structural basis for a major histocompatibility complex class ib–restricted t cell response

Structural basis for a major histocompatibilitycomplex class Ib–restricted T cell response

Hilary L Hoare1,5, Lucy C Sullivan2,5, Gabriella Pietra3,4, Craig S Clements1, Eleanor J Lee2, Lauren K Ely1,Travis Beddoe1, Michela Falco3, Lars Kjer-Nielsen2, Hugh H Reid1, James McCluskey2, Lorenzo Moretta3,4,Jamie Rossjohn1 & Andrew G Brooks2

In contrast to antigen-specific immunity orchestrated by major histocompatibility complex (MHC) class Ia molecules,

the ancestrally related nonclassical MHC class Ib molecules generally mediate innate immune responses. Here we have

demonstrated the structural basis by which the MHC class Ib molecule HLA-E mediates an adaptive MHC-restricted cytotoxic

T lymphocyte response to human cytomegalovirus. Highly constrained by host genetics, the response showed notable fine

specificity for position 8 of the viral peptide, which is the sole discriminator of self versus nonself. Despite the evolutionary

divergence of MHC class Ia and class Ib molecules, the structure of the T cell receptor–MHC class Ib complex was very similar

to that of conventional T cell receptor–MHC class Ia complexes. These results emphasize the evolutionary ‘ambiguity’ of HLA-E,

which not only interacts with innate immune receptors but also has the functional capacity to mediate virus-specific cytotoxic

T lymphocyte responses during adaptive immunity.

Major histocompatibility complex (MHC) class Ia molecules (HLA-A,HLA-B and HLA-C) have a critical function in the adaptive immuneresponse to viral infections, capturing virus-derived peptides ininfected cells and transporting them to the cell surface, where thepeptide-MHC complex can be recognized by virus-specific CD8+ Tcells1. The genes encoding MHC class Ia molecules have manypolymorphisms that confer allele-specific peptide-binding propertiesand broaden the repertoire of peptides that can be presented by thespecies2,3. The proteins encoded by these genes are recognized byclonotypic ab T cell receptors (TCRs) that dock on MHC class Iamolecules in an orientation that positions the highly variable com-plementarity-determining region (CDR) loops of the a- and b-chainin proximity with both antigenic peptide and the polymorphicresidues of the MHC class Ia heavy chain4,5. T cell recognition isaugmented by the coreceptor CD8, which binds the conserved a3domain of MHC class Ia molecules6.

Although the MHC class Ib molecule HLA-E is both evolutionarilyand structurally related to MHC class Ia molecules, it is almostmonomorphic and, as a ligand for the CD94-NKG2 receptorsexpressed by natural killer (NK) cells, is thought to be involved mainlyin innate immunity7–11. Unlike MHC class Ia molecules, HLA-E has avery limited peptide repertoire that consists mostly of nonamericpeptides derived from the signal sequences of MHC class Ia mole-cules12. Thus, optimal cell surface expression of HLA-E requiresboth the expression of MHC class Ia molecules and the capacity of

antigen-presenting cells to import the MHC class Ia signal sequencepeptides into the endoplasmic reticulum12,13. Recognition of HLA-E–peptide complexes acts to protect cells from lysis by NK cells thatexpress the inhibitory receptor CD94-NKG2A7,8. Downregulation ofHLA-E expression on a target cell, as a result of viral interference withMHC class Ia expression or transporter associated with antigenprocessing (TAP) function, for example, can enhance its susceptibilityto NK cell–mediated lysis.

Human cytomegalovirus (CMV), which downregulates MHC classIa molecules by a variety of mechanisms14–16, has evolved manystrategies to evade recognition by NK cells17, one of which involvesmanipulation of the interaction between CD94-NKG2 receptors andHLA-E18,19. The UL40 protein of CMV contains a ‘surrogate peptide’for HLA-E that mimics the leader sequence of certain MHC class Iamolecules18,19, but unlike the leader sequence peptides derived fromMHC class Ia molecules, the UL40-derived peptide and HLA-Eassemble using a TAP-independent mechanism. Consequently,whereas CMV infection leads to a reduction in the cell surfaceexpression of MHC class Ia molecules, the expression of HLA-E ismaintained or even upregulated18–20.

Despite its involvement in innate immunity, there is emergingevidence that HLA-E has the capacity to stimulate CD8+ T cellresponses to a variety of pathogens, including Salmonella typhi,Mycobacterium tuberculosis and CMV21–24. The target of theCMV-specific T cells that are HLA-E restricted is the UL40-derived

Received 29 August 2005; accepted 19 January 2006; published online 12 February 2006; doi:10.1038/ni1312

1The Protein Crystallography Unit, Department of Biochemistry and Molecular Biology, School of Biomedical Sciences, Monash University, Clayton, Victoria 3800,Australia. 2Department of Microbiology and Immunology, University of Melbourne, Parkville, Victoria 3010, Australia. 3Istituto Giannina Gaslini, Genova, Italy.4Department of Experimental Medicine, University of Genova, Italy. 5These authors contributed equally to this work. Correspondence should be addressed to J.R.([email protected]) or A.G.B. ([email protected]).

256 VOLUME 7 NUMBER 3 MARCH 2006 NATURE IMMUNOLOGY

A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

mimic of the MHC class Ia leader sequences18,19, which iseither identical to or very similar to the sequences present in mostbut not all MHC class Ia molecules. Thus, the fine specificity of theUL40-specific T cells is governed in part by the HLA genotype of theperson. UL40-specific T cells, for example, do not recognize HLA-E–peptide complexes derived from self MHC class Ia peptides but insteadrecognize only HLA-E–peptide complexes that are nonself24. Peoplewith MHC class I genotypes that lack the sequences encodingVMAPRTLIL and VMAPRTLVL (variable peptide residues underlinedthroughout) have been shown to elicit UL40-specific cytotoxic Tlymphocytes that recognize both of those peptides when presented byHLA-E. Furthermore, people who lack MHC class Ia genes encodingVMAPRTLIL yet express at least one allele encoding VMAPRTLVLstimulate cytotoxic T lymphocytes that selectively recognize VMAPR-TLIL but not the self peptide VMAPRTLVL24. Thus, MHC class Ib–restricted cytotoxic T lymphocytes have the capacity to discriminatebetween closely related peptides.

The leader peptide in complex with HLA-E is well known to bethe focus of innate recognition mediated by CD94-NKG2receptors. However the structural basis for ab TCR discriminationbetween HLA-E–self MHC class Ia peptides and HLA-E–viral mimicpeptides is not known. Here we demonstrate the molecular basis forthe self-nonself discrimination of HLA-E–peptide complexes anddefine the mechanism for HLA-E restriction in adaptive cytotoxicT lymphocyte immunity. Our findings show a pattern of MHCrestriction homologous to that noted for MHC class Ia molecules,which emphasizes the functional relatedness of class Ia and class IbMHC molecules.

