static-content.springer.com10.1007... · web viewthe m. tuberculosis had phosphatase (rv3042c)...
TRANSCRIPT
![Page 1: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/1.jpg)
The M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine
Sonal Shree1, Abhishek Kumar Singh2, Richa Saxena3, Harish Kumar2, Aparna Agarwal1, Vijay Kumar Sharma1, Kanchan Srivastava3, Kishore Kumar Srivastava3, Sabyasachi
Sanyal2 and Ravishankar Ramachandran1*
Supplementary Data
Table S1: Relative activity of MtSerB2 and M. avium SerB on phosphorylated peptides
Substrates Relative activity (%)
MtSerB2
Relative activity (%)
M. avium SerB
serine phosphopeptide
RRApSVA
100 ± 0.005774 100± 0.017321
threonine phosphopeptide
RRApTVA
15 ± 0.1253 20 ± 0.215484
tyrosine phosphopeptide
RRAEpYAARG
0.07 ± 0.001155 0.05 ± 0.007211
![Page 2: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/2.jpg)
Table S2: Oligonucleotide sequences for Quantative Real Time PCR. All sequences are in 5'
to 3' orientation.
Gene name Forward Reverse
ARP2/3 GTCTGACTTCCTCAAGGTGC TCCAGTAGCAAGTGTTCCAGC
Cdc42 TGGAGTGTTCTGCACTTACACA GGCTCTTCTTCGGTTCTGG
ROCK TGCATTCCAAGATGATCGTTA AAGATCTCCACCAGGCATGTA
PAK TTCTGCTGCTTTTAGGGACAA TCAGGTAGGATAAAATGTTCCATGT
MAPK p38 GGGACCTCCTTATAGATGAGTGG GGACTCCATCTCTTCTTGGTCA
ACTN1 CGTGGAGATTAGGTCCAAGC CTGGCGAAGGCTGCTACT
VCL GGAGGTGATTAACCAGCCAAT AATGATGTCATTGCCCTTGC
LIMK CACCTGGAGGGAAGAACGTA GGCCATCATAGATCCTCTGG
RAC ATGTAGTTCTCAGATGCGTAAAGC GAGTTCAATGGCAACGCTTC
![Page 3: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/3.jpg)
Figure S1: Bead based His tagged pull down assay to probe interactions of MtSerB2 with
host proteins
(A) Pull down assay of MtSerB2, its ACT domain (G18A, G108A) mutants, PSP domain
(S273A, D341N/D345N) mutants with host proteins. Mycobacterium avium SerB protein also
shows interaction with host proteins. (B) MtSerB2 specifically interacts with HSPs 90, 70 and
27 but fails to interact with other HSP’s and HSP-like proteins. In the first lane whole cell
extracts of THP-1 macrophages was run as a positive control for expression of HSP’s and other
HSP binding proteins.
![Page 4: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/4.jpg)
Figure S2: Physical and functional interaction of GST MtSerB2 with pure host cofilin
protein
(A) GST pull down of GST - MtSerB2 with pure cofilin protein of host, Lane 1 is protein
marker, Lane 2 and 3 represent input protein GST MtSerB2 and His cofilin, Lane 4 is pull down
and Lane 5 is control to see interaction of GST only with host cofilin protein. (B) Pull down
samples was immunoblotted to probe the interacting proteins. Anti cofilin and GST antibody was
used to probe the cofilin and GST MtSerB2 respectively. (C) In vitro dephosphorylation
experiment of cofilin was done by immobilizing about 100 µg His cofilin on Ni- NTA resin and
incubating it with crude THP-1 lysate supplemented with ATP and phosphatase & protease
inhibitor. Bead was washed thoroughly and phosphatases assay was performed using 100nM of
MtSerB2 and liberated inorganic phosphate was monitored using malachite green reagent and
absorbance was taken at 630 nm. Additional control used was null mutant MtSerB2-
D341N/D345N and MtSerB2 incubated with 5µM of CFZ to determine that there was no
unspecific liberation of phosphate. Phosphorylation and dephosphorylation level of cofilin after
incubation with crude lysate and MtSerB2 was also determined by western immunoblotting
using phospho cofilin antibody and cofilin protein antibody.
