STRUCTURAL AND FUNCTIONAL INSIGHTS ON REGULATION BY PHENOLIC

COMPOUNDS.

By

Dea Shahinas

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Cell and Systems Biology

University of Toronto© Copyright by Dea Shahinas, 2008

ii

STRUCTURAL AND FUNCTIONAL INSIGHTS ON REGULATION BY PHENOLIC

COMPOUNDS.

Dea Shahinas

2008

Master of Science Department of Cell and Systems Biology

University of Toronto

Abstract

The shikimate pathway is a primary metabolic pathway involved in the synthesis

of aromatic compounds in plants, fungi, apicomplexan parasites and microbes.

The absence of this pathway in animals makes it ideal for the synthesis of

antimicrobial compounds and herbicides. Additionally, its branching into indole

hormone synthesis and phenylpropanoid secondary metabolism makes this

pathway attractive for metabolic engineering. Here, the focus is on the first step

of the shikimate pathway catalyzed by DAHP synthase. This step consists of the

condensation of phosphoenol pyruvate and erythrose-4-phosphate to make

DAHP, which undergoes another six catalytic steps to synthesize chorismate, the

precursor of the aromatic amino acids. Arabidopsis thaliana contains three DAHP

synthase isozymes, which are known to indirectly regulate downstream pathways

in response to wounding and pathogen stress. The model presented here

proposes that DAHP synthase isozymes are regulated by the end products

tyrosine, tryptophan and phenylalanine.

iii

TABLE OF CONTENTS LIST OF FIGURES V LIST OF ABBREVIATIONS: VI

CHAPTER I: REGULATION OF ARABIDOPSIS DAHP SYNTHASE ISOZYMES IN RESPONSE TO AROMATIC AMINO ACIDS. ........................................................................ 1

SUMMARY 1 INTRODUCTION 2 THE SHIKIMATE PATHWAY ............................................................................................................. 3 DAHP SYNTHASE (DAHPS) ........................................................................................................... 8 DAHP SYNTHASES IN ARABIDOPSIS THALIANA ............................................................................ 13 THE PHENYLPOPANOID PATHWAY AND ITS REGULATION. ............................................................ 16 AUXIN BIOSYNTHESIS AND ITS REGULATION. ............................................................................... 19 CHAPTER OBJECTIVES 22 MATERIALS AND METHODS 23 PLANT MATERIAL AND GROWTH CONDITIONS ............................................................................... 23 GENOMIC DNA EXTRACTION ........................................................................................................ 26 GENERATION OF DAHPS1XDR5::GUS CROSSES ............................................................................ 27 TOTAL RNA EXTRACTION ............................................................................................................ 27 MICROARRAY ANALYSIS ............................................................................................................... 28 VERIFICATION OF DR5::GUS CROSSES WITH PCR ........................................................................ 29 GUS STAINING PROCEDURE........................................................................................................... 29 RESULTS 30 DAHPS2 LACKS A C-TERMINAL ALPHA HELIX WHICH IS PRESENT IN DAHPS1 AND DAHPS3. .. 30 AROMATIC AMINO ACID SUPPLEMENTATION HAS DISTINCTIVE EFFECTS ON THE DHS SEEDLING PHENOTYPE IN ARABIDOPSIS THALIANA. ...................................................................................... 34 TRANSCRIPTIONAL ANALYSIS ....................................................................................................... 43 THE EFFECT OF THE AROMATIC AMINO ACIDS ON DR5::GUS LEVELS. ......................................... 65 DISCUSSION 67 THE ROLE OF THE DAHP SYNTHASES ........................................................................................... 67 THE ROLE OF THE AROMATIC AMINO ACIDS IN REGULATING THE SHIKIMATE PATHWAY. ............ 69 PERSPECTIVES ON THE MODEL AND FUTURE DIRECTIONS. ............................................................ 77

CHAPTER II: THE CRYSTAL STRUCTURE OF A. AEOLICUS PREPHENATE DEHYDROGENASE REVEALS THAT TYROSINE INHIBITION IS MEDIATED BY A SINGLE RESIDUE ..................................................................................................................... 81

ABSTRACT 81 INTRODUCTION 82 MATERIALS AND METHODS 85 CHEMICALS AND REAGENTS .......................................................................................................... 85 SITE-DIRECTED MUTAGENESIS ...................................................................................................... 86 PROTEIN EXPRESSION AND PURIFICATION ..................................................................................... 86 DETERMINATION OF ENZYME ACTIVITY AND DISSOCIATION CONSTANTS FOR LIGAND BINDING . 86 CRYSTALLIZATION ........................................................................................................................ 87 X-RAY DIFFRACTION AND STRUCTURE DETERMINATION .............................................................. 88 RESULTS AND DISCUSSION 90

iv

CRYSTALLIZATION AND STRUCTURAL SUMMARIES OF Δ19PD-NAD+-HPP, Δ19PD-NAD+-HPPROPIONATE AND Δ19PD-NAD+L-TYROSINE ......................................................................... 90 CONFORMATIONAL SHIFTING UPON SUBSTRATE BINDING ............................................................ 96 LOCATION OF A. AEOLICUS PD ACTIVE SITE ................................................................................. 99 ARCHITECTURE OF THE SUBSTRATE BINDING SITE .................................................................... 101 ROLE OF HIS147 IN THE REACTION MECHANISM ........................................................................ 103 ROLE OF SER126 IN THE REACTION MECHANISM ....................................................................... 105 ROLE OF WAT1 IN THE REACTION MECHANISM ........................................................................ 105 ROLE OF ARG250 IN THE REACTION MECHANISM ...................................................................... 106 ROLE OF HIS217 IN THE REACTION MECHANISM ........................................................................ 106 HIS217 AS A DETERMINANT OF LIGAND PREFERENCE ................................................................. 111 STRUCTURAL COMPARISONS OF AD AND PD .............................................................................. 112 BIOLOGICAL AND BIOCHEMICAL RELEVANCE ............................................................................ 113

CHAPTER III: STRUCTURAL INSIGHT ON THE MECHANISM OF REGULATION OF THE MARR FAMILY OF PROTEINS............................................................................ 116

ABSTRACT 116 INTRODUCTION 117 RESULTS AND DISCUSSION 120 CRYSTALLIZATION AND STRUCTURE DETERMINATION .............................................................. 120 OVERALL STRUCTURE OF MTH313 ............................................................................................ 120 SEQUENCE ANALYSIS ................................................................................................................... 124 STRUCTURE ANALYSIS WITH DALI ............................................................................................ 124 BIOPHYSICAL ANALYSIS OF SALICYLATE BINDING TO MTH313 ................................................. 132 SALICYLATE DISRUPTS MTH313 BINDING TO DNA ................................................................... 133 MECHANISM OF INACTIVATION OF MTH313 .............................................................................. 137 BIOLOGICAL RELEVANCE ............................................................................................................ 139 MATERIALS AND METHODS 141 CLONING, PROTEIN EXPRESSION AND PURIFICATION ................................................................. 141 PROTEIN CRYSTALLIZATION ....................................................................................................... 142 X-RAY DIFFRACTION AND STRUCTURE DETERMINATION .......................................................... 143 DNA BINDING STUDY PROBE DESIGN ........................................................................................ 144 GEL SHIFT ASSAY ........................................................................................................................ 144 THERMAL SHIFT SALICYLATE BINDING ASSAY .......................................................................... 145 CONCLUDING DISCUSSION 147 REFERENCES: 150

v

LIST OF FIGURES FIGURE 1- 1: AN OVERVIEW OF THE SHIKIMATE PATHWAY.. ........................................................................... 7 FIGURE 1- 2: THE DAHP FORMATION REACTION MECHANISM.. ......................................................................... 9 FIGURE 1- 3: E.COLI DAHP SYNTHASE CO-CRYSTALLIZED WITH PEP AND PHENYLALANINE.. ............................ 12 FIGURE 1- 4: ORGAN SPECIFIC MAP OF DAHPS ISOZYME TRANSCRIPT EXPRESSION IN A.THALIANA.. ................. 15 FIGURE 1- 5: DIAGRAM OF THE POSITION OF THE T-DNA INSERTION FOR THE DAHP SYNTHASE KNOCKOUT

LINES. . ................................................................................................................................................ 25 FIGURE 1- 6: PREDICTED THREE DIMENSIONAL MODELS OF THE ARABIDOPSIS THALIANA DAHP SYNTHASE

ISOZYMES.. .......................................................................................................................................... 31 FIGURE 1- 7: MULTIPLE SEQUENCE ALIGNMENT OF DAHP SYNTHASE ISOZYMES FROM SEQUENCED PLANT

GENOMES (A-C) AND MICROBIAL SEQUENCES (D).. .......................................................................... 33 FIGURE 1- 8: DIAGRAM OF THE POSITION OF THE PRIMERS USED BY VALERIE CROWLEY FOR GENOTYPING

THE DAHP SYNTHASE INSERTION LINES. ........................................................................................... 35 FIGURE 1- 9: RESPONSE OF DAHPS1 TO AROMATIC AMINO ACID SUPPLEMENTATION. ................................ 39 FIGURE 1- 10: RESPONSE OF THE DAHPS1-2 ALLELE TO AROMATIC AMINO ACID SUPPLEMENTATION. ...... 40 FIGURE 1- 11: RESPONSE OF DAHPS2 TO AROMATIC AMINO ACID SUPPLEMENTATION ...................................... 41 FIGURE 1- 12: RESPONSE OF DAHPS3 TO AROMATIC AMINO ACID SUPPLEMENTATION ....................................... 42 FIGURE 1- 13: VENN DIAGRAM REPRESENTATION OF THE PHENYLPROPANOID PATHWAY TRANSCRIPTS

SIGNIFICANTLY AFFECTED IN EACH COMPARISON. . ................................................................................ 61 FIGURE 1- 14: VENN DIAGRAM REPRESENTATION OF ALL THE TRANSCRIPTS SIGNIFICANTLY AFFECTED IN EACH

COMPARISON.. ...................................................................................................................................... 63 FIGURE 1- 15: EFFECT OF TYROSINE ON THE DR5::GUS MARKER AND DAHPS1XDR5::GUS CROSSES AS

OBSERVED AT THE ROOT APEX.. ............................................................................................................. 66 FIGURE 1- 16: ILLUSTRATION OF THE EFFECT OBSERVED ON KEY SHIKIMATE AND PHENYLPROPANOID PATHWAY

GENES UPON AROMATIC AMINO ACID SUPPLEMENTATION.. ...................................................................... 75 FIGURE 1- 17: THE MODEL BY WHICH DAHPS ISOZYMES ARE PREDICTED TO INTERACT WITH THE AROMATIC

AMINO ACIDS AND AFFECT THE LEVELS OF INTERMEDIATES SHUTTLED TO THE BRANCHING PATHWAYS.. ... 76 FIGURE 2- 1 METABOLIC ROUTES FROM CHORISMATE LEADING TO THE SYNTHESIS OF L-TYROSINE AND L-

PHENYLALANINE. . ................................................................................................................................ 95 FIGURE 2- 2 CΑ TRACES OF A. AEOLICUS PREPHENATE DEHYDROGENASE SHOWING CONFORMATIONAL CHANGES

THAT OCCUR AS A RESULT OF LIGAND BINDING TO THE SUBSTRATE BINDING SITE. .................................... 98 FIGURE 2- 3: A SCHEMATIC OF THE ACTIVE SITE OF A. AEOLICUS PREPHENATE DEHYDROGENASE.. ..................102 FIGURE 2- 4: REPRESENTATIVE ELECTRON DENSITY FOR NAD+, WAT1 AND A BOUND LIGAND IN THE ACTIVE SITE

OF A. AEOLICUS PREPHENATE DEHYDROGENASE.. .................................................................................104 FIGURE 2- 5: SUPERIMPOSITION OF LIGANDS IN THE ACTIVE SITE OF PD.. .......................................................110 FIGURE 3- 1: A RIBBON DIAGRAM OF THE APO PROTEIN MTH313 DIMER.. .....................................................123 FIGURE 3- 2: COMPARISON OF THE TOP DALI STRUCTURAL HOMOLOGUES AT THE HELIX TURN HELIX MOTIF

REVEALS CONSERVATION OF THE LIGAND BINDING POCKET IN THREE-DIMENSIONAL SPACE.. ...................126 FIGURE 3- 3: ELECTROSTATIC SURFACE REPRESENTATION OF MTH313 IN THE APO AND IN COMPLEX WITH

SALICYLATE.. ........................................................................................................................................129 FIGURE 3- 4:THE STABILIZING EFFECT OF SALICYLATE ON THE THERMAL DENATURATION AND DNA BINDING

OF MTH313. . ....................................................................................................................................135

vi

LIST OF ABBREVIATIONS: TyrA Family of enzymes involved in tyrosine biosynthesis MarR Multiple antibiotic resistance repressor DAHP 3-deoxy-D-arabino-heptulosonate-7-phosphate PEP Phosphoenol pyruvate E-4-P Erythrose-4-phosphate DAHPS DAHP synthase DHQS Dehydroquinate synthase DHQ Dehydroquinate dehydratase SDH Shikimate dehydrogenase SK Shikimate kinase EPSPS 5-enolpyruvylshikimate-3-phosphate synthase CS Chorismate synthase EPSP 5-enolpyruvylshikimate-3-phosphate 3-DHQ 3-dehydroquinate 3-DHS 3-dehydroshikimate S3P Shikimate-3-phosphate AROM Fungal pentafunctional complex of enzymes 2-6 in the shikimate pathway. UV ultraviolet DAHPS1 DAHP synthase encoded by At4g39980 DAHPS2 DAHP synthase encoded by At4g35510 DAHPS3 DAHP synthase encoded by At1g22410 MS Mushragie and Skoog medium MES morpholino ethane sulfonic acid w/v weight to volume ratio EDTA ethylenediaminetetraacetic acid SDS sodium dodecyl sulfate NaPi Sodium phosphate PHYRE Three-dimensional structure modeling software CLUSTAL W Multiple sequence alignment software F Phenylalanine W Tryptophan Y Tyrosine wt Wild type CM1 Chorismate mutase 1 CM2 Chorismate mutase 2 CM3 Chorismate mutase 3 ICS1 Isochorismate mutase 1 ICS2 Isochorismate mutase 2 ADT2 Arogenate dehydratase 2 ADT3 Arogenate dehydratase 3 ADT5 Arogenate dehydratase 5 4CL 4-Coumarate:CoA ligase PAL Phenylalanine ammonia lyase HPP 4-hydroxyphenylpyruvate PD Prephenate dehydrogenase AD Arogenate dehydrogenase CM-PD Chorismate mutase - prephenate dehydrogenase bifunctional enzyme HPpropionate Hydroxyphenylpropionate Δ19PD Prephenate dehydrogenase construct with 19 amino acid deletion. WAT Water molecule MTH313 Methanobacterium thermoautotrophicus gene 313 MAR Multiple antibiotic resistance MDR Multiple drug resistance SA Salicylic acid

1

CHAPTER I: REGULATION OF ARABIDOPSIS DAHP SYNTHASE ISOZYMES IN RESPONSE TO AROMATIC AMINO ACIDS.

Summary The shikimate pathway is a primary metabolic pathway involved in the synthesis

of aromatic compounds in plants, fungi, apicomplexan parasites and microbes. The

absence of this pathway in animals makes it ideal for the synthesis of antimicrobial

compounds and herbicides. Additionally, its branching into indole hormone synthesis

and phenylpropanoid secondary metabolism makes this pathway attractive for

metabolic engineering. Here, the focus is on the first step of the shikimate pathway

catalyzed by DAHP synthase. This step consists of the condensation of phosphoenol

pyruvate and erythrose-4-phosphate to make DAHP, which undergoes another six

catalytic steps to synthesize chorismate, the precursor of the aromatic amino acids.

Arabidopsis thaliana contains three DAHP synthase isozymes, which are known to

indirectly regulate downstream pathways in response to wounding and pathogen stress.

The model presented here proposes that DAHP synthase isozymes are regulated by

the end products tyrosine, tryptophan and phenylalanine.

2

INTRODUCTION The shikimate pathway is an essential metabolic pathway involved in the

synthesis of aromatic compounds in plants, apicomplexan parasites, fungi and microbes

(Suzich, Ranjeva et al. 1984; Dyer, Henstrand et al. 1989; Keith, Dong et al. 1991;

Herrmann 1995; Herrmann 1995; Herrmann and Weaver 1999; Elandalloussi,

Rodrigues et al. 2005; Webby, Baker et al. 2005; Webby, Lott et al. 2005). Animals

obtain their aromatic compounds from their diet. Starcevic et al. challenge the view that

the shikimate pathway is not found in animals by showing its presence in metazoans

using phylogenetic analysis (Starcevic, Akthar et al. 2008). However, no functional data

has been provided for the identified genes.

The interest in the shikimate pathway enzymes as potential targets for non-toxic

herbicides and anti-microbial compounds dates back more than 25 years ago. In 1972,

the company Monsanto reported the discovery of glyphosate (N-

phosphonomethylglycine), which became a billion dollar herbicide, and in the 1980s

following Monsanto’s model, more commercially important herbicides that targeted other

amino acid biosynthetic pathways became available (Coggins, Abell et al. 2003).

Even though glyphosate was discovered as a herbicide, later on it was also

tested as an antiparasitic agent. In vitro growth of Toxoplasma gondii, Plasmodium

falciparum (malaria) and Cryptosporidium parvum was inhibited by glyphosate

(Coggins, Abell et al. 2003; Campbell, Richards et al. 2004). This effect on T. gondii and

P. falciparum was reversed by treatment with p-aminobenzoate, which suggests that the

shikimate pathway supplies folate precursors for their growth. However, since its

3

introduction, resistance to glyphosate has been reported, including several species of

cyanobacteria that are equipped with a resistant form of 5-enolpyruvylshikimate-3-

phosphate (EPSP) synthase up to the millimolar range (Forlani, Pavan et al. 2008).

Therefore, new efforts have concentrated on more successful drug and herbicide design

strategies.

Apart from inhibitor discovery, the shikimate pathway is also of high interest for

metabolic engineering since the phenolic products of the pathway are extensively used

in the industry as antioxidants for processed foods (De Leonardis and Macciola 2004;

La Camera, Geoffroy et al. 2005). Shikimic acid, one of the intermediates in the

shikimate pathway, is used as a precursor for the synthesis of Tamiflu (Oseltamivir

phosphate), the most prescribed flu medicine (Bertelli, Mannari et al. 2008). In plants,

the shikimate pathway provides the precursors for the synthesis of the indole hormones

and phenylpropanoids, which are currently of high interest due to their potential as

nutraceuticals such as ferulic acid and genistein. However, despite its potential the

metabolic engineering of the shikimate pathway has encountered a lot of challenges

because regulation of the pathway in eukaryotes is much more complex than in

microbes due to this secondary metabolism branching (Herrmann 1995; Herrmann

1995; Herrmann and Weaver 1999; Delmas, Petit et al. 2003; Singh and Christendat

2006).

The Shikimate Pathway

The shikimate pathway consists of seven enzymatic steps that terminate with the

production of chorismate (Figure 1-1). The committed step of the shikimate pathway is

the aldol condensation of phosphoenol pyruvate (PEP) and erythrose-4-phosphate

4

(E4P) to form 3-deoxy-D-Arabino-Heptulosonate 7-phosphate (DAHP) catalyzed by the

enzyme DAHP synthase. The pathway terminates with the synthesis of chorismate,

which branches into the production of tyrosine, phenylalanine and tryptophan as well as

folates, ubiquinones, salicylic acid, terpenoids, flavonoids, benzylisoquinoline alkaloids

(Liscombe and Facchini 2008), indole hormones and lignin in plants (Campbell,

Richards et al. 2004). These compounds are involved in signaling, growth, UV

protection, pathogen defense and structural support in plants(Herrmann 1995;

Herrmann 1995; Herrmann and Weaver 1999). Furthermore, benzylisoquinoline

alkaloids serve as precursors for semi-synthetic drugs (Liscombe and Facchini 2008).

DAHP synthase, the first enzyme of the pathway, interlinks glycolysis and the

pentose-phosphate pathway with the shikimate pathway. This enzyme exists in three

isoforms in most organisms and as such, it is a key regulatory point for the shikimate

pathway. It condenses phosphoenol pyruvate (PEP) from glycolysis, and erythrose 4-

phosphate (E4P) from the pentose phosphate pathway to form DAHP. 3-

dehydroquinate (3-DHQ) synthase catalyzes the cyclization of 3-DHQ from DAHP and

3-DHQ dehydratase forms 3-dehydroshikimate (3-DHS), which is converted to

shikimate by shikimate dehydrogenase. Shikimate is phosphorylated by shikimate

kinase to form shikimate 3-phosphate (S3P). S3P is converted to 5-

enolpyruvylshikimate 3-phosphate (EPSP) by EPSP synthase. The seventh and

ultimate step of the pathway is catalyzed by chorismate synthase (CS) to form

chorismate (Herrmann 1995a). Chorismate is used to synthesize the aromatic amino

acids as well as a variety of aromatic compounds such as: folates, ubiquinones, salicylic

acid etc. (Herrmann 1995; Herrmann 1995; Herrmann and Weaver 1999; Campbell,

Richards et al. 2004).

5

In bacteria, a separate enzyme catalyzes each step of the shikimate pathway,

but this is not the case in fungi, apicomplexan parasites and plants. Fungi and

Taxoplasma gondii have a pentafunctional AROM complex that includes the second to

the sixth steps of the pathway (Lumsden and Coggins 1977; Lumsden and Coggins

1978; Campbell, Richards et al. 2004). It has been suggested that arom is the ancient

supergene form that was either lost or replaced in several eukaryotic lineages raising

interesting questions about the differential regulation of this pathway in the different taxa

(Campbell, Richards et al. 2004). This phylogenetic path of the shikimate pathway

places plants in an interesting taxonomic context with all the reactions being catalyzed

by separate enzymes with the exception of dehydroquinase and shikimate

dehydrogenase that form a bifunctional enzyme with two independent active sites

(Singh and Christendat 2006).

The aromatic amino acids are a direct product of the shikimate pathway, and

apart from their role in protein synthesis, they also serve as precursors for a wide range

of metabolites such as flavonoids, anthocyanins, lignin and indole hormones, that are

involved in signaling, UV protection and structural support in plants (Herrmann 1995;

Herrmann 1995; Herrmann and Weaver 1999). Shuttling of aromatic amino acids into

secondary pathways is generally not observed in microbes, even though there is some

evidence for their participation in antibiotic synthesis and other secondary metabolites

(Webby, Baker et al. 2005; Webby, Lott et al. 2005). Because the intermediates of the

shikimate pathway serve as precursors for many branch pathways, the study of the

regulation mechanism of this pathway in plants is both interesting and necessary for the

engineering of the pathway as well as for drug, vaccine or herbicide development.

6

All the shikimate pathway enzymes are predicted to be localized in the plant

chloroplast using ChloroP (Emanuelsson, Nielsen et al. 1999), which predicts a

characteristic N-terminal transit peptide and from data present in the plastid proteome

databank which also indicates the localization of the shikimate pathway enzymes in the

chloroplast (Friso, Giacomelli et al. 2004). In addition, chorismate synthase has been

shown to be inactive in the cytosol in the presence of the cleavable transit peptide and

chorismate is not synthesized in the cytosol (Henstrand, Schmid et al. 1995).

7

Figure 1- 1: An overview of the shikimate pathway. This is the pathway by which the aromatic amino acids are synthesized in plants, fungi, microbes and apicomplexan parasites. The pathway initiates with the condensation of phosphoenol pyruvate (PEP) and erythrose-4-phosphate (E-4-P) and through a series of seven enzymatic steps, it terminates with the synthesis of chorismate, which serves as a precursor for aromatic compounds including the aromatic amino acids. In plants, apart from protein synthesis, the aromatic amino acids are also used to synthesize secondary metabolites such as the flavonoids, anthocyanins, lignin and indole hormones. These metabolites are important for signaling, structural support and responding to UV as well as pathogenic stress.

8

DAHP Synthase (DAHPS)

DAHP synthase, the first enzyme of the shikimate pathway, catalyzes the

condensation of E-4-P and PEP to form DAHP. The substrates for this reaction are

derived from primary metabolism. PEP is derived from glycolysis and E-4-P is derived

from the pentose phosphate pathway (Figure 1-2). Upon the condensation of PEP and

E-4-P into DAHP by DAHP synthase, a phosphate is released (Dyer, Henstrand et al.

1989; Herrmann 1995; Herrmann 1995; Herrmann and Weaver 1999; Delmas, Petit et

al. 2003; Crowley 2006).

From genetic and biochemical studies on the microbial shikimate pathway, it is

apparent that DAHPS is the regulatory step of the shikimate pathway. In bacteria, there

are three isozymes of DAHPS characterized as aroF, aroG and aroH and they are

feedback inhibited respectively by the aromatic amino acids: Tyrosine, Phenylalanine

and Tryptophan. Inhibition of the Trp-sensitive isozymes does no exceed 40% to ensure

formation of sufficient amount of chorismate to fulfill the need for protein synthesis and

for folate biosynthesis (Herrmann 1995; Herrmann 1995; Schmid 1995; Herrmann and

Weaver 1999; Gosset, Bonner et al. 2001; Webby, Baker et al. 2005; Webby, Lott et al.

2005).Transcriptional repression by the tyr and trp repressors bound to the aromatic

amino acids is also observed, but the main mode of regulation is feedback inhibition at

the protein level in vivo (Herrmann 1995; Herrmann 1995; Schmid 1995; Herrmann and

Weaver 1999; Gosset, Bonner et al. 2001; Webby, Baker et al. 2005; Webby, Lott et al.

2005).

9

-Adapted from (Herrmann and Weaver 1999)-

Figure 1- 2: The DAHP formation reaction mechanism. DAHP synthase catalyzes the condensation of phosphoenol pyruvate (PEP) and erythrose-4-phosphate (E-4-P) to make DAHP.

DAHP synthase

10

Structural analyses of bacterial DAHP synthases have revealed the architecture of the

active site as well as the allosteric site (Figure 1-3). The PEP and E4P binding site is

characterized by a conserved TIM barrell fold consisting of eight alternating alpha

helices and beta sheets (Shumilin, Zhao et al. 2002).

DAHP synthase enzymes are classified into two homologous clusters: AroAI and

AroAII. The AroAI cluster is subdivided into AroAIα and AroAIβ (Gosset, Bonner et al.

2001). Gram negative bacteria contain DAHP synthase isozymes that belong to the

AroAIα subcluster. The E.coli DAHP synthase isozymes belonging to this group are

feedback regulated by each of the aromatic amino acids. Figure 1-3 is an illustration of

the E.coli DAHPS AroG. The allosteric pocket in which a phenylalanine molecule is

bound per monomer is located at the proximity of the dimerization domain in the co-

crystal structure. This site is distant to the active site, in which a molecule of PEP is

bound in each monomer. The active site is found in the center of the TIM barrel

(Shumilin, Zhao et al. 2002).

The AroAIβ cluster consists of enzymes closely related to KDOP synthases

according to the 2001 classification (Gosset, Bonner et al. 2001). These enzymes are

involved in the synthesis of lipopolysaccharides in bacteria and phosphorylated KDO in

plants. KDO is a rare sugar synthesized by utilizing PEP in plants (Gosset, Bonner et al.

2001; Delmas, Petit et al. 2003). KDOP synthases can function as DAHP synthase with

the opposite stereochemistry in vitro but not in vivo (Subramaniam, Xie et al. 1998;

Subramanian, Benson et al. 2003).

The AroAII family contains enzymes with a high degree of similarity between

plants and microbes. A well characterized representative of this family is the

Mycobacterium tuberculosis enzyme which apart from the active site TIM barrel

11

contains two helices that have been inserted between α2 and β3 (Webby, Baker et al.

2005; Webby, Lott et al. 2005). These features distinguish this type II enzyme from the

known structures of the Iα or Iβ subtypes. The authors propose that these extra two

helices provide two distinct allosteric inhibitor sites that can be regulated by

phenylalanine and tyrosine simultaneously, as they observe synergistic inhibition when

they assay the enzyme for in vitro activity (Webby, Baker et al. 2005; Webby, Lott et al.

2005).

12

PDB ID: 1KFL

Figure 1- 3: E.coli DAHP synthase co-crystallized with PEP and phenylalanine. This microbial enzyme was crystallized as a dimer. The substrate PEP molecule (grey) is located at the centre of the TIM barrel, an α/β barrel.. The allosteric pocket is located in the proximity of the dimerization domain and phenylalanine is bound at this site (cyan).

13

DAHP synthases in Arabidopsis thaliana

Arabidopsis thaliana also has three DAHPS: DAHPS1, DAHPS2 and DAHPS3,

isozymes encoded by the genes At4g39980, At4g35510 and At1g22410 respectively.

Feedback inhibition has not been reported in plants. Since the aromatic amino acids are

shunted to different secondary pathways in plants, the regulation mechanism of the

shikimate pathway must be more complex than in microbes. It is possible that regulation

occurs at several levels including transcriptional and post-translational modifications

(Herrmann 1995; Herrmann 1995; Herrmann and Weaver 1999; Soll and Schleiff 2004;

Winkel 2004).