RESULTS

HLA-E–restricted T cells in healthy CMV-seropositive donors

Although UL40-specific, HLA-E–restricted CD8+ T cells have beenisolated in many blood donors24, the frequency of HLA-E–restricted

CD8+ T cells in healthy CMV-seropositive donors, compared withthat of MHC class Ia–restricted CD8+ T cells, has been unclear. Westained peripheral blood mononuclear cells (PBMCs) from a CMV-seronegative and a CMV-seropositive donor with antibody to CD8b(anti-CD8b) and with multimeric MHC complexes of the class Iamolecule HLA-A2 and the immunodominant NLVPMVATV peptide(residues 495–503) from the matrix phosphoprotein pp65 of CMV(Fig. 1a). As expected, we were unable to identify CMV-specific, HLA-A2-restricted CD8+ T cells in the CMV-seronegative donor RC.However, in the CMV-seropositive donor KK, about 0.3% of thelymphocyte population stained with HLA-A2–(NLVPMVATV) penta-mers, consistent with the hypothesis that the HLA-A2–(NLVPMVATV) determinant is a chief target of CMV-specific MHCclass Ia–restricted CD8+ T cells. We compared the result with thatobtained after staining PBMCs with tetramers of HLA-E andVMAPRTLVL (the HLA-A2 leader sequence) or HLA-E and VMAPR-TLIL (the UL40-derived mimic). Because HLA-E interacts with CD94-NKG2 receptors expressed by both NK and T cells8, many lymphocyteswere stained by both the HLA-E–(VMAPRTLVL) and HLA-E–(VMAPRTLIL) tetramers (Fig. 1a). Monoclonal antibody (mAb)blocking of CD94-NKG2 receptors mostly abrogated binding of the

Figure 1 Flow cytometry of CMV-specific cells

from the CMV-seronegative donor RC (HLA-

A2,HLA-A29, HLA-B44, HLA-B51 and HLA-Cw7)

and the CMV-seropositive donor KK (HLA-A2,

HLA-B44 and HLA-Cw7). (a) PBMCs stained

with mAb to CD8b and either with pentamers

corresponding to an HLA-A2-restricted

determinant of CMV pp65 (HLA-A2–(NLV))or with HLA-E–(VMAPRTLVL) or HLA-E–

(VMAPRTLIL) tetramers, in the presence (a-CD94

+) or absence (a-CD94 –) of unlabeled blocking

mAb specific for CD94. (b) Flow cytometry of PBMCs from donor KK stained with a Vb16-specific mAb and HLA-E–(VMAPRTLIL) tetramers in the presence

(+a-CD94) or absence (–a-CD94) of unlabeled blocking mAb specific for CD94. Numbers in quadrants indicate the proportion of lymphocytes in each. Data

are representative of at least two independent experiments.

0.16

HLA-A2–(NLV)

Mul

timer

Mul

timer

RC(CMV

–)

KK(CMV

+)

HLA-E–(VMAPRTLVL)

0.06

α-CD94

α-CD94

α-CD94

CD8β

1.79 0.12 1.8 0.110.3

– – –

–

+ +

+0.45 0.03 0.79 0.44

2.3 0.23 3.40.04 0.16 0.38 2.0

0.13 0.42

0.05

KK

0.450.07 0.12

HLA-E–(VMAPRTLIL) HLA-E–(VMAPRTLIL)

Vβ 16

a b

31.6 µM

300

250

200

Res

pons

e (R

U)

Res

idua

ls

150

100

50

0

4

0

3501614

Req

/HLA

-E (

µM)

Req (RU)

121086420

270

190

Req

(R

U)

110

30

0 20 40 60HLA-E (µM)

80 100 100 200 300

0 20 40 60

Time (s)

80 100 120 160–4

17.8 µM

10 µM

5.62 µM3.16 µM1.78 µM

a

b c

Figure 2 Low-affinity interaction between HLA-E–(VMAPRTLIL) and the

TCR. (a) Binding of increasing concentrations of HLA-E–(VMAPRTLIL) to

the KK50.4 TCR after baseline subtraction. The curve fits are solid lines

overlaying data points; corresponding residual plots are below. The kinetic

binding constant (Kdcalc) derived from the kinetic rate constants was

30.7 mM. RU, response units. Data are representative of eight independent

experiments. (b) Equilibrium binding of HLA-E–(VMAPRTLIL) (diamonds),

HLA-E–(VMAPRTLLL) (triangles) or HLA-E–(VMAPRTLVL) (squares) to an

immobilized TCR. The equilibrium dissociation constant (Kdeq) derived fromnonlinear regression was calculated to be 30.2 mM. (c) Scatchard analysis of

the interaction between HLA-E–(VMAPRTLIL) and the KK50.4 TCR; the Kd

value derived (Kd ¼ –1 / Ka, where Ka is the slope) was equivalent to that

derived from nonlinear regression analysis. Req, response at equilibrium.

Data are representative of at least three independent experiments.

NATURE IMMUNOLOGY VOLUME 7 NUMBER 3 MARCH 2006 257

A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

HLA-E–(VMAPRTLVL) tetramer to both CD8b+ and CD8b– cells, asanticipated. In contrast, the CD94-blocking mAb did not abrogatestaining of 0.44% of CD8b+ lymphocytes by the HLA-E–(VMAPR-TLIL) tetramer but did block tetramer binding to theCD8b– population (Fig. 1a). There were similar proportions ofHLA-E–(VMAPRTLIL)–specific lymphocytes in multiple unrelatedCMV-seropositive donors who expressed HLA molecules lackingMHC class Ia–encoded homologs of the UL40 mimic peptide (datanot shown). These data demonstrated that the frequency of CMV-specific T cells restricted by HLA-E is comparable to the frequency ofT cells restricted by MHC class Ia molecules and suggested animportant function for the T cells.

All HLA-E–restricted T cell clones generated from donor KK use thevariable b-region 16 (Vb16) gene segment24. Thus, we assessed theexpression of Vb16 on HLA-E–(VMAPRTLIL) (UL40)–specific cellsfrom donor KK directly ex vivo. Consistent with the clonal analysis,after blockade of CD94-NKG2 receptors, most HLA-E tetramer–positive cells expressed Vb16, suggesting a structural basis for the‘preferential’ expansion of this cell population in vivo (Fig. 1b).

Highly specific, low-affinity interaction between ab TCR and HLA-E

To determine the biophysical basis for the interaction between theTCR and HLA-E, we expressed a soluble recombinant form of the TCRfrom a UL40-specific T cell clone from donor KK (KK50.4) that usesthe Vb16 and Va26 gene segments. We then assessed the ability of therecombinant TCR to interact with both HLA-E*0103 and HLA-E*0101in complex with the UL40 peptide (VMAPRTLIL). The KK50.4 TCRbound HLA-E*0103–(VMAPRTLIL) with an affinity of about 30 mM(Fig. 2 and Table 1). Although equilibrium binding saturation was notreached, we obtained similar values when we determined the dissocia-tion constant (Kd) by nonlinear regression or Scatchard analysis or bycalculation from kinetic rate data; the observed Kd was also similarregardless of whether the KK50.4 TCR or HLA-E*0103–(VMAPR-TLIL) complex was immobilized. Similarly, the KK50.4 TCR andHLA-E*0101–(VMAPRTLIL) interacted with an affinity of about30 mM, a result that was consistent with localization of the singlepolymorphic residue, 107, in a position unlikely to make TCR contacts(Table 1). The affinity of the KK50.4 TCR for HLA-E–(VMAPRTLIL)was relatively low compared with values reported for cognate TCR–MHC class Ia interactions (about 5–10 mM) and closely resembled theTCR affinity for weak agonist ligands25. Although the half-life of theKK50.4 TCR–HLA-E–(VMAPRTLIL) interaction was within the rangeof that determined before for TCR–MHC class Ia interactions, the

‘on-rate’ was relatively slow26, approximatelyone tenth that described for the interaction ofboth influenza- and Epstein-Barr virus–specific TCRs with their cognate MHC classIa–peptide ligands27,28.

In contrast to its interaction with theUL40-derived peptide VMAPRTLIL, therewas no binding of the KK50.4 TCR withHLA-E–(VMAPRTLLL), a peptide presentin the HLA-A32 molecule expressed bydonor KK (Fig. 2b and Table 1). Similarly,consistent with the observation that HLA-E–(VMAPRTLVL) tetramers did not bind toTCRs expressed by T cells in PBMCs ofdonor KK, the interaction between theKK50.4 TCR and HLA-E–(VMAPRTLVL)was too weak to determine an affinity con-stant (Kd 4 100 mM; Fig. 2b and Table 1).

