sophien's lectures on oomycetes, uea bio 6007b, january 2016

Crop losses due to fungi and oomycetes (filamentous plant pathogens)

Fisher et al. 2012

Veredeling voor resistentie niet gelukt The Irish potato famine pathogen Phytophthora infestans causes potato blight

Phytophthora Irish potato famine pathogen Greek for plant destroyer fungus-like oomycete

Ü  Infection cycle and diversity

Ü Evolutionary history

Ü Genome architecture and evolution

Ü Virulence mechanisms: effector biology

Ü Host resistance and evasion of resistance

Ü Breeding host resistance: prospects and challenges

What you will learn – Phytophthora and the oomycetes

Fifi the oomycete is a scary parasite,

With flagellated spores and hyphal threads

She kills crops and triggers blight.

Infection cycle and diversity

Infection cycle of Phytophthora infestans

Infection cycle of Phytophthora infestans

Zoospore cyst

appressorium Infection vesicle

haustorium

sporangium

Phytophthora infestans

necrotrophy biotrophy

Phytophthora infestans is a hemibiotroph – undergoes a biotrophic phase and then becomes necrotrophic

Filamentous growth of Phytophthora

Appressoria – Infection structures that enable penetration of plant tissue

appressorium

Haustoria – Infection structures that enable nutrient uptake and secretion of effector proteins

Coffey and Wilson, 1983

Tolga Bozkurt, Imperial College

Extrahaustorial membrane (EHM)

haustorium

Haustoria – pathogen infection structures that are surrounded by a host-derived membrane

Bozkurt et al. Curr Opin Plant Biol 2012

Haustoria enable secretion of effector proteins and nutrient uptake

suppress immunity, alter host physiology

nutrients?

Asexual spores – finding the host and dispersal Sporangia and zoospores

a d

c f

g h

↓ ↓

↓ ↓

↓

↓ ↓

↓ ↓

↓ b↓ ↓ ↓ ↓

↓ ↓ ↓ ↓

↓ ↓

↓ ↓

↓ ↓

↓

↓ ↓ ↓ ↓ ↓

↓ ↓ ↓ ↓

e↓ ↓

↓ ↓ ↓

↓ ↓ ↓

↓

↓ ↓

*

Phytophthora palmivora: Root tip (electrotaxis)

Pythium aphanidermatum: Wound exudates (chemotaxis)

Zoospore-root interactions

Fifi the oomycete is a scary parasite,

With flagellated spores and hyphal threads

She kills crops and triggers blight.

Infection cycle and diversity

Oomycete phylogeny and diversity

Colonized many ecological niches yet more than 60% of species are parasitic on plants

■  Obligate biotrophic parasites: require living plants to grow, usually do not kill host plants

■  Largest number of species

■  Typically host specific/specialized parasites: one species infects one plant species

■  Best studied is Hyaloperonospora arabidopsidis (Hpa); infects host plant Arabidopsis thaliana

Downy mildews

Variety of symptoms caused by downy mildews on plants

■  Phytophthora are the most important pathogens of dicot plants, causing tens of billions of dollars of losses annually

■  Phytophthora infestans, the agent of late blight of potato and tomato, causes more crop losses than any other member of the genus

■  But there are many other species that are damaging to natural and agricultural ecosystems

Phytophthora: “plant killers”

Phytophthora capsici causes blight on several vegetables

Phytophthora ramorum and Phytophthora kernoviae infect many native British woodland species and are a threat to the environment

Fifi the oomycete is a heterokont, they say,

She’s fungus-like but the scientists

Know how she had plastids one day.

Evolutionary history

Phytophthora is an oomycete not a fungus

Oomycetes are fungus-like filamentous microbes: a unique group of eukaryotic plant pathogens

Plant pathogens in green Animal parasites in red Tree adapted from Embley and Martin (2006) Nature 440:623

(Het

erok

onts

)

Christine Strullu-Derrien and Paul Kenrick @ Natural History Museum

Oomycetes form an ancient eukaryotic lineage §  may have been parasitic ~300

million year ago §  present in the 407 million year-old

Rhynie Chert, an ecosystem of plants, fungi and oomycetes

■  Unrelated to fungi, more closely related to brown algae and diatoms in the Stramenopiles (Heterokonts)

■  Supported by molecular phylogenies based on ribosomal RNA sequences, compiled amino acid data for mitochondrial proteins, and protein encoding chromosomal genes

■  Exhibit fungal-like filamentous (hyphal) growth and several fungal-like morphological structures

Oomycetes - Phylogeny

Fifi the oomycete has a big genome, they say,

Full of repeats but don’t call it junk

‘cause can be handy one day.

Genome architecture and evolution

Veredeling voor resistentie niet gelukt Why the misery? Why are oomycetes the scourge of farmers worldwide?

§  Phytophthora are astonishing plant destroyers that can wipe out crops in days but the secret of their success is their ability to rapidly adapt to resistant plant varieties

§  How did Phytophthora and other oomycetes manage to keep on changing and adapting to ensure their uninterrupted survival over evolutionary time?