Studies in our lab as well as studies in potato suspension cultures suggest that

DAHPS isozymes are regulated in response to wounding, pathogens and exogenous

compounds (Dyer, Henstrand et al. 1989; Herrmann 1995; Herrmann 1995; Herrmann

and Weaver 1999; Crowley 2006). The EPSP synthase inhibitor, glyphosate, increases

DAHP expression in vivo, but not in vitro, in potato suspension cultures (Dyer,

Henstrand et al. 1989). Additionally, the DAHPS2 protein levels in plants are redox

regulated suggesting that the shikimate pathway is stimulated in the presence of light

(Rogers, Dubos et al. 2005).

A large number of chloroplast localized proteins are regulated by redox

modulation. Post-translational redox regulation does not only apply to light-dark

regulation, but it also regulates the plastid response to cytosolic sugar levels (Soll 2002;

Geigenberger, Kolbe et al. 2005). Experimental evidence suggests that protein import

into the chloroplast can be controlled by redox state and this is a potential mode of

regulation for the DAHP synthase isozymes in plants (Soll 2002; Geigenberger, Kolbe et

al. 2005; Rogers, Dubos et al. 2005).

14

Studies on the regulation of the shikimate pathway in eukaryotes to determine

the mechanism of regulation of this pathway are under way. For example, in yeast,

DAHP synthase has been shown to interact with the Smt3p, a SUMO protein, which can

affect diverse protein function and has been shown to reduce the activity of several

transcription factors (Subramaniam, Xie et al. 1998). However, no validation or

functional characterization of such an interaction has been achieved so far.

Further evidence that hints towards complex regulation of the pathway in plants

shows that DAHPS1 is the only DAHPS affected by wounding and pathogen attack

(Keith, Dong et al. 1991) and also, organ specific expression of DAHPS isozymes has

been reported in tomato (Gorlach, Beck et al. 1993) and is also observed with DAHPS

isozymes in Arabidopsis thaliana (Figure 1- 4). DAHPS1 transcript levels are the highest

in the rosette leaves. DAHPS2 is regulated by circadian rhythms and its levels are

highest in the dry seed, leaves and floral organs, while DAHPS3 transcript levels are

highest in the floral organs and the stem (Schmid, Davison et al. 2005).

15

Figure 1- 4: Organ specific map of DAHPS isozyme transcript expression in A.thaliana. The colour intensity bar indicates the relative levels of expression for each isozyme based on the AtGenExpress Consortium Data (Schmid et al, 2005). DAHPS1 is most highly expressed in the rosette leaves. The corresponding organs of highest expression for each of these isozymes are: Rosette leaves for DAHPS1; dry seed, leaves and floral organs for DAHPS2; and, lower stem and floral organs for DAHPS3. The images were generated using the eFP browser at the Bio-Array Resource for Arabidopsis Functional Genomics (Winter, Vinegar et al. 2007).

DAHPS2 DAHPS3 DAHPS1

16

SALK T-DNA insertion lines of each DHS isozyme (Table 1-1) have been used in

our lab to elucidate the role of each of these isozymes in the regulation of the shikimate

pathway (Crowley 2006). Single homozygous knockout lines have no apparent

phenotype when grown under standard growth conditions: 0.5X MS, 2.5mM MES and

1.5% sucrose, standard light and room temperature.

However, when these knockout seedlings are stressed, some interesting

phenotypes are observed. All these homozygous knockout lines are sensitive to 20

minute UV light exposure compared to wild type plants. They show delayed bolting and

dried leaves. In addition, dahps1 plants are sensitive to supplementation with 150 μM

tyrosine. These seedlings exhibit arrested growth and leaves do not emerge.

This phenotype suggests that tyrosine serves as a modulator of either DAHPS2,

DAHPS3 or both. This modulation can be applied directly to these isozymes or it can be

mediated. To determine if tyrosine has a direct effect on the function of these proteins,

kinetic analysis of each isozyme that measured the release of inorganic phosphate by

each of the isozymes in the absence and presence of tyrosine with different substrate

concentrations was performed. This analysis showed that there was no difference in the

activity of the DAHPS isozymes in the presence of tyrosine (Crowley 2006).

The phenylpopanoid pathway and its regulation.

The phenylpropanoid pathway is involved in the synthesis of flavonoids and

monolignols (Bate, Orr et al. 1994; Werck-Reichhart 1995; Dixon and Steele 1999;

Werck-Reichhart and Feyereisen 2000; Werck-Reichhart, Hehn et al. 2000). Flavonoids

are phenolic compounds with anti-oxidant properties and are involved in protecting the

plant against ultraviolet and pathogen stress. Monolignols serve as precursors for the

17

synthesis of lignin. The chemical diversity acquired specifically in plants via this pathway

is advantageous for large repertoires of pigments, structural and defensive compounds

(Bate, Orr et al. 1994; Werck-Reichhart 1995; Dixon and Steele 1999; Werck-Reichhart

and Feyereisen 2000; Werck-Reichhart, Hehn et al. 2000).

Phenylpropanoids serve as key chemical modulators in defensive phytoalexin

responses to infection and herbivory, attraction of insect pollinators via flower color, and

induction of root nodulation by symbiotic nitrogen-fixing rhizobial colonies (Ferrer, Austin

et al. 2008). Three enzymatic transformations redirect the carbon flow from primary

metabolism, transforming phenylalanine into the Coenzyme A (CoA)-activated

hydroxycinnamoyl (phenylpropanoid) thioester capable of entering the two major

downstream pathways, monolignol and flavonoid biosynthesis. Deamination by

phenylalanine ammonia-lyase (PAL) forms the phenylpropanoid skeleton, producing

cinnamic acid. Various general

phenylpropanoid pathway intermediates are also diverted into biosynthetic pathways for

benzoic acid, salicylic acid, and coumarins (Ferrer, Austin et al. 2008).

Lignin is an abundant structural polymer formed from monolignol derivatives of

the general phenylpropanoid pathway. Together with cellulose, it provides the structural

integrity to support plant vertical stature (Ferrer, Austin et al. 2008). It imparts

mechanical strength to stems and trunks, and hydrophobicity to water-conducting

vascular elements (Dixon, Lamb et al. 1996; Dixon, Howles et al. 1998; Dixon and

Steele 1999).

Flavonoids provide protection against ultraviolet rays. Chalcone synthase (CHS)

is the first enzyme specific for flavonoid biosynthesis. It catalyzes the condensation of

three molecules of malonyl CoA with one molecule of 4-coumaroyl CoA (a product of

18

the core phenylpropanoid pathway) to yield a polyketide intermediate which is cyclized

on the enzyme to form 2',4,4',6'-tetrahydroxychalcone. Following CHS, several

isomerases, reductases, hydroxylases, glycosyltransferases and acyltransferases

enrich the basic flavonoid skeleton leading to the variety of flavonoid compound

subclasses. The presence of a C2=C3 double bond dinstinguishes flavones and

flavonones, making the latter less reactive. Isoflavonoids are characterized by a C2-C3

aryl ring migration and concomitant double bond formation catalyzed by isoflavone

synthase. The addition of hydroxyl groups to core flavonoid rings leads to the formation

of the flavonols and flavandiols, which serve as precursors of proanthocyanidins and

anthocyanins (Dixon, Lamb et al. 1996; Dixon, Howles et al. 1998; Dixon and Steele

1999; Ferrer, Austin et al. 2008).

The chemical diversity as well as the multiplicity of roles exhibited by the

phenylpropanoid pathway requires tight regulation of these processes. More than 15

P450-dependent reactions have been characterised in this pathway. Several of these

reactions constitute important regulatory branching points, which provide clues in the

regulation of metabolic pathways in plants. Indirect and direct data indicate that distinct

P450s catalyse the different reactions. Cinnamate 4-hydroxylase (C4H), is the most

extensively studied plant P450 (Werck-Reichhart 1995; Werck-Reichhart and

Feyereisen 2000; Werck-Reichhart, Hehn et al. 2000). The phenylalanine ammonia

lyase mediated reaction becomes the dominant rate-determining step in the regulation

of lignin deposition at levels 3-4-fold below wild-type (Bate, Orr et al. 1994). There are

two phenylalanine ammonial lyases in plants: phenylalanine ammonia lyase 1 (PAL1)

and phenylalanine ammonia lyase 2 (PAL2). PAL2 can be induced to localize to the ER

by overexpression of cinnamate 4-hydroxylase (C4H), and this localization can be

19

reversed by overexpression of PAL1. This points to protein interactions between the

membrane P450 enzyme, C4H, and the two PAL enzymes, and further suggests that

the two PAL isoforms play distinct roles in interactions with C4H (Winkel 2004).

Experimental evidence exists for the spatial organization of phenylpropanoid

enzymes in the cytoplasm of plant cells. Studies in a wide range of species have

generated evidence for the co-ordinate expression of genes and enzymes, channeling

of labeled intermediates, membrane association of operationally soluble enzymes, and

physical interaction of component enzymes making this the pathway with the most

diverse regulatory mechanisms at many levels (Winkel 2004). It is possible that these

enzymes function in distinct metabolons, each dedicated to producing a particular class

of phenylpropanoids.

Auxin biosynthesis and its regulation.

Indole-3-acetic acid (IAA) was the first plant growth regulatory substance

discovered and ever since, auxins are known to be involved in the regulation of basic

growth processes such as cell division and cell elongation. Auxins exhibit pleiotropic

physiological effects on tissues, organs and the whole plant in general (Galweiler, Guan

et al. 1998; Leyser 1999; Leyser and Berleth 1999; Sabatini, Beis et al. 1999; Geldner,

Friml et al. 2001; Leyser 2001; Swarup, Friml et al. 2001; Friml and Palme 2002; Friml

2003; Blakeslee, Peer et al. 2005; Blilou, Xu et al. 2005; Dharmasiri, Dharmasiri et al.

2005; Dhonukshe, Kleine-Vehn et al. 2005; Leyser 2005; Paponov, Teale et al. 2005;

Leyser 2006).

Auxins are weak acids and at the extracellular pH 5.5, auxin is protonated and

can enter by diffusion (Lomax 1997), but this uptake can be enhanced in tissues by

20

auxin influx carriers (Swarup, Friml et al. 2001). However, inside the cell, the higher pH

of the cytoplasm results in ionization and auxin is trapped inside the cell. And, therefore,

efflux is an active and carrier dependent process mainly carried out by the PIN efflux

transporters. PIN proteins cycle between the plasma membrane and the intracellular

vesicular compartments (Geldner, Friml et al. 2001) and are frequently localized polarly

to specific cell faces (Leyser 2005). This polar localization correlates with the direction

of auxin movement.  Therefore, PIN transporters are essential for the highly specific

patterns of auxin distribution (Paponov, Teale et al. 2005).

PIN transcription, accumulation and subcellular localization all seem to be

regulated by auxin and in the root tip, there is a strong stabilizing effect in this dynamic

(Leyser 2002; Leyser 2005). In a similar fashion, the transcription patterns of the PINs

that are required to maintain the auxin distribution pattern are also auxin regulated

(Blilou, Xu et al. 2005). Therefore, PIN knockouts exhibit no phenotypic defects because

changes in auxin distribution affect the transcription of other PINs to compensate.

PIN proteins are members of the major efflux facilitator family of integral

membrane proteins, are essential for polarized auxin movement, and align with the

vector of auxin transport. In Arabidopsis thaliana, each member of the PIN family

displays a unique tissue-specific expression pattern, and pin mutations generally exhibit

growth phenotypes that are consistent with the loss of directional auxin transport in the

corresponding tissues (Blakeslee, Peer et al. 2005).

In the root tip, initially the main source of auxin is from the shoot with auxin

transported from the shoot to the root tip through the phloem and the polar transport

stream (Swarup, Friml et al. 2001; Bhalerao, Eklof et al. 2002) . The root apical

meristem established during embryogenesis occurs in response to local auxin

21

accumulation at the basal end of the embryo (Friml and Palme 2002; Friml 2003). When

auxin is low, transcription from auxin response factor (ARF) regulated genes is

repressed by dimerization between ARFs and members of the Aux/IAA family of

repressors. To activate this transcription, auxin targets Aux/IAAs for degradation by the

26s proteasome (Leyser 2002).

22

Chapter Objectives Previous studies with Arabidopsis. thaliana DAHPS knockout lines in our

laboratory have shown that dahps1 seedlings are hypersensitive to tyrosine. This

seedlings show arrested growth upon tyrosine concentration at 150μM and this

sensitivity is not observed with Columbia up to 750 μM tyrosine (Crowley 2006). This

has suggested that tyrosine plays an important role in regulating either DAHPS2 or

DAHPS3. Furthermore, previous analysis has also shown that dahps1,2,3 knockout

lines are hypersensitive to UV stress. In continuation to this investigation, the work

presented here has two aims:

1) To establish an understanding of the putative role of the DAHP synthase

isozymes in regulating the flux of chorismate into the branching pathways. For this

aim, DAHP synthase knockout lines in Arabidopsis thaliana have been used to study

the phenotypic and transcriptional changes that occur in these knockout seedlings in

the absence of one of the DAHP synthase isozymes.

2) To examine the role of the aromatic amino acids in regulating enzymes of the

shikimate pathway and the downstream pathways ie. the phenylpropanoid pathway

and the indole hormone biosynthetic pathway. For this aim, the aromatic amino

acids: tyrosine, tryptophan and phenylalanine were used to supplement the single

dahps knockout lines of Arabidopsis thaliana. Root length was quantified as the

most reliable indicator of seedling development. To determine the synergistic role

that each aromatic amino acid plays in concert with the DAHP synthases in

regulating the partitioning of the chorismate pool, transcriptional analysis of dahps1

seedlings treated with tyrosine and a combination of tyrosine and phenylalanine or

23

tyrosine and tryptophan was done. dahps1 seedlings were chosen because their

hypersensitivity to tyrosine, observed by arrest in root growth, was known and

transcriptional analysis with one of the other aromatic amino acids revealed which

branching pathway was differentially regulated to rescue the tyrosine hypersensitivity

which affected transcripts of the phenylpropanoid pathway and expression of auxin

response genes. Validation of the rescue of tyrosine hypersensitivity was achieved

through crosses with the auxin responsive marker DR5::GUS, which served as an

indicator of auxin accumulation at the root tip.

MATERIALS AND METHODS Plant material and growth conditions

The transgenic seeds were ordered from the Salk Institute via the Arabidopsis

Biological Resource Centre and they were verified as true knockout lines previously in

our laboratory (Crowley 2006). These lines are described in table 1-1.

24

Table 1-1: The DAHP synthase insertion lines and the corresponding AGI IDs

Annotation Name Salk Line ID AGI ID

DAHPS1 dahps1 salk_055360 At4g39980

DAHPS1 dahps1-2 salk_088442 At4g39980

DAHPS2 dahps2 salk_033389 At4g35510

DAHPS3 dahps3 salk_026183 At1g22410

The insertion position of each line is illustrated in figure 1-5.

25

Figure 1- 5: Diagram of the position of the T-DNA insertion for the DAHP synthase knockout lines. dahps1 contains an insertion in the third exon. dahps2 contains an insertion in the third intron. dahps3 contains an insertion in the second intron.

26

Arabidopsis seeds were sterilized for 10 minutes in 20% (v/v) bleach and 0.05%

Tween-20 (BioShop) and were rinsed sequentially with double distilled MilliQ water.

Seeds were imbibed for two days on 0.5X Mushragie and Skoog (MS) media (Sigma),

2.5mM morpholino ethane sulfonic acid (pH 7.5) (BioShop) and supplemented with

1.5% (w/v) sucrose (BioShop) in the dark at 4oC for two days. The same medium was

used for their germination and growth in the subsequent 7days under continuous light

(45μmol/m2/sec) at room temperature. For root quantification and gravitropism

responses, the seedlings were grown vertically (ie. perpendicular to the shelf).

Seedlings that were transferred to soil were grown in a growth chamber at 22oC with 16

hours light and 8 hours dark. Upon seed collection, the seeds were dried for 7 days

prior to sterilization.

For aromatic amino acid supplementation, all amino acids were obtained from Sigma.

Stock solutions of 11mM L-tyrosine, 61mM L-phenylalanine , and 48.9mM L-tryptophan

were diluted to the appropriate concentrations in sucrose-supplemented MS-agar

medium.

Genomic DNA Extraction

Leaves or seedlings were frozen in liquid nitrogen and ground to a fine powder.

200μl of fresh extraction buffer consisting of 200mM Tris-HCl (pH 8) (BioShop), 25mM

ethylenediaminetetraacetic acid (EDTA) (pH 8) (BioShop) and 0.5% sodium dodecyl

sulfate (SDS) (BioShop) was added to the ground tissue. 100μl of phenol

(Invitrogen):chloroform (EMD):isoamyl alcohol (BioShop) (24:24:1) was added to the

mix. The sample was mixed and centrifuged for 10 minutes at 13000 rpm. The DNA

27

from the supernatant was precipitated with an equal volume of isopropanol (EM

Science). The sample was spinned for 10 minutes at 13000 rpm to pellet the DNA.

Isopropanol was removed and the excess was evaporated at room temperature for 15

min. DNA samples were resuspended in 50 μL of double distilled water.

Generation of dahps1xDR5::GUS crosses

Single mutant flowers were emasculated as soon as the tips of the white petals

were visible. The DR5::GUS plant pollen was used to fertilize the dahps1 flowers under

the microscope. Hand-pollinated stigmas were wrapped in Saran wrap and left to

mature. Seeds were harvested once the siliques turned brown but prior to pod splitting.

The F1 plants were allowed to self and the F3 generation was screened via PCR for the

maternal dahps1 mutation and through 5mM GUS staining for the paternal DR5::GUS

marker. The stained seedlings were visualized under an Olympus bright field

microscope at 20x magnification.

Total RNA Extraction

For the microarray experiments, the RNA was isolated using the Qiagen Plant

RNA preparation kit. Briefly, 100mg of 8-day old seedlings were placed in liquid nitrogen

and ground thoroughly. 450 μL of buffer RLT was added to the ground sample and the

tube was vortexed for 1 minute. The lysate was transferred to a QIAshredder spin

column and spun down for 2 minutes at full speed. The supernatant was transferred to a

fresh tube and was precipitated with an equal volume of ethanol and the mixture was

transferred to an RNeasy spin column. The sample was spun at 10000 rpm for 15

28

seconds and was washed with 700 μL of buffer RW1. It was spun again at 10000 rpm

for 15 seconds and the flow through was discarded. The RNA was washed twice with

buffer RPE prior to elution. After spinning for 2 minutes at 10000rpm, the RNA was

eluted in 17 μL of RNase-free water.

Microarray Analysis

Transgenic dahps1 plants were grown for 8 days under continuous light. For the

amino acid supplemented seedlings, 8ml of 2mM tyrosine, tyrosine and phenylalanine

or tyrosine and tryptophan was added and the plates were replaced under continous

light for the next 8 hours. Seedlings were flash frozen in liquid nitrogen RNA was

extracted as described above. Three replicates were submitted for each

treatment.Hybridization to the ATH1 whole genome array (Affymetrix), scanning of the

hybridized array and data pre-processing were done at the Department of Cell and

Systems Biology Affymetrix Genechip facility headed by Dr. Nicholas Provart. Thanh

Nguyen performed the reverse transcription and hybridization with standard oligo dT

primers. The signals from the Affymetrix chips were normalized using Microarray

Software Suite 2.0 and with an expression average of 500. Statistical analysis was done

using the SAM (Significance Analysis of Microarrays) Excel Plug-in (Tusher, Tibshirani

et al. 2001) . Significance was determined at 5% false discovery rate based on the

number of differentially regulated genes. Overrepresentation of gene groups among the

differentially regulated genes was determined using the GOstats tool in Gene Ontology

(Beissbarth and Speed 2004). Term enrichment of the GOstats hits was achieved using

29

AmiGO release 2008/08/07. The Venn diagrams were prepared using Venny (Oliveros

2007) and were manipulated using Adobe Photoshop.

Verification of Dr5::GUS crosses with PCR

The verification of the parental recessive trait dahps1 in the dahps1xDr5::GUS

progeny was achieved through a gene specific and insertion specific reaction. These

primers were previously designed in our laboratory (Crowley 2006) and were

synthesized by Integrated DNA Technologies (IDT): Forward: 5'-

GAGCCTTTGCCACTGGAGGTT-3' and reverse: 5'-TCTCATGTTCTCGGCACCCAT-3'.

To determine if the gene contained T-DNA, the left border primer LBb1 (5'-

GCGTGGACCGCTTGCTGCAACTC-3') designed by SALK and the gene specific

reverse primer were used. All PCR reactions used pfu enzyme purified at home as the

polymerizing enzyme. The PCR conditions were an initial 1.5 minute denaturing step at

95oC, followed by 35 cycles of a 1-minute denaturation at 95

oC, 1-minute annealing

step at 48-60 oC, and a 1.5-3 min extension step at 72

oC. This was followed by a final

extension step for 10 minutes at 72 oC.

GUS staining procedure

Seven day old seedlings were incubated for one hour in -20 o

C in pre-chilled 90%

acetone. After that, the seedlings were washed twice for 5 minutes in 100 mM NaPi

buffer pH7.7. Then, the seedlings were incubated for 1 hour at 37 oC in staining buffer

(2mM X-gluc, 5mM ferricyanide/ferrocyanide). The samples were transferred in

30

ethanol:acetic acid 3:1 at 4 oC for 1 hour. The fixative was replaced with 70% ethanol

prior to visualization under the microscope.

RESULTS DAHPS2 lacks a C-terminal alpha helix which is present in DAHPS1 and DAHPS3.

To determine the presence of any putative regulatory domains, comparison of

Arabidopsis DAHPS three-dimensional models was conducted. Structural modeling

using PHYRE (Bennett-Lovsey, Herbert et al. 2008) selects the Mycobacterium

tuberculosis AroAII structure as the closest relative and as the modeling template for

high precision homology modelling. None of the Arabidopsis proteins are predicted to

contain the extra α2 and β3 helices that the M.tuberculosis structure contains for

allosteric regulation. Interestingly, the Arabidopsis DAHPS3 isozyme has a

pronounced hairpin loop that is absent in the microbial protein and the other two

Arabidopsis proteins. Additionally, DAHPS2 has a deletion for the last C-terminal helix

observed in DAHPS1 and DAHPS3 (Figure 1-6, 1-7).

To explore the extent of this deletion in plants and bacteria, multiple sequence

alignments were conducted for the best reciprocal hits of each DAHPS isozyme. This C-

terminal deletion is also observed in most microbial proteins but in none of the other

plant DAHP synthase isozymes (Figures 1-7A,B,C,D). This domain has been identified

in the black cottonwood, grape vine, tobacco, European beech, curly leaf parsley, rice,

tomato and Indian mulberry DAHP synthases even though it is partially absent in

potato.

31

Figure 1- 6: Predicted three dimensional models of the Arabidopsis thaliana DAHP synthase isozymes. This prediction shows conservation of the active site TIM-barrel but there is no conservation of the allosteric pocket. Additionally, this analysis identifies the presence of a C-terminal α-helix in DAHP synthase 1 and 3 that is not found in DAHP synthase 2. The C-terminal helix , colored blue, is only present in DAHPS1 and DAHPS3 but not in DAHPS2.

DAHPS1 DAHPS2 DAHPS3

Models generated with 100% estimated precision using Phyre: Bennett-Lovsey et al, 2008

32

A)

B)

CLUSTAL W ALIGNMENT WITH HOMOLOGOUS DAHPS1 SEQUENCES FROM PLANTS SHOWS CONSERVATION OF THE C-TERMINAL REGION.

CLUSTAL W ALIGNMENT WITH HOMOLOGOUS DAHPS2 SEQUENCES FROM PLANTS SHOWS DELETION OF THE C-TERMINAL REGION IN A.THALIANA AND PARTIAL DELETION IN POTATO.

33

Figure 1- 7: Multiple sequence alignment of DAHP synthase isozymes from sequenced plant genomes (A-C) and microbial sequences (D). This alignment shows the presence of a C-terminal domain in most plant sequences but not in the microbial sequences. A) Multiple sequence alignment of the DAHPS1 closest orthologs based on the best reciprocal match. B) Multiple sequence alignment of the DAHPS2 closest orthologs based on the best reciprocal match. C) Multiple sequence alignment of the DAHPS3 closest orthologs based on the best reciprocal match. D) A) Multiple sequence alignment of the Arabidopsis thaliana DAHPS sequences with the closest microbial orthologs based on the best reciprocal match.

C)

D)

CLUSTAL W ALIGNMENT WITH HOMOLOGOUS DAHPS3 SEQUENCES FROM PLANTS SHOWS CONSERVATION OF THE C-TERMINAL REGION.

CLUSTAL W ALIGNMENT WITH HOMOLOGOUS DAHPS SEQUENCES FROM BACTERIA SHOWS THE SAME ABSENCE OF THE C-TERMINAL REGION AS A.THALIANA DAHPS2.

34

Aromatic amino acid supplementation has distinctive effects on the DHS seedling phenotype in

Arabidopsis thaliana.

To investigate the role of DAHP synthase isozymes in Arabidopsis, T-DNA

insertion lines for DAHPS1, DAHPS2, and DAHPS3 were obtained from the Salk

Institute. Seeds from the T3 generation were screened via PCR for homozygous

mutants. Gene specific and insertion specific PCR were performed to identify the

presence of the wild type copy of the gene (Figure 1-8). The extension time was kept

1:30 min and this did not allow polymerization of the T-DNA insertion with gene specific

primers. However the insertion was amplified from genomic DNA with a T-DNA specific

forward primer designed by the SALK institute and a gene specific reverse primer in

order to verify the presence of the T-DNA insertion in the DAHP synthase gene. RT-

PCR was used to identify true knockout lines for the gene encoding each isozymes

based on the lack of transcript levels (Crowley 2006) This analysis does not eliminate

the possibility of a T-DNA insertion in another gene of the Arabidopsis thaliana genome.

35

Figure 1- 8: Diagram of the position of the primers used by Valerie Crowley for genotyping the DAHP synthase insertion lines. Polymerization with the gene specific primers in the presence of the insertion would result in a product ~5000 bp. However, due to the limitation of the extension time to 1:30 min, polymerization of this large amplicon was not achieved.

36

The DAHP synthase knockout lines were treated with increasing concentrations

of aromatic amino acids in their media ranging from 250 μM to 750 μM tyrosine (Figure

1-9 to 1-12). This experiment was replicated five times with ten seedlings per treatment

each time.

dahps1 seedlings are hypersensitive to tyrosine. This sensitivity is also observed

with the other lines including wild type Columbia but this effect is observed at 750 μM

tyrosine as opposed to 250 μM for dahps1 (Figure 1-9). Seedlings grown on tyrosine

supplemented media show arrested growth and shorter root length. dahps1 seedlings

supplemented with 250-750 μM tyrosine germinate, but do not develop any further.

Interestingly, a dose dependent reduction in root growth is observed upon treatment

with increasing concentrations of tyrosine both on the dahps1 heterozygous seedlings

and on the second dahps1 allele (salk_088442) (Figure 1-10), which is not a true

knockout of the gene. However, the arrest in growth in the dahps1 heterozygous

seedlings and in the insertion siblings is not as severe as that observed in the true

dahps1 knockout line. The tyrosine sensitivity phenotype is alleviated if these lines are

grown with a combination of either 500 μM tyrosine and tryptophan or tyrosine and

phenylalanine as well as with all three amino acids at the same time. These seedlings

show no longer arrested growth and if transferred to soil, they grow to full maturity.

Even though there is a significantly different response to aromatic amino acid

supplementation for the dahps2 seedlings compared to the no treatment and wild type

controls, these seedlings do not exhibit any differential response to amino acid

supplementation when compared to the other two knockout lines (Figure 1-10).

However, the dahps3 seedlings are hypersensitive to treatment with tryptophan (Figure

1-11). Growth of dahps3 knockout plants in the presence of tryptophan inhibits growth

37

after day 4 and aborts root growth. This is a dose dependent response and 750 μM

tryptophan in the media causes the most severe phenotype. These seedlings exhibit

arrested growth upon hypocotyl emergence. When the line is treated with 500 μM

tryptophan and phenylalanine or tryptophan and tyrosine or with all three amino acids,

the sensitivity at embryogenesis is not severe and the seedlings have the potential to

grow to maturity.

To quantify the dose-dependent effect of the treatment with the aromatic amino

acids as well as the degree of recovery by treatment with more than one aromatic

amino acid, root length was measured from seedlings grown on aromatic amino acid

supplemented media. Germination was synchronized and all the seeds germinated at

the same time. The plates were grown vertically and root length was quantified on 5-day

old seedlings. In figures 1-9 to 1-12, treatment with phenylalanine also shows a

significant effect on root growth on all genotypes and this effect is not as severe as that

observed with the tyrosine and tryptophan hypersensitivity. There is no apparent defect

on seedling growth and survival upon supplementation with phenylalanine and the

seedlings are capable of growing to maturity. Interestingly, treatment with 750μM

phenylalanine encourages root growth of wild type seedlings comparable to that

observed with the untreated wild type control (Figures 1-9 to 1-12). This response to

phenylalanine in the untreated control is not observed with the dahps knockout lines

and is also not observed with lower concentrations of phenylalanine.

Root length was also quantified from 10-day old seedlings that were grown on

plain media for 5 days and then transferred on fresh aromatic amino acid supplemented

media. This was done to ensure that the effect of the aromatic amino acids is on growth

and not germination. The pattern of sensitivity with the knockout lines and the varied

38

treatments was the same but the highest sensitivity was observed when the seedlings

were germinated on amino acid supplemented media. The seedlings were also

observed for defects on gravitropism, but no such effect was observed.

