spatial and temporal expression patterns of bmal delineate a circadian clock in the nervous system...

Spatial and Temporal Expression Patterns of BmalDelineate a Circadian Clock in the Nervous System ofBranchiostoma lanceolatumHelmut Wicht, Elke Laedtke, Horst-Werner Korf, and Christof Schomerus*Fachbereich Medizin der Johann Wolfgang Goethe-Universitat, Dr. Senckenbergische Anatomie, D-60590 Frankfurt, Germany

ABSTRACTWe cloned the homologue of the clock gene Bmal from acephalochordate, Branchiostoma lanceolatum (syn. am-phioxus). Amphioxus possesses a single copy of this gene(amphiBmal) that encodes for a protein of 649 amino acids,which is quite similar to BMALs of other chordates. Thegene is expressed by a restricted cell group in the anteriorvesicle of the neural tube, and its expression site coincideswith that of another clock gene, namely, amphiPer. Theexpression of amphiBmal shows a rhythmic fluctuation

that persists under constant darkness and is, thus, circa-dian. Similar to the situation in craniates, the peak phasesof the amphiBmal and amphiPer expression are offset by12 hours. Based on these observations and the putativehomology between the diencephalon of vertebrates andthe anterior vesicle of lancelets, we suggest a homologybetween the suprachiasmatic nucleus of craniates and theamphiBmal/amphiPer-expressing cell group of amphioxus.J. Comp. Neurol. 518:1837–1846, 2010.

© 2009 Wiley-Liss, Inc.

INDEXING TERMS: circadian; bmal; clock gene; lancelet; amphioxus; invertebrate

The animals on which we report here are famed for thephylogenetic role they play (see below). They are also no-torious for hiding not only in the sediments of their marinehabitat, but also behind an impressive array of synonyms:cirrostomes, cephalochordates, acraniates, lancelets,branchiostomids, amphioxi: the same beasts in differentdisguises. “Amphioxus” literally means “pointed at bothends.” Traditionally, the front end of amphioxus has at-tracted more scientific interest than the rear, because itsstudy was expected to shed light on the evolution of thecraniate (and human) head and brain.

Leaving aside the question of why the evolution of therear end of craniates and humans has attracted relativelyso little attention, it can be stated safely that the cephalo-chordates indeed are one of the outgroups of craniates(Delsuc et al., 2006). Thus, the interest in their anatomy isfully justified from the viewpoint of anyone interested inthe evolution of craniates (Garcia-Fernandez and Benito-Gutierrez, 2009). In addition, it has become clear in themeantime that amphioxi do possess a homologue of thecraniate diencephalon, namely, the anterior vesicle of theneural tube (Shimeld and Holland, 2004), and that, in ad-dition, some organs that are typical of the latter can beidentified and homologized even in lancelets: a homologueof the lateral eyes (the frontal organ), one of the pineal

organ (the lamellar body), and one of the subcommissuralorgan (the infundibular organ; for review see Wicht andLacalli, 2005). All these structures are located in the dien-cephalon of craniates; indeed, a telencephalon seems tobe entirely missing in cephalochordates.

In an attempt to address the question of whether lanceletsalso possess a circadian rhythm generator, which, in verte-brates, is typically located in the hypothalamus of the dien-cephalon, we have begun to investigate the spatiotemporalexpression patterns of clock genes (Schomerus et al., 2008).Clock genes encode for proteins with a well-defined and evo-lutionarily conserved function. Clock proteins regulate theirown transcription in a rhythmic manner and, thus, form anautoregulatory network of transcriptional-translational feed-back loops that is the basis for rhythm generation in circadianoscillators (Reppert and Weaver, 2002; Ko and Takahashi,2006). The vertebrate clock protein BMAL1 and its protosto-mian counterpart CYCLE are essential core components ofthe circadian clock, and mutation of the corresponding genesgenerates arrhythmicity (Rutila et al., 1998; Bunger et al.,

*CORRESPONDENCE TO: Christof Schomerus, Fachbereich Medizinder Johann Wolfgang Goethe-Universitat, Dr. Senckenbergische Anato-mie, Theodor-Stern-Kai 7, D-60590 Frankfurt, Germany.E-mail: [email protected]

Received 2 September 2009; Revised 28 October 2009; Accepted 19 Novem-ber 2009DOI 10.1002/cne.22306Published online December 8, 2009 in Wiley InterScience (www.interscience.wiley.com).© 2009 Wiley-Liss, Inc.

RESEARCH ARTICLE

The Journal of Comparative Neurology � Research in Systems Neuroscience 518:1837–1846 (2010) 1837

2000). In vertebrates, BMAL1 binds to the CLOCK protein toform heterodimers, which activate the transcription of geneswith specific circadian E-box elements in their promoter re-gions, including the Per and Cry genes (Gekakis et al., 1998;Kume et al., 1999). The resultant PER and CRY proteins formheterodimers, translocate back into the nucleus, and finallyinhibit their own CLOCK/BMAL-controlled transcription, thuscompleting the negative transcriptional feedback loop essen-tial for clockwork function. In mammals, the principal circa-dian oscillator is the hypothalamic nucleus suprachiasmati-cus (SCN) in the diencephalon. The SCN controls a largenumber of endocrine (e.g., cortisol or thyrotropin), physiolog-ical (e.g., core body temperature, urine volume, systolic bloodpressure), and behavioral (e.g., sleep/wakefulness) rhythmsin order to entrain these functions to the challenges and op-portunities provided by the 24-hour day/night cycle (for re-view see Hastings et al., 2007). This entrainment is accom-plished via neuronal and humoral signals originating from theSCN that coordinate the activity of independent peripheraloscillators in various tissues and organs so that coherentrhythmicity is generated on the organismic level (Reppert andWeaver, 2002; Hastings et al., 2007).

In the present paper, we report on the clock gene am-phiBmal, which we cloned from B. lanceolatum. It is ex-pressed in the same restricted cell group that has previ-ously been shown to express amphiPer (Schomerus et al.,2008), and the temporal pattern of its expression corre-sponds to the one seen in craniates. Thus, we put forwardthe hypothesis that lancelets possess a “homologue of theSCN” (hSCN) and that this diencephalic rhythm-generatingcell group is one of the “ancient building blocks” of thechordate brain.