(A) (B)
![Page 5: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/5.jpg)
(C)
![Page 6: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/6.jpg)
Figure S3: Physical and functional interaction of GST MtSerB2 with pure host MAPK p38
protein
(A) GST pull down of GST - MtSerB2 with pure MAPK p38 protein of host, Lane 1 is protein
marker, Lane 2 and 3 represent input protein GST MtSerB2 and His MAPK p38, Lane 4 is pull
down and Lane 5 is control to see interaction of GST only with host MAPK p38 protein. (B) Pull
down samples was immunoblotted to probe the interacting proteins. Anti MAPK p38and GST
antibody was used to probe the MAPK p38 and GST MtSerB2 respectively. (C) In vitro
dephosphorylation experiment of MAPK p38 was done by immobilizing about 100 µg His
MAPK p38 on Ni- NTA resin and incubating it with crude THP-1 lysate supplemented with ATP
and phosphatase & protease inhibitor. Bead was washed thoroughly and phosphatases assay was
performed using 100nM of MtSerB2 and liberated inorganic phosphate was monitored using
malachite green reagent and absorbance was taken at 630 nm. Additional control used was null
mutant MtSerB2- D341N/D345N and MtSerB2 incubated with 5µM of CFZ to determine that
there was no unspecific liberation of phosphate. Phosphorylation and dephosphorylation level of
MAPK p38 after incubation with crude lysate and MtSerB2 was also determined by western
immunoblotting using phospho MAPK p38 antibody and MAPK p38 protein antibody. (D)
Phosphatases assay was also done using MAPK p38 alpha (PROSPEC, pka-217) phosphorylated
in vitro with the MKK6 kinase and found that indeed MtSerB2 dephosphorylates MAPK p38 in
vitro. Phosphatase activity of MtSerB2 using 50 µM of L- phosphoserine as substrate was
assumed as 100% relative activity as maximum substrate concentration available for
phosphorylated MAPK p38 alpha was 20 µM. Concentration of MtSerB2 used for assay was 100
nM. Additional control used was null mutant MtSerB2- D341N/D345N and MtSerB2 incubated
with 5µM of CFZ to determine that there was no unspecific liberation of phosphate
![Page 7: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/7.jpg)
(A) (B)
(C)
![Page 8: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/8.jpg)
(D)
![Page 9: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/9.jpg)
Figure S4: Effect of MtSerB2 on phosphorylation pattern of JNK and ERK
Phosphorylation and dephosphorylation pattern of JNK and ERK protein was determined by
treating THP-1 with MtSerB2 protein for 0 min, 30 min and 2 hour. After treatment, cells were
lysed and whole cell protein extract was run on 12% SDS gel and blotted on nitrocellulose
membrane to probe for levels of phospho JNK, JNK protein and phospho ERK and ERK protein
![Page 10: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/10.jpg)
Figure S5: MtSerB2 specifically dephosphorylates NF-kB p65 protein at Ser-536 residue
MtSerB2 does not dephosphorylate Ser-276 and Ser-468 residue, for this purpose THP-1
macrophages were stimulated with TNF-α at the concentration of 5ng/ml for 30 min followed by
addition of MtSerB2 and its mutant for 2 hour, cells were then lysed and immunoblotted for
indicated antibodies.
![Page 11: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/11.jpg)
Figure S6: Physical and functional interaction of His MtSerB2 with pure NF-kB p65 host
protein
(A) His pull down of His - MtSerB2 with pure NF-kB p65 protein of host, Lane 1 is protein
marker, Lane 2 and 3 represent input protein His MtSerB2 and NF-kB p65, Lane 4 is pull down
and Lane 5 is control to see interaction of NF-kB p65 with His tag. (B) Pull down samples was
immunoblotted to probe the interacting proteins. Anti NF-kB p65 and His antibody was used to
probe the NF-kB p65 and His MtSerB2 respectively. (C) In vitro dephosphorylation experiment
of NF-kB p65 was done by immobilizing about 100 µg myc- NF-kB p65 on Protein A beads
(GE health care) with the help of Myc antibody and incubating it with crude THP-1 lysate
supplemented with ATP and phosphatase & protease inhibitor. Bead was washed thoroughly and
phosphatases assay was performed using 100nM of MtSerB2 and liberated inorganic phosphate
was monitored using malachite green reagent and absorbance was taken at 630 nm. Additional
control used was null mutant MtSerB2- D341N/D345N and MtSerB2 incubated with 5µM of
CFZ to determine that there was no unspecific liberation of phosphate. Phosphorylation and
dephosphorylation level of Ser – 536 residue of NF-kB p65 protein after incubation with crude
lysate and MtSerB2 was also determined by western immunoblotting using phospho Ser- 536
NF-kB p65 antibody and NF-kB p65 protein antibody.