39

Figure 1- 9: Response of dahps1 to aromatic amino acid supplementation (5 day old seedlings, n=50) The seeds were synchronized for germination. Root length was measured on vertically grown seedlings.Seedlings were grown on 0.5X MS/MES media supplemented with 1.5% sucrose and the appropriate concentration of the aromatic amino acids. Significance was determined using an unbiased two-tailed student’s t-test from Microsoft Excel. F:phenylalanine, Y:tyrosine, W:tryptophan. dhs1:dahps1; dhs1 Het: heterozygous for the dahps1 trait.

*: significantly compared to the untreated control, p<0.05 +: significantly compared to the wild type control, p<0.05

40

Figure 1- 10: Response of the dahps1-2 allele to aromatic amino acid supplementation (5 day old seedlings, n=50) The seeds were synchronized for germination. Root length was measured on vertically grown seedlings.Seedlings were grown on 0.5X MS/MES media supplemented with 1.5% sucrose and the appropriate concentration of the aromatic amino acids. Significance was determined using an unbiased two-tailed student’s t-test from Microsoft Excel. F:phenylalanine, Y:tyrosine, W:tryptophan. dhs1:dahps1;

*: significantly compared to the untreated control, p<0.05 +: significantly compared to the wild type control, p<0.05

41

Figure 1- 11: Response of dahps2 to aromatic amino acid supplementation (5 day old seedlings, n=50) The seeds were synchronized for germination. Root length was measured on vertically grown seedlings. Seedlings were grown on 0.5X MS/MES media supplemented with 1.5% sucrose and the appropriate concentration of the aromatic amino acids. Significance was determined using an unbiased two-tailed student’s t-test from Microsoft Excel. F:phenylalanine, Y:tyrosine, W:tryptophan. dahps2:dahps2;

*: significantly compared to the untreated control, p<0.05 +: significantly compared to the wild type control, p<0.05

42

Figure 1- 12: Response of dahps3 to aromatic amino acid supplementation (5 day old seedlings, n=50) The seeds were synchronized for germination. Root length was measured on vertically grown seedlings. Seedlings were grown on 0.5X MS/MES media supplemented with 1.5% sucrose and the appropriate concentration of the aromatic amino acids. Significance was determined using an unbiased two-tailed student’s t-test from Microsoft Excel. F:phenylalanine, Y:tyrosine, W:tryptophan. dhs1:dahps1; dhs1 Het: heterozygous for the dahps1 trait.

*: significantly compared to the untreated control, p<0.05 +: significantly compared to the wild type control, p<0.05

43

Transcriptional Analysis

The purpose of this experiment was to investigate the transcriptional changes

that occur in dahps1 knockout seedlings upon tyrosine supplementation. In addition,

microarray analysis of seedlings treated with tyrosine and either tryptophan or

phenylalanine was conducted to determine the transcriptional changes that are

responsible for the alleviation of tyrosine hypersensitivity upon treatment with each of

these aromatic amino acids. Therefore, here is presented the identification of transcripts

differentially expressed upon tyrosine treatment for wild type plants and dahps1

knockout plants. The Significance Analysis (SAM) Excel Plug-in was used to determine

significantly upregulated and downregulated genes in response to aromatic amino acid

treatment. A false discovery rate of 5% was selected based on the number of

upregulated and downregulated hit genes. Initially, three replicates of 8 day old wild

type seedlings treated for 8 hours with 2 mM tyrosine were compared against untreated

wild type seedlings. Then, 8 day old dahps1 seedlings treated with 2mM tyrosine were

compared against untreated dahps1 seedlings. dahps1 seedlings treated with 2mM

tyrosine and phenylalanine were compared against dahps1 seedlings treated with 2mM

tyrosine to identify differentially expressed transcripts due to addition of phenylalanine.

Additionally, dahps1 seedlings treated with 2mM tyrosine and tryptophan were

compared against dahps1 seedlings treated with 2mM tyrosine to determine which

transcript levels are restored by tryptophan treatment in addition to tyrosine. Genes

with raw expression value of less than 100 were eliminated from the dataset. In this

analysis, tables 1-2 to 1-5 show the number of differentially regulated transcripts for

each treatment. The analysis was also conducted using log2 ratios and a p-value ≤ 0.05.

44

The differentially expressed transcripts were the same and only the SAM analysis is

shown here.

45

Table 1-2:Pre-chorismate and post-chorismate transcripts involved in aromatic amino acid synthesis.

Annotation AGI ID WT + Y WT DHS1 DHS1+Y DHS1+FY DHS1+WYshikimate kinase family protein At2g16790 221.4 193.6 255.5 332.6 215.1 269.3shikimate kinase family protein At4g39540 175.9 124.6 219.4 164.6 121.3 132.0shikimate kinase/ zinc ion binding At5g47050 384.2 335.0 276.8 360.1 430.1 485.0chorismate synthase At1g48850 281.1 383.1 229.0 327.8 190.0 164.2CM1 chorismate mutase 1 At3g29200 437.4 292.3 298.2 815.4 603.6 705.3CM2 chorismate mutase 2 At5g10870 810.6 1134.1 825.0 918.7 676.5 714.6CM3 chorismate mutase 3 At1g69370 787.0 661.2 417.0 635.2 1131.0 934.3chorismate mutase At1g53110 383.5 434.0 402.4 434.8 525.8 532.1ICS1 isochorismate synthase 1 At1g74710 681.8 450.3 479.9 356.1 317.8 354.8ICS2 isochorismate synthase 2 At1g18870 635.1 1056.9 648.6 497.6 504.3 541.6isochorismatase hydrolase At3g16190 1071.9 1114.4 1767.6 1363.1 1296.6 1498.5anthranilate synthase alpha-1 At5g05730 241.3 173.1 181.8 204.3 717.4 541.5anthranilate synthase 2 At2g29690 209.2 106.0 157.9 168.4 246.0 230.4anthranilate synthase At2g28880 214.5 319.3 333.5 279.1 453.0 540.3anthranilate phosphoribosyltransferaAt1g70570 143.5 142.7 313.7 123.1 114.1 85.7ADT2 Arogenate dehydratase 2 At3g07630 218.9 291.5 451.4 147.9 219.5 204.4ADT3 Arogenate dehydratase 3 At2g27820 644.5 758.9 620.5 523.3 615.9 578.0ADT5 Arogenate dehydratase 5 At5g22630 332.2 154.1 N/A 311.5 130.9 188.3tryptophan synthase At4g27070 525.2 628.5 601.1 766.7 640.2 744.3tryptophan synthase 1 At3g54640 283.6 269.1 152.6 376.4 271.6 217.8tryptophan synthase-related At5g38530 672.4 286.6 1172.2 719.8 541.5 408.2Mean expression values have been shown for each transcript. Significance of differential regulation in the microarray data was determined using Significance Analysis of Microarray (SAM). Y: tyrosine treated F: phenylalanine W: tryptophan

46

Table 1-3: Auxin response, signaling and biosynthesis transcripts affected by aromatic amino acid supplementation.

Annotation AGI ID WT + Y WT DHS1 DHS1+Y DHS1+FY DHS1+WYATNAC3 [Arabidopsis thaliana] At3g15500 1484.6 7961.2 12949.7 1976.1 4352.5 3829.2PIN3 auxin:hydrogen symporter/ transporter At1g70940 5025.6 1745.1 6228.2 6379.2 2710.1 2688.3PIN4 auxin:hydrogen symporter/ transporter At2g01420 975.9 906.5 1110.5 695.8 708.7 612.4PIN5 auxin:hydrogen symporter/ transporter At5g16530 1011.7 996.0 785.2 793.8 890.2 586.3PIN8 auxin:hydrogen symporter/ transporter At5g15100 5363.0 3045.6 2550.3 6248.3 9425.5 10140.6ARF1 auxin response transcription factor At1g59750 330.7 529.4 321.5 448.0 473.0 563.4ARF4 auxin response transcription factor At5g60450 602.7 190.0 325.3 778.7 362.8 523.8ARF8 auxin response transcription factor At5g37020 138.0 152.3 219.7 173.3 259.5 256.9ARF11 auxin response transcription factor At2g46530 553.9 556.4 366.6 604.4 301.6 262.9ARF12 auxin response transcription factor At1g34310 15200.7 11731.6 27704.6 13784.4 21544.1 17707.1ARF13 auxin response transcription factor At1g34170 387.4 444.4 322.3 374.8 380.1 377.1ARF16 auxin response transcription factor At4g30080 381.2 439.1 571.9 621.1 669.4 465.6ARF18 auxin response transcription factor At3g61830 2646.3 1638.4 4905.4 1745.6 1855.3 1567.7ARF23 auxin response transcription factor At1g43950 529.7 502.1 429.0 541.9 573.5 556.1AXR1 Auxin resistant 1 At1g05180 317.3 333.0 135.0 192.5 201.2 222.2AXR4 Auxin resistant 4 At1g54990 521.5 688.5 742.7 485.3 677.1 625.3auxin responsive protein At2g28085 3551.8 1303.9 2221.8 3260.8 3891.4 3772.8auxin-responsive protein At2g24400 1022.0 829.0 4739.2 690.4 628.6 606.0auxin responsive protein At2g21210 1012.3 808.0 814.9 1096.6 675.7 766.2auxin responsive protein At2g21200 255.9 270.0 184.0 393.5 207.5 233.6auxin responsive protein At2g36210 154.4 154.4 145.0 N/A N/A N/Aauxin responsive protein At1g76190 191.3 112.6 451.4 224.2 290.2 392.7auxin responsive protein At1g19830 253.7 209.8 199.0 220.7 309.2 236.3auxin responsive protein At1g72430 485.7 419.9 411.2 569.7 514.7 505.8auxin responsive protein At1g29450 1213.2 1154.6 957.4 956.7 1110.9 1144.2auxin responsive protein At1g29490 1105.6 910.2 563.7 910.4 631.6 591.4auxin responsive protein At1g29460 1194.9 1657.9 1676.7 792.1 739.4 618.3auxin responsive protein At1g29430 At 3165.5 3440.3 2371.7 3281.3 3634.4 3870.2auxin responsive protein At3g09870 191.1 160.5 220.3 232.1 249.8 273.9auxin responsive protein At3g25290 783.8 1008.7 485.4 665.8 581.8 553.6auxin responsive protein At3g12830 342.0 405.5 450.1 452.5 417.5 432.6auxin responsive protein At1g43040 278.8 396.1 276.3 262.1 251.5 252.6auxin responsive protein At4g00880 126.3 149.8 N/A 143.0 181.9 164.3auxin responsive protein At4g13790 7790.1 5288.7 3834.0 8060.1 9980.4 9907.3auxin responsive protein At4g22620 776.2 1074.9 697.2 1052.5 444.7 614.0auxin responsive protein At4g34750 540.2 701.8 692.8 411.2 510.0 423.8auxin responsive protein At4g34760 430.9 348.3 851.7 235.6 315.9 278.0auxin responsive protein At4g34770 244.3 241.3 319.5 266.1 325.8 366.4auxin responsive protein At4g36110 921.7 1170.4 1453.3 603.0 843.5 677.4auxin responsive protein At4g38840 111.0 119.0 N/A N/A 119.8 100.7auxin responsive protein At3g51200 1015.6 706.2 303.5 1110.3 2077.7 1944.7auxin responsive protein At3g53250 369.8 574.8 460.8 299.1 447.5 380.7auxin responsive protein At3g59070 401.3 547.3 484.0 372.7 442.4 482.6auxin responsive protein At3g61900 639.9 521.4 515.0 688.5 635.1 523.3auxin responsive protein At5g03310 397.8 533.3 746.3 511.8 376.3 448.4auxin responsive protein At5g35735 2934.3 3872.0 13446.1 1363.4 3405.8 2954.9auxin responsive protein At5g50760 538.1 571.6 712.7 677.0 494.1 508.1auxin responsive protein At5g20810 220.0 434.0 261.2 183.3 402.3 284.3auxin responsive protein At5g20820 539.5 486.7 499.5 630.9 537.6 589.8

Mean expression values have been shown for each transcript. Significance of differential regulation in the microarray data was determined using Significance Analysis of Microarray (SAM). Y: tyrosine treated; F: phenylalanine; W: tryptophan

47

Table 1-3 continuedAnnotation AGI ID WT + Y WT DHS1 DHS1+Y DHS1+FY DHS1+WYauxin responsive protein At5g20820 539.5 486.7 499.5 630.9 537.6 589.8auxin responsive protein At4g17280 150.2 179.1 214.7 N/A 282.6 264.1auxin responsive protein At1g75580 133.0 240.0 N/A 196.0 170.7 165.3auxin responsive protein At1g29440 182.1 269.3 410.4 212.2 364.7 355.3auxin responsive protein At5g53590 108.5 275.8 154.3 104.3 N/A 134.5auxin responsive GH3 protein At5g13350 1573.3 1199.0 2017.9 1394.7 1698.0 1617.7auxin responsive GH3 protein At5g13360 At 383.0 320.0 511.7 464.1 440.0 444.9auxin responsive GH3 protein At5g51470 4991.0 5250.7 11727.6 4275.4 6357.5 5857.3auxin/aluminum responsive protein At5g19140 316.5 392.3 415.0 340.1 339.9 260.7SAR1 Suppressor of auxin resistance At1g33410 276.0 580.3 502.1 243.2 408.9 380.0AIR1 Auxin induced in root cultures At4g12550 1264.6 1198.4 1631.6 1277.9 1139.6 1126.4AIR3 Auxin induced in root cultures At2g04160 2876.9 2342.7 1839.5 2485.8 2662.8 2559.6AIR9 Auxin induced in root cultures At2g34680 775.8 604.5 854.9 348.4 613.5 766.8AIR12 Auxin induced in root cultures At3g07390 168.9 580.6 1052.3 477.8 488.2 509.0auxin efflux carrier family protein At2g17500 299.3 145.6 264.6 370.3 230.5 242.1auxin efflux carrier family protein At1g76530 271.6 342.8 194.0 146.2 181.0 157.6auxin efflux carrier family protein At5g01990 142.4 136.4 116.0 144.8 165.2 106.6SAUR Small auxin up RNA At4g38850 1749.2 1398.2 1507.8 1731.6 2310.0 2300.7SAUR68 Small auxin up RNA At1g29510 3370.4 4700.3 2742.4 2923.0 2807.3 2978.9IAR3 IAA-Ala resistant metallopeptidase At1g51760 At 362.1 592.3 167.7 416.1 N/A 174.4IAR4 IAA-Ala resistant dehydrogenase At1g24180 153.1 167.5 50.7 164.9 176.9 155.2IAA1 Indole-3-acetic acid inducible At4g14560 616.4 341.6 275.4 474.3 188.1 202.3IAA2 Indole-3-acetic acid inducible At3g23030 391.1 430.6 364.4 361.6 433.1 564.1IAA5 Indole-3-acetic acid inducible At1g15580 276.9 292.7 144.7 475.6 322.9 390.1IAA10 Indole-3-acetic acid inducible At1g04100 832.6 757.3 635.1 852.9 959.2 927.1IAA11 Indole-3-acetic acid inducible At4g28640 609.3 588.8 750.1 236.8 521.0 334.7IAA14 Indole-3-acetic acid inducible At4g14550 1182.1 925.1 914.8 1614.7 1601.8 1748.6IAA19 Indole-3-acetic acid inducible At3g15540 2658.0 2177.1 832.8 3699.0 3369.1 3789.9IAA23 Indole-3-acetic acid inducible At5g20730 1993.3 607.1 1221.0 1566.4 1065.3 1276.2IAA24__MP (MONOPTEROS) IAA inducible At1g19850 674.5 660.7 266.1 445.0 495.8 474.8IAA27 Indole-3-acetic acid inducible At4g29080 749.4 574.5 680.4 1387.6 858.9 848.9IAA28 Indole-3-acetic acid inducible At5g25890 333.5 229.8 476.5 355.3 339.4 322.0IAA29 Indole-3-acetic acid inducible At4g32280 N/A 146.9 114.7 N/A 200.2 199.8IAA30 Indole-3-acetic acid inducible At3g62100 600.2 321.5 487.1 787.9 603.5 677.1IAA31 Indole-3-acetic acid inducible At3g17600 6321.9 6400.5 8862.0 4113.3 5246.6 4479.1IAA33 Indole-3-acetic acid inducible At5g57420 332.9 392.0 368.1 305.6 364.4 394.5IAA34 Indole-3-acetic acid inducible At1g15050 233.2 275.1 336.1 227.9 259.6 288.5IAMT1 IAA Carboxylmethyltransferase At5g55250 412.4 394.7 487.4 358.3 297.6 287.9ATMYB75_transcription factor (Anthocyanin) At1g56650 337.3 464.0 239.1 218.3 322.7 247.8

Mean expression values have been shown for each transcript. Significance of differential regulation in the microarray data was determined using Significance Analysis of Microarray (SAM). Y: tyrosine treated F: phenylalanine W: tryptophan

48

Table 1-4: Phenylpropanoid transcripts affected upon aromatic supplementation of dahps1 seedlings. Annotation AGI ID WT + Y WT DHS1 DHS1+Y DHS1+FY DHS1+WYcinnamoyl-CoA reductase At1g76470 1050.4 329.5 376.8 355.5 293.5 262.5cinnamoyl-CoA reductase At5g14700 192.0 180.0 180.7 154.6 188.3 139.9cinnamoyl-CoA reductase At2g33590 859.2 549.6 2429.2 1127.4 895.2 649.0cinnamoyl-CoA reductase At5g58490 390.6 399.3 349.3 264.4 370.2 285.6cinnamoyl-CoA reductase At2g23910 1102.2 956.9 1159.3 770.8 1175.0 863.1cinnamoyl CoA reductase At1g76470 316.9 329.5 376.8 355.5 293.5 262.5cinnamoyl CoA reductase At1g80820 1331.1 1731.6 3727.0 1592.8 1992.2 2017.2Naringenin 3-dioxygenase At3g51240 1229.1 1266.7 1074.0 1305.0 2048.4 1950.6chalcone-flavanone isomerase At1g53520 1367.9 1677.6 2574.3 647.0 1009.4 646.1 farnesyltranstransferase At2g18640 487.7 751.5 639.4 576.0 641.8 657.4cinnamyl-alcohol dehydrogenase 4 At3g19450 476.1 480.8 377.1 440.8 353.5 400.8cinnamyl-alcohol dehydrogenase 5 At4g34230 583.2 532.1 644.8 757.0 690.5 739.4cinnamyl-alcohol dehydrogenase family At1g66800 344.6 434.4 339.9 413.2 352.4 405.4cinnamyl-alcohol dehydrogenase family At1g09480 At 125.3 146.8 100.6 N/A N/A N/Acinnamyl-alcohol dehydrogenase At1g51410 290.0 337.4 534.8 423.9 242.0 275.9cinnamyl-alcohol dehydrogenase family At1g09500 246.5 510.5 748.6 238.8 706.6 560.0isoflavone reductase, putative At1g19540 1518.2 1169.4 1224.7 1880.7 1731.2 1803.7isoflavone reductase, putative At1g75300 191.4 207.6 247.7 271.0 128.3 170.9isoflavone reductase, putative At1g75290 1421.7 1277.5 1508.1 1233.9 1382.5 1187.2isoflavone reductase family protein At4g34540 5802.0 5533.1 6545.7 5261.3 5102.8 4196.7dihydroflavonol 4-reductase family At4g35420 1464.2 737.5 898.9 1504.5 796.9 779.0flavonol 3-sulfotransferase-related At3g51210 721.3 925.3 844.0 875.2 685.0 753.1dihydrokaempferol 4-reductase At5g42800 1000.1 838.3 857.2 1017.1 1409.6 1417.3flavonol synthase At5g08640 115.2 185.0 260.7 141.2 146.1 177.7flavonol synthase, putative At5g63580 567.7 607.2 849.1 530.4 654.5 666.4flavonol synthase, putative At5g63600 161.4 225.9 113.8 246.1 177.2 201.0 flavonol synthase At5g63590 587.4 515.6 397.1 511.4 586.7 592.9Flavanone 3-dioxygenase At3g51240 1229.1 1266.7 1074.0 1305.0 2048.4 1950.6naringenin-chalcone synthase At5g13930 914.3 506.5 461.2 738.3 1028.4 836.5chalcone isomerase At3g55120 1395.0 1093.6 1935.3 1596.6 1847.8 1692.7Chalcone isomerase-like At3g63170 805.5 1124.2 1316.4 992.9 1085.5 981.7chalcone and stilbene synthase family protein At1g02050 175.7 273.4 378.1 182.2 199.6 210.7chalcone-flavanone isomerase-related At1g53520 1367.9 1677.6 2574.3 647.0 1009.4 646.1chalcone and stilbene synthase family protein At4g00040 358.6 373.3 378.6 407.9 587.6 584.94CL1 4-coumarate:CoA ligase 1 At1g51680 3085.5 3670.7 11881.0 2443.4 3120.3 3195.64CL2 4-coumarate:CoA ligase 2 At3g21240 385.9 384.2 329.4 394.7 410.0 296.84CL3 4-coumarate--CoA ligase 3 At1g65060 1300.3 1493.3 1306.3 1146.1 1227.2 1213.44CL5 4-coumarate-CoA ligase 5 At3g21230 664.0 462.6 429.2 759.0 720.3 709.94-coumaroyl-CoA synthase family protein At1g62940 3170.3 5086.8 9344.9 2875.9 2038.8 1876.74-coumaroyl-CoA synthase family protein At1g20480 292.9 200.7 163.8 373.1 173.8 N/A4-coumarate-CoA ligase At1g20510 597.4 582.4 1065.5 637.7 612.2 539.7coniferyl-alcohol glucosyltransferase At5g66690 3998.0 3854.4 5636.4 4459.8 2343.5 2271.0flavin reductase-related At2g34460 20031.8 16513.5 52431.9 22430.0 31664.4 32273.2flavin-containing monooxygenase At2g33230 109.9 120.7 256.3 118.4 158.7 159.7flavin-containing monooxygenase At1g62580 At 1921.8 999.8 3200.8 2562.2 2355.0 2509.9flavin-containing monooxygenase At1g62620 At 235.5 317.2 193.2 236.0 206.2 197.3flavin-containing monooxygenase At1g62560 259.9 394.6 272.8 230.7 351.1 312.8flavin-containing monooxygenase At1g62540 1324.4 3147.2 901.5 780.5 967.4 518.3flavin-containing monooxygenase At1g04610 374.4 567.2 208.1 429.2 159.3 150.8flavin-containing monooxygenase At1g04180 2592.4 2928.8 3796.3 2881.6 3152.8 3388.7flavin-containing monooxygenase At1g12160 168.3 370.1 377.2 202.1 284.8 252.5flavin-containing monooxygenase At1g12130 859.3 540.5 982.0 603.5 955.3 636.8flavin-containing monooxygenase At4g28720 300.6 348.1 181.6 207.1 292.1 204.1flavin-containing monooxygenase At5g07800 357.6 322.4 357.8 382.8 417.4 396.7flavin-containing monooxygenase At5g45180 249.4 603.0 187.7 293.6 149.0 N/Aflavin-containing monooxygenase At5g61290 2425.9 2036.5 2033.6 3093.8 2598.0 2968.2

49

Table 1-4: -continued

Annotation AGI ID WT + Y WT DHS1 DHS1+Y DHS1+FY DHS1+WYYUCCA flavin-containing monooxygenas At4g32540 1648.1 1530.5 3309.8 1881.3 1420.6 1743.7flavin-containing monooxygenase At5g07800 357.6 322.4 357.8 382.8 417.4 396.7flavin-containing monooxygenase At5g45180 249.4 603.0 187.7 293.6 149.0 N/Aflavin-containing monooxygenase At5g61290 2425.9 2036.5 2033.6 3093.8 2598.0 2968.2PAL1 phenylalanine ammonia-lyase 1 At2g37040 793.2 707.6 1223.0 818.3 663.6 699.6PAL2 phenylalanine ammonia-lyase 2 At3g53260 2658.1 1375.5 2394.7 1928.5 1108.7 1375.1PAL3 phenylalanine ammonia-lyase 3 At5g04230 197.1 196.8 212.3 202.0 711.2 693.8Caffeoyl-CoA 3-O-methyltransferase At1g67980 456.4 299.2 383.8 326.0 195.4 240.7caffeoyl-CoA 3-O-methyltransferase, puta At4g26220 1577.4 1119.1 650.3 1237.8 1520.2 1406.5Mean expression values have been shown for each transcript. Significance of differential regulation in the microarray data was determined using Significance Analysis of Microarray (SAM). Y: tyrosine treated F: phenylalanine W: tryptophan

50

Table 1-5: Cell wall synthesis transcripts affected upon aromatic amino acid supplementation.

Annotation AGI ID WT + Y WT DHS1 DHS1+Y DHS1+FY DHS1+WYendo-xyloglucan transferase (TCH4) At5g57560 590.4 777.4 513.2 551.4 325.6 415.3EXGT Endoxyloglucan transferase A4 At5g13870 357.8 395.2 430.6 286.4 315.9 369.1XTH20 xyloglucan endotransglucosylase At5g48070 199.5 187.5 276.5 296.1 260.0 346.3XTH33 xyloglucan endotransglucosylase At1g10550 173.4 261.2 309.3 270.6 222.1 315.3xyloglucan endotransglucosylase At1g11545 365.2 193.5 198.0 381.5 260.0 216.8xyloglucan endotransglucosylase At3g23730 801.8 614.1 582.2 775.5 990.8 1061.4xyloglucan endotransglucosylase At4g18990 4098.5 4031.6 5190.4 2547.4 4464.1 3553.4xyloglucan endotransglucosylase At2g36870 2015.1 1019.9 1641.5 1763.7 2961.5 2624.9xyloglucan endotransglucosylase At4g13080 193.3 182.4 293.6 192.8 293.4 293.5xyloglucan endotransglucosylase At4g13090 1495.1 2213.1 1190.7 1291.1 1465.5 1517.8MERI5B xyloglucan endotransglucosylaseAt4g30270 350.2 147.5 N/A 242.8 555.3 439.3xyloglucan endotransglucosylase At4g37800 849.2 1052.4 1006.8 776.9 2099.6 2341.7xyloglucan endotransglucosylase At3g48580 3602.0 3662.7 5106.0 3160.1 7355.1 6097.2xyloglucan endotransglucosylase At5g57540 107.5 N/A 105.5 111.4 N/A N/Axyloglucan endotransglucosylase At5g57530 705.2 543.7 934.3 337.2 767.4 641.7xyloglucan endotransglucosylase At5g65730 229.6 249.9 307.2 218.3 392.8 346.7XTR3 xyloglucan endotransglucosylase At5g57550 108.4 119.1 145.9 148.4 N/A N/AXTR4 xyloglucan endotransglucosylase At1g32170 133.5 N/A N/A 106.0 N/A N/AXTR7 xyloglucan endotransglucosylase At4g14130 1585.1 5596.1 440.5 1133.7 621.4 843.1XTR9 xyloglucan endotransglucosylase At4g25820 597.5 476.2 763.0 701.4 755.6 876.2XTH19 xyloglucan endotransglucosylase At4g30290 11351.5 6273.5 6870.5 11229.3 14157.6 13558.8 Mean expression values have been shown for each transcript. Significance of differential regulation in the microarray data was determined using Significance Analysis of Microarray (SAM). Y: tyrosine treated F: phenylalanine W: tryptophan

51

Classification of differentially regulated transcripts was done using the GOstats

and AmiGO packages from Gene Ontology (Beissbarth and Speed 2004). The GOstats

algorithm provides the overrepresentation significance of the functional categories

identified among the differentially regulated transcripts. AmiGO enhances the terms

provided by GOstats in order to obtain more specific pathways for the classification.

The dahps1 mutation affects sugar metabolism, aromatic compound biosynthesis,

hormone response pathways and cell wall biosynthesis including genes involved in

lignin and lignan biosynthesis from the phenylpropanoid pathway (Table 1-6). The

overrepresented groups of transcripts as a result of this mutation as identified by

AmiGO are: amino acid and derivative metabolic processes and aromatic compound

metabolic processes. Tyrosine treatment exhibits downregulation of auxin response

genes and differential expression of structural and aromatic compound synthesis.

Tyrosine supplementation causes transcriptional changes for pre-chorismate enzymes

of the shikimate pathway and post chorismate enzymes involved in tryptophan

synthesis. The most overrepresented groups of genes upon tyrosine treatment belong

to: amino acid and derivative metabolic processes and aromatic compound metabolism.

In order to dissect which pathway is affected in response to tyrosine sensitivity dahps1

seedlings treated with tyrosine and tryptophan or treated with tyrosine and

phenylalanine were compared to dahps1 seedlings treated only with tyrosine. This

analysis revealed that both tryptophan and phenylalanine supplementation in addition to

tyrosine supplementation cause mainly an increase in auxin transporter activity as well

as transcriptional changes in key genes of the phenylpropanoid pathway such as

flavonol synthase, flavonone-3-hydroxylase, chalcone and stilbene synthase, chalcone-

flavonone isomerase, 4-coumerate-CoA ligase, flavin-containing monooxygenases,

52

phenylalanine ammonia lyase and caffeoyl-CoA 3-O-methyltransferase. A

comprehensive list of the overrepresented differentially regulated categories for each

treatment has been shown in tables 1-6 to 1-13:

53

Table 1-6: Overrepresented groups of transcripts among the dahps1 downregulated transcripts. compared to the wild type background untreated..