MATERIALS AND METHODSAnimal maintenance

Adult specimens of B. lanceolatum were obtained fromthe Biologische Anstalt in Helgoland, Germany, and kept ina water tank filled with 250 liters of artificial sea water(“main aquarium”) as described by Schomerus et al.(2008). The lancelets were maintained at a constant tem-perature of 17°C under a standard photoperiod of 12hours light/12 hours dark (12/12 L/D) for at least 2weeks prior to the experiments. Light onset was at Zeitge-ber time (ZT) 0 and dark onset at ZT12. For gene expres-sion experiments under 12/12 L/D, animals were col-lected from this tank at ZT3, ZT9, ZT15, and ZT23.

For gene expression experiments under constant dark-ness (12/12 D/D), groups of 15 animals were transferredinto a 20-liter sea water tank (“experimental aquarium”) ina light-proof metal box, where exposure to visible light at70 cd/m2 (corresponding to approximately 10 �W/cm2)was controlled by an automatic timer (Schomerus et al.,

2008). Lancelets were first kept in this aquarium under12/12 L/D for 2 weeks, with additional dim red lightsconstantly switched on. The time period when only the redlight was switched on is referred to as darkness. Then, thephotoperiod was changed to 12/12 D/D, with visible lightconstantly switched off and red light constantly switchedon. Circadian time (CT) 0 refers to visible lights on, andCT12 refers to visible lights off during the previous cycle inLD (i.e., CT0 conforms to the beginning of subjective day,and CT12 conforms to the beginning of subjective dark-ness).

Cloning of the Bmal cDNA fromB. lanceolatum (amphiBmal)

Reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) tech-niques were applied basically as described earlier (Scho-merus et al., 2008) to clone the full-length Bmal cDNA fromB. lanceolatum. In brief, total RNA was isolated with Trizolreagent (Invitrogen, Karlsruhe, Germany) from the anteriortip of the body (rostrally of Hatschek’s pit) of adult lance-lets collected at ZT15. Complementary DNA (cDNA) was syn-thesized (Reverse-iT 1st Strand Synthesis Kit; Abgene, Ep-som, United Kingdom) and used as a PCR template with twodifferent pairs of gene-specific primers (forward primer 1:5�-CAACATGTTTGACGGTATGGAG-3�; reverse primer 1: 5�-CTCGTTATCCGCCTCGTTATC-3�; forward primer 2: 5�-AAAG-AGCGTAAGCATTATTTGGTG-3�; reverse primer 2: 5�-AGCG-ACCACAGTGTTGGTGTTG-3�) that correspond to nucleotidesequences retrieved from the Joint Genome Institute (JGI)v.1.0 Branchiostoma floridae genome assembly (http://genome.jgi-psf.org/; see also Putnam et al., 2008) bytBLASTn searches with several vertebrate BMAL1 protein se-quences as queries. Two overlapping B. lanceolatum BmalcDNA fragments were isolated, sequenced, and used for thedesign of gene-specific primers for 5�- and 3�RACE experi-ments with the FirstChoice RLM-RACE Kit (Ambion, Austin,TX). The following gene-specific primers were used: GCT-TCTCAATCTCGCTATGGTT (5�RACE outer primer) andTACTGACATTCTTGCGGCTGT (5�RACE inner primer); AAA-GAGCGTAAACATTACTTGGTG (3�RACE outer primer) andCTGACGTGCGTGTATCGTTT (3�RACE inner primer). Over-lapping cDNA sequences allowed assembly of the com-plete B. lanceolatum Bmal cDNA, designated amphiBmal(see Results).

Histology and in situ hybridizationLancelets kept under 12/12 L/D in the main aquarium

were collected during the light phase at ZT3 and ZT9 andduring the dark phase at ZT15 and ZT23, respectively.Lancelets kept under 12/12 D/D in the experimentalaquarium were caught at CT3 and CT9 during subjective

Wicht et al. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1838 The Journal of Comparative Neurology � Research in Systems Neuroscience

day and at CT15 and CT23 during subjective darkness. Theanimals were killed and fixed in 4% paraformaldehyde inphosphate-buffered saline (PBS; 0.1 M NaH2PO4, 0.15 MNaCl, pH 7.4). Cryosections were prepared as describedelsewhere (Schomerus et al., 2008). For this, the anteriorpart of the body (the so-called rostrum and the regionadjacent to the first myomere, containing the anterior ves-icle and the part of the neural tube immediately caudal toit; see Fig. 4) was cut into serial sections.

In situ hybridizations on cryosections from amphioxuswere performed according to Schomerus et al. (2008). Adigoxigenin-labeled antisense riboprobe complementaryto nucleotides 778–1284 of the amphiBmal coding se-quence was synthesized in vitro from a linearized plasmidusing the DIG RNA Labelling Kit (SP6/T7; Boehringer,Mannheim, Germany). Control sections were hybridizedwith the corresponding sense riboprobe. The hybridizedsignals were visualized by NBT/BCIP substrate (Roche,Mannheim, Germany).

Sequence analysesThe predicted protein sequences of the various BMAL

proteins of vertebrates and those of their protostomianhomologue, CYCLE, were obtained from the protein data-base of the NCBI (http://www.ncbi.nlm.nih.gov/). Geneidentifiers are supplied in the legend to Figure 2. For se-quence alignments, ClustalW2 software was used (Larkinet al., 2007). The construction of phylogenetic trees wasdone with MEGA version 4 software (Tamura et al., 2007).

Acquisition and handling of digital imagesImages from the in situ hybridizations and the histolog-

ical sections were acquired in a “tagged image file” formatwith a Zeiss microscope connected to a Kodak digital cam-era that was controlled by Kodak camera manager soft-ware. The colored images shown in Figures 4 and 5 weregenerated from such files in Photoshop (Adobe) with minoradjustments of brightness and contrast.