These data suggested that recognition of HLA-E by the KK50.4 TCR ishighly dependent on the presence of an Ile residue at position 8 of thepeptide. Consistent with that, substitution of Ile at position 8 by Ala,Phe, Tyr or Lys abrogated binding of the KK50.4 TCR (Table 1). Thedata collectively demonstrated that the KK50.4 TCR interacts withHLA-E–(VMAPRTLIL) with low affinity that in turn may facilitate thediscrimination of structurally similar residues at position 8 in other-wise identical peptides.

Structural basis of ab TCR recognition of HLA-E–(VMAPRTLIL)

To determine the structural basis of the exquisite TCR specificityfor peptides bound to HLA-E, we determined the 2.6-A resolu-tion structure of the KK50.4 TCR–HLA-E–(VMAPRTLIL) complexto Rfactor and Rfree values of 21.4% and 29.2%, respectively (Fig. 3aand Table 2). The interpretation of electron density at the antigenicinterface was unambiguous. Comparison of unliganded HLA-E struc-tures with that of HLA-E in complex with the TCR showed no

Table 1 Binding constants for the interaction KK50.4 TCR and HLA-E

Immobilized ligand Analyte Kdeq (mM)a kon (�103 M–1s–1) koff (s–1)

KK50.4 TCR HLA-E*0103–(VMAPRTLIL) 30.2 ± 2.8 3.56 ± 0.184 0.106 ± 0.01

KK50.4 TCR HLA-E*0101–(VMAPRTLIL) 32.7 ± 5.8 2.95 ± 0.01 0.104 ± 0.006

HLA-E*0103–

(VMAPRTLIL)

KK50.4 TCR 28.4 ± 0.8 3.03 ± 0.13 0.0823 ± 0.002

KK50.4 TCR HLA-E*0103–(VMAPRTLLL NB NB NB

KK50.4 TCR HLA-E*0103–(VMAPRTLVL) 4100 mM NB NB

KK50.4 TCR HLA-E*0103–(VMAPRTLAL) NB NB NB

KK50.4 TCR HLA-E*0103–(VMAPRTLKL) NB NB NB

KK50.4 TCR HLA-E*0103–(VMAPRTLFL) NB NB NB

KK50.4 TCR HLA-E*0103–(VMAPRTLYL) NB NB NB

a Equilibrium dissociation constants (Kdeq) were derived by nonlinear regression. These values are equivalent to theKdcalc values calculated from the kinetic rate constants. NB, no steady-state affinity or kinetic constants could beobtained for this interaction because of weak binding.

a bCαCβ

Vβ Vα

CDR1α

CDR2α

CDR3β

CDR1β

CDR2β

CDR3α

α2

α1

HLA-E

Figure 3 The KK50.4 TCR–HLA-E–(VMAPRTLIL) complex. (a) KK50.4

TCR (top): a-chain, green ribbons; b-chain, tan ribbons. HLA-E heavy chain,

light blue; b2-microglobulin, yellow; bound UL40 peptide (‘stick’ format),magenta. (b) Docking orientation of TCR onto HLA-E: a1 and a2 helices

of HLA-E, light blue; peptide, magenta. Positioning of CDR loops from the

KK50.4 TCR: CDR1a, purple; CDR2a, orange; CDR3a, blue, CDR1b, yellow;

CDR2b, green; CDR3b, red. Docking orientation of KK50.4 (black) versus

LC13 TCR–HLA-B8–(FLRGRAYGL) (light gray) and B7 TCR–HLA-A2–

(LLFGYPVYV) (dark gray). For determination of docking orientations, an axis

was drawn between points at the center of gravity of the Va and Vb domains.


A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

substantial changes in the conformation of the heavy chain or thepositioning of the peptide (r.m.s.d. between the forms of HLA-Ewith and without TCR is 0.44 A)29,30. However, we found that someHLA-E side chains changed conformation after TCR ligation: residuesArg 62, Arg 65, Gln 72, Glu 154 and His 155.This amount of conformational change iscomparable to that noted for MHC class Iamolecules after interaction with the TCR31.The KK50.4 TCR docked diagonally (at anangle of approximately 501) onto HLA-E–(VMAPRTLIL) (Fig. 3b), within the rangereported before for TCR–MHC class Ia com-plexes4. Unlike the ‘footprint’ of most TCR–MHC class Ia complexes, the ‘footprint’ ofKK50.4 TCR on HLA-E–(VMAPRTLIL) wasfocused at the C-terminal end of the cleft,although the displacement was not asextreme as that noted in the LC13 TCR–HLA-B8 complex (Figs. 3b and 4)31. Despitethe low affinity of the KK50.4 TCR–HLA-E–(VMAPRTLIL) interaction, the total buried

surface area at the interface was approximately 2,100 A2, which waswithin the upper end of the range noted before for TCR–MHC class Iacomplexes (1,360–2,220 A2 buried surface area). Although the Va andVb domains made approximately equivalent contributions to theburied surface area (46% and 54%, respectively), the TCR b-chain(Vb16) dominated contacts with the HLA-E heavy chain, contributing47 of the total 77 contacts.

All CDR loops contributed to the HLA-E ‘footprint’, but to verydifferent extents. The CDR1a, CDR3a and CDR3b loops contributedroughly equally (20% buried surface area), whereas CDR1b andCDR2a were minimally involved at the interface, contributing 6%and 5%, respectively (Fig. 4). The CDR1a loop interacted exclusivelywith the HLA-E a2 helix; the CDR3b loop interacted with both the a2helix and antigenic peptide; and the CDR3a loop bridged the a1 anda2 helices of the heavy chain and also made contact with thepeptide. Notably, the CDR2b loop contributed 30% of the buriedsurface area and made 30 contacts with the HLA-E heavy chain(Table 3 and Fig. 4).

In summary, the ab KK50.4 TCR– HLA-E complex had many ofthe hallmarks of typical ab TCR–MHC class Ia complexes. It had acommon docking orientation and an extensive ‘footprint’ in which theCDR3a and CDR3b loops interacted with the antigenic peptide.However, the prominent function of the CDR2b loop in the KK50.4TCR–HLA-E structure was atypical compared with that of TCR–MHCclass Ia structures determined so far.

Peptide specificity controlled by a single residue at position 8

Compared with MHC class Ia–binding peptides, the HLA-E-boundpeptide VMAPRTLIL ‘sat’ deeper in the antigen-binding cleft, and ofthe three side chains that protruded from the cleft (positions 4, 5 and8), only Ile at position 8 was nonself (Fig. 5). Thus, the HLA-E–(VMAPRTLIL) complex may be considered to represent a challengefor TCR ligation29. However, the side chains of residues at positions 4,5 and 8 of VMAPRTLIL all interacted with the TCR (Table 3). Overall,the peptide contributed 22.5% of buried surface area of the HLA-Einterface, which was within the range previously determined forTCR–MHC class Ia complexes4. However, the Pro side chain atposition 4 interacted minimally with the KK50.4 TCR, althoughits main chain formed van der Waals contacts with the backboneof the CDR3a loop, which straddled the groove formed betweenpositions 4 and 5. Most peptide-mediated contacts arose from theside chains of Arg at position 5 and Ile at position 8 and the mainchain of position 6. Arg at position 5 protruded into a pocketformed by the CDR3a and CDR3b loops, where it made extensive

CDR2βCDR2βCDR3α CDR3α

CDR3β CDR3βCDR1α

CDR1α

CDR2α CDR2α

CDR1β

a b

Figure 4 Contribution of CDRs to the ‘footprint’ of the KK50.4 TCR on HLA-E–(VMAPRTLIL). The

‘footprint’ of the KK50.4 TCR on HLA-E–(VMAPRTLIL) (a) is compared with ‘footprint’ of the LC13

TCR on HLA-B8–(FLRGRAYGL) (b). Colors are as in Figure 3b.