GO TERM GO ID P-value Sample Frequency

Background Frequency

Amino acid and derivative metabolic process

GO:0006519 2.19e-13

(19.2%)

(1.5%)

Aromatic compound metabolic process

GO:0006725

2.59e-08

(11.5%)

(1.0%)

Flavonoid biosynthetic process

GO:0009813

3.02e-07

(2.6%)

(0.2%)

Phenylpropanoid metabolic process

GO:0009698

8.26e-07

(6.5%)

(0.5%)

Hexose metabolic process

GO:0019318

2.93e-06

(6.5%)

(0.3%)

Carbohydrate metabolic process

GO:0005975

2.33e-05

(11.9%)

(1.5%)

Pigment biosynthetic process

GO:0046148

9.81e-05

(2.7%)

(0.3%)

Jasmonic acid and ethylene dependent systemic resistance.

GO:0009861

4.26e-03

(0.8%) (0.1%)

Response to hormone stimulus

GO:0009725

9.43e-02

3.4% 2.4%

Hormone biosynthetic process

GO:0042446

7.65e-02 0.5% 0.2%

Steroid biosynthetic process

GO:0006694

1.99e-02 1.4% 0.2%

Lignin metabolic process GO:0009808

5.47e-03

(0.8%) (0.1%)

Lignan metabolic process

GO:0009806

2.46e-03

(0.5%) (0.0%)

Prephenate pathway

GO:0009095

1.03e-02

(0.4%) (0.0%)

Plant-type cell wall GO:0009505

1.72e-07

(7.9%) (0.6%)

Significance was determined based on a p-value >0.01. The sample frequency (%) was compared relative to a background database.

54

Table 1-7: Overrepresented groups of transcripts among the dahps1 upregulated transcripts.

GO TERM GO ID P-value Sample Frequency

Background Frequency

Pyruvate metabolic process GO:0006090 8.45e-05 0.9% 0.0%

Positive regulation of abscisic acid mediated signaling

GO:0009789

3.84e-03

5.2% 0.7%

Response to hormone stimulus GO:0009725

3.54e-02

3.6% 2.4%

Phytosteroid metabolic process

GO:0016128

3.92e-02

0.4% 0.1%

Cellular carbohydrate catabolic process

GO:0044275

5.32e-03

6.1% 0.3%

Response to ethylene stimulus

GO:0009723

5.94e-03

(1.9%)

0.5%

Response to gibberellin stimulus

GO:0009739

3.61e-02

1.0% 0.4%

Auxin polar transport

GO:0009926

7.88e-02

0.8% 0.2%

Auxin metabolic process GO:0009850

4.45e-02

0.5% 0.1%

Pigment metabolic process

GO:0042440

7.19e-03

2.5% 0.3%

Circadian rhythm

GO:0007623

8.17e-03

1.1% 0.2%

Steroid metabolic process

GO:0008202

1.83e-02

1.0% 0.2%

Hexose biosynthetic process

GO:0019319

1.88e-02

1.2% 0.1%

Response to UV

GO:0009411

2.73e-02

2.5% 0.2%

Significance was determined based on a p-value <0.01. The sample frequency (%) was compared relative to a background database .

55

Table 1-8: Overrepresented groups of transcripts among the tyrosine treated dahps1 downregulated transcripts.

GO TERM GO ID P-value Sample Frequency

Background Frequency

Amino acid and derivative metabolic process

GO:0006519 8.68e-02

1.8% 0.7%

Aromatic compound metabolic process

GO:0006725

6.44e-02

2.2% 1.0%

Phenylpropanoid metabolic process

GO:0009698

8.70e-02

1.3% 0.5%

Carbohydrate metabolic process

GO:0005975

1.76e-02

3.6% 1.5%

Plant-type cell wall

GO:0009505

3.00e-02

0.9% 0.1%

Significance was determined based on a p-value >0.01. The sample frequency (%) was compared relative to a background database .

56

Table 1-9: Overrepresented groups of transcripts among the tyrosine treated dahps1 upregulated transcripts.

GO TERM GO ID P-value Sample Frequency

Background Frequency

Amino acid and derivative metabolic process

GO:0006519 4.59e-02

2.8% 0.7%

Aromatic compound metabolic process

GO:0006725

8.31e-02

2.8% 1.0%

Flavonoid biosynthetic process

GO:0009813

1.60e-02

1.9% 0.2%

Phenylpropanoid metabolic process

GO:0009698

6.49e-02

1.9% 0.4%

Hormone biosynthetic process

GO:0042446

4.14e-02

1.9% 0.3%

Auxin metabolic process GO:0009850

9.83e-03

1.9% 0.1%

Significance was determined based on a p-value >0.01. The sample frequency (%) was compared relative to a background database .

57

Table 1-10: Overrepresented groups of transcripts among the tyrosine treated dahps1 downregulated transcripts rescued by phenylalanine.

GO TERM GO ID P-value Sample Frequency

Background Frequency

Amino acid and derivative metabolic process

GO:0006519 2.80e-05

3.3% 1.5%

Aromatic compound metabolic process

GO:0006725

4.47e-04

1.6% 0.6%

Flavonoid biosynthetic process

GO:0009813

1.31e-05

1.0% 0.2%

Phenylpropanoid metabolic process

GO:0009698

3.20e-04

1.4% 0.5%

Hexose metabolic process

GO:0019318

5.86e-08

1.6% 0.3%

Carbohydrate metabolic process

GO:0005975

7.05e-07

1.4% 0.3%

Pigment biosynthetic process

GO:0046148

6.29e-04

1.0% 0.3%

Jasmonic acid and ethylene dependent systemic resistance.

GO:0009861

1.90e-02

0.2% 0.0%

Response to hormone stimulus

GO:0009725

2.32e-04

4.2% 2.4%

Lignan metabolic process

GO:0009806

9.02e-02

0.2% 0.0%

Plant-type cell wall

GO:0009505

3.14e-02

1.2% 0.6%

Pyruvate metabolic process GO:0006090 8.95e-03

0.3% 0.0%

Response to ethylene stimulus

GO:0009723

5.62e-06

1.7% 0.5%

Pigment metabolic process

GO:0042440

6.29e-04

1.0% 0.3%

Hexose biosynthetic process

GO:0019319

5.86e-08

1.6% 0.3%

Response to UV

GO:0009411

1.13e-02

0.4% 0.1%

Significance was determined based on a p-value >0.01. The sample frequency (%) was compared relative to a background database.

58

Table 1-11: Overrepresented groups of transcripts among the tyrosine treated dahps1 upregulated transcripts rescued by phenylalanine.

GO TERM GO ID P-value Sample Frequency

Background Frequency

Amino acid and derivative metabolic process

GO:0006519 4.42e-04

3.7% 1.5%

Aromatic compound metabolic process

GO:0006725

7.60e-02

0.6% 0.2%

Flavonoid biosynthetic process

GO:0009813

7.93e-02

0.6% 0.2%

Pigment biosynthetic process

GO:0046148

1.97e-03

1.4% 0.3%

Jasmonic acid and ethylene dependent systemic resistance.

GO:0009861

8.95e-02

0.4% 0.1%

Response to hormone stimulus

GO:0009725

6.36e-02

3.5% 2.4%

Steroid biosynthetic process

GO:0006694

2.32e-02

0.8% 0.2%

Plant-type cell wall

GO:0009505

2.68e-05

2.4% 0.6%

Sugar:hydrogen symporter activity

GO:0005351

4.05e-02

1.0% 0.4%

Pyruvate metabolic process GO:0006090 1.92e-03

0.6% 0.0%

Phytosteroid metabolic process

GO:0016128

2.32e-02

0.8% 0.2%

Response to ethylene stimulus

GO:0009723

8.99e-02

1.0% 0.5%

Auxin mediated signaling pathway

GO:0009734

7.55e-02

0.4% 0.1%

Steroid metabolic process

GO:0008202

3.26e-02

0.4% 0.1%

Significance was determined based on a p-value >0.01. The sample frequency (%) was compared relative to a background database.

59

Table 1-12: Overrepresented groups of transcripts among the tyrosine treated dahps1 downregulated transcripts rescued by tryptophan.

GO TERM GO ID P-value Sample Frequency

Background Frequency

Amino acid and derivative metabolic process

GO:0006519 3.50e-03

2.2% 0.7%

Aromatic compound metabolic process

GO:0006725

1.10e-02

1.7% 0.6%

Flavonoid biosynthetic process

GO:0009813

8.06e-04

1.2% 0.2%

Phenylpropanoid metabolic process

GO:0009698

6.43e-04

2.0% 0.5%

Hexose metabolic process

GO:0019318

8.14e-03

1.0% 0.2%

Carbohydrate metabolic process

GO:0005975

5.89e-02

1.5% 0.7%

Pigment biosynthetic process

GO:0046148

2.78e-02

1.0% 0.3%

Jasmonic acid and ethylene dependent systemic resistance.

GO:0009861

2.35e-03

1.7% 0.4%

Lignan metabolic process

GO:0009806

1.68e-02

0.5% 0.0%

Plant-type cell wall

GO:0009505

3.56e-02

1.2% 0.4%

Pyruvate metabolic process GO:0006090 1.29e-02

0.5% 0.0%

Hexose biosynthetic process

GO:0019319

2.13e-04

1.7% 0.3%

Response to UV

GO:0009411

4.79e-02

0.5% 0.1%

Positive regulation of abscisic acid mediated signaling

GO:0009789

9.48e-04

2.5% 0.7%

Significance was determined based on a p-value >0.01. The sample frequency (%) was compared relative to a background database.

60

Table 1-13: Overrepresented groups of transcripts among the tyrosine treated dahps1 upregulated transcripts rescued by tryptophan.

GO TERM GO ID P-value Sample Frequency

Background Frequency

Response to hormone stimulus

GO:0009725

1.93e-03

5.0% 2.4%

Steroid biosynthetic process

GO:0006694

4.80e-02

0.8% 0.2%

Plant-type cell wall

GO:0009505

1.29e-03

2.1% 0.6%

Response to auxin stimulus

GO:0009926

2.00e-02

2.1% 0.9%

Auxin polar transport GO:0009926

3.24e-02

0.8% 0.2%

Auxin metabolic process GO:0009850

5.36e-04

0.8% 0.0%

Significance was determined based on a p-value >0.01. The sample frequency (%) was compared relative to a background database.

61

Figure 1- 13: Venn diagram representation of the phenylpropanoid pathway transcripts significantly affected in each comparison. Blue: Significance analysis was conducted for dahps1 treated with tyrosine Yellow: Results of the comparison between dahps1 treated with tyrosine and phenylalanine and dahps1 treated with tyrosine alone. Green: Significance was determined by comparing dahps1 treated with tyrosine and tryptophan relative to dahps1 treated with tyrosine alone. The transcripts that overlap between all three treatments encodes the proteins: phenylalanine-ammonia lyase 2 (PAL2), flavanone 3-dioxygenase and dihydroflavonol-4-reductase (DHFR). The transcript that intersects between the tyrosine treatment and the phenylalanine treatment, but not at the tryptophan and tyrosine treatment encodes chorismate mutase 2 .

62

Table 1-14: Raw expression values of intersecting genes in Figure 1-13.

63

Figure 1- 14: Venn diagram representation of all the transcripts significantly affected in each comparison. Blue: Significance analysis was conducted for dahps1 treated with tyrosine compared to the dahps1 background untreated.. Yellow: Results of the comparison between dahps1 treated with tyrosine and phenylalanine and dahps1 treated with tyrosine alone. Green: Significance was determined by comparing dahps1 treated with tyrosine and tryptophan relative to dahps1 treated with tyrosine alone. The four genes that intersect among all three treatments are: phenylalanine-ammonia lyase 2 (PAL2), flavonol synthase 1(FLS1) and dihydroflavonol-4-reductase (DHFR) and arogenate dehydrogenase 5 (ADH5).

64

Table 1-15: Raw expression values of intersecting genes in Figure 1-14.

N/A: Not available (Absent signal).

65

The effect of the aromatic amino acids on DR5::GUS levels.

DR5::GUS (Sabatini, Beis et al. 1999) was crossed to dahps1 to analyze the

endogenous levels of auxin accumulation in the root tip during embryogenesis. The

GUS accumulation in the treated roots was compared to the respective untreated

controls. Dr5::GUS is expressed in the quiescent zones and surrounding columella cells

of root tips, referred to as zone 1 according to the classification by Birnbaum et al,

(Birnbaum, Shasha et al. 2003). Treatment with exogenous tryptophan results in

increasing levels of DR5::GUS in zone 1, as indicated by the diffusion of the area of

staining. In crosses with this marker to the dahps1 background, GUS levels in the root

tip are severely affected upon tyrosine supplementation and recovery of these levels is

observed upon supplementation with either phenylalanine or tryptophan. Even though in

the dahps1 background the restoration of the GUS levels is not the same as in the wild-

type, there is a significant recovery both in the root morphology and GUS levels upon

tryptophan or phenylalanine supplementation (Figure 1-15). Tyrosine treatment results

in the most severe reduction in the levels of GUS in the root tip. Supplementation with

both tyrosine and phenylalanine causes a partial restoration of the GUS accumulation in

the root, while tryptophan causes a bigger expansion of the staining area compared to

the untreated control. However, when the Dr5::GUS background is supplemented with

all three aromatic amino acids, the GUS accumulation in the root is less than that

observed with only tyrosine and tryptophan. This applies to the dahps1xDr5::GUS cross

as well, but with this mutation, there is less GUS accumulation in the root tip with all the

treatments. However, a restoration back to the untreated control levels is observed with

the supplementation with tyrosine as well as another one of the aromatic amino acids.

66

Figure 1- 15: Effect of tyrosine on the DR5::GUS marker and dahps1xDr5::GUS crosses as observed at the root apex. Maginifcation: 20x. Exposure time for the pictures: 20 sec. The exposure and magnification were the same for all pictures.

67

DISCUSSION Briefly, experimental analysis has shown that DAHPS knockout seedlings show a

significantly different response in root growth compared to the wild type Columbia. In

particular, dahps1 seedlings are sensitive to tyrosine supplementation and the dahps3

seedlings are sensitive to tryptophan supplementation. Bioinformatic analysis has

identified a C-terminal domain in DAHPS1 and DAHPS3 that is absent in bacteria

(Figure 1-6).

Microarray analysis identified several genes that were differentially regulated by

tyrosine treatment in dahps1 seedlings compared to wild type Columbia and the

expression of which was reversed by supplementation with tryptophan or phenylalanine.

These genes belong to the phenylpropanoid pathway, hormone signaling and cell wall

biosynthesis. Further validation showed that aromatic amino acid treatment has a

significant effect on the accumulation of auxin.

The role of the DAHP synthases

  Treatment of dahps1 seedlings with the aromatic amino acids indicated that

these seedlings are hypersensitive to tyrosine and that this phenotype is rescued in the

presence of either tryptophan or phenylalanine. The requirement for the absence of

DAHPS1 to observe this hypersensitivity suggests that tyrosine regulates either

DAHPS2 or DAHPS3 or both. In vitro kinetic analysis with recombinant DAHPS

isozymes from Arabidopsis thaliana shows that tyrosine does not affect the binding of

PEP and E4P nor the catalytic rate, indicating that tyrosine must be regulating either

DAHPS2 or DAHPS3 indirectly. Based on the root quantification results and the

68

microarray data, root length of dahps1 knockout seedlings is significantly affected upon

tyrosine supplementation and this phenotype is observed in a quantitative fashion with

increasing concentrations of tyrosine. Together with the microarray results, it suggests

that it is a result of regulation of the flux of chorismate shuttled to tryptophan synthesis,

which causes variations in the indole hormone levels in response to the regulation of the

shikimate pathway. Phenylalanine provides a more balanced systemic response to

alleviate tyrosine hypersensitivity compared to tryptophan. Furthermore, phenylalanine

(via flavonols) and tryptophan affect transcription of auxin transporters as opposed to

key auxin response genes suggesting that these changes are an effect of altered

phenylpropanoid pathway transcript levels. Since, the gene encoding DAHPS1 is

knocked out in these seedlings and since they are able to activate the phenylpropanoid

pathway in the presence of phenylalanine or tryptophan, then either DAHPS2 or

DAHPS3 is contributing towards phenylpropanoid pathway regulation.

Seedlings carrying a mutation in the dahps2 gene show no hypersensitivity to

any of the aromatic amino acids. dahps2 transcripts are expressed at basal levels

ubiquitously throughout the plant (Figure 1-4). These results suggest that DAHPS2 is

maintaining the level of shikimate pathway metabolites. This hypothesis can be further

supported by the experimental evidence that DAHPS2 is diurnally cycled, is redox

regulated and is activated when glucose catabolism is turned on to ensure sufficient

synthesis of chorismate (Rogers, Dubos et al. 2005). Several genes involved in lignin

biosynthesis have been shown to cycle with a diurnal pattern of transcription in

response to light, and others are under circadian control (Rogers, Dubos et al. 2005).

Because DAHPS2 is expressed under considerably low levels (Figure 1-4) and is redox

69

regulated (Rogers, Dubos et al. 2005), it probably ensures that basal flow of metabolites

is maintained in the shikimate pathway and DAHPS3 may be regulated by tyrosine.

The phenotype of tryptophan sensitivity in dahps3 knockout seedlings suggests

that tryptophan participates in regulating either DAHPS1 or DAHPS2. Because the

levels of expression of DAHPS2 are basal and ubiquitously spread in different tissues, it

is more likely that DAHPS1 expression is regulated by tryptophan. Together DAHPS1

and tryptophan are potentially regulating indole hormone biosynthesis. This is

consistent with the dried stem and flower phenotype displayed by dhs1dhs3, but not by

dhs2dhs3, which shows floral stem dessication (Galweiler, Guan et al. 1998; Crowley

2006). The dhs1dhs3 phenotype is quite similar to the phenotype observed with the

pin1 mutant that contains a mutation in the auxin transporter, PINI (Galweiler, Guan et

al. 1998).

The role of the aromatic amino acids in regulating the shikimate pathway.

Synchronized germination of seeds on plates supplemented with each of the

aromatic amino acids shows a significant abruption in embryogenesis for dahps1 and

dahps3 seedlings which are hypersensitive to tyrosine and tryptophan respectively. This

concentration dependent response is most evident in root growth as has been shown in

Figures 1-9 to 1-12. These findings suggest that tyrosine is regulating DAHPS2 or

DAHPS3 and tryptophan is regulating DAHPS1 or DAHPS2. No hypersensitivity is

observed with phenylalanine, which suggests that phenylalanine is not involved in

feedback regulation of the DAHPs. This mode of regulation by phenylalanine may be to

ensure that basal level of chorismate is synthesized.

70

In a similar fashion to DAHPS2 treament, phenylalanine supplementation did not

produce a hypersensitive phenotype in any of the dahps knockout lines. This may have

evolved as a defensive response against stress, in order to ensure adequate levels of

intermediates are flowing toward the phenylpropanoid pathway in need of effective and

prompt stress responses.

Comparison of the genome wide transcript levels of dahps1 seedlings and wild

type Columbia siblings identified a number of affected pathways that were

overrepresented compared to the background. dahps1 knockout seedlings exhibit

differential transcript levels of genes that are involved in sugar metabolism, aromatic

compound synthesis, hormone response pathways and cell wall biosynthesis (Tables 1-

6, 7). Upregulation of the phenylpropanoid pathway genes is correlated with an increase

in the transcript levels of cell wall modifying genes mainly those belonging to the group

of xyloglucan:xyloglucosyl transferases, which modify the cell wall in response to

changes in lignin levels (Zhong and Ye 2007).The transcript levels of auxin transporters

and auxin reponse genes were also increased.

  However, treatment of these seedlings with tyrosine results in general reversal of

the differential regulation observed with the mutation. But, this reversal of the effect

does not restore transcript levels observed in wild type seedlings. Instead, it causes a

downregulation or upregulation below and above the wild type levels (Tables 1-2 to 4).

For example, several xyloglucan:xyloglucosyl endotransglycosylases are upregulated

by the dahps1 mutation but they are downregulated by the tyrosine treatment. However,

this downregulation does not restore the wild-type levels, because the transcript levels

of these enzymes are significantly further downregulated than wild-type Columbia. A

similar response is observed with the PIN4 and PIN5 transporters. Interestingly, the

71

PIN8 transporter transcript level is downregulated in response to the mutation and

upregulated in response to tyrosine compared to the wild type levels.

In addition, tyrosine treatment results in differential regulation of transcripts in

pathways upstream and downstream of chorismate. For example, chorismate synthase

is upregulated in the dahps1 seedlings treated with tyrosine. Tyrosine supplementation

has triggered an increase in the levels of these enzymes suggesting an interaction or

indirect communication between these enzymes in regulating chorismate levels. The

hypothesis here is that an increase in chorismate synthase will provide sufficient

quantity of chorismate for the branching pathways. The general downregulation of the

phenylpropanoid pathway and expression of hormone related genes that is observed

upon tyrosine supplementation must then be achieved downstream of chorismate. This

downregulation of the phenylpropanoid pathway has been previously reported for the

chorismate mutases which catalyze the conversion of chorismate to prephenate, the

committed step of tyrosine and phenylalanine synthesis. Chorismate mutase 1 and 3

are expected to be chloroplast localized and have been shown to be regulated by

tyrosine and phenylalanine, but not by tryptophan (Mobley, Kunkel et al. 1999). It has

been suggested that chorismate mutase 3 activity is sufficient to provide requisite levels

of free phenylalanine and tyrosine under normal growing conditions, but that it becomes

saturated when the chorismate level increases rapidly, in which case, chorismate

mutase 1 is important and is regulated over a much wider range of substrate

concentrations (Mobley, Kunkel et al. 1999). Therefore tyrosine mediated regulation of

these enzymes would result in fine adjustments of the levels of chorismate needed for

phenylalanine and tyrosine or for tryptophan synthesis.

72

Tryptophan and phenylalanine treatment reverses the transcript levels of key

enzymes in pathways that were previously lowered by tyrosine treatment. For most of

the transcripts affected in both the phenylpropanoid pathway and hormone response,

phenylalanine and tryptophan play a similar role. The reasoning behind this hypothesis

is that altered levels of transcripts in the phenylpropanoid pathway (Figure 1-16) exhibit

a direct response in reversal of their levels in the treatment of dahps1 seedlings with

either tryptophan or phenylalanine as opposed to the levels of hormone response genes

that seem to be changing in distinctive groups, but independently in response to the

supplementation with the different aromatic amino acids. Evidence in the literature

(Leyser 2002; Dharmasiri, Dharmasiri et al. 2005) suggests that the levels of the indole

hormones are regulated by transport or degradation. Unlike ethylene that can travel

through the plant by diffusion, IAA is transported by a complex of efflux carriers

(Stepanova, Yun et al. 2007). Some flavin-containing monoxygenases are responsible

for the conversion of tryptamine to N-hydroxyl tryptamine to regulate hormone

biosynthesis (Mikkelsen, Naur et al. 2004); A direct effect is observed in the microarray

data on several flavin containing monooxygenases thus implicating these enzymes in

mediating the indirect effect observed with the hormone response genes. Differential

regulation of the auxin PIN transporters in these microarray data is further indicative of

an indirect effect of the aromatic amino acid supplementation on hormone response

transcripts compared to the direct effect and relationship that is observed with the

phenylpropanoid pathway genes. Therefore, the altered transcripts expression is a

result of decreased metabolite pool that has been compensated here by

supplementation with the respective aromatic amino acids. The roles that phenylalanine

and tryptophan are playing in this rescue may be slightly different. Phenylalanine is

73

possibly restoring the metabolite pool necessary for phenylpropanoid metabolism while

tryptophan saturates the metabolite pool for hormone synthesis and may be causing

allosteric inhibition of regulatory enzymes in tryptophan synthesis such as anthranilate

synthases (Niyogi and Fink 1992) or tryptophan synthases (Niyogi, Last et al. 1993),

which are regulated by allosteric inhibition of substrate channelling (Dunn, Niks et al.

2008). Differential control or regulation of the pathway by the associated metabolite is

important to address the requirement of both pathways. Previously, the connection

between ethylene, auxin and secondary metabolites has been reported. For example,

the regulation of auxin transport by flavonols (Peer, Bandyopadhyay et al. 2004) and the

role of phenylpropanoids in ethylene mediated responses against pathogens (Ecker and

Davis 1987; La Camera, Geoffroy et al. 2005) are well documented. Auxin and ethylene

regulate the production of flavonols and phenylpropanoids through differential

transcription of key biosynthetic genes. Auxin and ethylene act independently on the

regulation of these pathways (Ecker and Davis 1987; La Camera, Geoffroy et al. 2005).

To examine the production of tryptophan levels, dahps1 plants were crossed to the

Dr5::GUS line. DR5 is a synthetic promoter consisting of a constitutive auxin response element

repeated five times in tandem. Activity of the DR5 markers as auxin responsive reporters

reflect accumulation of auxin transported from the apical regions of embryos to the root

poles (Hamann, Mayer et al. 1999; Leyser 2001; Friml and Palme 2002; Hamann,

Benkova et al. 2002; Friml 2003; Blakeslee, Peer et al. 2005; Dhonukshe, Kleine-Vehn

et al. 2005; Paponov, Teale et al. 2005; Leyser 2006).

Exogenous auxin treatment did not stimulate GUS activity in plants (Stepanova, Yun

et al. 2007). Therefore, the response that we are observing for dahps1xDr5::GUS

crosses is an endogenous response to auxin accumulation even though the aromatic

74

amino acids are supplied exogenously and the GUS level is used here as an indirect

indicator of tryptophan levels in the plant. Addition of tyrosine causes general

downregulation of the GUS levels. The lack of GUS accumulation in the dahps1 mutant

in the presence of tyrosine is an indicator of the lack of tryptophan for hormone

synthesis. If this data is compared to the general downregulation of the phenylpropanoid

pathway, it suggests that tyrosine lowers the levels of available chorismate for the

downstream pathways.

Upon supplementation with both tryptophan and tyrosine, restoration of GUS levels

is seen to the same level as the untreated control, but these levels are not the same as

those observed with the tyrosine and tryptophan supplemented wild type, suggesting

once more the involvement of DAHPS1 in upregulating the hormone biosynthesis.

75

Figure 1- 16: Illustration of the effect observed on key shikimate and phenylpropanoid pathway genes upon aromatic amino acid supplementation. The transcript levels for key enzymes in the phenylpropanoid pathway are altered in response to supplementation with phenylalanine and tryptophan in addition to tyrosine supplementation. Green arrows show downregulation of transcript levels. Red arrows show upregulation of transcript.

 

76

Figure 1- 17: The model by which DAHPS isozymes are predicted to interact with the aromatic amino acids and affect the levels of intermediates shuttled to the branching pathways. DAHPS1 supplies intermediates to hormone biosynthesis and this process is regulated by tryptophan. DAHPS2 maintains basal levels of shikimate pathway intermediates and DAHPS3 regulates the phenylpropanoid pathway, which is downregulated in the presence of tryptophan. Phenylalanine increases the levels of phenylpropanoid pathway transcripts and does not render any of the dahps knockout seedlings hypersensitive, suggesting that it ensures basal flux through the phenylpropanoid pathway in response to stress.

77

Perspectives on the model and future directions.

The model proposed here predicts that in Arabidopsis thaliana: a) DAHPS1 is

regulated by tryptophan and in concert, they regulate flux through indole hormone

biosynthesis. b) DAHPS2 and phenylalanine play a passive role in ensuring that basal

levels are maintained in the shikimate pathway and the phenylpropanoid pathway,

respectively. c) DAHPS3 causes positive regulation of the phenylpropanoid pathway. It

appears to be regulated by tyrosine which causes an overall reduction in chorismate

availability to the branching pathways. The most difficult question to address and that

still remains is: What is the mechanism responsible for this regulation? In order to

address this question, detailed analysis with downstream regulation steps is necessary.

For example, looking at the effects of crosses of dahps3 mutants with the phenylalanine

ammonia lyase (PAL) isozyme mutants would reveal if there is direct or indirect

communication between them in regulating the phenylpropanoid pathway. In a similar

fashion, crosses between dahps1 and the newly characterized wei8 mutant carrying a

mutation in tryptophan aminotransferase (Stepanova, Robertson-Hoyt et al. 2008)

would dissect the role of the steps necessary for this feedback inhibition.

A strong connection has currently been reported between auxin synthesis,

differential growth and meristem maintenance (Stepanova, Robertson-Hoyt et al.

2008)(Hong, Fuangthong et al. 2005). Embryogenesis in plants is a well-characterized

auxin-dependent developmental process and therefore, processes that require proper

auxin response levels are abnormal in the mutants. In root tips, ethylene activates Trp

biosynthetic enzymes to fulfill the demand for auxin (Stepanova, Robertson-Hoyt et al.

2008). Previous analysis has shown that during the globular stage of embryogenesis,

the apical part of the embryo is the main site of IAA production that gets transported

78

toward the hypophysis (Friml 2003). This is consistent with the increased levels of auxin

transporters in the microarray data presented here. Auxin activity gradients during

embryogenesis are essential in guiding root pole formation (Hardtke and Berleth 1998;

Hamann, Mayer et al. 1999; Dharmasiri, Dharmasiri et al. 2005).