For the densitometric analyses, digital images were gen-erated with the same hardware but were recorded as gray-value files. The microscope settings as well as the param-eters of the analogue/digital conversion were keptconstant. Contrast and brightness were left untouched inthe subsequent densitometric analysis that was carriedout in Photoshop.

Densitometric analysesIn situ hybridized tissue sections from 34 animals killed

at four different time points and under different light re-gimes (see above; 22 animals for the D/L study, 12 forD/D) were subjected to densitometric analysis. Thus, eachdata point shown in the diagrams below (Figs. 5, 6) isbased on measurements in at least three individuals. Be-

cause of the large number of slides, the in situ stainingshad to be carried out in several batches. To obtain compa-rable data, each batch contained sections from all fourtime points, and all batches were subjected to the same insitu protocol with the same incubation times, tempera-tures, and reagents (riboprobes, digoxigenin probes, etc.)that were taken from from the same lots.

From each individual animal, those three or four adja-cent sections through the anterior vesicle that containedthe labeled cell groups (see below) were digitized. Thedensitometric measurements themselves were carried out“blindly” on these digital images; i.e., the person who didthe measurements was not aware of time points, batchnumbers, etc.

The regions to be analyzed were defined manually bymeans of the software’s selection tools. Because of the vary-ing size of the individual animals and the inevitable deforma-tion that occurred during sectioning, a set of “measurementmasks” had to be generated for each section (see Fig. 5). Twomore or less circular masks were placed over the dorsal partof the anterior vesicle, and a U-shaped mask was placed overthe ventral part. Another mask (not shown in Fig. 5) wasplaced over the notochord. The mean gray value (0–255) ofeach masked region was then read out of the histogram func-tion of the program, and the relative optical density (r.o.d.)was calculated using the formula r.o.d. � log(255/mean grayvalue). The r.o.d. determined in the notochord of one partic-ular section was subtracted from the r.o.d. of all othermasked areas of interest in the same section in order to cor-rect effects of varying section thickness and backgroundstaining.

All these r.o.d. values from individual sections were thenreassigned to their various time points and light regimes.The statistical analyses (Graph Pad, San Diego, CA) wereperformed using an ANOVA with subsequent Bonferronitests for multiple comparisons, with P � 0.05 as the crite-rion of significance.

RESULTSCloning of an amphioxus Bmal homolog

A 2,357-base-pair (bp) cDNA was cloned from a B. lan-ceolatum total RNA sample. The full-length cDNA clonecomprises a 130-bp 5�-untranslated region (UTR) and a1,947-bp open reading frame (ORF) terminated by a stopcodon (Fig. 1). The 3�-untranslated UTR is 277 bp in length,including a putative nonconsensus polyadenylation signal(TTTAAA; Retelska et al., 2006) 49 bp upstream of a poly-adenylation tail.

It is reasonable to propose that the ATG at position131–133 of the full-length cDNA clone is the initiationcodon, because it is the first ATG that is in-frame with theORF. In addition, it is flanked by purine bases at positions

------------------------------------------------------------------------------------------------------------------------------------------- Rhythmic Bmal expression in lancelets

The Journal of Comparative Neurology � Research in Systems Neuroscience 1839

–3 and �4, thus matching the Kozak consensus sequence,which is suggested to optimize translational efficiency(Kozak, 1987). On this basis, the cloned cDNA has thepotential to encode a protein of 649 amino acids with apredicted molecular mass of approximately 71 kDa. Astructural analysis of the cDNA indicated a marked simi-larity to Bmal genes from various vertebrate and nonverte-brate species (see below). Thus, the cloned gene was des-ignated amphioxus Bmal (amphiBmal).

Structural and phylogenetic analysis ofamphiBMAL

The predicted protein sequence of amphiBMAL groupedtogether with those of the different vertebrate BMALs inour phylogenetic trees. Most frequently, the resulting treesdisplayed the topology of the one shown in Figure 2, with

1 aatgacccagacggccatgttgttgtagcggccgctgccaagatg 46 cgttcctgtcgggcgatggttgtcttgtaagaaaagcggcctggg 91 ggacagcagggacgccttctcgggcgcagaaaacccaggg