Table 2 Data collection and refinement statistics

Data collection

Temperature (K) 100

X-ray source BioCars, APS

Detector Quantum 4 CCD

Space group C2

Cell dimensions (A) 235.1; 41.5; 112.5

Cell angles (1) 90; 114.7; 90

Resolution 2.6

Total observations 67,491

Unique observations 29,161

Multiplicity 2.3

Data completeness (%) 93.1 (81.9)

Data 4 2s (%) 69.5 (33.9)

I/si 11.2 (2.7)

Rmerge (%) 10.4 (56.5)a

Refinement statistics

Nonhydrogen atoms

Protein 6,587

Water 185

Iodide 5

Resolution (A) 50–2.6

Rfactor 21.4 (33.9)b

Rfree 29.2 (45.4)b

r.m.s.d. from ideality

Bond lengths (A) 0.006

Bond angles (1) 1.02

Impropers (1) 1.22

Dihedrals (1) 28.10

Ramachandran plot

Most favored 88.2

Allowed regions 11.5

B-factors (A2)

Average main chain 28.8

Average side chain 30.2

Average water molecule 23.4

r.m.s.d.-bonded Bs 1.69

Values in parentheses are for the shell of highest resolution (2.7–2.6 A).aRmerge ¼

P|Ihkl –

P/IhklS /

P||Ihkl.

bRfactor ¼P

||hklFo | – | Fc /P

|hkl|Fo| for all data exceptthat 5% were used for the Rfree calculation.


A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

contacts with residues from the CDR3b loop and formed hydrogenbonds to the backbone of Ser 96a (Fig. 5). Arg at position 5 wasflanked by two positively charged residues, His 155 of HLA-E, andArg 98b of the CDR3b loop, which stacked in an antiparallel way(Fig. 6a). This unusual arrangement was compensated for by theformation of a salt bridge between Arg 98b in the CDR3 loop andGlu 152 of HLA-E in addition to a salt bridge and hydrogenbond from Asp 99b to Arg at position 5 of the peptide and His 155of HLA-E, respectively (Fig. 6a). Although the Thr side chain atposition 6 was buried and thus unavailable for TCR contact, itsmain chain interacted with the TCR by forming hydrogen bondswith Asp 97a and Arg 98b (Fig. 5).

The C-terminal ‘footprint’ of KK50.4 TCRon HLA-E–(VMAPRTLIL) was consistentwith the requirement to discriminate betweensimilar residues at position 8: Ile of UL40versus Val or Leu of MHC class Ia–derived(self) peptides. The specificity is probablyachieved by the convergence of the threeCDR loops of the b chain onto position 8(Figs. 4a and 5). Val 50b and Arg 98b of theTCR interacted substantially with Ile at posi-tion 8, whereas Asp 30 and Asn 31 (CDR1b)made more limited contacts (Fig. 5 andTable 3). Val and Ile differ only by a methylgroup (the CD1 carbon of Ile). The CD1methyl group of Ile at position 8 mademost of the position-8 contacts with theTCR (seven of a total of eleven contacts).Specifically, CD1 formed van der Waals inter-actions with four atoms from Arg 98b, twoatoms from Val 50b and one atom from Asn31b, thus contacting all three CDR loops ofthe KK50.4 TCR Vb (Fig. 5). In contrast, theCG1 and CG2 atoms of Ile at position 8 madecontact with CDR3b (two atoms of Arg 98)and CDR1b (one atom of Asp 30), respec-tively. The focus of the CDR loops of the TCRb chain on the position-8 side chain andspecifically its CD1 methyl group accountedfor the substantial loss of TCR affinity wheneven conservative substitutions were intro-duced at this position (Fig. 2 and Table 1).

Notably, among these interactions, Arg 98bof the KK50.4 TCR was crucial in specificitythrough interactions with residues positions5, 6 and 8 (Fig. 5) as well as Glu 152 of theHLA-E heavy chain (Fig. 6a). Analysis of theCDR3 regions of Vb16+ T cell clones con-firmed the powerful selection of Arg 98b thatwas present in each of four clones derivedfrom two independent donors and isthe product of nucleotide-substitution-region and diversity-region diversification(Table 4). Thus, the complex emphasizedthe structural basis for the selection of aTCR that is exquisitely sensitive to the sidechain present at position 8 of the peptide,sensitivity thought to be characteristic ofadaptive immune responses.

Structural basis of HLA-E restriction

The KK50.4 TCR made extensive contacts with HLA-E–(VMAPR-TLIL), spanning residues 62–80 and 146–158 of the a1 and a2 helices,respectively (Fig. 6). Collectively, there were five salt bridges, ninehydrogen bonds, six water-mediated hydrogen bonds and many vander Waals contacts (Table 3) at the interface. A feature of this TCR–MHC class Ib complex was the prominent involvement of CDR2b inthe interaction with HLA-E–(VMAPRTLIL), making 30 contacts andcontributing 30% of the buried surface area. Consistent with thatcontribution, the HLA-E-restricted UL40-specific response in donorKK almost exclusively used the Vb16 gene segment (Fig. 1b). More-over, Vb16+ UL40-specific clones were also derived from an additional

Table 3 Contacts at the TCR–peptide–MHC interface

TCR residue pMHC residue Type of bond Contacts

CDR1a Gly 29 Asp 162 van der Waals 2

Asn 30ND2 Thr 163OG1 H bond, van der Waals 5

Tyr 31OH Glu 154OE2 H bond, van der Waals 5

Tyr 31 His 155 van der Waals 4

Tyr 31 Ala 158 van der Waals 1

CDR2a Leu 50 Glu 154 van der Waals 1

Leu 50 Arg 157 van der Waals 1

CDR3a Arg 94 Arg 62 van der Waals 1

Ser 95OG His 155ND1 H bond, van der Waals 5

Asn 97 Asp 69 van der Waals 2

Asn 97ND2 Thr 70OG1 Water-mediated, van der Waals 2

Thr 98OG1 Asp 69OD2 Water-mediated 1

CDR1b Asp 30 Lys 146 Salt bridge 1

CDR2b Val 50 Val 76 van der Waals 1

Val 50 Ile 73 van der Waals 2

Lys 51 Thr 80 van der Waals 2

Glu 52 Arg 79 Salt bridge 1

Ser 53 Arg 75 van der Waals 3

Ser 53 Val 76 van der Waals 2

Gln 55NE2 Asp 69OD2 Water-mediated, van der Waals 9

Gln 55O Gln 72OE1 H bond, van der Waals 4

Gln 55 Ile 73 van der Waals 5

Asp 56 Arg 65 Salt bridge 1

CDR3b Asp 97 Ala 150 van der Waals 4

Asp 97 Glu 152 van der Waals 1

Arg 98 Glu 152 Salt-bridge 3

Asp 99OD1,OD2 His 155NE2 H bonds, van der Waals 7

TCR–peptide contacts

CDR3a Ser 95 Pro 4 van der Waals 3

Ser 96 Pro 4 van der Waals 3

Ser 96O Arg 5NE H bond, van der Waals 8

Asn 97OD1 Thr 6N H bond, van der Waals 7

Asn 97ND2 Thr 6OG1 Water-mediated 1

Asn 97ND2 Arg 5N Water-mediated, van der Waals 6

Asn 97ND2 Ala 3O Water-mediated 1

Asn 97 Pro 4 van der Waals 2

CDR1b Asp 30 Ile 8 van der Waals 1

Asn 31 Ile 8 van der Waals 1

CDR2b Val 50 Ile 8 van der Waals 3

CDR3b Asp 97O Arg 5NH1,NH2 H-bond, van der Waals 3

Arg 98 Arg 5 van der Waals 6

Arg 98 Ile 8 van der Waals 6

Arg 98NH2 Thr 6O H-bond, van der Waals 3

Asp 99 Arg 5 Salt bridge 1

Superscripted designations indicate element involved in hydrogen bonding.