The ethylene effect on root growth is largely mediated by an increase in the

levels of auxin signalling and response in roots due to an ethylene-mediated increase in

auxin synthesis and transport (Stepanova, Yun et al. 2007). Due to this effect, it is

difficult to dissect the independent effect of each of these hormones in our microarray

data. RT- PCR data with primers spanning key genes in ethylene response would

strongly aid in this analysis and are under way. Cell wall genes are enriched among

genes that are regulated only by auxin and are not affected by ethylene. To determine

the regulatory role that aromatic amino acid supplementation plays on cell wall

biosynthesis, crosses with mutations on cell wall biosynthesis genes and markers would

be another tool that can be used to distinguish this effect. Since, the effect on root

growth and transcriptional data observed for hormone response genes is indirect and

since both auxin response genes and ethylene response genes are overrepresented, it

is difficult to differentiate the role of each of these hormones on root growth upon

aromatic amino acid supplementation. Since cell wall genes are regulated only by auxin

and not ethylene, the crosses suggested above are important to differentiate the role of

each of these hormones.

Cell wall biosynthesis genes are among those whose regulation by ethylene is

likely to be mediated by auxin and part of the ethylene effect on root growth is auxin

independent. Xyloglucan endotransglycosylases modify xyloglucans which are major

components of primary cell walls in dicots (Zhong and Ye 2007). They are regulated by

79

gibberellins and may also be involved in the modification of the cellulose/xyloglucan

network . Downregulation of several of these genes upon tyrosine treatment may be a

direct effect of the downregulation of gibberellin levels and may be a modification

required for regulation of lignin deposition. This is quite likely since several lignin

synthesis and phenylpropanoid pathway genes were also downregulated such as

caffeoyl-CoA 3-O-methyltransferase and cinnamoyl-CoA reductases which synthesize

lignin constituent precursors. The levels of several MYB and WRKY family transcription

factors were also donwregulated. These transcription factors are involved in regulating

the levels of genes during development including the levels of structural genes,

particularly those involved in secondary cell wall biosynthesis, in which lignification is

very important and is directly dependent on the regulation of the phenylpropanoid

pathway (Zhong and Ye 2007).

80

PUBLICATION NOTICE: THIS CHAPTER HAS BEEN SUBMITTED TO THE JOURNAL OF BIOLOGICAL CHEMISTRY FOR PUBLICATION UNDER SUBMISSION NUMBER M8:06272 UNDER THE FOLLOWING CITATION: THE CRYSTAL STRUCTURE OF A. AEOLICUS PREPHENATE DEHYDROGENASE

REVEALS THAT TYROSINE INHIBITION ISMEDIATED BY A SINGLE RESIDUE Warren Sun+1, Dea Shahinas+1, Julie Bonvin2, Wenjuan Hou2, Joanne Turnbull+2,

Dinesh Christendat+1 1 Department of Cell and Systems Biology, University of Toronto. 25 Harbord St. Toronto, ON, M5S 3G5, Canada 2 Department of Biochemistry, Concordia University. 7141 Sherbrooke Street West, Montréal, Québec, Canada, H4B 1R6 + These authors have contributed equally. Warren Sun and Dea Shahinas contributed equally to the structure determination. The manuscript was written by Warren Sun and edited by Dr. Dinesh Christendat, Dr. Joanne Turnbull and Dea Shahinas. All the figures were prepared by Dea Shahinas. The kinetics analyses and biochemical characterization were jointly done by Warren Sun and Julie Bonvin.

81

CHAPTER II: THE CRYSTAL STRUCTURE OF A. AEOLICUS PREPHENATE DEHYDROGENASE REVEALS THAT TYROSINE INHIBITION IS MEDIATED BY A SINGLE RESIDUE

Abstract TyrA proteins belong to a family of dehydrogenases that are dedicated to L-

tyrosine biosynthesis. The three TyrA subclasses are distinguished by their substrate

specificities, namely the prephenate dehydrogenases, the arogenate dehydrogenases

and the cyclohexadienyl dehydrogenases, which utilize prephenate, L-arogenate, or

both substrates, respectively. The molecular mechanism responsible for TyrA substrate

selectivity and regulation is unknown. To further our understanding of TyrA-catalyzed

reactions, we have determined the crystal structures of Aquifex aeolicus prephenate

dehydrogenase bound with NAD+ plus either 4-hydroxyphenylpyuvate, 4-

hydroxyphenylpropionate or L-tyrosine and have used these structures as a guide to

target active site residues for site-directed mutagenesis. From a combination of

mutational and structural analyses, we have demonstrated that His147 and Arg250 are

key catalytic and binding groups, respectively and Ser126 participates in both catalysis

and substrate binding through the ligand 4-hydroxyl group. The crystal structure

revealed that tyrosine, a known inhibitor, binds directly to the active site of the enzyme

and not to an allosteric site. The most compelling finding though, is the role of His217 in

conferring ligand selectivity to recombinant A. aeolicus prephenate dehydrogenase.

Mutating His217 relieved the inhibitory effect of tyrosine on A. aeolicus.

82

INTRODUCTION Tyrosine serves as a precursor for the synthesis of proteins and secondary

metabolites such as quinones (Rinaldi, Porcu et al. 1998; Meganathan 2001;

Meganathan 2001), alkaloids (Meganathan 2001; Memelink 2004), flavonoids (Kaneko,

Baba et al. 2003), and phenolic compounds (Mobley, Kunkel et al. 1999; Kaneko, Baba

et al. 2003). In prokaryotes and plants, these compounds are important for their viability

and normal development (Taylor and Grotewold 2005).

The TyrA protein family consists of dehydrogenase homologues that are

dedicated to the biosynthesis of L-tyrosine. These enzymes participate in two

independent metabolic branches that result in the conversion of prephenate to L-

tyrosine, namely the arogenate route and the 4- hydroxyphenylpyruvate (HPP) routes.

Although both of these pathways utilize a common precursor and converge to produce a

common end-product, they differ in the sequential order of enzymatic steps. Through

the HPP route, prephenate is first decarboxylated by prephenate dehydrogenase (PD)

to yield HPP, which is subsequently transaminated to L-tyrosine via a TyrB homologue

(Fazel, Bowen et al. 1980). Alternatively, through the arogenate route, prephenate is

first transaminated to L-arogenate by prephenate aminotransferase and then

decarboxylated by arogenate dehydrogenase (AD) to yield L-tyrosine(Fazel, Bowen et

al. 1980; Bonner and Jensen 1987) (Figure 2-1A).

There are three classes of TyrA enzymes that catalyze the oxidative

decarboxylation reactions in these two pathways. The enzymes are distinguished by the

affinity for cyclohexadienyl substrates. PD and AD accept prephenate or Larogenate,

83

respectively, while the cyclohexadienyl dehydrogenases can catalyze the reaction using

either substrate (Song, Bonner et al. 2005).

To ensure efficient metabolite distribution of the pathway intermediates, TyrA

enzymes are highly regulated by various control mechanisms including feedback

inhibition, and genetic regulation by the Tyr operon (Cobbett and Delbridge 1987; Xia,

Zhao et al. 1993; Bonner, Jensen et al. 2004; Bonner, Disz et al. 2008). In some cases,

L-tyrosine competes directly with substrate, be it prephenate or L-arogenate for the

active site of arogenate or cyclohexadienyl dehydrogenases (Xie, Bonner et al. 2000;

Rippert and Matringe 2002; Bonner, Jensen et al. 2004; Bonvin, Aponte et al. 2006).

The product HPP can also serve as an efficient competitive inhibitor with respect to

prephenate (Jensen 1975). Additionally, at the protein level PD are only shown to by

regulated at distinct allosteric sites or domains to modulate their activity. For example,

the results of kinetic studies on the bifunctional E. coli chorismate mutase/prephenate

dehydrogenase (CM-PD) have indicated that this enzyme likely possesses a distinct

allosteric site for binding tyrosine (Turnbull, Morrison et al. 1991). In other examples,

such as with Bacillus subtilis PD additional regulatory control can originate through a C-

terminal aspartate kinase-chorismate mutase-TyrA (ACT) domain (Chipman and

Shaanan 2001). Specifically, this PD is competitively inhibited by HPP and L-tyrosine,

but is also noncompetitively inhibited by L-phenylalanine and L- tryptophan (Champney

and Jensen 1970; Song, Bonner et al. 2005). Biochemical analyses of PD from E. coli

CM-PD have provided a framework for understanding the molecular mechanism of the

TyrA enzymes. The E. coli PD-catalyzed reaction proceeds though a rapid equilibrium,

random kinetic mechanism with catalysis as the rate-limiting step (Sampathkumar and

Morrison 1982; Sampathkumar and Morrison 1982). Additionally, studies of the pH

84

dependence of the kinetic parameters V and V/K indicate that a deprotonated group

facilitates hydride transfer from prephenate to NAD+ by polarizing the 4-hydroxyl group

of prephenate, while a protonated residue is required for binding prephenate to the

enzyme-NAD+ complex (Turnbull, Cleland et al. 1991). The conserved residues His197

and Arg294, have been identified through extensive mutagenesis studies to fulfill these

two roles (Christendat, Saridakis et al. 1998; Christendat and Turnbull 1999). Further

analyses of the activities of wild-type protein and site-directed variants in the presence

of a series of inhibitory substrate analogues support the idea that Arg294 binds

prephenate through the ring carboxylate (Christendat and Turnbull 1999).

The structures of AD from Synechocystis sp and PD from Aquifex aeolicus (both

in complex with NAD+) have been reported by Legrand et al. (Legrand, Dumas et al.

2006) and by our group (Sun, Singh et al. 2006), respectively. Analyses of these

structures have provided structural information on the conserved histidine and arginine

residues. The structure A. aeolicus PD has also led to the identification of other active

site residues that may play a role in enzyme catalysis, most notably Ser126, which we

propose facilitates catalysis by orienting the catalytic histidine and the nicotinamide

moiety of NAD+ into their catalytically efficient conformations. Ambiguities can arise

from examination of the binary complexes, as prephenate has only been modeled in the

active site. For example, analysis of the AD structure by Legrand et al. (Legrand,

Dumas et al. 2006) places Arg217 (equivalent to Arg294 in E. coli and Arg250 in A.

aeolicus) too far from the active site to play a role in prephenate binding. Thus, the full

complement of interactions between prephenate and TyrA proteins are still largely

unknown, as are the interactions of the enzymes with L-tyrosine. To further investigate

the importance of residues involved in ligand binding, specificity and catalysis, we have

85

carried out co-crystallization studies of A. aeolicus PD with NAD+ and prephenate, with

NAD+ and 4-hydroxyphenylpropionate (HPpropionate), a product analogue, and with

NAD+ and L-tyrosine. Accordingly, this study provides the first direct evidence that L-

tyrosine binds to the active site of a prephenate dehydrogenase. We have investigated

the role of Ser126, His147, His217, and Arg250 through the kinetic analysis of site-

directed mutants and structural analysis of the co-crystal complexes. In order to

understand the role of active site residues in substrate selectivity, comparative structural

analysis of AD and PD was also conducted. The current study provides a basis for

understanding the mechanism of substrate selectivity between the different classes of

TyrA enzymes and details how A. aeolicus PD can accept prephenate as substrate and

L-tyrosine as a competitive inhibitor.

MATERIALS AND METHODS

Chemicals and reagents

Prephenate was prepared as described previously (Duzinski and Morrison 1976),

while NAD+ (free acid) was obtained from Roche. L-tyrosine was from ICN while HPP

and HPproprionate were from Aldrich. The keto form of HPP was prepared as outlined

by Lindblad et al. (Lindblad, Lindstedt et al. 1977). All other reagents were of molecular

biology grade and were purchased from Sigma, Bioshop, or BDH. Oligonucleotides

used for sitedirected mutagenesis were purchased from Integrated DNA Technologies

(Coralville, IA).

86

Site-directed mutagenesis

The expression plasmid (∆19PD) encoding residues 20-311 of the A. aeolicus

VF5 PD protein (gi:15282445; NP) has been previously described19. Site-directed

mutagenesis was carried out using the QuickChangeTM Site-Directed Mutagenesis Kit

(Stratagene), whereby complimentary oligonucleotides containing the desired mutations

for ∆19PD were used. Table 1 summarizes the mutants generated and the respective

oligonucleotides used for mutagenesis. All ∆19PD mutants were verified by DNA

sequencing.

Protein expression and purification

All constructs of A. aeolicus VF5 PD were expressed and purified as previously

described (Sun, Singh et al. 2006) with the following modifications. Cells harboring

recombinant mutant ∆19PD were disrupted by French press followed by sonication and

the heat treatment step was omitted. Following chromatography of the thrombin-treated

enzyme on Ni-NTA resin, PDs were subjected directly to size exclusion chromatography

on a Superdex 200 column.

Determination of enzyme activity and dissociation constants for ligand binding

Enzyme activity of A. aeolicus PD in the presence of NAD+ and prephenate was

monitored in a 1 mL reaction cuvette containing 50mM HEPES and 150 mM NaCl at pH

7.5 as previously described (Bonvin, Aponte et al. 2006). Briefly, the reaction mixture

was incubated at 55oC for 2 min, and then the reaction was initiated by the addition of

enzyme. The production of NADH was followed at 340 nm spectrophotometrically. The

turnover numbers and Michaelis constants for substrates were obtained by fitting initial

87

velocity to the Michaelis-Menten equation. Inhibition constants (Ki) for the dissociation

of HPP, HPpropionate or L-tyrosine from the enzyme-NAD+ complex were obtained by

fitting initial velocity data to the equation for linear competitive inhibition. These data

were obtained by varying prephenate at four concentrations ranging from below to

above the Km (in the presence of 2 mM NAD+) and HPP from 0.2 to 1.0 mM and L-

tyrosine ranging from 0 to 0.20 mM. Percent residual activity as a function of L-tyrosine

concentration was monitored as described by Bonvin et al. (Bonvin, Aponte et al. 2006).

All kinetic data were fitted to the appropriate rate equations by using the computer

programs of Cleland 32 or GraFit (Version 5.0, Leatherbarrow). Changes in

fluorescence emission as a function of prephenate concentration were used to

determine dissociation constants of the prephenate from the binary complex as

described by Bonvin et al (Bonvin, Aponte et al. 2006) Protein concentration was

estimated using the Bio-Rad Protein Assay Kit (Bio-Rad Laboratories) with bovine

serum albumin (Sigma) as a standard.

Crystallization

The initial crystallization condition was determined with a sparse matrix

crystallization (Hampton Research Crystal ScreenI TM) screen at room temperature

using the hanging drop vapor diffusion technique. The optimized cocrystallization

condition consists of 48% MPD and 100 mM HEPES at pH 7.8, and co-crystals were

obtained by supplementing the protein solution (at a concentration of 12 mg / mL) with 5

mM NAD+ and 10 mM of HPpropionate or prephenate, or 2.25 mM L-tyrosine.

88

X-ray diffraction and structure determination

X-ray diffraction data were collected from single crystals at a temperature of 100

K in a nitrogen stream on beamline SBC19 at a wavelength 0.9794 Å at the Argonne

National Laboratory, Advanced Photon Source. The diffraction data was processed and

scaled with the HKL3000 suite of programs (DENZO/SCALEPACK) (Otwinowski 1997).

The enzyme-ligand structures were sufficiently isomorphous with the previously

described ∆19PD-NAD+ complexed structure (Sun, Singh et al. 2006) to allow the

immediate use of the RIGID routine of CNS (Crystallography and NMR system)

(Brunger, Adams et al. 1998), to correctly place the search model. Model visualization

and rebuilding were done with the program O (Jones, Zou et al. 1991). The remainder

of the model was manually built with O, and simulated annealing refinement was

subsequently conducted with CNS after every round of model building. For the ∆19PD-

NAD+-HPP, ∆19PD-NAD+-HPpropionate and ∆19PDNAD+-L-tyrosine structures,

multiple rounds of model building with O and CNS refinement were conducted. All

molecules of PD were rebuilt prior to every round of refinement and noncrystallographic

restraint was not applied during CNS refinement. NAD+ molecules and ligands were

fitted to the unaccounted electron density in each molecule in the tetramer after the

second round of refinement. PDB, topology and parameter files for NAD+, tyrosine,

HPP and prephenate were obtained from the HIC-up server

(http://xray.bmc.uu.se/hicup), whereas the corresponding files for HPpropionate were

obtained by modifying the respective files of prephenate. Representative figures from

the crystal structure were produced with PyMol (DeLano 2002).

89

Table 2-1: Forward primers used to generate active site variants.

90

RESULTS AND DISCUSSION The primary objectives of this study are to identify active site residues that are

directly involved in the catalytic and regulatory mechanisms of PDH and to determine

the mechanism that contributes to substrate selectivity amongst enzymes in the TyrA

family. Cocrystallization was conducted in the presence of NAD+ and either prephenate,

HPpropionate, or L-tyrosine. Site-directed mutagenesis studies targeted residues

Ser126, His147, His217, and Arg250, which are considered important for either the

enzyme-catalyzed reaction or for conferring ligand selectivity.

Crystallization and structural summaries of Δ19PD-NAD+-HPP, Δ19PD-NAD+-HPpropionate

and Δ19PD-NAD+L-tyrosine

Crystals of ∆19PD-NAD+-HPP, ∆19PDNAD+-HPpropionate and ∆19PD-NAD+-

L-tyrosine grew under identical precipitant and pH crystallization conditions. These

crystals belong to space group P212121 and their respective structures were

determined by molecular replacement. All atomic models display excellent overall

stereochemistry as judged by the Ramachandran plot; for the structures of ∆19PD

complexed with NAD+-HPP, NAD+-HPpropionate and NAD+-L-tyrosine more than 99

percent of the residues, are in the allowed regions. The structure of ∆19PD-NAD+-HPP,

∆19PD-NAD+-HPpropionate and ∆19PD-NAD+-L-tyrosine structures were refined to

2.15 Å, 2.25 Å and 2.0Å, respectively. Data collection and refinement statistics are

summarized in Table 2 and 3,respectively.

91

Table 2-2: Summary of X-ray data collection statistics.

92

Table 2-3:

93

Although continuous, interpretable electron density was observed for the vast

majority of these structures, the following residues were excluded in the model due to

poor or absent densities: for the ∆19PD-NAD+-HPP structure, residues 20-25 and

residues 310-311 for chain A, residues 20-27 and 310-311 for chain B, residues 20-24

and 306-311 for chain C, residues 20-26 and 309-311 for chain D; ∆19PD-NAD+-

HPpropionate crystal structure, residues 20-25 and 311 in Chain A, 20-27 and 310-311

in Chain B, 20-24 and 311 in Chain C, and 20-26 and 309-311 in Chain D; for the

∆19PD-NAD+-L-tyrosine crystal structure, residues 20-25 and 311 in Chain A, 20-29

and residues 308-311 in Chain B, 20-29 and 306-311 in Chain C, and 20-26 and 311 in

Chain D.

Crystals of ∆19PD-NAD+-HPpropionate, and ∆19PD-NAD+-L-tyrosine were

obtained from cocrystallization studies with 5 mM NAD+ and 10mM of HPpropionate or

2.25 mM L-tyrosine, respectively. Interestingly, the ∆19PD-NAD+-HPP crystals were

obtained from co-crystallization experiment containing 5 mM NAD+ and 10 mM

prephenate. The presence of HPP, instead of prephenate, in the structure indicates that

prephenate was enzymatically converted to HPP during the co-crystallization studies.

All ligand types were located in the F0 – Fc difference electron density map after the

initial round of refinement. Accordingly, these molecules were built into the model prior

to the second round of refinement. Figure 2-1B shows the chemical structure of each

ligand.

Only one molecule of the product or product analogue is consistently identified

per dimer. In contrast, both subunits in the dimer contain a molecule of NAD+. For

example, for each dimer of the ternary complex ∆19PD-NAD+-HPP, one subunit

contains a molecule of NAD+and one molecule of product (we define this as a ‘paired’

94

occupancy), whereas the other subunit contains only one molecule of NAD+, but no

product (we defined this as the ‘unpaired’ occupancy). It is unlikely that interdimer

interaction in the crystal packing prevents the binding of HPP to both binding sites

simultaneously since the structure was obtained from co-crystallization studies. The

observation of paired and unpaired occupancy of product analogue in the dimer is

indicative that substrate binding and product release are ordered, which is consistent

with kinetic data obtained for arogenate dehydrogenase from Synechosystis sp in which

arogenate preferentially binds first (Bonner, Jensen et al. 2004). However, this finding

contrasts the random kinetic mechanism proposed from the analysis of initial velocity,

dead-end and product inhibition studies of PD and AD from a number of organisms

including E.coli and A. thaliana (Sampathkumar and Morrison 1982; Sampathkumar and

Morrison 1982; Rippert and Matringe 2002; Bonvin, Aponte et al. 2006; Legrand,

Dumas et al. 2006).

95

Figure 2- 1 A) Metabolic routes from chorismate leading to the synthesis of L-tyrosine and L-phenylalanine. In the arogenate , 4-hydroxyphenylpyruvate or phenylpyruvate route, prephenate and arogenate are branch point intermediates in both L-tyrosine and L-phenylalanine biosynthesis. The enzymes listed are: (i) chorismate mutase; (ii) prephenate dehydratase (iii) phenylpyruvate aminotransferase; (iv) prephenate aminotransferase; (v) arogenate dehydratase; (vi) arogenate dehydrogenase; (vii) prephenate dehydrogenase; (viii) 4-hydroxypheynylpyruvate aminotransferase; PLP, pyridoxal 5′-phosphate. Figure adapted from Dewick P.M. B) A comparison of the chemical structure of the three ligands, HPP, HPpropionate, and tyrosine,studied in the crystal structures of A. aeolicus prephenate dehydrogenase. These ligands all have an –OH at the C4 position of the ring. The chemical nature of the propionyl sidechain at the C1 position dictates the binding properties of these ligands to the enzyme.

96

Conformational shifting upon substrate binding

Superimposition of the four crystal structures of PD indicated that substrate

binding induces a global conformational change in the dimer. The protein is in an open

conformation with only NAD+ bound and the binding of HPP or a product analogue

brings the two monomers closer together by about 5Å (Figure 2). In addition, the binding

of the product analogue induces structural changes within the PD subunits. A

comparison of ∆19PD-NAD+-ligand structures with the ∆19PD-NAD+ structure

indicated that the overall structures of the subunits are similar to each other; however, in

all cases the same conformational changes were observed in regions that comprise the

active site.

The most notable shift occurs in the loop located between β6 and α6 (residues

149 - 156), a region, which defines the hydrophobic region, or

“the wall”, of the active site. A Cα trace of this region reveals that Gly151 shifts 2.5 - 3.4

Å away from this pocket upon substrate binding. The inclusion of HPP, HPpropionate or

L-tyrosine molecule in the active site demonstrates that this shift is necessary to avoid

steric clash between Gly151 and the side chain of the product or product analogues. In

addition, this region contains Glu153, a residue which is suggested to participate in the

gated mechanism through coordination of an ionic network with Asp247 and Arg250.

Moreover, we have proposed, based on our previous structural analyses, that Glu153

modulates binding through this ionic network by regulating substrate access to the

active site (Sun, Singh et al. 2006). Positional analysis of the Glu153 side chain reveals

that the ionic interaction with Arg250 is maintained with substrate binding, whereupon

the release of the product this interaction is lost.

97

Other secondary structures that have shifted upon ligand binding include α8, α9,

α10 and α11 (residues 214 - 266). Two functionally important residues, His217 and

Arg250, are contained within these regions. With respect to the binary subunit, the side

chain of Arg250 in the paired subunit is shifted 1.3 Å closer to the active site pocket and

closer to the side chain carboxylate of the respective ligand.

98

Figure 2- 2 Cα traces of A. aeolicus prephenate dehydrogenase showing conformational changes that occur as a result of ligand binding to the substrate binding site. NAD+ is present in all of the studied structures. The structure containing only NAD+ is used as the reference conformation to compare the ligand dependent conformational changes (PDB ID:2G5C). Tyrosine produces the largest conformational change, of approximately 5Å. Each dimer has both sites occupied by NAD+ but only one site occupied by the other ligands. Colors for each Cα�trace: NAD bound: burgundy; Tyr bound: blue. HPpropionate bound: green; HPpyruvate bound: purple

99

Location of A. aeolicus PD active site

A comparison of the structures of A.aeolicus PD with each of the three ligands,

HPP, HPpropionate, and L-tyrosine helps to identify residues involved in substrate

binding and catalysis, and in the regulation of enzyme activity by inhibitor, L-tyrosine. All

of the ligands studied have a common C4-hydroxyl group but they vary in the properties

of the side chain at the C1 position. These variations at the side chain dictate the

binding properties of the different ligands to A. aeolicus PD (Figure 2-1B). HPP, the

immediate product, acts as a linear competitive inhibitor with respect to prephenate for

the reaction catalyzed by ∆19PD (data not shown). The dissociation constant of HPP

from the enzyme-NAD+ complex of 118 ± 14μM is essentially identical to the Michaelis

constant for prephenate (Km of 135 ± 12 μM) even though HPP is aromatic rather than

a cyclohexadiene and lacks the ring carboxyl group associated with prephenate (Table

2-4). Based on the structural similarities between these two compounds, we propose

that the interactions between HPP and active site residues in PD should closely reflect

those with prephenate. Initial velocity data obtained by varying prephenate (102- 680

μM) in the presence of 2 mM NAD+ and increasing concentrations of L-tyrosine also fit

well to the equation for linear competitive inhibition (data not shown), with a Ki of 15.9 ±

1.3 μM for tyrosine.

100

Table 2-4: Summary of kinetics parameters for wild-type ∆19PD and variant

dehydrogenases at pH 7.4 and 55oC

101

Architecture of the Substrate Binding Site

The position of the active site of A.aeolicus PD is consistent with our previous

report from modeling with prephenate (Sun, Singh et al. 2006). The active site lies

adjacent to the nicotinamide moiety of NAD+ which is expected for efficient hydride

transfer from prephenate to the C4 position of the nicotinamide ring. Amino acids from

both subunits of the dimer contribute to the prephenate binding site; however, a large

portion of the binding pocket is contained within one subunit, specifically at the inter-

domain cleft. From one subunit, regions of β6, α8, α10, and the loop regions between

β5 and α5, and between β6 and α6, comprise the majority of the active site pocket,

whereas, in the other subunit, regions of the turn preceding α10′ and α10′ itself

complete the pocket. The active site can be arbitrarily divided into three regions based

on residue composition and interactions with the product analogues; a polar region

consisting of residues His147, Ser126, His214, Ser213, Phe209 and His205, a

hydrophobic region consisting of residues Ile149, Ala150, Gly151, Thr152, His217,

Phe221, Met258 and Trp259, and an ionic region consisting of residues Glu153,

Arg250, Ile251 and Asp247′ (Figure 2-3A, B, C, D). Collectively, the physiochemical

properties of these three regions in the active site reflect the interactions with the

different groups of the substrate. The C-4 hydroxyl group of the ligand is located in the

polar region, while the side chain participates in interactions with residues in the ionic

region.

102

Figure 2- 3: A schematic of the active site of A. aeolicus prephenate dehydrogenase. A) PD-NAD+ structure. The active site is characterized by a polar region consisting of residues His147, Ser126, His214, Ser213, Phe209 and His205, a hydrophobic region consisting of residues Ile149, Ala150, Gly151, Thr152, His217, Phe221, Met258 and Trp259, and an ionic region consisting of residues Glu153, Arg250, Ile251 and Asp247’. B) PD-NAD+, HPP (green)bound structure. H-bonding interactions are observed with His147, Ser126, Ser213, WAT1 and the –OH of HPP. Arg250 is making an ionic interacting with the propionyl carboxylate. The amide backbone of Gly244 is H-bonding to the keto group of the propionyl sidechain. C) PDNAD+, HPpropionate (yellow) bound structure. HPpropionate makes similar interactions as HPPexcept that the propionyl keto is absent. D) PD-NAD+, tyrosine (silver) bound structure. Tyrosine makes similar interactions at the –OH and the propionyl carboxylate as HPP except that the amino group is interacting with the carbonyl of Thr152.

A) B)

C) D)

103

Role of His147 in the Reaction Mechanism

Interactions between the C4-hydroxyl group of the different ligands (HPP,

HPpropionate, and L-tyrosine) and active site residues are conserved. The C-4 hydroxyl

hydrogen bonds with His147, a highly conserved catalytic group, which is part of a

hydrogen bonding network between, Ser126 and Ser213 and a highly conserved water

molecule (WAT 1) (Figure 2-3B, C, D and Figure 2-4A, B, C). Additionally, C4 of the

ligand is also located within 2.5Å from the N1 portion of the nicotinamide ring of NAD+.

These interactions are consistent with kinetic data from E. coli CM-PD, which implicates

His197 (corresponding to A.aeolicus His147) as a key catalytic group. As observed for

the E. coli enzyme, pH activity profiles of D19PD revealed that a deprotonated group,

most likely His147 with a pK of ~ 6.8 is required for catalysis (data not shown). Kinetic

analysis was also conducted on the A. aeolicus PD H147N mutant to confirm its role in

catalysis (Table 4). The H147N mutant is essentially inactive, but binds prephenate with

apparent affinity similar to the wild-type enzyme, as determined by its kinetic

parameters and by thermodynamic measurements of the quenching of tryptophan

fluorescence emission by prephenate (data not shown) (Table 2-4). These findings

further support the catalytic role of His147 in polarization the C4-hydroxyl group of

prephenate to facilitate hydride transfer from prephenate to NAD+.

104

Figure 2- 4: Representative electron density for NAD+, WAT1 and a bound ligand in the active site of A. aeolicus prephenate dehydrogenase. a) HPpropionate bound active site b) HPP bound active site c) tyrosine bound active site. The electron density for each ligand is unambiguous. Comparison of the active sites shows that most interactions are conserved amongst the three ligands; in contrast, their conformations are markedly different. The position of the water molecule (WAT1) is also well conserved in all three structures containing HPpropionate, HPP or tyrosine bound.

a) b) c)

105

Role of Ser126 in the Reaction Mechanism

The role of Ser126 was further investigated by mutagenesis and kinetic analyses.