131 atggtcggagacagcctaccgcctatctcatcaagttcatgtgca M V G D S L P P I S S S S C A 176 gacccctcgcagtacaactccagcaccaaggccagcaacatgttt D P S Q Y N S S T K A S N M F 221 gacggtatggaggcagacagccagatggacatggaccggatggac D G M E A D S Q M D M D R M D 266 cagtccgataccgacagccgcaagaatgtcagtatgttcagtcga Q S D T D S R K N V S M F S R 311 cagaaccatagcgagattgagaagcggcggcgagacaagatgaac Q N H S E I E K R R R D K M N 356 agttacatcatggaactgtcggccatgatccccatgtgcaatgcc S Y I M E L S A M I P M C N A 401 atgtcccgtaagctggacaagctgaccgtcctgcgaatggctgtc M S R K L D K L T V L R M A V 446 cagcacatgaagacactccgagcaactgcaaatcctttcactgag Q H M K T L R A T A N P F T E 491 ggcaacttcaaaccatcgttcctgtccgaagatgagctcaaacat G N F K P S F L S E D E L K H 536 cttattctagaggcagcggatgggttcctgttcgttgtgagctgt L I L E A A D G F L F V V S C 581 gaccgtggccggatcctgtacgtgtcagagtcagtggctcgagtg D R G R I L Y V S E S V A R V 626 ctgaactacaaccagagagacctgatgggtcagagctggttcgac L N Y N Q R D L M G Q S W F D 671 attctccatccgaaggacgtggccaaggtcaaagagcagctcctg I L H P K D V A K V K E Q L L 716 tcctccgacatgtcgcccagggagagactcatcgatgccaaaact S S D M S P R E R L I D A K T 761 ggtttcccagtgaaggcagacgttccaccgatgccgtcgtgcctg G F P V K A D V P P M P S C L 806 tgttccggggcgcgccgctcgtttttctgtcgcatgaagacgggg C S G A R R S F F C R M K T G 851 agagtggtaaaggaggagaagtacagccctgacagtgtcgctccc R V V K E E K Y S P D S V A P 896 tgttccagaaaaaaagagcgtaaacattacttggtgatccactgt C S R K K E R K H Y L V I H C 941 acggggtacctgaagagttggcagccctccaagatggggatcgag T G Y L K S W Q P S K M G I E 986 gaggataacgaggcggataacgagggatgtaacctgagctgtctc E D N E A D N E G C N L S C L1031 gtggcggtcgggcgcacgcaggccgtggcgaacccgggcatcgac V A V G R T Q A V A N P G I D1076 agcgccaacatcaacgtgaagccgctggagtttgtgtcgagactc S A N I N V K P L E F V S R L1121 accatcgaccacaagttcaccttcgtggaccagagagccacgacc T I D H K F T F V D Q R A T T1166 atcctgggctacctgccccaggagctgctgggcacctccagctat I L G Y L P Q E L L G T S S Y1211 gagtattactactacgaggacctgccacatctagcagagagccac E Y Y Y Y E D L P H L A E S H1256 aaagcagttctgacgacgaaagacaagatcctgacgtgcgtgtat K A V L T T K D K I L T C V Y1301 cgtttccgcgtgaaggacggacgcttcatcggcctgcggacgaaa R F R V K D G R F I G L R T K1346 tgcttcagctttcgcaacccgtggaccaaggaggtggaatacatc C F S F R N P W T K E V E Y I1391 gtcaacaccaatactgtggtcgctccaaatggagggaacactcca V N T N T V V A P N G G N T P1436 gtgtccgctacccctgccacactggccaacctggactctctctac V S A T P A T L A N L D S L Y1481 cactaccctatggaagctggtaaacagaaggttccatccgtgccg H Y P M E A G K Q K V P S V P1526 ggggtgccaggggggaccagacccggcgccggcaagatcggccga G V P G G T R P G A G K I G R1571 cagattgctgaggagatcatagaaatgcacagaagccgagcttcc Q I A E E I I E M H R S R A S1616 ccccccagccacagaggcacccccagtcccatgggcctggaccct P P S H R G T P S P M G L D P1661 ggacagaacggtggctctccgcacactcccatgatgacctcccct G Q N G G S P H T P M M T S P1706 ggcaaggtgatacagggcagtccaggcacccctaacctagtggca G K V I Q G S P G T P N L V A1751 tcttccggtatgagtcagccgtccaccagccaggcatcagaagga S S G M S Q P S T S Q A S E G1796 cagccagccagtctttccccaggtcaacaggaggctgacgccgcc Q P A S L S P G Q Q E A D A A1841 tcccctgccatcccgtgcacgcaccccaacggcctggtcctcccg S P A I P C T H P N G L V L P1886 cccacgcttgccaccaccctgcctgacatctccatcaacaccagc P T L A T T L P D I S I N T S1931 gaccacggtttcccgccggaactcgacccagccaacctgggcggg D H G F P P E L D P A N L G G1976 cccgagaacgacgaggcggccatggcggtcatcatgagcctgttg P E N D E A A M A V I M S L L2021 gaggcggacgctggtctgggcggaccggtgganttcagcgacatc E A D A G L G G P V X F S D I2066 ccgtggccgctgtga P W P L *

2081 cgaacgcatcgtggttagaagcctttatcaaagttaaactgcaat 2126 ttctaacacaaaaattggacttacccaaatttttaactgattaac 2171 tccagtccttttatcaaggaatgagcaatatatagttataagtgg 2216 ttaaaagccatatgaaactttggaaagtagtactccgtctggact 2161 tgcttgatgaagctatttcaattccaaaatttaaaaatttaatct 2306 ttcaggatgaacaagatggagttatgaaagatacacaagaaaaaa 2351 aaaaaaa

Figure 1. Nucleotide and deduced amino acid sequence of amphiB-mal. The START and STOP codons of the amphiBmal gene are indi-cated in boldface letters.

Figure 2. Evolutionary history of amphiBMAL and other known BMALproteins as inferred from their aligned protein sequences as predictedfrom their cDNAs, according to the minimum evolution method withpairwise elimination of gaps/missing data and bootstrap testing. Thepercentages of replicate trees in which the associated taxa clusteredtogether in the bootstrap test (3,000 replicates) are shown next to thebranching points. The “sister protein” relationship between amphiBMALand the vertebrate BMALs was also observed with the maximum-parsimony and neighbor-joining algorithms. BMALs from chordates aregrouped by a shaded background. The following protein sequences wereextracted from the National Center for Biotechnology Information (NCBI,Bethesda, MD) databases and were used for phylogenetic analyses (thisfigure), alignment and calculation of identity scores (Fig. 3): xenopusB-MAL1 [NCBI gene identifier (GI): 58700545], horseBMAL1 (GI:126352624), humanBMAL1a (GI: 71852580), ratBMAL1b (GI:3668183), mouseBMAL1 (GI: 6680732), chickenBMAL1 (GI:47825375), zebrafishBMAL1, zebrafishBMAL3 (GI: 21685554), chick-enBMAL2 (GI: 45383840), humanBMAL2 (GI: 31745180), (GI:7595268), ratBMAL2 (GI: 15277629), mouseBMAL2 (GI: 26986633),zebrafishBMAL2 (GI: 18858361), triboliumCYCLE (GI: 166998248),drosophilaCYCLE (GI: 24667005), culexBMAL/CYCLE (GI: 170058672),bombyxCYCLE (GI: 20373017), and antheraeaBMAL (GI: 38232200).

Wicht et al. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------


amphiBMAL as the “sister protein” of all vertebrateBMALs.