A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

unrelated donor, which suggests a potential bias toward this Vb inHLA-E–(VMAPRTLIL) recognition by CD8+ T cells. Although suchrestricted Vb use was typical of UL40-specific HLA-E-restricted T cellsfrom donor KK, there was no absolute requirement for Vb16, becauseUL40-specific T cells obtained from other donors use other Vb genesegments, including Vb9, Vb5.1 and Vb22 (refs. 24,32). CDR2b layparallel to the a1 helix, making contacts with position 8 of the peptideand electrostatic interactions with HLA-E Asp 69, Gln 72 and Arg 79,as well as many van der Waals contacts (Fig. 6b). Furthermore, aframework residue, Asp 56, immediately C-terminal to the CDR2bloop, also formed a salt bridge with Arg 65 of HLA-E, therebyexpanding the contribution of this loop (Fig. 6b).

Although HLA-E shares considerable structural homology withMHC class Ia molecules, it also contains many unique residues.

Many of these residues are buried deep within the antigen-bindingcleft and dictate the restricted peptide repertoire of HLA-E. Thesurface-exposed HLA-E residues Asp 69, Thr 70, His 155 and Asp162, which are either absent from or rare in MHC class Ia molecules,mediated contacts with the HLA-E-restricted TCR (Fig. 6c). Asp 69 ofHLA-E, located on the a1 helix, projected upward and formed van derWaals contacts with TCR residues Asn 97a and Gln 55b, and alsoformed water-mediated hydrogen bonds with Thr 98a of CDR3a andGln 55b (Fig. 6b). Thr 70 of HLA-E had less extensive involvement, asit ‘pointed into’ the peptide-binding groove, but nevertheless made awater-mediated hydrogen bond with Asn 97 of CDR3a (Fig. 6b).Similarly, HLA-E Asp 162 also seemed to have less involvement inmediating HLA-E restriction, forming limited van der Waals contactswith Gly 29 on the CDR1a loop (Fig. 6a).

All MHC class Ia molecules and the MHC class Ib molecule HLA-Ghave a Gln residue at position 155 on the a2 helix33, whereas in HLA-E this position is a His residue that protrudes upward from the centerof the a2 helix. His 155 of HLA-E was pivotal in the interaction withKK50.4 TCR, making a total of 18 contacts with three CDR loops,including hydrogen bonds with Ser 95a and Asp 99b and van derWaals contacts with Tyr 31 of the a chain. Consequently, these HLA-Eunique residues, particularly residues 69 and 155, were prominent inthe restriction of this TCR to HLA-E.

DISCUSSION

Although MHC class Ia molecules have a central function in adaptiveimmunity by presenting peptides for recognition by CD8+ T cells, theyalso can act as ligands for receptors of the innate immune system34,35.In contrast to MHC class Ia molecules, the main function of theessentially monomorphic MHC class Ib molecule HLA-E is to act as aligand for the innate CD94-NKG2 receptors expressed mostly by NKcells and some populations of memory T cells36,37. Binding datasuggest that the recognition site of the CD94-NKG2 receptors onHLA-E is mutually exclusive of the site required for binding of HLA-Eto the UL40-specific TCR KK50.4 (refs. 38–40). However the CD94-NKG2A receptor seems to be more tolerant of substitutions at position8 of the peptide than does the KK50.4 TCR. The consequences ofpotential competition between innate and adaptive receptors for the

CDR3β

CDR3α

CDR1β

CDR2β

D97

D30

R98 CD1

N31

N97

V50

P9

P8P7

P6P5

P4

D99

S96

Figure 5 KK50.4 TCR–peptide interactions are dominated by the Vb loops.

KK50.4 TCR contacts made by key peptide residues, the CD1 carbon of

position 8 and atoms that make van der Waals contacts with it are orange.

CDR3a, CDR1b, CDR2b and CDR3b in ‘worm’ format and residues in the

CDR loops that make contact with the peptide are in ‘ball-and-stick’ (colors

are as in Figure 3b.). Hydrogen bonds, dashed black lines; salt bridges, gray

lines; water molecules, pink spheres.

a b c

Figure 6 Residues unique to HLA-E form the basis of the restriction of KK50.4 to HLA-E. (a) The a2 helix of HLA-E, light blue ribbon; CDR1a loop, purple

ribbon; CDR3a loop, blue ribbon; CDR3b loop, red ribbon; His 155 and Asp 162 of HLA-E, gold ‘ball-and-stick’. Residues in the CDR loops that contact

Glu 152 and His 155 are in ‘ball-and-stick’ format. TCR Gly 29a, which makes contact with HLA-E Asp 162, is in ‘ribbon’ format. Hydrogen bonds, dashed

black lines; salt bridges, gray lines. (b) Residues in HLA-E and the CDR2b loop that form contacts and residues in CDR3a that contact Asp 69 and Thr 70

are in ‘ball-and-stick’ format; Asp 69 and Thr 70 of HLA-E are gold. Hydrogen bonds, dashed black lines; water molecules, pink spheres.(c) HLA-E residues

absent or rare in MHC class Ia alleles are in gold.


A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

same ligand are unclear and may ultimately be influenced by factorssuch as the relative cell surface densities of the receptors and/or ligandsor the ability of NK or T cells to traffic to sites of infection. SomeUL40-specific T cells from donor KK expressed the CD94-NKG2Areceptor, raising the possibility that these molecules compete with theTCR for access to HLA-E41. Although CD94-NKG2A interacts withHLA-E with higher affinity than KK50.4 TCR and their binding toHLA-E seems to be mutually exclusive, in vitro studies have indicatedthat the cytolytic function of HLA-E–restricted T cell clones isunaffected by the addition of a blocking CD94-specific mAb41. Thismay be due to low expression of CD94-NKG2A receptors on theseT cell clones, thus allowing the TCR to effectively compete for theHLA-E binding site.

Our data have also demonstrated that the overall mode ofTCR recognition of HLA-E is similar to that of TCR recognition ofMHC class Ia molecules. The KK50.4 TCR adopted a diagonalorientation, with the CDR loops of both TCRa and TCRb makingmany contacts with both the a-helices and the peptide bound by HLA-E. Nevertheless, the prominent involvement of CDR2b and theconvergence of the three CDR loops of TCRb on position 8 ofVMAPRTLIL are notable features of the KK50.4 TCR–HLA-E–(VMAPRTLIL) complex.

Although there is an extensive interface between TCR and MHCclass Ia molecules, a small subset of these residues, including MHCclass Ia residues 65, 69 and 155, contribute disproportionately to thebinding energy, thus creating ‘energetic hotspots’ on the MHC class Iamolecule42,43. In all the MHC class Ia–TCR complexes determined sofar, these same positions have been shown to mediate interactions withcognate TCR44. Arg 65, Asp 69 and His 155 of HLA-E also makecontacts with the HLA-E–restricted TCR, although the amino acidspresent in the last two residues are unique to HLA-E. These datasuggest that the docking mechanism of TCR and MHC class Imolecules is conserved despite amino acid differences at key positionsof the heavy chain.