Ser126 coordinates a H-bonding network with His147, the N1 atom of NAD+ and C4-

hydroxyl group, and thus may play a role directly in catalysis by bringing together these

groups in a catalytically competent conformation. In addition, this H-bonding interaction

could also contribute to the binding of the ligands studied and prephenate in the active

site. As expected, S126A yielded both a 15-fold reduction in kcat and a 10-fold increase

in the Km value for prephenate, while the binding of NAD+ remained unchanged (Table

4). This observation is consistent with the proposed role of Ser126 in coordinating the

H-bonding interaction with prephenate and A. aeolicus PD.

Role of WAT1 in the Reaction Mechanism

WAT1 is a highly conserved water molecule that participates in the H-bonding

network with the ligand. Interestingly, this water molecule is only observed in the ternary

complex of the enzyme with NAD+ and the ligands studied. Specifically, WAT1 is shown

to bridge the interaction between Ser113, Ser126 and the ligand studied. We propose

that WAT1 may serve two mechanistic roles: WAT1 may be participating solely in the

binding interaction with the ligand and/or WAT1 could also participate in modulating the

properties of His147 in the catalytic mechanism.

106

Role of Arg250 in the Reaction Mechanism

The carboxylate of the propionyl sidechain is conserved between, HPP,

HPpropionate and L-tyrosine (Figure 2-1B). Analysis of the D19PD structure in complex

with each of the three ligands revealed that this carboxylate directly interacts with the

guanidinium group of Arg250 and is positioned in proximity of this group by an ionic

network (Figures 2-2C, D, E).

In these PD-ligand structures, Arg250 is ordered with excellent electron density.

In the absence of a ligand, Arg250 is disordered judging by the lack of its representative

electron density thus suggesting that it has an important binding role. Kinetic analysis of

the R250Q mutant displayed a 10-fold increase in the Km for prephenate relative to the

wild-type enzyme without significant change in the enzyme’s affinity for NAD+ or its

turnover rate (Table 2-4). Together these findings are in agreement with Arg250 being

important for the binding of the different ligands via the side chain carboxylate group.

Role of His217 in the Reaction Mechanism

The most important differences between the C1-sidechain of the ligands are:

HPP has a keto group in addition to the conserved carboxyl; L-tyrosine possesses an

amino group; HPpropionate is lacking a group at the corresponding position. The

structure of the ∆19PD-NAD+-HPP complex shows that the keto group on this propionyl

side chain makes an important H-bonding interaction with the main chain amide of

Gly244 and is also participating in a H-bonding network which is mediated by a water

molecule (WAT2). This H-bonding network includes, Nε2 of His217, -OH of Ser254, the

keto and the carboxyl groups of HPP propionyl side chain. The Nδ1 of His217 is also H-

bonding to the mainchain carbonyl of Ser213. These H-bonding interactions by both

107

Nδ1 and Nε2 of His217 would indicate that it is in the protonated state. To further

understand the role of His217, H217A and H217N mutant were designed and kinetically

analyzed. Substitutions of His217 to either alanine or asparagine produce significant

changes in the kinetic parameters for the ∆19PD catalyzed reaction. The Km for

prephenate was increased, by 40-fold and 30-fold, for the H217A and H217N mutants

respectively, thus indicating the importance of His217 in prephenate selectivity (Table 2-

4). However these substitutions also coincided with 10-20-fold decrease in kcat thus

indicating that this interaction with the keto group of the substrate may assist in

positioning prephenate in a catalytically competent conformation. This change in kinetic

properties for both H217A and H217N mutants can also be attributed in part to

structural perturbation on the active site presumably due to disruption of the

hydrophobic stacking of H217 with the neighbouring Trp259. We observed that Ile251

and Trp259 participate in a stacking interaction with His217 and this interaction is lost

when the ligand is not present (Figure 2-3A and B). We also determined that the binding

of NAD+ has improved, the Km for NAD+ was lowered by 7-fold for both H217 variants

(Table 4). Mutation of the equivalent residue (His257), based on sequence alignment, in

E. coli CM-PD (H257A) also affected both the Km for prephenate, a 2-fold increase, and

the kcat, a 3-fold decrease, with no effect on NAD+ binding (Christendat, Saridakis et al.

1998). Tyr303 from E. coli CM-PD aligned with Trp259 from A. aeolicus PD in primary

sequence, indicating that the composition of these two active sites is not completely

conserved. Therefore, such variation in the active site residues amongst PDs from

different organisms could explain the varying levels of perturbations in kinetic properties

between the H217A and H257A mutants from A.aeolicus PD and E. coli CMPD.

108

The importance of His217 is further illustrated by the co-crystal structure of

HPpropionate with D19PD. HPpropionate lacks the side chain keto group and as such

cannot participate in the hydrogen bonding interaction with His217 and the mainchain

amide of Gly244 (Figure 2-3B). The absence of this interaction has a direct effect on the

conformation of the HPpropionate sidechain in the active site (Figure 2-5A, B).

Superimposition of HPP and HPpropionate in the active site clearly shows that the

propionyl sidechains are not superimposable; the HPpropionate sidechain is shifted by

2 Å closer to His217 (figure 2-5A, B). Kinetic constants for the interaction of HPP to E.

coli PD is ten times better than that for HPpropionate, 0.18 mM versus 1.8 mM 26.

These findings are in agreement with our hypothesis that His217 is functioning as a

determent for the selective binding of ligands to PD active site. Ligands lacking the keto

group can still bind but with lower affinity because of increased dynamics of their

sidechain, due to the loss of H-bonding interactions with the Gly244 amide backbone

and the H-bonding network with His217. The structure of D19PD in complex with

tyrosine revealed a different set of H-bonding interactions with the amino group of

tyrosine compared to those with the keto group of HPP. In this complex, the amino

group of L-tyrosine is pointing in the opposite direction compared to that of the

corresponding keto group of HPP. As a result, the amino group of L-tyrosine is directed

away from His217 and from the Gly244 amide backbone by approximately 180��and

instead is interacting with the main chain carbonyl group of Thr152 (Figure 2-3B, D and

2-5B). Superimposition of the ligands in the active site of PD revealed that the side

chain of L-tyrosine has been shifted away from His217 by 3.2 Å, compared to the

propionyl sidechain of HPP and the resulting distance between the amino group of the

alanyl side chain and His217 is 4.1 Å.

109

A) B)

C) D)

110

Figure 2- 5: Superimposition of ligands in the active site of PD. A) Superimposition of HPP (green) and HPpropionate (yellow) indicates the twist in HPpropionate. B) Superimposition of HPP (green), HPpropionate (yellow) and tyrosine (teal) illustrates the substrate specific interactions. The keto group of HPP mediates an interaction with His217. The amino group of Tyr is shifted away by His217 and the interaction with Thr152 stabilizes the interaction at the active site. C,D,E) The PDH active site with a bound HPP molecule. All functionally important active site residues identified in PDH are conserved in ADH (these residues are labeled in black). Moreover, these residues are in spatially equivalent positions; therefore, it is possible that AGN interacts with ADH in the same way that HPP does with PDH. However, a major difference between the two active sites is the presence/absence of His217 and of bulky groups adjacent to the substrate binding site. The absence of these bulky groups in the ADH active site results in a large pocket. Since His217 is playing a role in determining substrate preference, this region may be important for substrate discrimination.

E)

111

His217 as a determinant of ligand preference

Superimposition of the three ligands in the A. aeolicus PD active site revealed

that the propionyl side chains adopt a different conformation depending on the ability to

hydrogen bond with the Gly244 amide and the ability to participate in the H-bonding

network with His217, Ser254 and WAT2. This observation in conjunction with the kinetic

studies of the His217 mutants led us to hypothesize that His217 functions as a

determinant for the selective binding of different ligands to the enzyme. The ionization

state of His217 may dictate the nature of ligands that can bind to the active site of PD.

Based on the H-bonding interactions at both Nδ1 and Nε2 discussed above for His217,

we proposed that the side chain of this histidine is in the protonated state. This

hypothesis is consistent with our observation for the HPP-bound and L-tyrosine bound

structures, in which the keto group of HPP is interacting with the Nδ2 of His217 and the

amino group of L-tyrosine is pointing away from the histidine and instead is interacting

with the main chain carbonyl of Thr152. This charge state of His217 would produce a

repulsive effect which directs the interaction between the main chain carbonyl of Thr152

and the amino group of the bound tyrosine.

Tyrosine inhibition studies were conducted to evaluate the role of His217 and

other residues in the binding of L-tyrosine to PD. L-tyrosine was shown to have an

inhibitory effect on both wild-type enzyme and on S126A, but had a reduced inhibitory

effect on the activity of R250Q (Figure 2-6). R250Q activity is inhibited by L-tyrosine

less effectively than the WT enzyme since the interaction is absent between the

carboxylate of the bound tyrosine and Arg250. The most interesting finding though is

the inhibitory effect of L-tyrosine was completely lost by mutating His217 to either an

alanine or an asparagine (Figure 2-6). The inability for tyrosine to inhibit the H217A/N

112

mutants strongly supports our hypothesis that His217 serves as a determinant of

substrate selectivity. We envision that removing His217 eliminates the repulsive effect,

which is responsible for directing the interaction between the amino group of tyrosine

and the carbonyl of Thr152 therefore this important interaction is lost.

Structural comparisons of AD and PD

The availability of an AD structure permits structural comparisons between L-

arogenate- specific and prephenate-specific TyrA dehydrogenases for better

understanding of the molecular mechanism responsible for substrate binding in the TyrA

family of proteins. To this end, we superimposed the structure of ternary complex

∆19PD-NAD+-HPP, ∆19PD-NAD+- HPpropionate and ∆19PD-NAD+-tyrosine structures

with Synechocystis sp. AD (PDB ID: 21FK)28 (Figure 2-5D, E).

The monomers superposed over 272 equivalent Cα atoms and have an r.m.s.d

value of 2.4 Å. The overall structures, PD and AD are quite similar, as their secondary

structures have been maintained. Regions exhibiting significant deviations include

portions of the loop between β6 and α6, and helices α8, α9, α10 and α11, α12 (Figure

2-5C, D, E). Overall, the active site of AD is more open and accessible, relative to that

of binary ∆19PD-NAD+ complex. This is due to the fact that α10 and the β6-α6 loop

region, which comprise the base and wall of the pocket, respectively, are shifted ~3.1-

6.5 Å away from the active site. Analysis of the PD and AD active sites reveals that

functionally important residues are conserved (Figure 2-5C, D, E). For example, the

catalytic histidine, His 247 in PD, and the important binding arginine, Arg250 in PD, are

equivalently positioned in both structures. Moreover, the serine residues that are shown

to bind to the C4-hydroxyl group of prephenate are also spatially conserved. Other

113

common active site residues include Gly151, Thr152, His205, Ser213, and His214

(numbering corresponds to the D19PD from A. aeolicus). The conservation of

functionally important residues indicates that L-arogenate may bind to the AD active site

in a similar fashion to that of prephenate in PD. Superimposing the HPP molecule from

the ∆19PD-NAD+-HPP structure into the AD active site supports this hypothesis. Based

on the latter study, we infer that it is indeed possible for L-arogenate to interact with

Ser92, His112 and Arg217, which correspond to Ser126, His147 and Arg250 in D19PD.

Our proposed interaction with Arg217 contradicts Legrand et al. (2006) (Legrand,

Dumas et al. 2006) who have suggested that this arginine is too far from the active site

pocket to play a role in substrate binding.

Despite these similarities in the active site, there are notable differences. Most

notably, there is a large pocket adjacent to the superposed HPP molecule in the AD

active site (Figure 2-5D, E). This pocket results from the absence of bulky Trp and His

residues (Trp259 and His217 in PD) in the AD structure. These missing residues could

provide the required binding interactions for prephenate.

Biological and Biochemical Relevance

This study describes the functional role of active site residues of proteins in the

Tyra family. Mainly, residues that are involved in ligand selectivity, binding and in

catalysis. Comparative structural analysis with existing structures in the PDB revealed

that the catalytic histidine residue is conserved amongst proteins in the TyrA family. The

arginine residue that is involved in binding the different ligands through the side chain

carboxylate is also conserved. The most significant finding however is a single residue,

His217, which we propose dictates the selective binding of different ligands to the PD

114

active site. Notably, the presence of His217 allows L-tyrosine to function as a

competitive inhibitor with respect to prephenate. Substitution of the histidine residue at

position 217 completely eliminated the inhibitory effect of L-tyrosine on A. aeolicus PD

activity. This novel finding has direct implications on future metabolic engineering of

downstream pathways in plants. It is likely that tyrosine could function as a feedback

regulator by inhibiting PD at elevated intracellular concentrations. The mutation of the

equivalent His217 could produce a constitutively active PD which will result in the

unregulated production of HPP and subsequently tyrosine. Tyrosine, aside from being

an essential component in proteins, is known to be an essential precursor of the

biosynthesis of benzylisoquinoline alkaloids (BA). BA is diversified towards the

production of more than 2500 secondary metabolites, and in addition BA itself is used

as a precursor for the synthesis of pharmaceuticals, including morphine and codeine

(Liscombe and Facchini 2008).

115

PUBLICATION NOTICE: THIS WORK HAS BEEN PUBLISHED IN THE JOURNAL OF MOLECULAR BIOLOGY UNDER THE FOLLOWING CITATION:

Structural insight on the mechanism of regulation

of the MarR family of proteins High resolution crystal structure of a transcriptional repressor

from Methanobacterium thermoautotrophicum

Vivian Saridakis1, Dea Shahinas2, Xiaohui Xu3 and Dinesh Christendat2* 1Department of Biology, York University, 4700 Keele Street, Toronto, Ontario, M3J 1P3, 2Department of Cell and Systems Biology, University of Toronto, 25 Willcocks Street, Toronto, Ontario, Canada, M5S 3B2, 3Clinical Genomics Center, University Health Network, 101 College Street, Toronto, Ontario, Canada, M5G 1L7 Running Title: Crystal Structure of MTH313 The MTH313 structure was solved by Dr.Vivian Saridakis and Dr.Dinesh Christendat. Refinement was done by Dea Shahinas and Dr.Vivian Saridakis. The structural comparison, the electrophoretic mobility shift assay and the biophysical analyses using the thermal denaturation assay were done by Dea Shahinas. She wrote the corresponding sections of the paper for these results. The manuscript was written by Dr. Dinesh Christendat and Dea Shahinas was involved in editing it. She was also involved in the figure preparation and submission of the manuscript.

116

CHAPTER III: Structural insight on the mechanism of regulation of the MarR family of proteins Abstract Transcriptional regulators belonging to the MarR family are characterized by a

winged-helix DNA binding domain. These transcriptional regulators regulate the efflux

and influx of phenolic agents in bacteria and archaea. In E.coli, MarR regulates the

multiple antibiotic resistance (mar) operon and its inactivation produces a multiple

antibiotic resistance phenotype. In some organisms, active efflux of drug compounds

will produce a drug resistance phenotype whereas in other organisms active influx of

chlorinated hydrocarbons results in their rapid degradation. Although proteins in the

MarR family are regulators of important biological processes, their mechanism of action

is not well understood and structural information about how phenolic agents regulate the

activity of these proteins is lacking. This paper presents the three dimensional structure

of a protein of the MarR family, MTH313, in its apo form and in complex with salicylate,

a known inactivator. A comparison of these two structures indicates that the mechanism

of regulation involves a large conformational change in the DNA binding lobe.

Electrophoretic mobility shift assay and biophysical analyses further suggest that

salicylate inactivates MTH313 and prevents it from binding to its promoter region.

117

Introduction Microbial antibiotic resistance is a result of either inactivation or reduced

accumulation of antibiotics within an organism. The biological route by which an

organism accomplishes this feat can stem from one or more mechanisms, most of

which are not well understood. One such mechanism is multiple antibiotic resistance

(MAR) in which microbes reduce their intracellular concentration of antibiotics by

upregulating the expression of drug efflux pumps, which actively remove these

compounds from the cell (George and Levy 1983; Sanders, Sanders et al. 1984;

Gutmann, Williamson et al. 1985; Then and Angehrn 1986) .

In bacteria, both transcriptional activators and repressors regulate the expression

of MAR pumps. The known transcriptional activators of the genes for MAR pumps

belong to the MerR, AraC or LysR families; the known repressors of the multiple drug

resistant (MDR) pumps include the TetR, MarR or LacI families (Ahmed, Borsch et al.

1994; Martin and Rosner 1995; Baranova, Danchin et al. 1999; Kohler, Epp et al. 1999;

Zheleznova, Markham et al. 1999; Alekshun, Kim et al. 2000; Schumacher and Brennan

2002; Grkovic, Hardie et al. 2003). The E.coli MAR system is biologically well

characterized. It consists of a repressor protein MarR which plays a key role in

regulating the multiple antibiotic resistance (mar) regulon (Cohen, Hachler et al. 1993;

Martin, Nyantakyi et al. 1995; Alekshun, Kim et al. 2000). This regulon consists of the

marRAB operon and is responsible for the mar phenotype, which is manifested as

resistance to a variety of structurally diverse compounds including medically relevant

antibiotics (Cohen, Hachler et al. 1993; Martin and Rosner 1995). In E. coli, antibiotic

resistance has been shown to arise from mutations in the MarR gene (Maneewannakul

118

and Levy 1996; Alekshun, Kim et al. 2000; Notka, Linde et al. 2002; Yaron, White et al.

2003; Martin and Rosner 2004).

Proteins in the MarR family are transcriptional regulators for diverse sets of

biological processes. Some of these proteins, MarR in E. coli, MexR in P. aeruginosa

and EmrR in E. coli, are involved in the control of multiple antibiotic resistance operons.

Others regulate tissue-specific activities, such as adhesive properties of cells, hemolytic

properties and the regulation of protease expression (Perego and Hoch 1988;

Lomovskaya and Lewis 1992; Marklund, Tennent et al. 1992; Cohen, Hachler et al.

1993; Ludwig, Tengel et al. 1995; Poole, Tetro et al. 1996). A number of proteins within

the MarR family interact with phenolics including salicylate which have been shown to

modulate their repressor properties (Cohen, Hachler et al. 1993; Ariza, Cohen et al.

1994; Martin and Rosner 1995; Seoane and Levy 1995).

The crystal structures of proteins in the MarR family have been determined from

a number of organisms including, MarR from E. coli, SlyA from E. faecalis and MexR

from P. aeruginosa (Alekshun, Levy et al. 2001; Lim, Poole et al. 2002; Wu, Zhang et

al. 2003). These proteins are all homodimers with each monomer consisting of two

highly conserved domains; a predominantly helical dimerization domain and a helix-

turn-helix plus a characteristic winged-helix DNA binding domain. Although the helix-

turn-helix and winged-helix motifs were identified, their mechanisms of inactivation,

which prevents their binding to DNA, are still unclear. E.coli MarR was crystallized with

two molecules of salicylate per monomer, both of which are highly solvent exposed

(Alekshun, Levy et al. 2001). The physiological relevance of either salicylate binding

site could not be ascertained because salicylate was involved in interactions with

protein molecules within the crystal, which may have stabilized the crystal lattice

119

(Schumacher, Miller et al. 2001). In the absence of salicylate, crystals of the apo

protein were not suitable for structure determination (Alekshun, Levy et al. 2001).

Although the crystal structure of proteins within the MarR family has been determined,

the mechanism of their regulation by drug compounds is still elusive.

Given the importance of MarR repressor protein and its family in antibiotic

resistance and other important biological processes, an understanding of the

mechanism of their regulation by their cognate ligand(s) is urgently needed. The crystal

structure of any member protein in the MarR family in complex with effector molecule

such as salicylate serves as a useful source for mechanistic information. It provides

insight into the location and amino acid composition of its ligand binding site and

conformational changes that occur upon effector binding which may affect binding of the

protein to its template DNA. In this study, we have determined the crystal structure of a

MarR homologue from Methanobacterium thermoautotrophicum, MTH313, in the apo

form and in complex with salicylate, a modulator of protein activity in this family.

Comparison of the two structures revealed a large and asymmetrical conformational

change that is mediated by the binding of sodium salicylate to two distinct locations in

the dimer. We suggest that the conformational change resulting from salicylate binding

is a mechanism to modulate the DNA binding activity of proteins in this family. This is

the first structural study which demonstrates distinct conformational changes upon

ligand binding to a protein within the MarR family and suggests that this mechanism

may be similar for other proteins within the MarR family of proteins.

120

Results and Discussion Crystallization and Structure Determination

The protein MTH313 produces orthorhombic shaped crystals that appear within

48 hours and grow to approximately 150 μm in the shortest direction. Diffraction studies

indicated that MTH313 crystallized with a single molecule in the asymmetric unit and

belonged to the space group C2221. MTH313 was also crystallized with sodium

salicylate as a ligand, since salicylate is a known effector of E.coli MarR and was

previously shown to inhibit the E.coli MarR from binding to its operator DNA (Martin and

Rosner 1995). The MTH313-salicylate crystals are long rod shaped compared to

orthorhombic shaped observed for the apo protein crystals. In addition, the protein now

crystallized as a dimer in the asymmetric unit of space group P212121. The molecular

weight of each monomer of MTH313 was calculated from its primary amino acid

sequence to be 17.6 kDa. Gel filtration analysis of MTH313 with salicylate revealed that

binding of this compound to the protein did not affect its oligomeric state; the protein

was predominantly dimeric, at a molecular weight of approximately 35 kDa, even at 50

mM salicylate, which is 100 fold higher than the determined binding constants for E. coli

MarR (Martin and Rosner 1995).

Overall Structure of MTH313

Although MTH313 crystallized as a single molecule in the asymmetric unit, the

arrangement of the terminal helical elements which involves a large number of

intersubunit interactions, indicated that the protein is dimeric (Figure 1A). Indeed this is

further supported by gel filtration analysis which shows that MTH313 is dimeric in

solution. The arrangement of secondary structure elements in the monomer is α1-α2-

121

α3-α4-β1-β2-α5-α6 (Figure 3-1A). Helices α1 and α2 are oriented perpendicular to

each other. α3 and α4 form the typical helix-turn-helix motifs and are oriented

approximately 120° to each other. β1 and β2 form a β-hairpin, which constitutes the

typical winged motif.

The dimer adopts a triangular topology in which the helical N- and C-terminus

helices are involved in subunit interactions and the two internal winged-helix motifs are

separated by approximately 14 Å (Figure 3-1A). The resulting interactions produce an

exclusively helical dimerization domain, which is formed by α1, α5 and α6 from each

monomer. The structure of the dimerization region reveals domain swapping, where α1

of one subunit is inserted between α5’ and α6’ of the other subunit and forms a coiled-

coiled with helix α6’.

The winged-helix (WH) motifs are located at the base of this triangle architecture

and their separation produces a large void with virtually no interactions from the

adjacent domains (Figure 3-1A). This DNA binding WH motif architecture is similar to

other WH motifs described for MarR family transcription factors (Alekshun, Levy et al.

2001; Lim, Poole et al. 2002; Schumacher and Brennan 2002; Wu, Zhang et al. 2003).

The two MTH313 WH motifs in the dimer are completely separated, by about 14 Å, with

no intersubunit interactions. Interestingly, such separation is also observed for other

protein members in the MarR family (Alekshun, Levy et al. 2001; Lim, Poole et al. 2002;

Schumacher and Brennan 2002; Wu, Zhang et al. 2003). A quick glance of the

representative structures of this family in the PDB indicated that that WH motifs are

separated by at least 6.3 Å to 22 Å (Alekshun, Levy et al. 2001; Wu, Zhang et al. 2003;

122

Hong, Fuangthong et al. 2005; Miyazono, Tsujimura et al. 2007). The organization of

the WH motifs in the dimer results in electropositive residues pointing away from the

base of the structure, which could provide a platform for interaction with DNA. The

organization of the electropositive residues is indeed important for DNA interactions as

shown from modeling studies with MexR and also with the crystal structure of OhrR

protein in complex with DNA from B. subtilis (Lim, Poole et al. 2002; Hong, Fuangthong

et al. 2005).

123

Figure 3- 1: A) A ribbon diagram of the apo protein MTH313 dimer. The protein is composed of two distinct domains, a helical dimerization domain and a winged-helix DNA binding domain. The two DNA binding domains within the dimer are separated by approximately 14 Å. B) A ribbon diagram of protein MTH313 in complex with salicylate. Salicylate binds to two distinct locations in the dimer. The binding of salicylate imparts a conformational change resulting in the winged-helix lobes being 21 Å away from each other. C) Superimposition of the apo and the salicylate complexed structure of MTH313 revealed a large conformational change at the winged-helix domain. D) Superimposition of E.coli MarR-salicylate bound structure with the MTH313-salicylate bound structure. In the E.coli MarR four salicylate molecules bind to the DNA binding domains in the dimer whereas salicylate binds at the junction of the helical dimerization and the winged-helix DNA binding domain in MTH313.

A) B)

C) D)

124

Sequence analysis

Amino acid sequence analysis of MTH313 with PSI-Blast (5 iterations) on the

non-redundant protein database identified a large number of proteins most of which are

annotated as transcriptional regulators belonging to the MarR family of regulators.

Sequence alignment was conducted with the top 10 organisms that showed pairwise

amino acid sequence identity better than 28 %. Interestingly, only four residues, Arg 16,

Gly 47, Gly 75 and Gln 50, were identified as being conserved amongst the identified

proteins from these organisms. This observation demonstrates clearly the high

sequence divergence amongst proteins in the MarR family. Among this list of sequence

homologues are two SlyA transcriptional regulators, one from E. coli and the other from

E. faecalis. It is interesting to note that only a small proportion of the proteins identified

from sequence analysis above are transcriptional regulators from Archaea, which

suggests that the function of MTH313 is not Archaea-specific.

Structure Analysis with DALI

The high-resolution 1.4 Å crystal structure of MTH313 was searched against the

Protein Databank (PDB) using the DALI program to identify structural neighbors (Holm

and Sander 1993). Exclusively DNA binding proteins were identified from this analysis

with the SlyA transcriptional regulator from E. faecalis (PDB ID: 1lJ9) being the closest

structural match with a Z score of 17.4 followed by a Z-score of 16.4 for EmrR from S.

tokodaii (PDB ID: 2GXG) and a Z-score of 15.3 for OhrR from B. subtilis (PDB ID:

1Z91), then MarR protein from E. coli (PDB ID: 1JGS) with a Z-score of 14.8. The Z

score is a measure of structural similarity with increasing value indicating higher level of

structural conservation. The three dimensional structure of MTH313 superposed with

125

the SlyA, EmrR. OhrR and MarR structures with RMSD values of 2.6 Å, 2.4 Å, 2.2 Å

and 2.6 Å respectively between the structurally equivalent Cα positions. The crystal

structure of a number of other transcriptional regulators in the MarR family are present

in the PDB including MexR from P. aeruginosa and SarS from S. aureus (Liu, Manna et

al. 2001; Lim, Poole et al. 2002). Although the overall three dimensional structure

among the proteins in the marR family is very similar, they share very little conservation

as shown from the structure based sequence alignment (Figure 2A).

A

126

Figure 3- 2: Comparison of the top DALI structural homologues at the helix turn helix motif reveals conservation of the ligand binding pocket in three-dimensional space. A) Structure based alignment of the top DALI structural homologues. B) The identified salicylate binding site of Methanobacterium thermoautotrophicum consists mainly of basic and hydrophobic residues. C) Enterobacter faecalis SlyA (PDB ID: 1LJ9) is the closest structural homologue to MTH313. The binding site contains similar composition of hydrophobic and basic residues. D) In Bacillus subtilis OhrR (PDB ID: 1Z91), the redox Cysteine, residue 15 is identified in the binding pocket (substituted to Serine 15 in the coordinate file). E) The identified binding site in Escherichia coli MarR (1JGS). F) The identified binding site for EmrR from Sulfolobus tokodaii, (2GXG) The identified binding site contains a high proportion of polar and charged reisdues.

127

Crystal structure of MTH313 complexed with salicylate

The MTH313-salicylate complexed structure was determined to 2.2 Å resolution.

The protein crystallized as a dimer in the asymmetric unit with one molecule of

salicylate bound to each monomer (Figure 3-1B). The salicylate binding site in each

monomer is located at the interface between the DNA binding and the helical

dimerization domain (Figure 3-1B). The electrostatic surface analysis of this complex

revealed that a large portion of the hinge region between the DNA binding and the

dimerization domain form the salicylate binding pocket (Figure 3-3A and B). In addition,

the electrostatic surface potential revealed a high concentration of basic residues in this

region of the protein (Figure 3-3A and B). We speculate that this protein has the

potential to bind a diverse set of compounds due to the size and the high composition of

basic amino acids in this pocket. This is further exemplified by salicylate binding to the

dimer at two distinct locations, which we refer to as first and second binding site, within

this binding pocket (Figure 3-1B, 3-3A and 3-3B).

The binding of salicylate produced distinct conformational changes in the DNA

binding motif of each monomer, discussed below. One molecule of salicylate was

located deep in the binding-pocket directly at the junction of the dimerization and the

DNA binding domains, which we refer to as the “first binding site” (Figure 3B and C).