The predicted protein sequence of amphiBMAL showssubstantial structural similarity to BMAL proteins from var-ious vertebrate and nonvertebrate species (Fig. 3). Theoverall amino acid identity ranged from 40% (humanBMAL2) to 54% (human BMAL1). Notably, the overall am-phiBMAL amino acid sequence is consistently more similarto vertebrate BMAL1 proteins than to their correspondingBMAL2 paralogs. In general, sequence similarity betweenamphiBMAL and orthologous BMAL proteins is highest indomains that are conserved in other currently knownBMAL proteins and are critical for BMAL function. Thesecomprise the basic helix-loop-helix (bHLH) region, the PAS(PER-ARNT-SIM) A and B tandem repeats, and the BMALcarboxyterminal region (BCTR). The highest identity scoreto the corresponding domains in amphiBMAL was found inCYCLE from the fruitfly Drosophila melanogaster and inseveral vertebrate BMAL1 proteins (from zebrafish,mouse, and human) in the case of bHLH (79%), in severalvertebrate BMAL1 in the case of PAS-A (79%), in zebrafishBMAL2 in the case of PAS-B (78%), and in several verte-brate BMAL1 proteins in the case of BCTR (91%).

Spatial and temporal amphiBmal expressionpatterns

To investigate the localization of amphiBmal expressionin the anterior part of the neural tube, transverse cryosec-tions of adult lancelets were hybridized with amphiBmal-specific riboprobes. A specific and intense signal was ob-tained in the anterior vesicle (Fig. 4). The amphiBmal-

expressing cells are located in the caudal half of theanterior vesicle. As in the case of the amphiPer staining(Schomerus et al., 2008), the overall appearance of thatcell group resembled a “bent dumbbell with a U-shapedhandle” (Fig. 4D). The “handle” occupied the floor of theanterior vesicle, and the two spherical balls were localizeddorsally on either side in the walls of the vesicle.

A temporal analysis of amphiBmal expression was per-formed on sections from lancelets that were kept under12/12 D/D or under 12/12 D/L conditions and killed atCT3, CT9, CT15, and CT23 or at ZT3, ZT9, ZT15, and ZT23,respectively. Under DD conditions, amphiBmal expressionwas lowest at CT3 at the beginning of the subjective dayand highest at circadian time CT15 at the beginning of thesubjective darkness (Fig. 5). The circadian fluctuation ofamphiBmal was observed both in the “handle part” and inthe “balls”; however, the staining intensity was consis-tently stronger in the latter. Under a 12/12 D/L photope-riod, the temporal dynamics of the amphiBmal stainingintensity were the same. These data are shown in Figure 6,together with data on amphiPer expression under 12/12D/L adapted from Schomerus et al. (2008).

DISCUSSIONStructural analysis of amphiBMAL

We have cloned and characterized the cDNA encoding aBmal/Cycle homolog from a cephalochordate, B. lanceola-tum, designated amphiBmal. This is the first known Bmalgene from a deuterostome outside of craniates.

The structural analysis of the deduced amphiBMAL pro-tein sequence shows that amphiBMAL consists of 649amino acids and harbors several functional domains thatare well conserved in BMAL proteins from vertebrates andinsects. These domains comprise the PAS domain consist-ing of the PAS-A/PAS-B tandem repeats, the bHLH do-main, and the BMAL C-terminal region (BCTR). The PASdomain is required for heterodimerization of BMAL pro-teins with other bHLH-PAS proteins. The interaction withthe clock protein CLOCK is of particular importance (Gek-akis et al., 1998; Hogenesch et al., 1998). BMAL1/CLOCKheterodimers have been shown to bind to circadian E-boxelements in the promoter regions of target genes and stim-ulate their transcription (Gekakis et al., 1998; Kume et al.,1999). Among these are the Per and Cry genes. They codefor proteins that are themselves clock components thatdimerize and repress CLOCK/BMAL1 transcriptional activ-ity through mechanisms not yet completely understood(Reppert and Weaver, 2002; Sato et al., 2006). Moreover,the PAS domains play a crucial role in codependent phos-phorylation of BMAL1 and CLOCK that is important fornuclear translocation and transcriptional activity of theBMAL1/CLOCK heterodimer (Kondratov et al., 2003; Dar-

Figure 3. Schematic representation of functional domains in am-phiBMAL compared with BMAL proteins from various other species.Numbers indicate the percentage of amino acid identity relative toamphiBMAL. bHLH, basic helix-loop-helix domain; PAS-A and PAS-B,portions of the PAS protein–protein interaction domain; BCTR, BMALcarboxyterminal region. The protein sequences used for alignmentand calculation of identity score were extracted from the NationalCenter for Biotechnology Information databases (NCBI, Bethesda,MD; see legend to Fig. 2).



dente et al., 2007; see below). The bHLH domain wasshown primarily to convey DNA binding of the BMAL1/CLOCK heterodimers (Dardente et al., 2007). Finally, theBCTR represents the main transactivation domain of BMALproteins. The BCTR is important for the transcriptional ac-tivity of BMAL1 as well as for inhibition of this activity bythe transcriptional repressor CRY (Kiyohara et al., 2006,Sato et al., 2006). The dual role of the BCTR implies thepresence of a switch mechanism that controls the balancebetween activation and repression of the transcriptionalactivity of the BMAL1/CLOCK heterodimer. This mecha-nism may involve cyclic posttranslational modification(s)at the BCTR.

The general importance of reversible posttranslationalmodifications for the function of BMAL (and other clockproteins) is well documented. In particular, rhythmic phos-phorylation seems to be crucial for the control of BMALprotein–protein interactions, transcriptional activity, andlocalization. Biochemical analyses have revealed thatBMAL1 undergoes phosphorylation in vivo (Lee et al.,2001) and that the phosphorylated forms of BMAL1 (andalso of CLOCK) occur mostly in the nucleus but not in thecytoplasm (Kondratov et al., 2003), at times correspond-ing to the expected maximal transcriptional activity of theheterodimer. Thus, it has been suggested that the phos-phorylation status of BMAL1 determines heterodimeriza-

Figure 4. Localization of amphiBmal expression in B. lanceolatum. A,B: In situ hybridizations with an antisense (A) and a sense (B) probe foramphiBmal. Note that both sections are at the same transverse level, cutting the entry point of the second nerve (2) dorsally and the infundibularorgan (io) ventrally. In both cases, there is some punctate labeling in the connective tissues dorsal to the first myomere and in the connectivetissue sheath of the neural tube, but the cytoplasmic label that is seen in the cells of the neural tube in A is lacking in B. The sections were obtainedfrom animals kept under 12/12 D/D and killed at CT9. C: Schematic drawing of a midsagittal section through the anterior part of the neural tubeand its surroundings. The ventricular system is shaded. The transverse sections in this and the following figure stem from the boxed region of theanterior vesicle. D: Sketch meant to illustrate the overall “balls and bent handle” appearance of the amphiBmal/amphiPer-expressing cell group.1,2, First and second nerves; dfc, dorsal fin coelome; Kp, Kolliker’s pit; m1, outlines of chevron-shaped first myomere; fo, frontal organ; io,infundibular organ. Scale bar � 50 �m.