2006

intrinsic light scattering in bR) will help establishthe exact nature of the field interaction. The mainconclusion is that the experiment is clearly in theweak field limit and the laser field is not stronglyperturbing the underlying thermally populatedmodes, but rather inducing their interference inthe excited-state surface. Isomerization yieldswerealso compared with and without phase control(Fig. 6C), keeping spectral amplitudes constant(Fig. 6D; spectral profiles were confirmed usinga tunable monochromator with 0.2-nm spec-tral resolution). The data show a clear phasedependence indicative of coherent control.

Pure amplitude modulation alters the temporalprofile of the pulse (fig. S5); therefore, removingthe phase modulation affects the isomerizationyield by only 5 to 7%. The phase sensitivity ofthe control efficiency further illustrates the co-herent nature of the state preparation.

The temporal profiles of the shaped optimal andanti-optimal pulses and the observed degree of theisomerization yield control are consistent with theknown fast electronic dephasing of bR (10, 38).The largest field amplitudes are confined to ap-proximately 300-fs widths to yield 20% control. Inthe case of transform-limited pulses, all the vibra-tional levels within the excitation bandwidth areexcited in phase and there is a fast decoherence inthe initial electronic polarization (38). However,with the phase-selective restricted bandwidths inthe shaped pulses, there is an opportunity to ma-nipulate different vibrational stateswithmuch long-er coherence times than the electronic polarization.The resultant constructive and destructive interfer-ence effects involving vibrational modes displacedalong the reaction coordinate offer the possibility ofcontrolling isomerization. Experimental obser-vations presented here show that the wave proper-ties ofmatter can play a role in biological processes,to the point that they can even be manipulated.

References and Notes1. M. Shapiro, P. Brumer, Rep. Prog. Phys. 66, 859 (2003).2. S. H. Shi, H. Rabitz, J. Chem. Phys. 92, 364 (1990).3. W. T. Pollard, S. Y. Lee, R. A. Mathies, J. Chem. Phys. 92,

4012 (1990).4. Q. Wang, R. W. Schoenlein, L. A. Peteanu, R. A. Mathies,

C. V. Shank, Science 266, 422 (1994).5. K. C. Hasson, F. Gai, P. A. Anfinrud, Proc. Natl. Acad. Sci.

U.S.A. 93, 15124 (1996).6. T. Ye et al., J. Phys. Chem. B 103, 5122 (1999).7. R. Gonzalez-Luque et al., Proc. Natl. Acad. Sci. U.S.A. 97,

9379 (2000).8. T. Kobayashi, T. Saito, H. Ohtani, Nature 414, 531 (2001).9. J. Herbst, K. Heyne, R. Diller, Science 297, 822 (2002).

10. J. T. M. Kennis et al., J. Phys. Chem. B 106, 6067 (2002).11. S. Hayashi, E. Tajkhorshid, K. Schulten, Biophys. J. 85,

1440 (2003).12. S. C. Flores, V. S. Batista, J. Phys. Chem. B 108, 6745 (2004).13. Y. Ohtsuki, K. Ohara, M. Abe, K. Nakagami, Y. Fujimura,

Chem. Phys. Lett. 369, 525 (2003).14. G. Vogt, G. Krampert, P. Niklaus, P. Nuernberger,

G. Gerber, Phys. Rev. Lett. 94, 068305 (2005).15. K. Hoki, P. Brumer, Phys. Rev. Lett. 95, 168305 (2005).16. J. L. Herek, W. Wohlleben, R. J. Cogdell, D. Zeidler,

M. Motzkus, Nature 417, 533 (2002).17. J. Tittor, D. Oesterhelt, FEBS Lett. 263, 269 (1990).18. S. L. Logunov, M. A. El-Sayed, J. Phys. Chem. B 101, 6629

(1997).19. H. J. Polland et al., Biophys. J. 49, 651 (1986).

20. F. Gai, K. C. Hasson, J. C. McDonald, P. A. Anfinrud,Science 279, 1886 (1998).

21. See supporting data on Science Online.22. V. I. Prokhorenko, A. M. Nagy, R. J. D. Miller, J. Chem.

Phys. 122, 184502 (2005).23. A. K. Dioumaev, V. V. Savransky, N. V. Tkachenko,

V. I. Chukharev, J. Photochem. Photobiol. B Biol. 3, 397(1989).

24. G. Schneider, R. Diller, M. Stockburger, Chem. Phys. 131,17 (1989).

25. A. Xie, Biophys. J. 58, 1127 (1990).26. S. P. Balashov, E. S. Imasheva, R. Govindjee, T. G. Ebrey,

Photochem. Photobiol. 54, 955 (1991).27. J. Paye, IEEE J. Quant. Electron. 28, 2262 (1992).28. H. L. Fragnito, J.-Y. Bigot, P. C. Becker, C. V. Shank, Chem.

Phys. Lett. 160, 101 (1989).29. A. B. Myers, R. A. Harris, R. A. Mathies, J. Chem. Phys. 79,

603 (1983).30. B. X. Hou, N. Friedman, M. Ottolenghi, M. Sheves,

S. Ruhman, Chem. Phys. Lett. 381, 549 (2003).31. R. Morita, M. Yamashita, A. Suguro, H. Shigekawa, Opt.

Commun. 197, 73 (2001).32. K. Blum, Density Matrix Theory and Applications (Plenum,

New York, 1981).33. D. Gelman, R. Kosloff, J. Chem. Phys. 123, 234506 (2005).34. J. Hauer, H. Skenderovic, K.-L. Kompa, M. Motzkus, Chem.