This site is formed at the dimer interface by helix α1’ of molecule B and helices α3 and

α7 of molecule A. This binding site is composed of a high proportion of hydrophobic

groups; including Ile B5, Ile B13, Gly B9, Pro B6, Val A36, Leu A40, Ala A37, Phe A56,

Phe A57 and a small number of charged or polar groups; Arg B16, Arg A41 and Arg

A44 and Asp A33 and Ser B12 (Figure 3-3C). The guanidinium group of Arg B16 is

128

just 2.9 Å away and the primary amino group of Lys B8 is 2.6 Å away from the

carboxylate of salicylate, thus indicating that both groups may be involved in ionic

interactions or hydrogen bonding with salicylate (Figure 3-3C). Interestingly, Arg 16 is

conserved in three dimensional space amongst the different structures have analyzed

(Figure 3-2 B, C, D, E and F). The guanidiniums of Arg A41 and Arg A44 are at a

distance of 9 Å and 8 Å respectively, and are pointing away from the salicylate (Figure

3-3C). It is mainly the alkyl portion of the Arg side-chains that is contributing to the

hydrophobicity of the binding site.

129

Figure 3- 3: A) Electrostatic surface representation of MTH313 in the apo and in complex with salicylate. The arrow is pointing at the biologically relevant binding site. The identified binding pocket consists of a high proportion of basic residues which may indicate its potential to bind different drug molecules. B) Electrostatic representation of the two salicylate binding sites in the dimer. C) A representation of some of the binding site residues relative to the bound salicylate in the binding pocket. In the first binding site salicylate made distinct interactions with both Arg 16 and Lys 8. The electron density for the bound salicylates was obtained from a 2Fo-Fc composite omit map.

A)

B)

C)

130

Analysis of the symmetry related salicylate binding pocket indicated that

salicylate binds to a different position in the pocket. A salicylate molecule was identified

adjacent (approximately 5 Å away) to the symmetry related salicylate binding site, which

we refer to as the “second binding site” (Figure 3-3C). The amino acid composition of

this second salicylate binding site includes, Arg A16, Lys A8, Arg A19, Ser A12, Leu

A15, Leu B15, Ala B34 and B37, Cys B38, Phe B57, Val B59, Thr B63, B67, and Ile B64

(Figure 3-3C). This “second binding site” is formed by an even distribution of polar,

charged and hydrophobic residues instead of a high proportion of hydrophobic groups

seen for the first binding site. The carboxylate of this second salicylate is not well

resolved hence making it difficult to determine its ionic interactions. Nevertheless, the

location of this salicylate was determined by well-resolved electron density at 1σ.

Superimposition of this subunit with the other monomer in the dimer and with the native

monomer revealed that the binding of salicylate to this second site does not impart a

large conformational change. This would indicate that the binding of salicylate to the

first binding site is sufficient to modulate the activity of this transcriptional regulator. As

such we propose that the first binding site is the biologically relevant site. This

observation is further supported by our binding studies in which MTH313 exhibits

negativity cooperativity for salicylate binding (Figure 4A). Indeed, other members in this

transcriptional regulator family also show negative cooperativity for their respective

ligand (Wilkinson and Grove 2006). Therefore, the binding of salicylate to one site

prevents the binding of salicylate binding to the second symmetric site in the dimer.

This mechanism of ligand binding enhances the sensitivity for salicylate by the protein

(Wilkinson and Grove 2006).

131

The binding of salicylate produces an asymmetric structural change, which

suggests a novel mode of regulation for proteins in the MarR transcriptional regulator

family. This asymmetric structural change imparts an additional level of complexity in

the mechanism of regulation, in which the DNA binding lobe is not just pushed apart,

but is now twisted out of plane by 5Å, causing the interaction with the target DNA

sequence to be highly unlikely (Figure 3-1B and C). It is also likely that since this

protein is natively expressed in a thermostable organism, it may be conformationally

restricted at room temperature thus producing this unusual observation. We addressed

this question by increasing the concentration of salicylate to 50 mM and heating the

protein sample to 80°C prior to setting up crystallization trials. Interestingly, we still

observed the asymmetric binding of ligand, but never identified a structure with

salicylate bound in a symmetrical manner.

Since proteins within the MarR family share a conserved structural motif, we

analyzed some of the representative structures in the protein database to determine if

the biologically relevant salicylate binding pocket is also conserved. Indeed,

superposition of representative structures with that of MTH313 identified an analogous

ligand binding pocket in the crystal structures of SlyA, OhrR, MarR and EmrR from E.

faecalis, B. subtilis, E. coli and S.tokodaii, respectively (Alekshun, Levy et al. 2001; Lim,

Poole et al. 2002; Wu, Zhang et al. 2003; Hong, Fuangthong et al. 2005; Miyazono,

Tsujimura et al. 2007)(Figure 2 B, C, D, E and F). This effector binding site was not

previously identified in these structures and interestingly, although E. coli MarR was

crystallized with salicylate this binding site was not identified (Alekshun, Levy et al.

2001). The identified binding pocket of E. faecalis SlyA is composed of mainly polar

groups. These include Arg 38, Asn 20, Lys 55, Thr 60, Ile 50 and Ile 54 from one

132

subunit and Arg 13 from the second subunit (Figure 3-2C) (28). The identified ligand

binding site in OhrR consists of Tyr 19, Tyr 40, Tyr 65, Glu 11, Arg 23, Lys 9, Leu 44,

and Cys 15 (Figure 2D). The tyrosines and cysteine 15 are functionally important for

the regulation of OhrR. Cys 15 is highly reactive and its oxidative state is correlated

with its ability to bind DNA. (Hong, Fuangthong et al. 2005). The identified salicylate

binding pocket in E. coli MarR is formed at the dimer interface (Figure 2E). It consists of

mainly polar residues including Lys 25 and Lys 44, Cys 47, Cys 51 and Cys 108, His

112, from one subunit and Arg 16 and His 19 from the second subunit (Alekshun, Levy

et al. 2001).

This analysis showed that the position of the ligand binding pocket is conserved

in three dimensional space amongst the different MarR family members. However,

there is significant variation in the amino acid composition for this binding site amongst

the different proteins, which may indicate their capacity to accept different ligands. The

biological relevance of this identified binding site is substantiated from the

superimposition analysis with the structure of the OhrR protein from B. subtilis which

revealed that its reactive cysteine is indeed located in this conserved ligand binding site

(Hong, Fuangthong et al. 2005). These observations taken together indicate that this

family of transcriptional regulators could accept different ligands or effector molecules in

the common pocket, but they have a common mechanism of regulation.

Biophysical analysis of salicylate binding to MTH313

Thermal denaturation study was conducted to determine the binding affinity of

salicylate to MTH313 since salicylate was shown to bind to a specific pocket on the

protein. The presence of salicylate was shown to stabilize MTH313 which is evident by

133

an increase in the temperature at which the protein unfolds. Consistently the unfolding

temperature of MTH313 increases nonlinearly with increasing concentration of salicylate

(Figure 3-4A). The titration profile obtained is saturable, thus indicating that salicylate is

binding specifically to the identified site on MTH313. A Hill plot for this dataset produces

a Hill coefficient of 0.69 which indicated that the binding of salicylate to MTH313

induces negative cooperativity (Figure 3-4A, inset). Also 40mM of salicylate was the

maximum concentration used in the cocrystallization study. This is only 16 times the

binding constant for salicylate to MTH313 and is within the working ratio of ligand to

protein normally used for other co-crystallization studies.

Salicylate disrupts MTH313 binding to DNA

The A-box for MTH313 was identified by searching in the promoter region, 500bp

upstream of the ATG translation start site, for the consensus A-box TTTAWA motif

(Kaine, Mehr et al. 1994; Langer, Hain et al. 1995). The A-box sequence, TTTATA,

was identified 22 nucleotides upstream from the translational start site for MTH313.

The A-box motif has been shown to be important for transcriptional efficiency in archaea

(Hain, Reiter et al. 1992). In addition, these transcriptional regulators are dimers and

are thought to bind to palindromic DNA sequences. In Archaea one of the palindromic

sites overlaps with the A-box motif (Hain, Reiter et al. 1992; Cohen-Kupiec, Blank et al.

1997). The second palindromic site for MTH313 was identified as TTGCAA and

resides 10 nucleotides upstream from first palindromic site TATATA, which overlaps the

A-box motif. As such, the DNA probe was prepared in this region upstream of the gene

and includes this A-box motif. Gel shift analysis with these DNA probes indicated that

MTH313 binds specifically to this region on the DNA. This observation suggests that

the A-box and nucleotide sequences downstream of it are important for MTH313

134

binding. Subsequent binding assays were conducted with a fixed amount of the probe

and varying amounts of MTH313 to demonstrate the specificity of the probe to the

protein. The intensity increased in the high molecular weight region of the gel indicating

that MTH313 is binding specifically to the probe (Figure 3-4B). The crystallization

studies revealed that salicylate binds to MTH313. Therefore, DNA binding studies were

conducted with salicylate to determine its role on the biochemical function of MTH313.

The presence of salicylate resulted in the release of the DNA probe from MTH313

(Figure 3-4B). The ability of salicylate to disrupt the interaction of probe DNA with

MTH313 suggests that salicylate is an inactivator of MTH313. This finding is consistent

with the observation that salicylate inactivates E.coli MarR (Martin, Nyantakyi et al.

1995; Martin and Rosner 1995). The biological significance of salicylate in modulating

the affinity of MTH313 for its target DNA will be the focus of future investigation.

135

Figure 3- 4A: The stabilizing effect of salicylate on the thermal denaturation of MTH313. The increased in Tm, midpoint in the denaturation curve, with increasing concentration of salicylate demonstrates the stabilizing effect of salicylate on the protein. This stabilizing effect of salicylate is analogous to a saturation kinetic profile, thus indicating that salicylate binds specifically and stabilizes MTH313. The inset is a Hill plot to determine the binding mechanism of salicylate to the protein. The slope (n) of this plot is equal to 0.69, which suggests that the binding of salicylate to MTH313 induces negative cooperativity. Tm is the melting temperature or midpoint in the denaturation curve. Tmf is the melting temperature at highest substrate concentration.

136

Figure 3-4B: Gel shift assay to determine the DNA binding properties of MTH313.

showing that MTH313 binds specifically to the promoter region including the A-box. The DNA binding is alleviated in the presence of salicylate. Lanes 1, 2, 3 and 11 are experimental controls. Lanes 4-6 show the DNA binding affinity of MTH313 with increasing concentrations. Lanes 7-10 show the effect of increasing the concentration of salicylate on the release of the bound DNA from MTH313. 100 μM MTH313 was used in lanes 7-10, which is similar to the amount of protein used in lane 5. Specifically, the content of each lane on the gel is: M: 1 kb DNA molecular weight markers ; 1: Non-specific DNA; 2: Non-specific DNA with MTH313; 3: Free probe; 4: Probe with 50 μM MTH313; 5: Probe with 100 μM MTH313 6: Probe with 150 μM MTH313; 7: 5 mM salicylate; 8: 10 mM salicylate; 9: 15 mM salicylate; 10: 20 mM salicylate; 11: Probe with non-specific protein.

137

Mechanism of inactivation of MTH313

The binding of salicylate to MTH313 imparts a large conformational change

exclusively in the DNA binding domain as shown by superimposition of the apo and the

ligand-bound form (Figure 3-3A). Since salicylate binds to two non-equivalent positions

on the dimer, the conformational change on each monomer is also non-equivalent.

Superimposition of these two molecules onto apo MTH313 indicated that a larger

conformational change is exerted on molecule B and is localized in the winged-helix

domain (Figure 3-3A). The largest deviation between molecule A and the apo protein

was observed between residues 37 and 100, with an average RMSD of 2 Å. In

contrast, the rmsd between molecule B and the apo protein is much greater than 2 Å in

this region. The binding of salicylate to the “first binding site” causes residues in this

site to move inwards by 4 Å towards the salicylate molecule. This movement is

localized at the hinge region of the dimerization and the WH domains and may be

responsible for the large structural change observed between the WH domains in the

dimer. In the apo protein, the DNA binding lobes are only 14 Å apart, however, the

binding of salicylate produces a dramatic conformational change in which these two

lobes move about 21 Å apart (Figure 3-1A, B and C). Once we consider the DNA

binding study described here for MTH313, and the study by Martin et al. (Martin and

Rosner 1995), which indicated that salicylate inactivates E.coli marR and our structural

data discussed above, we can conclude that the open conformation of MTH313 induced

by salicylate binding is the inactive form of the protein. Consequently, this observation

indicates that the closed form of the protein (Figure 3-1A) is active and capable of

binding to its operator region on the DNA. The inactive protein is therefore the open

138

conformation, separated by a large spacing (21 Å) between the two WH domains

(Figure 3-1B).

Comparison of apo MTH313 with E. coli MarR revealed that both structures are

in the closed conformation (Figure 3-1D). In E. coli MarR, the DNA binding lobes are

separated by just 8 Å which is similar to that observed for the apo MTH313 structure.

We expect this to be the active conformation, which binds to the operator region and

represses the MAR phenotype. It is interesting that E. coli MarR also crystallized with

salicylate, but the structure of this protein-ligand complex is in the active, closed

conformation. In addition, the amount of salicylate required for a stable crystal was

about 500 times higher than its binding constant of 0.5 mM as determined by

equilibrium dialysis (Martin and Rosner 1995). Two molecules of salicylate were

identified in each E.coli MarR monomer, however the binding sites were highly solvent

exposed. These salicylates may have been important in stabilizing crystal contacts and

thus promoted a well ordered protein crystal (Schumacher, Miller et al. 2001).

Therefore, it is likely that the crystal structure of E.coli MarR in complex with salicylate is

in the active and not the inactive conformation as previously reported (Alekshun, Levy et

al. 2001).

The MexR protein crystallized as an octamer in the crystallographic asymmetric

unit in which each monomer was shown to be in a different conformation (Lim, Poole et

al. 2002). This observation is largely due to the inherent flexibility between the DNA

binding and the dimerization domains. It is interesting that both the open and closed

states were obtained although no effector molecule was identified in the structure of

either state. The authors suggested that different conformations of the MexR dimer

139

observed in the crystal structure may represent each of the distinct DNA and effector-

bound conformations. This suggestion is indeed substantiated by our observation of the

apo and salicylate bound form of MTH313.

Biological Relevance

Transcriptional regulators belonging to the MarR family are involved in producing

multiple antibiotic resistance (mar) or multiple drug resistance (mdr) phenotypes by

upregulating the expression of protein efflux pumps. MarR can be inhibited from

binding to its cognate DNA by several anionic compounds including salicylate (Martin

and Rosner 1995). The binding affinity of salicylate is 500 μM, which completely

abolishes E. coli MarR from binding to the mar operator; however, how the binding of

this compound interferes with MarR binding to DNA is unclear.

Here we demonstrate that the binding of salicylate imparts a large structural

change in the DNA binding lobes of the structure and the binding sites are located in a

deep pocket at the dimerization and DNA binding lobe junction of MTH313. Also since

this ligand binding pocket is conserved in all of the structures in this family of proteins

we are proposing that this is the ligand binding pocket for proteins belonging to the

MarR family. This finding is also consistent with structural studies of other salicylate

binding proteins in which the salicylate molecule is also buried (Enroth, Eger et al.

2000).

From this study, we see that the mode of regulation for this family of

transcriptional regulators is exerted via large conformational changes occurring at the

DNA binding domain. The binding of salicylate pushes apart the two DNA binding lobes

which likely abolishes the interaction with DNA. This mechanism of regulation has been

140

observed for other DNA binding proteins including the TetR repressor protein in which

tetracycline binds, induces a conformational change which increases the distance

between the two DNA binding domains by 3 Å, thus abolishing the ability of TetR to bind

to its operator DNA (Orth, Cordes et al. 1998). Here we propose a similar mode of

regulation for the MarR family of transcriptional regulators, in which an effector molecule

binds to the identified binding pocket inducing a conformational change in the DNA

binding domain. This domain is pushed further apart, which we called the open state,

and prevents the binding of the protein to its operator DNA.

MTH313 is currently annotated as a transcriptional regulator, however its

biological function is still elusive. We expect that if this protein has similar biological

properties to the E. coli MarR homologue, the analogous marRAB operon should exist

in M. thermoautotrophicum and MTH313 should be part of this operon, particularly since

MTH313 binds the promoter region. Analysis of adjacent ORFs indicated that MTH0314

is a Na+ -driven multidrug efflux transporter and belongs to the MATE family of drug

efflux pumps. In addition, the transcriptional start site for this transporter starts in the

middle of MTH313 and the predicted translational start site is also found at the 3’ end in

the MTH313 gene. The Na+-driven efflux pumps in the MATE family utilize the

electrochemical potential of Na+ as the driving force for drug transport. However, the

mechanism of how organisms respond to increasing levels of these target drugs has not

been addressed. The identification of the marR transcriptional regulator homologue

(MTH313) adjacent to a Na+-driven efflux pump is indicative that the expression of this

pump is under the direct regulation of MTH313, a marR-like repressor protein.

However, this hypothesis is based on sequence analysis and our understanding of the

141

biological role of E. coli marR and therefore must be confirmed in the future with

detailed biological studies.

Materials and Methods Cloning, Protein Expression and Purification

The MTH313 gene (Gene ID: 1470274 ) was amplified from genomic DNA using

the forward primer, 5’-GCGGCGGCCCATATGGACAGGGACATACCAC-3’, and the

reverse primer, 5’-GCGCAGATCTTCACCTCCACTCACCCCTC-3’, which introduces a

NdeI and a BglII site at the 5’ and 3’ ends of the gene. The amplified gene was cloned

into the pET15b expression vector and its gene product was expressed,

selenomethionine (SeMet)-labelled and purified from a bacterial system using Ni+2

affinity chromatography as described elsewhere for M. thermoautotrophicum proteins

(Christendat, Saridakis et al. 2000). Briefly, recombinant MTH313 protein was

expressed in the E. coli strain BL21 Gold (DE3) in 1L Luria-Bertani media supplemented

with 50 µg/mL kanamycin and 100 µg/mL ampicillin and incubated at 37°C with shaking

until the culture reached an OD of 0.7 at 600nm. The culture was then induced with 0.4

mM IPTG for 4 hours at 37°C and then allowed to grow overnight with shaking at 16°C.

Cells were harvested by centrifugation, disrupted by sonication, and the insoluble

cellular material was removed by centrifugation. MTH313 was purified from other

contaminating proteins using Ni+2-NTA affinity chromatography (Qiagen) and the fusion

hexahistadine tag was removed by thrombin proteolytic digestion. Purified MTH313

was concentrated and quantified at 280nm using its extinction coefficient of 12 780 M-

142

1cm-1. The protein concentration was confirmed with the Bradford protein assay kit

using BSA as a standard (Bioshop).

Protein Crystallization

Screening for crystallization conditions was also performed as described

elsewhere for M. thermoautotrophicum proteins (Christendat, Saridakis et al. 2000).

Crystallization experiments were conducted using the hanging drop vapour diffusion

method at room temperature, 296 K. 2 μL of 8mg/ml protein sample was mixed with 2

μL of precipitating solution on siliconized cover slides and placed over a VDX plate well

containing 600 μL of the precipitation solution (Jancarik 1991). The crystallization

experiment was allowed to proceed undisturbed for at least 24 hours at room

temperature. The final (optimized) crystallization condition consists of 12 %

polyethylene glycol 3350 (PEG 3350) and 8 % isopropanol as the precipitant, 0.1 M

sodium potassium tartrate and 0.1 M sodium citrate at pH 5.0. The crystals chosen for

X-ray diffraction studies were flash-frozen in this buffer containing 12 % glycerol, which

acted as a cryoprotectant. The morphology of the single crystals is orthorhombic with

maximum dimensions of 0.3 x 0.1 x 0.4 mm3.

The cocrystallization studies were initiated using the vapor diffusion hanging drop

protocol as described above, in which 20 mM or 40 mM of sodium salicylate was added

to the optimized crystallization condition. Large, rod-like crystals with a deprivation

zone in the middle appear after 24 hours. The tip of one of these crystals was broken

off and used for diffraction studies.

143

X-Ray Diffraction and Structure Determination

Crystals of MTH313 belong to the orthorhombic space group C2221 with unit cell

dimensions a = 43.4 Å, b = 68.7 Å, c = 92.6 Å. Single wavelength anomalous

dispersion (SAD) data were collected at BioCARS, beamline 14ID, Advanced Photon

Source, Argonne National Laboratory, on a mar ccd 165 detector, to 2.0 Å resolution

from a single crystal containing SeMet-labelled protein near the Se edge (Table 1). The

native data and the data for the salicylate complexed protein were also collected at

BioCARS, beamline 14BMC, on an ADSC Quantum-4 detector, to 1.4 Å and 2.2 Å

respectively. All diffraction data were collected at 100 K in a nitrogen stream. All

diffraction data reduction was done using the HKL2000 suite of programs (Otwinowski

1997). Data collection statistics are presented in Table 3-1. Both SAD phasing and

phase improvement by density modification were done using Solve and Resolve

(Terwilliger 2004). Approximately 60 % of the initial model was traced using the

autobuild function of Resolve and additional regions of the model were manually built

with O (Jones, Zou et al. 1991). The initial rounds of refinement were done against the

Se data up to 2.2 Å resolution, with CNS 1.1, which consisted of minimize and

simulated annealing (Brunger, Adams et al. 1998). After every round of refinement, the

model was manually rebuilt using both 2|Fo|-|Fc| and |Fo|-|Fc| difference electron-density

maps, which was followed by individual B-factor refinement. The annealing step used in

the refinement includes the simulated annealing with torsion angle dynamics and

starting temperature of 5000 K. The final refinements were done with the native data

collected to 1.4 Å using the same refinement procedure as above except that 2500 K

was chosen as the starting temperature for simulated annealing. Water picking was

done using the following criteria: a peak of at least 2.5 σ in the |Fo|-|Fc| difference map

144

with acceptable bonding distance in the range of 2.8 – 3.5 Å with other atoms.

Molecular replacement was conducted with the refined 1.4 Å structure as a template for

the salicylate complexed protein, using the Amore program from the CCP4 suite (Bailey

1994). The phase information obtained was used to manually rebuild the protein

structure in O and multiple rounds of refinement were conducted as described above.

Density representing the salicylate model was seen during the first rebuilding routine for

the salicylate-bound structure. The program PyMOL (DeLano 2002) was used in the

production of the figures.

DNA Binding Study Probe Design

MTH313 A-box was identified by searching for the TTTA[A/T]A conserved motif,

500 base pairs upstream the translational start site . The probe sequence was:

5’GACAACATTTATATATGTTTTCCCACCAG 3’. Single strands were commercially

synthesized. Double stranded DNA was prepared by heating a mixture of

complimentary single stranded DNA to 93oC for 1 minute and then annealing of the

DNA by gradual cooling on a heat block to room temperature. The annealing reaction

was conducted at pH 7.5 with 10 mM Tris, 50mM NaCl and 1 mM EDTA.

Gel Shift Assay

The MTH313 DNA binding experiment was designed such that the amount of

DNA probe (57.6 pmol) was constant and the protein concentration was varied (50 µM

to 150 µM). The reactions were set up in 2X binding buffer ( 12mM HEPES, 1mM

MgCl2, 4mM Tris pH 7.9, 100mM KCl, 0.6 mM DTT and 12% glycerol). In the reactions

containing salicylate, the non-specific DNA and the non-specific protein, 100 µM of

145

protein was used. The concentration of salicylate was varied between 5 mM and 40

mM. In all cases the final reaction volume was kept at 34 µLThe samples were

incubated for 30 min at 55 oC and were resolved on 1% agarose containing 0.002%

ethidium bromide in 1/2x TAE running buffer for 30 min at 135V. The non-specific

double stranded DNA consists of 22 nucleotides and represents a small segment of the

MTH313 gene. The non-specific protein used in this study is a recombinant construct

of the Aquifex aeolicus prephenate dehydrogenase.

Thermal Shift Salicylate Binding Assay

Thermal denaturation of MTH313 was conducted with varying concentration of

salicylate to determine its binding constants. Sypro orange dye was used as a

fluorescent indicator to follow the denaturation of the protein. Sypro orange binds to the

hydrophobic regions of the proteins that are exposed upon denaturation. The protocol

was optimized from (Lo, Aulabaugh et al. 2004; Vedadi, Niesen et al. 2006). Briefly,

different amounts (5.6 μg -56 μg) of MT313 were tested to determine which

concentration produces the optimal fluorescence signal to reproducibly follow the

protein denaturation. In subsequent runs, 28 μg of protein was used. The reaction

buffer consisted of 10 mM HEPES pH 7.5, 600 mM NaCl and 5X sypro orange dye.

The concentration of salicylic acid was varied between 0-40 mM. A Bio-Rad Chromo4

real-time PCR system was used to analyze the denaturation of MTH313. The

temperature ranges from 40-100 oC with an incremental increase of 0.2 oC every 7

seconds was chosen as the optimal denaturation condition.

146

Footnote: The atomic coordinates and structure factors (code 3BPV and 3BPX [PDB]

for the apo and the salicylate bound structures, respectively ) have been deposited in

the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers

University, New Brunswick, NJ (http://www.rcsb.org/).

147

Concluding discussion

Most natural products can be classified into three major groups:

terpenoids, alkaloids and phenolic compounds. Terpenoids consist of five

carbon units which serve as toxins and feeding deterrents to herbivores.

Alkaloids are synthesized mainly from tyrosine and they are nitrogen-containing

compounds that protect plants from herbivores and many possess

pharmacologically important activity. Salicylate is a phenolic compound that has

pharmacological activity, serves as a hormone in plants and as a protective

signaling compound in plants and bacteria. Salicylate is an inducer for gene

expression in many cellular lifeforms. Although many salicylate binding

transcription factors have been identified in archaea, their biological role in gene

expression still remains to be elucidated.

Here, we have shown that aromatic amino acid supplementation and

transcriptional studies with the Arabidopsis thaliana DAHP synthases have

indicated that DAHPS1 may be involved in enhancing indole hormone synthesis

and DAHPS3 may be involved in directing the metabolite pool towards the

phenylpropanoid pathway. Tyrosine treatment causes a general reduction of

metabolites in the hormone biosynthetic branch as well as on the

phenylpropanoid transcripts suggesting that its effect is exercised upstream of

this branching. Tryptophan has been shown indirectly to increase the

accumulation of auxin in the root tips by GUS marker accumulation levels and

this suggests that it provides the metabolite pool necessary for auxin synthesis.

Phenylalanine provides a general flow through the shikimate pathway and the

148

phenylpropanoid pathway but it can also restore the levels of GUS

accumulation by tyrosine suggesting a mechanism of cross-talk between these

branching pathways. The role of flavonols in regulating hormone metabolism

has been well documented previously.

In addition, the TyrA family of proteins, which specialize in L-tyrosine

synthesis and catalyze the oxidative decarboxylation of prephenate and/or

arogenate based on substrate specificity has been used as a model to

determine the substrate selectivity mechanism. Due to the alternative catalytic

steps and substrate recognition mechanisms, this family of proteins is an

important tool for the study of enzymatic substrate discrimination. Structural

studies, mutagenesis and kinetics have not only identified some of the key

residues involved in the reaction, but also residues involved in substrate

specificity and selectivity. This study outlines a strategy of using a set of co-

crystal structures in the presence of tyrosine, 4-hydroxyphenylpyruvate and 4-

hydroxyphenylpropionate (prephenate analog) to analyze the mechanism of

substrate selectivity. This analysis has identified a single histidine residue as a

determinant of substrate selectivity. The architecture of the active site and the

interactions that have evolved to regulate the access of the ligands to the active

site provide important insight on feedback regulation by tyrosine. In the

crystallographic level, this work illustrates the dynamics, flexibility and functional

relevance of X-ray crystallography in understanding such molecular processes,

because the catalytic reaction took place inside the crystal.

149

The last study shows that salicylate is able to modulate MT313, a MarR

transcriptional regulator from archaea. These transcriptional regulators affect

the efflux and influx of phenolic agents in bacteria and archaea. In E.coli, MarR

regulates the multiple antibiotic resistance (mar) operon and its inactivation

produces the multiple antibiotic resistance phenotype. In some organisms,

active efflux of drug compounds will produce a drug resistance phenotype

whereas in other organisms active influx of chlorinated hydrocarbons results in

their rapid degradation. Although proteins in the MarR family are regulators of

important biological processes, their mechanism of action was not well

understood and structural information about how phenolic agents regulate the

activity of these proteins was lacking. Here, the three dimensional structure of a

MarR family protein, MTH313, in its apo form and in complex with salicylate, a

known inactivator is presented. A comparison of these two structures indicates

that the mechanism of regulation involves a large asymmetric conformational

change in the DNA binding lobe. Electrophoretic mobility shift assay and

biophysical analyses further suggest that salicylate inactivates MT313, induces

negative cooperativity and prevents it from binding to its promoter region.

150

References: Ahmed, M., C. M. Borsch, et al. (1994). "A protein that activates expression of a

multidrug efflux transporter upon binding the transporter substrates." J Biol Chem 269(45): 28506-13.

Alekshun, M. N., Y. S. Kim, et al. (2000). "Mutational analysis of MarR, the negative regulator of marRAB expression in Escherichia coli, suggests the presence of two regions required for DNA binding." Mol Microbiol 35(6): 1394-404.

Alekshun, M. N., S. B. Levy, et al. (2001). "The crystal structure of MarR, a regulator of multiple antibiotic resistance, at 2.3 A resolution." Nat Struct Biol 8(8): 710-4.