Wicht et al. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------


tion with CLOCK, changes in the subcellular localization ofCLOCK, and/or the transcriptional activity of the BMAL1/CLOCK heterodimer (Kondratov et al., 2006; Dardente etal., 2007). Along these lines, the repression of BMAL tran-scriptional activity by CRY may be caused by stabilizingunphosphorylated forms of BMAL and thereby shifting thephosphorylated/unphosphorylated BMAL1 ratio toward apredominantly unphosphorylated (transcriptionally inac-tive) form (Dardente et al., 2007). There is also growingevidence that protein phosphorylation masks or unmaskslocalization sequences in BMAL and in other clock proteins(Hirayama and Sassone-Corsi, 2005). Notably, nuclear lo-calization signals and nuclear export signals are presentnot only in BMAL proteins from mammals (Kwon et al.,2006) but also in amphiBMAL (amino acids 67–73EKRRRDK and amino acids 95–103 LDKLTVLRM, respec-tively).

In view of the importance of phosphorylation forBMAL function, we searched the amphiBMAL primary

sequence for phosphorylation motifs known from verte-brate BMAL1 proteins. Several MAPK phosphorylationsites (Sanada et al., 2002) and a putative casein kinase(CK)I� consensus phosphorylation site (Eide et al.,2002; Hirayama and Sassone-Corsi, 2005) located inthe BCTR of vertebrates are absent in amphiBMAL. An-other important phosphorylation site is a CK2� motif atthe amino terminus of BMAL1 which, in the mouse, isessential for regulation of nuclear entry of BMAL1 andcircadian rhythmicity (Tamaru et al., 2009). Although aserine is found in position 76 from amphiBMAL, whichcorresponds to the CK2� phosphoacceptor Ser90 inmouse BMAL1, the amino acid context does not match acanonical CK2� motif.

These sequence analysis data suggest differences be-tween the regulation of amphiBMAL (and BMAL orthologsfrom protostomians, which also do not contain the above-mentioned phosphorylation motifs) on the one side andBMAL proteins from vertebrates on the other side. Irre-

Figure 5. Circadian expression of amphiBmal. A–D: In situ hybridizations with an antisense probe for amphiBmal. The sections were obtained fromlancelets kept under 12/12 D/D and killed at the circadian time points indicated. The white outlines in C show the regions that were selected forthe aquisition of the densitometric data in that particular section; similar masks were generated for all other sections. E: Densitometric analysisof the hybridization signals in the “balls” (solid squares) and “bent handle” part (open squares) of the dumbbell-shaped, Bmal-expressing cellgroup. The asterisks indicate significant (P � 0.05) differences between values compared with those obtained at CT3. For details of thedensitometric analysis see Material and Methods. The gray and black bars indicate subjective day and subjective night, respectively. Scale bar �50 �m.



spective of these differences, however, posttranslationalmodification may still be important for amphiBMAL func-tion and may involve phosphorylation events other thanthose discussed and/or mechanisms different from phos-phorylation (Cardone et al., 2005; Hirayama et al., 2007).

Phylogeny of the suprachiasmatic nucleusand the forebrain

amphiBmal and a second clock gene, amphiPer (Schom-erus et al., 2008), are expressed in the same restricted andcircumscribed cell group in the anterior vesicle of B. lan-ceolatum. This vesicle, as a whole, is supposed to be ahomologue of the diencephalon of craniates (see the intro-ductory papagraphs). Both the expression of amphiPer(Schomerus et al., 2008) and that of amphiBmal show arobust diurnal fluctuation, which, in the case of amphiBmal,has been shown to persist even under constant darkness.The temporal dynamics of the expression of both clockgenes correspond to those seen in the hypothalamic SCNof craniates (Jilg et al., 2005), with the peaks of the am-phiBmal and amphiPer expression being offset by 12 hours(Fig. 6). The phylogenetic analyses place the clock proteinsof amphioxus in the immediate vicinity of those of crani-ates. The structural analysis of the functional domains ofthese proteins shows a high degree of similarity to those ofcraniates. Thus, from various points of view, it seems rea-sonable to hypothesize that the clock-gene-expressing cell

group in the anterior vesicle of lancelets is a homologue ofthe craniate SCN.

The dorsal, spherical part of the amphiBmal- andamphiPer-expressing cell group has previously been recog-nized by Ekhart et al. (2003) as the “anteriormost part ofthe anterolateral periventricular cell group.” Obviously,this term is a little bulky. Not only for that reason but alsobased on the similarities to the craniate SCN (see above),we would like to suggest identifying the entire dumbbell-shaped cell group in the anterior vesicle of lancelets as the“homologue of the suprachiasmatic nucleus” (hSCN). Theterm “SCN” alone would make very little sense in an animalthat does not have lateral eyes and an optic chiasm.Cephalochordates do, however, possess a multitude ofphotoreceptors (Wicht and Lacalli, 2005), and some, suchas the frontal organ and the larval lamellar organ, are lo-cated in the immediate vicinity of the hSCN. Light can beused to entrain the behavioral activity of lancelets (Scho-merus et al., 2008). Thus, it is quite likely that a signallingpathway similar to that seen in craniates (retinal photore-ceptors3 SCN) is also used by cephalochordates to syn-chronize their physiological rhythms with those of the en-vironment.

