control of thebacteriophage lambda pL promoter. J. Bacteriol. 155:1417-1425.

55. Szalay, A. A., K. Grohmann, and R. L. Sinsheimer. 1977.Separation of the complementary strands of DNA fragments onpolyacrylamide gels. Nucleic Acids Res. 4:1569-1578.

56. Travers, A. A. 1980. Promoter sequence for stringent control ofbacterial ribonucleic acid synthesis. J. Bacteriol. 141:973-976.

57. Vickers, J. D., and D. M. Logan. 1972. A rapid technique for theanalytical and preparative isolation of transfer RNA from reac-tion mixtures. Anal. Biochem. 48:45-52.

58. Wettstein, F. 0. 1966. Differential in vivo aminoacylation andutilization of homologous species of E. coli transfer RNA. ColdSpring Harbor Symp. Quant. Biol. 31:595-599.

59. Yudelevich, A. 1971. Specific cleavage of an Escherichia colileucine transfer RNA following bacteriophage T4 infection. J.Mol. Biol. 60:21-29.

J. BACTERIOL.

on June 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from