The finding that the affinity of the KK50.4 TCR for HLA-E–(VMAPRTLIL) was low was unexpected, given that the frequency ofUL40-specific HLA-E-restricted T cells is of the same order ofmagnitude as that of HLA-A2–pp65–restricted T cells, a paradoxthat might be explained by many factors. Given the paucity ofHLA-E-binding peptides, there may be inefficient positive selectionof HLA-E-restricted clones, reducing the likelihood of expanding aT cell population expressing a TCR with higher affinity. Alternatively,as the UL40 peptide differs from MHC class I–derived self peptidesonly at position 8, TCRs with specificity for HLA-E–MHC class Ileader peptide may be eliminated to avoid self-reactivity, therebyremoving higher-affinity T cells with the capacity to recognize HLA-E–(VMAPRTLIL). Functional studies support the latter view, as thepresence of specific MHC class Ia–encoded self peptides in the donorgenotype (such as VMAPRTLVL) seems to bias the specificity of

UL40-specific cytotoxic T lymphocytes such that they are unable torecognize these HLA-E–self peptide complexes24. Thus, the require-ment for self-tolerance probably only permits the selection oflow-affinity, HLA-E–restricted UL40-specific TCRs. It is the subtle‘negotiation’ of this specificity requirement that facilitates the recogni-tion of CMV-infected cells while sparing cells expressing self-encodedMHC class I–derived peptides presented by HLA-E.

The low affinity of the HLA-E–(VMAPRTLIL)–specific restrictedKK50.4 TCR is even more paradoxical given the poor interactionbetween CD8a and HLA-E45. It is likely that the restricted peptiderepertoire of HLA-E and the TAP independence of the UL40 peptideallow high antigen density on the surface of infected antigen-presenting cells, leading to a high-avidity interaction with the TCR.In fact, the peptide repertoire of HLA-E in cells infected withCMV may be further constrained, because another CMV protein,US6, can inhibit TAP-dependent loading of MHC class I–derivedpeptides into HLA-E, which further emphasizes the advantageobtained by assembly of UL40-derived peptide with HLA-E in aTAP-independent mechanism18,46.

The MHC loci are thought to continually evolve from a series ofgene duplications and inactivation events over time3. The MHC classIa loci are thought to have evolved by duplication and differentiationof MHC class Ib genes47. However, the HLA-E gene, despite itslocation in such a variable region of the genome, has remainedessentially invariant in humans, and in fact unlike most MHC classIa genes, the HLA-E gene is highly conserved throughout both Newand Old World primates3,48. Such conservation is typical for genes thatexpress ligands that interact with an invariant receptor. For HLA-Eand its invariant ligands, such conservation presumably reflects theimportance of HLA-E in innate immunity as a ligand for CD94-NKG2receptors. It is possible that the capacity of HLA-E to be recognized byCD8+ T cells represents a ‘missing link’ in the evolution of MHC classIa molecules, although we cannot rule out the possibility that this is amore recently acquired function. Nevertheless, our data have demon-strated that HLA-E has retained the ability to act as a restrictingelement that is recognized by the TCR of ab CD8+ T cells. Moreover,unlike semi-invariant T cells that recognize CD1d glycolipid com-plexes49, the T cells that recognize HLA-E use a variety of both Va andVb gene segments and, in the case of UL40-specific T cells, showstrong evidence of selection in the CDR3 region. Thus, HLA-E notonly acts as critical ligand for cells of the innate immune system butalso retains the structural and functional ability to be the target ofsubstantial adaptive T cell responses after both viral and bacterialinfection.

METHODSCell culture and flow cytometry. PBMCs were isolated from the blood of

normal donors by separation on a Ficoll Hypaque density gradient as

described21. After separation, PBMCs were stained with multimeric MHC

molecules and antibodies specific for CD8b or Vb16 (Immunotech) and were

analyzed by flow cytometry. HLA-E-restricted T cell clones were generated as

described24. Similarly, the CDR3 rearrangements present in these clones were

determined using established methods41.

Generation of recombinant KK50.4 TCR. RNA from the UL40-specific T cell

clone KK50.4 was reverse-transcribed and was used to amplify cDNA fragments

encoding the TCR a- or b-chain with the following primers: 5¢-GGCCCA

TATGGATGCTAAGACCACCCAG-3¢ and GTACACGGCAGGATCCGGGTT

CTGGAT-3¢ for the a-chain, and 5¢-GGCCCATATGGAAGCTGGAGTTACT

CAG-3¢ and 5¢-GGTGTGGGAGATCTCTGCTTCTGA-3¢ for the b-chain.

The PCR-derived a-fragment was cloned as an NdeI–BamHI fragment into a

pET-30 expression vector containing the a-chain of LC13 TCR50, which had

Table 4 Alignment of CDR3 regions in Vb16+ UL40-specific CD8+

T cell clones

T cell clone Vb nDn J

KK 50.4 C A S S Q D R D T Q Y F G P G T R L T V L

KK 50.14 C A S S Q H R P P G E L F F G E G S R L T V L

25.19 C A S S Q D R V G A F F G Q G T R L T V V

25.6 C A S S P D R V E Q Y F G P G T R L T V T

The non-germline-encoded Arg present in many T cell clones from unrelated donors inbold.


A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

been mutated to contain a BamHI site in the constant domain. The b-chain was

cloned as an NdeI-BglII fragment into a pET-30 expression vector containing

the b-chain of the LC13 TCR. The sequences of both chains were verified by

automated sequencing. The KK50.4 TCR a- and b-chains were expressed,

purified from inclusion bodies and refolded essentially as described50.

Production of soluble, recombinant HLA-E. The cDNA sequences encoding

the extracellular domain of wild-type HLA-E*0103, HLA-E*0101 and human

b2-microglobulin were cloned into the pET-30 expression vector or a modified

vector that allowed for an in-frame fusion of a substrate sequence for the

enzyme BirA, were expressed in Escherichia coli BL21 and were solubilized from

inclusion bodies. The proteins were refolded with synthetic peptides (GL

Biochem) by dilution essentially as described29. The resulting complexes were

purified by anion-exchange and gel-filtration chromatography. In some experi-

ments, refolded HLA-E*0103 was enzymatically biotinylated essentially

as described51.

Surface plasmon resonance. The surface plasmon resonance experiments were

done at 25 1C on a Biacore 3000 instrument with HBS buffer (10 mM HEPES,

pH 7.4, 150 mM NaCl and 0.005% surfactant P20) supplemented with 1% BSA

to inhibit nonspecific binding. Antibody 12H8, which is specific for TCRab,

was coupled to all four flow cells of a CM5 chip42. For each experiment, the

KK50.4 TCR was passed over two flow cells and approximately 500 response

units of the KK50.4 TCR was captured by the antibody. The other two flow cells

served as control cells for the experiments. HLA-E was injected over all four

flow cells at a rate of 20 ml/min with a concentration range of 1.8–100 mM.

Although equilibrium binding did not reach saturation in this concentration

range, higher HLA-E protein concentrations were not tested because the

protein has been found to aggregate at concentrations above 100 mM. The

final response was calculated by subtraction of the response with the antibody

alone from that obtained with the antibody–KK50.4 TCR complex. The

antibody surface was regenerated between each analyte injection with ActiSep

(Sterogene).

For cross-validation of the results, an alternate ligand-receptor capture

methodology was used. Biotinylated HLA-E–(VMAPRTLIL) monomer was

diluted to 3 mg/ml in HBS buffer and was coupled to two flow cells of a BIAcore

streptavidin sensorchip. The two remaining flow cells served as controls; one

was coupled with an irrelevant biotinylated MHC-I monomer (HLA-B8; a gift

from J. Lin, University of Melbourne, Melbourne, Australia), and the other flow

cell remained blank. KK50.4 TCR was serially diluted in HBS buffer containing

1% BSA (concentration range, 1.8–100 mM) and was injected simultaneously

over the test and control surfaces at a flow rate of 30 ml/min. There was no need

to regenerate the surface of the chip, as the TCR dissociated from HLA-E to

baseline values after cessation of injection. All measurements were made

minimally in duplicate. BIAevaluation Version 3.1 was used for all data analysis

and was fitted with the 1:1 Langmuir binding model. In experiments where

mAb 12H8 was used to capture the TCR, the model was modified to include an

additional parameter for the drifting baseline as described42. All data fits had a

w2 value of less than 5.