Notably, a Bmal homologue was not found in agenomewide survey in the urochordate Ciona intestina-lis (Satou et al., 2003), and so far nothing is knownabout the localization of rhythm-generating cell groupsin tunicates in general. Given the fact that an endoge-nous oscillator occurs in practically all living beings (Wi-jnen and Young, 2006), it is not very likely that it shouldbe missing in tunicates, even though it may have anunusual molecular and anatomical design. However,even in that case, the currently available data on thephylogenetic interrelationship of chordates (Delsuc etal., 2006) and the data on the hSCN that we have pre-sented here would indicate that the presence of anSCN/hSCN is a plesiomorphic trait for chordates.

If we now compare the entire forebrains of larval tuni-cates (Nicol and Meinertzhagen, 1991, Meinertzhagen etal., 2004), cephalochordates (Wicht and Lacalli, 2005;present paper), and those of craniates, three facts (triviaindeed) become evident immediately. In the stem line lead-ing to craniates, there must have been an enormous in-crease in sheer size, number of neurons, and complexity.The following calculations and estimates support this con-clusion: larval tunicates have a about 200 cells in theiranterior (“sensory”) vesicle; we estimate (roughly) thatthere are 1,000–2,000 cells in the anterior vesicle of Bran-chiostoma, but there are millions and billions of them in theforebrains of craniates. Complexity is far more difficult tomeasure; if it is measured in terms of delineable cellgroups, there are six such groups, including a photorecep-tor, in tunicates (Nicol and Meinertzhagen, 1991) but

Figure 6. Temporal relationship between amphiBmal and amphiPerexpression in lancelets kept under a 12/12 L/D photoperiod. Thedata on amphiBmal expression were raised by in situ hybridizationswith an amphiBmal antisense probe on sections from lancelets thatwere killed at the Zeitgeber time points indicated. The data on am-phiPer expression were adapted from Schomerus et al. (2008). Theasterisks and number signs indicate significant (P � 0.05) differ-ences of the respective amphiBmal and amphPer values comparedwith those obtained at ZT3. The white and black bars indicate thelight and dark phase, respectively.

Wicht et al. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------


about 50–100 in nonmammalian vertebrates and morethan 250 in mammals (Wicht and Northcutt, 1992). Foradult cephalochordates (Meves, 1973; Ekhart et al., 2003;present study), we can now discern five cell groups: pig-ment cells and sensory cells of the frontal organ, cells ofthe infundibular organ, cells of the hSCN as describedhere, and “remaining” cells of the anterior vesicle.

Obviously, the increase in cell number in craniates ismost impressive and forms the material basis for the in-crease in size and complexity, but how did complexityevolve on that background of addition of malleable cellularmaterial? If our hypothesis concerning the homology of theSCN/hSCN holds true, it apparently was a process of ad-dition of new units to already existing ones. The presenceof a photoreceptive organ (tunicates, cephalochordates,craniates), circumscribed infundibular and subcommis-sural organs (cephalochordates and craniates), a neurohy-pophyseal homologue (tunicates and craniates), and anSCN (craniates and cephalochordates) makes it likely thatthese were among the ancient “building blocks” of thechordate brain, serving as a solid basis for the cathedral ofcomplexity that was to be erected from new stones on oldfoundations later in evolution.

LITERATURE CITEDBunger MK, Wilsbacher LD, Moran SM, Clendenin C, Radcliffe LA,

Hogenesch JB, Simon MC, Takahashi JS, Bradfield CA. 2000.Mop3 is an essential component of the master circadianpacemaker in mammals. Cell 103:1009–1017.

Cardone L, Hirayama J, Giordano F, Tamaru T, Palvimo JJ,Sassone-Corsi P. 2005. Circadian clock control by SUMOyla-tion of BMAL1. Science 309:1390–1394.

Dardente H, Fortier EE, Martineau V, Cermakian N. 2007. Cryp-tochromes impair phosphorylation of transcriptional activa-tors in the clock: a general mechanism for circadian repres-sion. Biochem J 402:525–536.

Delsuc F, Brinkmann H, Chourrout D, Philippe H. 2006. Tunicatesand not cephalochordates are the closest living relatives ofvertebrates. Nature 439:965–968.

Eide EJ, Woolf MF, Kang H, Woolf P, Hurst W, Camacho F,Vielhaber EL, Giovanni A, Virshup DM. 2005. Control ofmammalian circadian rhythm by CKIepsilon-regulatedproteasome-mediated PER2 degradation. Mol Cell Biol 25:2795–2807.

Ekhart D, Korf HW, Wicht H. 2003. Cytoarchitecture, topography,and descending supraspinal projections in the anterior ner-vous system of Branchiostoma lanceolatum. J Comp Neurol466:319–330.

Garcia-Fernandez J, Benito-Gutierrez E. 2009. It’s a long way fromamphioxus: descendants of the earliest chordate. Bioessays31:665–675.

Gekakis N, Staknis D, Nguyen HB, Davis FC, Wilsbacher LD, KingDP, Takahashi JS, Weitz CJ. 1998. Role of the CLOCK proteinin the mammalian circadian mechanism. Science 280:1564–1569.

Hastings M, O’Neill JS, Maywood ES. 2007. Circadian clocks:regulators of endocrine and metabolic rhythms. J Endocrinol195:187–198.

Hirayama J, Sassone-Corsi P. 2005. Structural and functionalfeatures of transcription factors controlling the circadianclock. Curr Opin Genet Dev 15:548–556.

Hirayama J, Sahar S, Grimaldi B, Tamaru T, Takamatsu K, Naka-hata Y, Sassone-Corsi P. 2007. CLOCK-mediated acetylationof BMAL1 controls circadian function. Nature 450:1086–1090.

Hogenesch JB, Gu YZ, Jain S, Bradfield CA. 1998. The basic-helix-loop-helix-PAS orphan MOP3 forms transcriptionally activecomplexes with circadian and hypoxia factors. Proc Natl AcadSci USA 95:5474–5479.

Jilg A, Moek J, Weaver DR, Korf HW, Stehle JH, von Gall C. 2005.Rhythms in clock proteins in the mouse pars tuberalis dependon MT1 melatonin receptor signalling. Eur J Neurosci 22:2845–2854.