(A) (B)
![Page 12: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/12.jpg)
(C)
![Page 13: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/13.jpg)
Figure S7: Competitive inhibition of MtSerB2 with respect to ʟ- phosphoserine by the CFZ
(A) Activity of MtSerB2 measured in the presence of rising concentrations of CFZ (0-10 µM)
and ʟ- phosphoserine (0 – 1250 µM). (B) The double reciprocal plot clearly indicates
competitive binding between ʟ- phosphoserine and CFZ
(A)
(B)
10 µM
2.5 µM
0.5 µM0.1 µM0 µM
7.5µM
1.0 µM
5.0 µM
![Page 14: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/14.jpg)
Figure S8: Effect of Clofazimine (CFZ) on M.avium SerB phosphatase activity and other
phosphatases
(A) Relative activity of M.avium SerB in the presence of increasing concentration of CFZ (B)
Comparative inhibition of other phosphatases such as Human phosphoserine phosphatases
(HPSP), Tyrosine phosphatases (PTPase) such as PtpA and PtpB of Mycobacterium tuberculosis
with CFZ and found that there was no inhibition in phosphatases activity of these enzyme even at
high concentration of CFZ (100 µM)
(A)
(B)
![Page 15: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/15.jpg)
Figure S9: The PSP-domain as well as ACT domains of MtSerB2 interacts with Hsp 90.
Disruption of interactions involving only the PSP domain still presumably allows for interactions
through the ACT domains.
![Page 16: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/16.jpg)
Figure S10: M. avium SerB fails to elicits cytoskeletal rearrangement in THP-1 cells in the
presence of CFZ
Confocal microscopy experiment to visualize cytoskeletal rearrangements in THP-1
macrophages on exogenous addition of M. avium SerB in presence and absence of Clofazimine
at 2 hour time point
.
![Page 17: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/17.jpg)
Figure S11: Purification of MtSerB2 and its mutants
(A) His- MtSerB2 protein purification- Lane 1 is Un induced MtSerB2 C41 transformants, Lane
2 is induced MtSerB2 C41 transformants, Lane 3 is load (supernatant after sonication), Lane 4 is
flow through from Ni NTA Agarose beads, Lane 5-6 Washing with 50mM imidazole buffer,
Lane 7 is MtSerB2 elution and Lane 8 is MtSerB2 after size exclusion chromatography (B) His-
MtSerB2 mutant protein purification - Lane L is load (supernatant after sonication), Lane F is
Flow through and W1 & W2 represents washing with 50 mM imidazole. E1,E2, E3, E4 and E5
corresponds to elution fraction of MtSerB2- G18A, G108A, D341N/D345N , S273A and M.
avium SerB (C) GST- MtSerB2 protein purification – Lane 1 is load(supernatant after
sonication), Lane 2 is Flow through, Lane 3-5 represents washes with lysis buffer, Lane 6 is
Elution and Lane 7 is GST MtSerB2 after size exclusion chromatography.
(A)
![Page 18: static-content.springer.com10.1007... · Web viewThe M. tuberculosis HAD phosphatase (Rv3042c) interacts with host proteins and is inhibited by Clofazimine Sonal Shree 1, Abhishek](https://reader035.vdocuments.mx/reader035/viewer/2022081521/5aae62187f8b9aa8438c028c/html5/thumbnails/18.jpg)
(B)
(C)
(C)