Crystallization. Large crystal plates of KK50.4–HLA-E–(VMAPRTLIL) com-

plex were grown for 7 d at 4 1C by the hanging-drop vapor-diffusion method.

Equimolar amounts of HLA-E–(VMAPRTLIL) (10 mg/ml) and KK50.4

(8 mg/ml) were mixed with an equivalent volume of reservoir buffer

(18–22% PEG 3350 and 0.2 M potassium iodide, pH 6.4–7.4). Crystals

belonged to the C2 space group and unit cell dimensions (Table 2) were

consistent with one complex per asymmetric unit.

Structure determination and refinement. Crystals were ‘flash-frozen’ with

10% glycerol as cryoprotectant before data were collected. A 2.6-A data set was

collected at the BioCars beamline (Advanced Protein Source) and then was

processed and scaled with the HKL package (HKL Research). The crystal

structure was solved by molecular replacement using the AMoRe package and

using the LC13 structure31, (Protein Data Bank accession number, 1MI5) and

the HLA-E–(VMAPRTLFL) structure (unpublished data) as the search models.

Before refinement, the peptide and six CDR loops were omitted, and residues

differing between LC13 and KK50.4 were changed to Ala. The structure was

refined with rigid-body fitting of the individual domains and was implemented

in CNS (crystallography and nuclear magnetic resonance system, version 1.0)52

to yield an Rfree of 37.7%. The model was manually built with the program O53

interspersed with refinement within CCP4i54. Water molecules, assigned with

ARP/wARP (version 5.0), were included in the model if they appeared in Fo –

Fc maps contoured at more than 3.2s and were within hydrogen-bonding

distance to chemically appropriate groups. The final model contained 185

water molecules, 5 iodide ions, residues 2–276 of the HLA-E heavy chain

(excluding residues 219–225), residues 1–99 of b2-microglobulin, residues 1–9

of the peptide, residues 4–206 of the KK50.4 a-chain and residues 3–247 of the

KK50.4 b-chain. Excluded residues were within mobile loops distant from the

peptide–MHC–TCR interface and where electron density was scarce. The

model was refined to an Rfree of 29.2% (Rfactor, 21.4%); final refinement

statistics are in Table 2. The estimated coordinate error is 0.46 A.

Accession codes. Protein Data Bank: KK50.4 TCR-HLA-E–(VMAPRTLIL),

2ESV.

ACKNOWLEDGMENTSWe thank P. Coulie for HLA-E tetramers; A. Purcell for critical reading of themanuscript; and the Biocars staff at Advanced Photon Source (Chicago, Illinois)for assistance with data collection. Supported by the National Health andMedical Research Council, Doherty Fellowships from the National Health andMedical Research Council (L.C.S. and T.B.), the Australian Research Council, anAustralian Research Council Professorial Fellowship (J.R.) and a Wellcome TrustSenior Research Fellowship in Biomedical Science (J.R.).

COMPETING INTERESTS STATEMENTThe authors declare that they have no competing financial interests.

Published online at http://www.nature.com/natureimmunology/

Reprints and permissions information is available online at http://npg.nature.com/

reprintsandpermissions/

1. Wong, P. & Pamer, E.G. CD8 T cell responses to infectious pathogens. Annu. Rev.Immunol. 21, 29–70 (2003).

2. Falk, K., Rotzschke, O., Stevanovic, S., Jung, G. & Rammensee, H.G. Allele-specificmotifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature351, 290–296 (1991).

3. Adams, E.J. & Parham, P. Species-specific evolution of MHC class I genes in the higherprimates. Immunol. Rev. 183, 41–64 (2001).

4. Rudolph, M.G. & Wilson, I.A. The specificity of TCR/pMHC interaction. Curr. Opin.Immunol. 14, 52–65 (2002).

5. Ely, L.K., Kjer-Nielsen, L., McCluskey, J. & Rossjohn, J. Structural studies on thealphabeta T-cell receptor. IUBMB Life 57, 575–582 (2005).

6. Potter, T.A., Rajan, T.V., Dick, R.F., II & Bluestone, J.A. Substitution at residue 227 ofH-2 class I molecules abrogates recognition by CD8-dependent, but not CD8-indepen-dent, cytotoxic T lymphocytes. Nature 337, 73–75 (1989).

7. Borrego, F., Ulbrecht, M., Weiss, E.H., Coligan, J.E. & Brooks, A.G. Recognition ofhuman histocompatibility leukocyte antigen (HLA)-E complexed with HLA class I signalsequence-derived peptides by CD94/NKG2 confers protection from natural killer cell-mediated lysis. J. Exp. Med. 187, 813–818 (1998).

8. Braud, V.M. et al. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C.Nature 391, 795–799 (1998).

9. Carretero, M. et al. Specific engagement of the CD94/NKG2-A killer inhibitory receptorby the HLA-E class Ib molecule induces SHP-1 phosphatase recruitment to tyrosine-phosphorylated NKG2-A: evidence for receptor function in heterologous transfectants.Eur. J. Immunol. 28, 1280–1291 (1998).

10. Lee, N. et al. HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc. Natl. Acad. Sci. USA 95, 5199–5204 (1998).

11. Koller, B.H., Geraghty, D.E., Shimizu, Y., DeMars, R. & Orr, H.T. HLA-E. A novelHLA class I gene expressed in resting T lymphocytes. J. Immunol. 141, 897–904(1988).

12. Lee, N., Goodlett, D.R., Ishitani, A., Marquardt, H. & Geraghty, D.E. HLA-E surfaceexpression depends on binding of TAP-dependent peptides derived from certain HLAclass I signal sequences. J. Immunol. 160, 4951–4960 (1998).

13. Braud, V.M., Allan, D.S., Wilson, D. & McMichael, A.J. TAP- and tapasin-dependentHLA-E surface expression correlates with the binding of an MHC class I leader peptide.Curr. Biol. 8, 1–10 (1998).

14. Jones, T.R. et al. Human cytomegalovirus US3 impairs transport and maturation ofmajor histocompatibility complex class I heavy chains. Proc. Natl. Acad. Sci. USA 93,11327–11333 (1996).

15. Wiertz, E.J. et al. The human cytomegalovirus US11 gene product dislocates MHCclass I heavy chains from the endoplasmic reticulum to the cytosol. Cell 84, 769–779(1996).

16. Ahn, K. et al. The ER-luminal domain of the HCMV glycoprotein US6 inhibits peptidetranslocation by TAP. Immunity 6, 613–621 (1997).


A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

17. Lopez-Botet, M., Angulo, A. & Guma, M. Natural killer cell receptors for majorhistocompatibility complex class I and related molecules in cytomegalovirus infection.Tissue Antigens 63, 195–203 (2004).

18. Tomasec, P. et al. Surface expression of HLA-E, an inhibitor of natural killer cells,enhanced by human cytomegalovirus gpUL40. Science 287, 1031–1033 (2000).

19. Ulbrecht, M. et al. Cutting edge: the human cytomegalovirus UL40 gene productcontains a ligand for HLA-E and prevents NK cell-mediated lysis. J. Immunol. 164,5019–5022 (2000).

20. Cerboni, C. et al. Synergistic effect of IFN-gamma and human cytomegalovirus proteinUL40 in the HLA-E-dependent protection from NK cell-mediated cytotoxicity. Eur. J.Immunol. 31, 2926–2935 (2001).