Kiyohara YB, Tagao S, Tamanini F, Morita A, Sugisawa Y, YasudaM, Yamanaka I, Ueda HR, van der Horst GT, Kondo T, Yagita K.2006. The BMAL1 C terminus regulates the circadian tran-scription feedback loop. Proc Natl Acad Sci USA 103:10074–10079.

Ko CH, Takahashi JS. 2006. Molecular components of the mam-malian circadian clock. Hum Mol Genet 15:R271–R277.

Kondratov RV, Chernov MV, Kondratova AA, Gorbacheva VY,Gudkov AV, Antoch MP. 2003. BMAL1-dependent circadianoscillation of nuclear CLOCK: posttranslational events in-duced by dimerization of transcriptional activators of themammalian clock system. Genes Dev 17:1921–1932.

Kondratov RV, Shamanna RK, Kondratova AA, Gorbacheva VY,Antoch MP. 2006. Dual role of the CLOCK/BMAL1 circa-dian complex in transcriptional regulation. FASEB J 20:530 –532.

Kozak M. 1987. An analysis of 5�-noncoding sequences from 699vertebrate messenger RNAs. Nucleic Acids Res 15:8125–8148.

Kume K, Zylka MJ, Sriram S, Shearman LP, Weaver DR, Jin X,Maywood ES, Hastings MH, Reppert SM. 1999. mCRY1 andmCRY2 are essential components of the negative limb of thecircadian clock feedback loop. Cell 98:193–205.

Kwon I, Lee J, Chang SH, Jung NC, Lee BJ, Son GH, Kim K, Lee KH.2006. BMAL1 shuttling controls transactivation and degrada-tion of the CLOCK/BMAL1 heterodimer. Mol Cell Biol 19:7318–7330.

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thomp-son JD, Gibson TJ, Higgins DG. 2007. Clustal W and Clustal Xversion 2.0. Bioinformatics 23:2947–2948.

Lee C, Etchegaray JP, Cagampang FR, Loudon AS, Reppert SM.2001. Posttranslational mechanisms regulate the mammaliancircadian clock. Cell 107:855–867.

Meinertzhagen IA, Lemaire P, Okamura Y. 2004. The neurobiol-ogy of the ascidian tadpole larva: recent developments in anancient chordate. Annu Rev Neurosci 27:453–485.

Meves A. 1973. Elektronenmikroskopische Untersuchungenuber die Zytoarchitektur des Gehirns von Branchiostoma lan-ceolatum. Z Zellforsch 139:511–532.

Nicol D, Meinertzhagen IA. 1991. Cell counts and maps in thelarval central nervous system of the ascidian Ciona intestinalis(L.). J Comp Neurol 309:415–429.

Putnam NH, Butts T, Ferrier DE, Furlong RF, Hellsten U, Ka-washima T, Robinson-Rechavi M, Shoguchi E, Terry A, Yu JK,Benito-Gutierrez EL, Dubchak I, Garcia-Fernandez J, Gibson-Brown JJ, Grigoriev IV, Horton AC, de Jong PJ, Jurka J, Kapi-tonov VV, Kohara Y, Kuroki Y, Lindquist E, Lucas S, OsoegawaK, Pennacchio LA, Salamov AA, Satou Y, Sauka-Spengler T,Schmutz J, Shin-I T, Toyoda A, Bronner-Fraser M, Fujiyama A,Holland LZ, Holland PW, Satoh N, Rokhsar DS. 2008. Theamphioxus genome and the evolution of the chordate karyo-type. Nature 453:1064–1071.

Reppert SM, Weaver DR. 2002. Coordination of circadian timingin mammals. Nature 418:935–941.



Retelska D, Iseli C, Bucher P, Jongeneel CV, Naef F. 2006. Simi-larities and differences of polyadenylation signals in humanand fly. BMC Genomics 7:176–185.

Rutila JE, Suri V, Le M, So WV, Rosbash M, Hall JC. 1998. CYCLEis a second bHLH-PAS clock protein essential for circadianrhythmicity and transcription of Drosophila period and time-less. Cell 93:805–814.

Sanada K, Okano T, Fukada Y. 2002. Mitogen-activated proteinkinase phosphorylates and negatively regulates basic helix-loop-helix-PAS transcription factor BMAL1. J Biol Chem 277:267–271.

Sato TK, Yamada RG, Ukai H, Baggs JE, Miraglia LJ, Kobayashi TJ,Welsh DK, Kay SA, Ueda HR, Hogenesch JB. 2006. Feedbackrepression is required for mammalian circadian clock func-tion. Nat Genet 38:312–319.

Satou Y, Imai KS, Levine M, Kohara Y, Rokhsar D, Satoh N. 2003.A genomewide survey of developmentally relevant genes inCiona intestinalis. I. Genes for bHLH transcription factors. DevGenes Evol 213:213–221.

Schomerus C, Korf HW, Laedtke E, Moret F, Zhang Q, Wicht H.2008. Nocturnal behavior and rhythmic period gene expres-

sion in a lancelet, Branchiostoma lanceolatum. J Biol Rhythms23:170–181.

Shimeld SM, Holland ND. 2004. Amphioxus molecular biology:insights into vertebrate evolution and developmental mecha-nisms. Can J Zool 83:90–100.

Tamaru T, Hirayama J, Isojima Y, Nagai K, Norioka S, TakamatsuK, Sassone-Corsi P. 2009. CK2alpha phosphorylates BMAL1to regulate the mammalian clock. Nat Struct Mol Biol 16:446–448.

Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: MolecularEvolutionary Genetics Analysis (MEGA) software version 4.0.Mol Biol Evol 24:1596–1599.

Wicht H, Lacalli TC. 2005. The nervous system of amphioxus:structure, development, and evolutionary significance. Can JZool 83:122–150.

Wicht H, Northcutt RG. 1992. The forebrain of the Pacific hagfish:a cladistic reconstruction of the ancestral craniate forebrain.Brain Behav Evol 40:25–64.

Wijnen H, Young MW. 2006. Interplay of circadian clocks andmetabolic rhythms. Annu Rev Genet 40:409–448.

Wicht et al. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------


spatial and temporal expression patterns of bmal delineate a circadian clock in the nervous system...

Documents