Ariza, R. R., S. P. Cohen, et al. (1994). "Repressor mutations in the marRAB operon that activate oxidative stress genes and multiple antibiotic resistance in Escherichia coli." J Bacteriol 176(1): 143-8.

Bailey, S. (1994). "The CCP4 Suite:programs for protein crystallography." Acta Crystallogr D Biol Crystallogr 50: 760-763.

Baranova, N. N., A. Danchin, et al. (1999). "Mta, a global MerR-type regulator of the Bacillus subtilis multidrug-efflux transporters." Mol Microbiol 31(5): 1549-59.

Bate, N. J., J. Orr, et al. (1994). "Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis." Proc Natl Acad Sci U S A 91(16): 7608-12.

Beissbarth, T. and T. P. Speed (2004). "GOstat: find statistically overrepresented Gene Ontologies within a group of genes." Bioinformatics 20(9): 1464-5.

Bennett-Lovsey, R. M., A. D. Herbert, et al. (2008). "Exploring the extremes of sequence/structure space with ensemble fold recognition in the program Phyre." Proteins 70(3): 611-25.

Bertelli, A. A., C. Mannari, et al. (2008). "Immunomodulatory activity of shikimic acid and quercitin in comparison with oseltamivir (Tamiflu) in an in vitro model." J Med Virol 80(4): 741-5.

Bhalerao, R. P., J. Eklof, et al. (2002). "Shoot-derived auxin is essential for early lateral root emergence in Arabidopsis seedlings." Plant J 29(3): 325-32.

Birnbaum, K., D. E. Shasha, et al. (2003). "A gene expression map of the Arabidopsis root." Science 302(5652): 1956-60.

Blakeslee, J. J., W. A. Peer, et al. (2005). "Auxin transport." Curr Opin Plant Biol 8(5): 494-500.

Blilou, I., J. Xu, et al. (2005). "The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots." Nature 433(7021): 39-44.

Bonner, C. and R. Jensen (1987). "Arogenate dehydrogenase." Methods Enzymol 142: 488-94.

Bonner, C. A., T. Disz, et al. (2008). "Cohesion group approach for evolutionary analysis of TyrA, a protein family with wide-ranging substrate specificities." Microbiol Mol Biol Rev 72(1): 13-53, table of contents.

Bonner, C. A., R. A. Jensen, et al. (2004). "A core catalytic domain of the TyrA protein family: arogenate dehydrogenase from Synechocystis." Biochem J 382(Pt 1): 279-91.

151

Bonvin, J., R. A. Aponte, et al. (2006). "Biochemical characterization of prephenate dehydrogenase from the hyperthermophilic bacterium Aquifex aeolicus." Protein Sci 15(6): 1417-32.

Brunger, A. T., P. D. Adams, et al. (1998). "Crystallography & NMR system: A new software suite for macromolecular structure determination." Acta Crystallogr D Biol Crystallogr 54(Pt 5): 905-21.

Campbell, S. A., T. A. Richards, et al. (2004). "A complete shikimate pathway in Toxoplasma gondii: an ancient eukaryotic innovation." Int J Parasitol 34(1): 5-13.

Champney, W. S. and R. A. Jensen (1970). "The enzymology of prephenate dehydrogenase in Bacillus subtilis." J Biol Chem 245(15): 3763-70.

Chipman, D. M. and B. Shaanan (2001). "The ACT domain family." Curr Opin Struct Biol 11(6): 694-700.

Christendat, D., V. Saridakis, et al. (2000). "Crystal structure of dTDP-4-keto-6-deoxy-D-hexulose 3,5-epimerase from Methanobacterium thermoautotrophicum complexed with dTDP." J Biol Chem 275(32): 24608-12.

Christendat, D., V. C. Saridakis, et al. (1998). "Use of site-directed mutagenesis to identify residues specific for each reaction catalyzed by chorismate mutase-prephenate dehydrogenase from Escherichia coli." Biochemistry 37(45): 15703-12.

Christendat, D. and J. L. Turnbull (1999). "Identifying groups involved in the binding of prephenate to prephenate dehydrogenase from Escherichia coli." Biochemistry 38(15): 4782-93.

Cobbett, C. S. and M. L. Delbridge (1987). "Regulatory mutants of the aroF-tyrA operon of Escherichia coli K-12." J Bacteriol 169(6): 2500-6.

Coggins, J. R., C. Abell, et al. (2003). "Experiences with the shikimate-pathway enzymes as targets for rational drug design." Biochem Soc Trans 31(Pt 3): 548-52.

Cohen, S. P., H. Hachler, et al. (1993). "Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli." J Bacteriol 175(5): 1484-92.

Cohen-Kupiec, R., C. Blank, et al. (1997). "Transcriptional regulation in Archaea: in vivo demonstration of a repressor binding site in a methanogen." Proc Natl Acad Sci U S A 94(4): 1316-20.

Crowley, V. (2006). The isozymes of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase from Arabidopsis perform differential roles in vivo and may be regulated by tyrosine. Plant and Microbial Biology. Toronto, University of Toronto.

De Leonardis, A. and V. Macciola (2004). "A study on the lipid fraction of Adriatic sardine filets (Sardina pilchardus)." Nahrung 48(3): 209-12.

DeLano, W. L. (2002). "The PyMOL molecular graphics system." DeLano Scientific, San Carlos, CA.

Delmas, F., J. Petit, et al. (2003). "The gene expression and enzyme activity of plant 3-deoxy-D-manno-2-octulosonic acid-8-phosphate synthase are preferentially associated with cell division in a cell cycle-dependent manner." Plant Physiol 133(1): 348-60.

Dharmasiri, N., S. Dharmasiri, et al. (2005). "Plant development is regulated by a family of auxin receptor F box proteins." Dev Cell 9(1): 109-19.

152

Dhonukshe, P., J. Kleine-Vehn, et al. (2005). "Cell polarity, auxin transport, and cytoskeleton-mediated division planes: who comes first?" Protoplasma 226(1-2): 67-73.

Dixon, R. A., P. A. Howles, et al. (1998). "Prospects for the metabolic engineering of bioactive flavonoids and related phenylpropanoid compounds." Adv Exp Med Biol 439: 55-66.

Dixon, R. A., C. J. Lamb, et al. (1996). "Metabolic engineering: prospects for crop improvement through the genetic manipulation of phenylpropanoid biosynthesis and defense responses--a review." Gene 179(1): 61-71.

Dixon, R. A. and C. L. Steele (1999). "Flavonoids and isoflavonoids - a gold mine for metabolic engineering." Trends Plant Sci 4(10): 394-400.

Dunn, M. F., D. Niks, et al. (2008). "Tryptophan synthase: the workings of a channeling nanomachine." Trends Biochem Sci 33(6): 254-64.

Duzinski, P. K. and J. F. Morrison (1976). "The preparation and purification of sodium prephenate." Prep Biochem 6(2-3): 113-21.

Dyer, W. E., J. M. Henstrand, et al. (1989). "Wounding induces the first enzyme of the shikimate pathway in Solanaceae." Proc Natl Acad Sci U S A 86(19): 7370-7373.

Ecker, J. R. and R. W. Davis (1987). "Plant defense genes are regulated by ethylene." Proc Natl Acad Sci U S A 84(15): 5202-5206.

Elandalloussi, L. M., P. M. Rodrigues, et al. (2005). "Shikimate and folate pathways in the protozoan parasite, Perkinsus olseni." Mol Biochem Parasitol 142(1): 106-9.

Emanuelsson, O., H. Nielsen, et al. (1999). "ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites." Protein Sci 8(5): 978-84.

Enroth, C., B. T. Eger, et al. (2000). "Crystal structures of bovine milk xanthine dehydrogenase and xanthine oxidase: structure-based mechanism of conversion." Proc Natl Acad Sci U S A 97(20): 10723-8.

Fazel, A. M., J. R. Bowen, et al. (1980). "Arogenate (pretyrosine) is an obligatory intermediate of L-tyrosine biosynthesis: confirmation in a microbial mutant." Proc Natl Acad Sci U S A 77(3): 1270-3.

Ferrer, J. L., M. B. Austin, et al. (2008). "Structure and function of enzymes involved in the biosynthesis of phenylpropanoids." Plant Physiol Biochem 46(3): 356-70.

Forlani, G., M. Pavan, et al. (2008). "Biochemical bases for a widespread tolerance of cyanobacteria to the phosphonate herbicide glyphosate." Plant Cell Physiol 49(3): 443-56.

Friml, J. (2003). "Auxin transport - shaping the plant." Curr Opin Plant Biol 6(1): 7-12. Friml, J. and K. Palme (2002). "Polar auxin transport--old questions and new

concepts?" Plant Mol Biol 49(3-4): 273-84. Friso, G., L. Giacomelli, et al. (2004). "In-depth analysis of the thylakoid membrane

proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database." Plant Cell 16(2): 478-99.

Galweiler, L., C. Guan, et al. (1998). "Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue." Science 282(5397): 2226-30.

Geigenberger, P., A. Kolbe, et al. (2005). "Redox regulation of carbon storage and partitioning in response to light and sugars." J Exp Bot 56(416): 1469-79.

Geldner, N., J. Friml, et al. (2001). "Auxin transport inhibitors block PIN1 cycling and vesicle trafficking." Nature 413(6854): 425-8.

153

George, A. M. and S. B. Levy (1983). "Amplifiable resistance to tetracycline, chloramphenicol, and other antibiotics in Escherichia coli: involvement of a non-plasmid-determined efflux of tetracycline." J Bacteriol 155(2): 531-40.

Gorlach, J., A. Beck, et al. (1993). "Differential expression of tomato (Lycopersicon esculentum L.) genes encoding shikimate pathway isoenzymes. I. 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase." Plant Mol Biol 23(4): 697-706.

Gosset, G., C. A. Bonner, et al. (2001). "Microbial origin of plant-type 2-keto-3-deoxy-D-arabino-heptulosonate 7-phosphate synthases, exemplified by the chorismate- and tryptophan-regulated enzyme from Xanthomonas campestris." J Bacteriol 183(13): 4061-70.

Grkovic, S., K. M. Hardie, et al. (2003). "Interactions of the QacR multidrug-binding protein with structurally diverse ligands: implications for the evolution of the binding pocket." Biochemistry 42(51): 15226-36.

Gutmann, L., R. Williamson, et al. (1985). "Cross-resistance to nalidixic acid, trimethoprim, and chloramphenicol associated with alterations in outer membrane proteins of Klebsiella, Enterobacter, and Serratia." J Infect Dis 151(3): 501-7.

Hain, J., W. D. Reiter, et al. (1992). "Elements of an archaeal promoter defined by mutational analysis." Nucleic Acids Res 20(20): 5423-8.

Hamann, T., E. Benkova, et al. (2002). "The Arabidopsis BODENLOS gene encodes an auxin response protein inhibiting MONOPTEROS-mediated embryo patterning." Genes Dev 16(13): 1610-5.

Hamann, T., U. Mayer, et al. (1999). "The auxin-insensitive bodenlos mutation affects primary root formation and apical-basal patterning in the Arabidopsis embryo." Development 126(7): 1387-95.

Hardtke, C. S. and T. Berleth (1998). "The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development." Embo J 17(5): 1405-11.

Henstrand, J. M., J. Schmid, et al. (1995). "Only the Mature Form of the Plastidic Chorismate Synthase Is Enzymatically Active." Plant Physiol 108(3): 1127-1132.

Herrmann, K. M. (1995). "The shikimate pathway as an entry to aromatic secondary metabolism." Plant Physiol 107(1): 7-12.

Herrmann, K. M. (1995). "The Shikimate Pathway: Early Steps in the Biosynthesis of Aromatic Compounds." Plant Cell 7(7): 907-919.

Herrmann, K. M. and L. M. Weaver (1999). "The Shikimate Pathway." Annu Rev Plant Physiol Plant Mol Biol 50: 473-503.

Holm, L. and C. Sander (1993). "Protein structure comparison by alignment of distance matrices." J Mol Biol 233(1): 123-38.

Hong, M., M. Fuangthong, et al. (2005). "Structure of an OhrR-ohrA operator complex reveals the DNA binding mechanism of the MarR family." Mol Cell 20(1): 131-41.

Jancarik, J. K. (1991). "Sparse matrix sampling: a screening method for crystallization of proteins." Journal of Applied Crystallography 24: 409-411.

Jensen, R. A. S., S.L (1975). "The ancient origin of a second microbial pathway of L-tyrosine biosynthesis in prokaryotes." J.Mol.Evol. 4: 249-259.

Jones, T. A., J. Y. Zou, et al. (1991). "Improved methods for building protein models in electron density maps and the location of errors in these models." Acta Crystallogr A 47 ( Pt 2): 110-9.

154

Kaine, B. P., I. J. Mehr, et al. (1994). "The sequence, and its evolutionary implications, of a Thermococcus celer protein associated with transcription." Proc Natl Acad Sci U S A 91(9): 3854-6.

Kaneko, T., N. Baba, et al. (2003). "Protection of coumarins against linoleic acid hydroperoxide-induced cytotoxicity." Chem Biol Interact 142(3): 239-54.

Keith, B., X. N. Dong, et al. (1991). "Differential induction of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase genes in Arabidopsis thaliana by wounding and pathogenic attack." Proc Natl Acad Sci U S A 88(19): 8821-5.

Kohler, T., S. F. Epp, et al. (1999). "Characterization of MexT, the regulator of the MexE-MexF-OprN multidrug efflux system of Pseudomonas aeruginosa." J Bacteriol 181(20): 6300-5.

La Camera, S., P. Geoffroy, et al. (2005). "A pathogen-inducible patatin-like lipid acyl hydrolase facilitates fungal and bacterial host colonization in Arabidopsis." Plant J 44(5): 810-25.

Langer, D., J. Hain, et al. (1995). "Transcription in archaea: similarity to that in eucarya." Proc Natl Acad Sci U S A 92(13): 5768-72.

Legrand, P., R. Dumas, et al. (2006). "Biochemical characterization and crystal structure of Synechocystis arogenate dehydrogenase provide insights into catalytic reaction." Structure 14(4): 767-76.

Leyser, O. (1999). "Plant hormones: ins and outs of auxin transport." Curr Biol 9(1): R8-R10.

Leyser, O. (2001). "Auxin signalling: the beginning, the middle and the end." Curr Opin Plant Biol 4(5): 382-6.

Leyser, O. (2002). "Molecular genetics of auxin signaling." Annu Rev Plant Biol 53: 377-98.

Leyser, O. (2005). "Auxin distribution and plant pattern formation: how many angels can dance on the point of PIN?" Cell 121(6): 819-22.

Leyser, O. (2006). "Dynamic integration of auxin transport and signalling." Curr Biol 16(11): R424-33.

Leyser, O. and T. Berleth (1999). "A molecular basis for auxin action." Semin Cell Dev Biol 10(2): 131-7.

Lim, D., K. Poole, et al. (2002). "Crystal structure of the MexR repressor of the mexRAB-oprM multidrug efflux operon of Pseudomonas aeruginosa." J Biol Chem 277(32): 29253-9.

Lindblad, B., G. Lindstedt, et al. (1977). "Purification and some properties of human 4-hydroxyphenylpyruvate dioxygenase (I)." J Biol Chem 252(14): 5073-84.

Liscombe, D. K. and P. J. Facchini (2008). "Evolutionary and cellular webs in benzylisoquinoline alkaloid biosynthesis." Curr Opin Biotechnol 19(2): 173-80.

Liu, Y., A. Manna, et al. (2001). "Crystal structure of the SarR protein from Staphylococcus aureus." Proc Natl Acad Sci U S A 98(12): 6877-82.

Lo, M. C., A. Aulabaugh, et al. (2004). "Evaluation of fluorescence-based thermal shift assays for hit identification in drug discovery." Anal Biochem 332(1): 153-9.

Lomax, T. L. (1997). "Molecular genetic analysis of plant gravitropism." Gravit Space Biol Bull 10(2): 75-82.

Lomovskaya, O. and K. Lewis (1992). "Emr, an Escherichia coli locus for multidrug resistance." Proc Natl Acad Sci U S A 89(19): 8938-42.

Ludwig, A., C. Tengel, et al. (1995). "SlyA, a regulatory protein from Salmonella typhimurium, induces a haemolytic and pore-forming protein in Escherichia coli." Mol Gen Genet 249(5): 474-86.

155

Lumsden, J. and J. R. Coggins (1977). "The subunit structure of the arom multienzyme complex of Neurospora crassa. A possible pentafunctional polypeptide chain." Biochem J 161(3): 599-607.

Lumsden, J. and J. R. Coggins (1978). "The subunit structure of the arom multienzyme complex of Neurospora crassa. Evidence from peptide 'maps' for the identity of the subunits." Biochem J 169(2): 441-4.

Maneewannakul, K. and S. B. Levy (1996). "Identification for mar mutants among quinolone-resistant clinical isolates of Escherichia coli." Antimicrob Agents Chemother 40(7): 1695-8.

Marklund, B. I., J. M. Tennent, et al. (1992). "Horizontal gene transfer of the Escherichia coli pap and prs pili operons as a mechanism for the development of tissue-specific adhesive properties." Mol Microbiol 6(16): 2225-42.

Martin, R. G., P. S. Nyantakyi, et al. (1995). "Regulation of the multiple antibiotic resistance (mar) regulon by marORA sequences in Escherichia coli." J Bacteriol 177(14): 4176-8.

Martin, R. G. and J. L. Rosner (1995). "Binding of purified multiple antibiotic-resistance repressor protein (MarR) to mar operator sequences." Proc Natl Acad Sci U S A 92(12): 5456-60.

Martin, R. G. and J. L. Rosner (2004). "Transcriptional and translational regulation of the marRAB multiple antibiotic resistance operon in Escherichia coli." Mol Microbiol 53(1): 183-91.

Meganathan, R. (2001). "Biosynthesis of menaquinone (vitamin K2) and ubiquinone (coenzyme Q): a perspective on enzymatic mechanisms." Vitam Horm 61: 173-218.

Meganathan, R. (2001). "Ubiquinone biosynthesis in microorganisms." FEMS Microbiol Lett 203(2): 131-9.

Memelink, J. (2004). "Putting the opium in poppy to sleep." Nat Biotechnol 22(12): 1526-7.

Mikkelsen, M. D., P. Naur, et al. (2004). "Arabidopsis mutants in the C-S lyase of glucosinolate biosynthesis establish a critical role for indole-3-acetaldoxime in auxin homeostasis." Plant J 37(5): 770-7.

Miyazono, K., M. Tsujimura, et al. (2007). "Crystal structure of an archaeal homologue of multidrug resistance repressor protein, EmrR, from hyperthermophilic archaea Sulfolobus tokodaii strain 7." Proteins 67(4): 1138-46.

Mobley, E. M., B. N. Kunkel, et al. (1999). "Identification, characterization and comparative analysis of a novel chorismate mutase gene in Arabidopsis thaliana." Gene 240(1): 115-23.

Niyogi, K. K. and G. R. Fink (1992). "Two anthranilate synthase genes in Arabidopsis: defense-related regulation of the tryptophan pathway." Plant Cell 4(6): 721-33.

Niyogi, K. K., R. L. Last, et al. (1993). "Suppressors of trp1 fluorescence identify a new arabidopsis gene, TRP4, encoding the anthranilate synthase beta subunit." Plant Cell 5(9): 1011-27.

Notka, F., H. J. Linde, et al. (2002). "A C-terminal 18 amino acid deletion in MarR in a clinical isolate of Escherichia coli reduces MarR binding properties and increases the MIC of ciprofloxacin." J Antimicrob Chemother 49(1): 41-7.

Oliveros, J. C. (2007). "VENNY. An interactive tool for comparing lists with Venn diagrams."

Orth, P., F. Cordes, et al. (1998). "Conformational changes of the Tet repressor induced by tetracycline trapping." J Mol Biol 279(2): 439-47.

156

Otwinowski, Z. a. M. W. (1997). "Processing of X-ray diffraction data collected in oscillation mode." Academic Press, New York.

Paponov, I. A., W. D. Teale, et al. (2005). "The PIN auxin efflux facilitators: evolutionary and functional perspectives." Trends Plant Sci 10(4): 170-7.

Peer, W. A., A. Bandyopadhyay, et al. (2004). "Variation in expression and protein localization of the PIN family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin transport in Arabidopsis thaliana." Plant Cell 16(7): 1898-911.

Perego, M. and J. A. Hoch (1988). "Sequence analysis and regulation of the hpr locus, a regulatory gene for protease production and sporulation in Bacillus subtilis." J Bacteriol 170(6): 2560-7.

Poole, K., K. Tetro, et al. (1996). "Expression of the multidrug resistance operon mexA-mexB-oprM in Pseudomonas aeruginosa: mexR encodes a regulator of operon expression." Antimicrob Agents Chemother 40(9): 2021-8.

Rinaldi, A. C., C. M. Porcu, et al. (1998). "Biosynthesis of the topaquinone cofactor in copper amine oxidases--evidence from model studies." Eur J Biochem 251(1-2): 91-7.

Rippert, P. and M. Matringe (2002). "Purification and kinetic analysis of the two recombinant arogenate dehydrogenase isoforms of Arabidopsis thaliana." Eur J Biochem 269(19): 4753-61.

Rogers, L. A., C. Dubos, et al. (2005). "Light, the circadian clock, and sugar perception in the control of lignin biosynthesis." J Exp Bot 56(416): 1651-63.

Sabatini, S., D. Beis, et al. (1999). "An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root." Cell 99(5): 463-72.

Sampathkumar, P. and J. F. Morrison (1982). "Chorismate mutase-prephenate dehydrogenase from Escherichia coli. Kinetic mechanism of the prephenate dehydrogenase reaction." Biochim Biophys Acta 702(2): 212-9.

Sampathkumar, P. and J. F. Morrison (1982). "Chorismate mutase-prephenate dehydrogenase from Escherichia coli. Purification and properties of the bifunctional enzyme." Biochim Biophys Acta 702(2): 204-11.

Sanders, C. C., W. E. Sanders, Jr., et al. (1984). "Selection of multiple antibiotic resistance by quinolones, beta-lactams, and aminoglycosides with special reference to cross-resistance between unrelated drug classes." Antimicrob Agents Chemother 26(6): 797-801.

Schmid, J. A., N. (1995). "Molecular organization of the shikimate pathway in higher plants." Phytochemistry 39: 737-749.

Schmid, M., T. S. Davison, et al. (2005). "A gene expression map of Arabidopsis thaliana development." Nat Genet 37(5): 501-6.

Schumacher, M. A. and R. G. Brennan (2002). "Structural mechanisms of multidrug recognition and regulation by bacterial multidrug transcription factors." Mol Microbiol 45(4): 885-93.

Schumacher, M. A., M. C. Miller, et al. (2001). "Structural mechanisms of QacR induction and multidrug recognition." Science 294(5549): 2158-63.

Seoane, A. S. and S. B. Levy (1995). "Characterization of MarR, the repressor of the multiple antibiotic resistance (mar) operon in Escherichia coli." J Bacteriol 177(12): 3414-9.

Shumilin, I. A., C. Zhao, et al. (2002). "Allosteric inhibition of 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase alters the coordination of both substrates." J Mol Biol 320(5): 1147-56.

157

Singh, S. A. and D. Christendat (2006). "Structure of Arabidopsis dehydroquinate dehydratase-shikimate dehydrogenase and implications for metabolic channeling in the shikimate pathway." Biochemistry 45(25): 7787-96.

Soll, J. (2002). "Protein import into chloroplasts." Curr Opin Plant Biol 5(6): 529-35. Soll, J. and E. Schleiff (2004). "Protein import into chloroplasts." Nat Rev Mol Cell

Biol 5(3): 198-208. Song, J., C. A. Bonner, et al. (2005). "The TyrA family of aromatic-pathway

dehydrogenases in phylogenetic context." BMC Biol 3: 13. Starcevic, A., S. Akthar, et al. (2008). "Enzymes of the shikimic acid pathway encoded

in the genome of a basal metazoan, Nematostella vectensis, have microbial origins." Proc Natl Acad Sci U S A 105(7): 2533-7.

Stepanova, A. N., J. Robertson-Hoyt, et al. (2008). "TAA1-mediated auxin biosynthesis is essential for hormone crosstalk and plant development." Cell 133(1): 177-91.

Stepanova, A. N., J. Yun, et al. (2007). "Multilevel interactions between ethylene and auxin in Arabidopsis roots." Plant Cell 19(7): 2169-85.

Subramaniam, P. S., G. Xie, et al. (1998). "Substrate ambiguity of 3-deoxy-D-manno-octulosonate 8-phosphate synthase from Neisseria gonorrhoeae in the context of its membership in a protein family containing a subset of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthases." J Bacteriol 180(1): 119-27.

Subramanian, L., M. D. Benson, et al. (2003). "A synergy control motif within the attenuator domain of CCAAT/enhancer-binding protein alpha inhibits transcriptional synergy through its PIASy-enhanced modification by SUMO-1 or SUMO-3." J Biol Chem 278(11): 9134-41.

Sun, W., S. Singh, et al. (2006). "Crystal structure of prephenate dehydrogenase from Aquifex aeolicus. Insights into the catalytic mechanism." J Biol Chem 281(18): 12919-28.

Suzich, J. A., R. Ranjeva, et al. (1984). "Regulation of the Shikimate Pathway of Carrot Cells in Suspension Culture." Plant Physiol 75(2): 369-371.

Swarup, R., J. Friml, et al. (2001). "Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex." Genes Dev 15(20): 2648-53.

Taylor, L. P. and E. Grotewold (2005). "Flavonoids as developmental regulators." Curr Opin Plant Biol 8(3): 317-23.

Terwilliger, T. (2004). "SOLVE and RESOLVE: automated structure solution, density modification and model building." J Synchrotron Radiat 11(Pt 1): 49-52.

Then, R. L. and P. Angehrn (1986). "Multiply resistant mutants of Enterobacter cloacae selected by beta-lactam antibiotics." Antimicrob Agents Chemother 30(5): 684-8.

Turnbull, J., W. W. Cleland, et al. (1991). "pH dependency of the reactions catalyzed by chorismate mutase-prephenate dehydrogenase from Escherichia coli." Biochemistry 30(31): 7777-82.

Turnbull, J., J. F. Morrison, et al. (1991). "Kinetic studies on chorismate mutase-prephenate dehydrogenase from Escherichia coli: models for the feedback inhibition of prephenate dehydrogenase by L-tyrosine." Biochemistry 30(31): 7783-8.

Tusher, V. G., R. Tibshirani, et al. (2001). "Significance analysis of microarrays applied to the ionizing radiation response." Proc Natl Acad Sci U S A 98(9): 5116-21.

158

Vedadi, M., F. H. Niesen, et al. (2006). "Chemical screening methods to identify ligands that promote protein stability, protein crystallization, and structure determination." Proc Natl Acad Sci U S A 103(43): 15835-40.

Webby, C. J., H. M. Baker, et al. (2005). "The structure of 3-deoxy-d-arabino-heptulosonate 7-phosphate synthase from Mycobacterium tuberculosis reveals a common catalytic scaffold and ancestry for type I and type II enzymes." J Mol Biol 354(4): 927-39.

Webby, C. J., J. S. Lott, et al. (2005). "Crystallization and preliminary X-ray crystallographic analysis of 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase from Mycobacterium tuberculosis." Acta Crystallogr Sect F Struct Biol Cryst Commun 61(Pt 4): 403-6.

Werck-Reichhart, D. (1995). "Cytochromes P450 in phenylpropanoid metabolism." Drug Metabol Drug Interact 12(3-4): 221-43.

Werck-Reichhart, D. and R. Feyereisen (2000). "Cytochromes P450: a success story." Genome Biol 1(6): REVIEWS3003.

Werck-Reichhart, D., A. Hehn, et al. (2000). "Cytochromes P450 for engineering herbicide tolerance." Trends Plant Sci 5(3): 116-23.

Wilkinson, S. P. and A. Grove (2006). "Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins." Curr Issues Mol Biol 8(1): 51-62.

Winkel, B. S. (2004). "Metabolic channeling in plants." Annu Rev Plant Biol 55: 85-107.

Winter, D., B. Vinegar, et al. (2007). "An "electronic fluorescent pictograph" browser for exploring and analyzing large-scale biological data sets." PLoS ONE 2(1): e718.

Wu, R. Y., R. G. Zhang, et al. (2003). "Crystal structure of Enterococcus faecalis SlyA-like transcriptional factor." J Biol Chem 278(22): 20240-4.

Xia, T., G. Zhao, et al. (1993). "The pheA/tyrA/aroF region from Erwinia herbicola: an emerging comparative basis for analysis of gene organization and regulation in enteric bacteria." J Mol Evol 36(2): 107-20.

Xie, G., C. A. Bonner, et al. (2000). "Cyclohexadienyl dehydrogenase from Pseudomonas stutzeri exemplifies a widespread type of tyrosine-pathway dehydrogenase in the TyrA protein family." Comp Biochem Physiol C Toxicol Pharmacol 125(1): 65-83.

Yaron, S., D. G. White, et al. (2003). "Characterization of an Escherichia coli O157:H7 marR mutant." Int J Food Microbiol 85(3): 281-91.

Zheleznova, E. E., P. N. Markham, et al. (1999). "Structural basis of multidrug recognition by BmrR, a transcription activator of a multidrug transporter." Cell 96(3): 353-62.

Zhong, R. and Z. H. Ye (2007). "Regulation of cell wall biosynthesis." Curr Opin Plant Biol 10(6): 564-72.