21. Pietra, G. et al. The analysis of the natural killer-like activity of human cytolytic Tlymphocytes revealed HLA-E as a novel target for TCR a/b-mediated recognition. Eur. J.Immunol. 31, 3687–3693 (2001).

22. Salerno-Goncalves, R., Fernandez-Vina, M., Lewinsohn, D.M. & Sztein, M.B. Identifi-cation of a human HLA-E-restricted CD8+ T cell subset in volunteers immunized withSalmonella enterica serovar Typhi strain Ty21a typhoid vaccine. J. Immunol. 173,5852–5862 (2004).

23. Heinzel, A.S. et al. HLA-E-dependent presentation of Mtb-derived antigen to humanCD8+ T cells. J. Exp. Med. 196, 1473–1481 (2002).

24. Pietra, G. et al. HLA-E-restricted recognition of cytomegalovirus-derived peptides byhuman CD8+ cytolytic T lymphocytes. Proc. Natl. Acad. Sci. USA 100, 10896–10901(2003).

25. Davis, M.M. et al. Ligand recognition by ab T cell receptors. Annu. Rev. Immunol. 16,523–544 (1998).

26. van der Merwe, P.A. & Davis, S.J. Molecular interactions mediating T cell antigenrecognition. Annu. Rev. Immunol. 21, 659–684 (2003).

27. Ely, L.K. et al. Antagonism of antiviral and allogeneic activity of a human public CTLclonotype by a single altered peptide ligand: implications for allograft rejection.J. Immunol. 174, 5593–5601 (2005).

28. Willcox, B.E. et al. TCR binding to peptide-MHC stabilizes a flexible recognitioninterface. Immunity 10, 357–365 (1999).

29. O’Callaghan, C.A. et al. Structural features impose tight peptide binding specificity inthe nonclassical MHC molecule HLA-E. Mol. Cell 1, 531–541 (1998).

30. Strong, R.K. et al. HLA-E allelic variants. Correlating differential expression, peptideaffinities, crystal structures, and thermal stabilities. J. Biol. Chem. 278, 5082–5090(2003).

31. Kjer-Nielsen, L. et al. A structural basis for the selection of dominant alphabeta T cellreceptors in antiviral immunity. Immunity 18, 53–64 (2003).

32. Romagnani, C. et al. HLA-E-restricted recognition of human cytomegalovirus by asubset of cytolytic T lymphocytes. Hum. Immunol. 65, 437–445 (2004).

33. Clements, C.S. et al. Crystal structure of HLA-G: a nonclassical MHC class I moleculeexpressed at the fetal-maternal interface. Proc. Natl. Acad. Sci. USA 102, 3360–3365(2005).

34. Moretta, A. et al. Receptors for HLA class-I molecules in human natural killer cells.Annu. Rev. Immunol. 14, 619–648 (1996).

35. Vilches, C. & Parham, P. KIR: diverse, rapidly evolving receptors of innate and adaptiveimmunity. Annu. Rev. Immunol. 20, 217–251 (2002).

36. Mingari, M.C. et al. Human CD8+ T lymphocyte subsets that express HLA class I-specific inhibitory receptors represent oligoclonally or monoclonally expanded cellpopulations. Proc. Natl. Acad. Sci. USA 93, 12433–12438 (1996).

37. Lazetic, S., Chang, C., Houchins, J.P., Lanier, L.L. & Phillips, J.H. Human naturalkiller cell receptors involved in MHC class I recognition are disulfide-linked

heterodimers of CD94 and NKG2 subunits. J. Immunol. 157, 4741–4745(1996).

38. Kaiser, B.K. et al. Interactions between NKG2x immunoreceptors and HLA-E ligandsdisplay overlapping affinities and thermodynamics. J. Immunol. 174, 2878–2884(2005).

39. Wada, H., Matsumoto, N., Maenaka, K., Suzuki, K. & Yamamoto, K. The inhibitory NKcell receptor CD94/NKG2A and the activating receptor CD94/NKG2C bind the top ofHLA-E through mostly shared but partly distinct sets of HLA-E residues. Eur. J.Immunol. 34, 81–90 (2004).

40. Miller, J.D. et al. Analysis of HLA-E peptide-binding specificity and contact residues inbound peptide required for recognition by CD94/NKG2. J. Immunol. 171, 1369–1375(2003).

41. Romagnani, C. et al. Identification of HLA-E-specific alloreactive T lymphocytes: a cellsubset that undergoes preferential expansion in mixed lymphocyte culture and displaysa broad cytolytic activity against allogeneic cells. Proc. Natl. Acad. Sci. USA 99,11328–11333 (2002).

42. Borg, N.A. et al. The CDR3 regions of an immunodominant T cell receptor dictatethe ‘energetic landscape’ of peptide-MHC recognition. Nat. Immunol. 6, 171–180(2005).

43. Baker, B.M., Turner, R.V., Gagnon, S.J., Wiley, D.C. & Biddison, W.E. Identification of acrucial energetic footprint on the alpha1 helix of human histocompatibility leukocyteantigen (HLA)-A2 that provides functional interactions for recognition by tax peptide/HLA-A2-specific T cell receptors. J. Exp. Med. 193, 551–562 (2001).

44. Tynan, F.E. et al. Tcell receptor recognition of a ‘super-bulged’ major histocompatibilitycomplex class I-bound peptide. Nat. Immunol. 6, 1114–1122 (2005).

45. Gao, G.F. et al. Classical and nonclassical class I major histocompatibility complexmolecules exhibit subtle conformational differences that affect binding to CD8aa.J. Biol. Chem. 275, 15232–15238 (2000).

46. Llano, M., Guma, M., Ortega, M., Angulo, A. & Lopez-Botet, M. Differential effects ofUS2, US6 and US11 human cytomegalovirus proteins on HLA class Ia and HLA-Eexpression: impact on target susceptibility to NK cell subsets. Eur. J. Immunol. 33,2744–2754 (2003).

47. Shiina, T. et al. Molecular dynamics of MHC genesis unraveled by sequence analysis ofthe 1,796,938-bp HLA class I region. Proc. Natl. Acad. Sci. USA 96, 13282–13287(1999).

48. Knapp, L.A., Cadavid, L.F. & Watkins, D.I. The MHC-E locus is the most well conservedof all known primate class I histocompatibility genes. J. Immunol. 160, 189–196(1998).

49. Kawano, T. et al. CD1d-restricted and TCR-mediated activation of Va14 NKT cells byglycosylceramides. Science 278, 1626–1629 (1997).

50. Clements, C.S. et al. The production, purification and crystallization of a solubleheterodimeric form of a highly selected T-cell receptor in its unliganded and ligandedstate. Acta Crystallogr. D Biol. Crystallogr. 58, 2131–2134 (2002).

51. Burrows, S.R. et al. Peptide-MHC class I tetrameric complexes display exquisite ligandspecificity. J. Immunol. 165, 6229–6234 (2000).

52. Brunger, A.T. et al. Crystallography & NMR system: A new software suite for macro-molecular structure determination. Acta Crystallogr. D Biol. Crystallogr. 54, 905–921(1998).

53. Jones, T.A., Zou, J.Y., Cowan, S.W. & Kjeldgaard Improved methods for building proteinmodels in electron density maps and the location of errors in these models. ActaCrystallogr. A 47, 110–119 (1991).

54. Potterton, E., Briggs, P., Turkenburg, M. & Dodson, E. A graphical user interface to theCCP4 program suite. Acta Crystallogr. D Biol. Crystallogr. 59, 1131–1137 (2003).


A R T I C L E S©

2006

Nat

ure

Pub

lishi

ng G

roup

ht

tp://

ww

w.n

atur

e.co

m/n

atur

eim

mun

olog

y

structural basis for a major histocompatibility complex class ib–restricted t cell response

Documents