Phys. Lett. 421, 523 (2006).35. D. Oesterhelt, W. Stoeckenius, in Methods in Enzymology,

vol. 31 of Biomembranes (Academic Press, New York,1974), pp. 667–678.

36. The saturation energy is related to the absorption crosssection s as Es 0 1/strans (for a negligibly smallcontribution of the excited-state emission), and s is

related to the extinction coefficient e as s 0 [log(10)/NA]e 0 3.86 ! 10j21e, where NA is Avogadro’s number.

37. The fraction of excited molecules can be estimated as aratio between the number of absorbed photons np 0Eexc ! pd20/4 and the number of retinal molecules Nm 0C ! V in an excited volume V0 ; l0 ! pd20/4, where theconcentration is C 0 2.303A0/strans, A0 is OD at 565 nm(0.9), l0 0 0.04 cm is the path length in the cell used,and d0 0 0.015 cm is the beam diameter in the sample.This gives a fraction of excited molecules of 0.0236 (thatis, 1 out of 42.3 molecules will be excited during theexcitation pulse at a given fluence). The fraction ofdouble-excited molecules can be estimated from thePoisson distribution f(k) 0 ejl(l)k/k!, where l 0 0.0236,and k is the number of occurrences (k 0 1 for thesingle excitation, k 0 2 for the double excitation, etc.).Thus, the fraction of double-excited moleculesf(2)/f(1) 0 l/2; that is, 1.18%.

38. V. F. Kamalov, T. M. Masciangioli, M. A. El-Sayed, J. Phys.Chem. 100, 2762 (1996).

39. K. Edman et al., Nature 401, 822 (1999).40. This work was supported by the National Sciences and

Engineering Research Council of Canada. The authorsthank J.T.M. Kennis, Vrije Universiteit Amsterdam, forhelpful discussions of preliminary results.

Supporting Online Materialwww.sciencemag.org/cgi/content/full/313/5791/1257/DC1Materials and MethodsFigs. S1 to S5References

1 June 2006; accepted 10 August 200610.1126/science.1130747

Phytophthora Genome SequencesUncover Evolutionary Origins andMechanisms of PathogenesisBrett M. Tyler,1* Sucheta Tripathy,1 Xuemin Zhang,1 Paramvir Dehal,2,3 Rays H. Y. Jiang,1,4

Andrea Aerts,2,3 Felipe D. Arredondo,1 Laura Baxter,5 Douda Bensasson,2,3,6 Jim L. Beynon,5

Jarrod Chapman,2,3,7 Cynthia M. B. Damasceno,8 Anne E. Dorrance,9 Daolong Dou,1

Allan W. Dickerman,1 Inna L. Dubchak,2,3 Matteo Garbelotto,10 Mark Gijzen,11

Stuart G. Gordon,9 Francine Govers,4 Niklaus J. Grunwald,12 Wayne Huang,2,14

Kelly L. Ivors,10,15 Richard W. Jones,16 Sophien Kamoun,9 Konstantinos Krampis,1

Kurt H. Lamour,17 Mi-Kyung Lee,18 W. Hayes McDonald,19 Monica Medina,20

Harold J. G. Meijer,4 Eric K. Nordberg,1 Donald J. Maclean,21 Manuel D. Ospina-Giraldo,22

Paul F. Morris,23 Vipaporn Phuntumart,23 Nicholas H. Putnam,2,3 Sam Rash,2,13

Jocelyn K. C. Rose,24 Yasuko Sakihama,25 Asaf A. Salamov,2,3 Alon Savidor,17

Chantel F. Scheuring,18 Brian M. Smith,1 Bruno W. S. Sobral,1 Astrid Terry,2,13

Trudy A. Torto-Alalibo,1 Joe Win,9 Zhanyou Xu,18 Hongbin Zhang,18 Igor V. Grigoriev,2,3

Daniel S. Rokhsar,2,7 Jeffrey L. Boore2,3,26,27

Draft genome sequences have been determined for the soybean pathogen Phytophthora sojae andthe sudden oak death pathogen Phytophthora ramorum. Oomycetes such as these Phytophthoraspecies share the kingdom Stramenopila with photosynthetic algae such as diatoms, and thepresence of many Phytophthora genes of probable phototroph origin supports a photosyntheticancestry for the stramenopiles. Comparison of the two species’ genomes reveals a rapid expansionand diversification of many protein families associated with plant infection such as hydrolases, ABCtransporters, protein toxins, proteinase inhibitors, and, in particular, a superfamily of 700 proteinswith similarity to known oomycete avirulence genes.

Phytophthora plant pathogens attack awide range of agriculturally and orna-mentally important plants (1). Late blight

of potato caused by Phytophthora infestans re-sulted in the Irish potato famine in the 19th cen-

tury, and P. sojae costs the soybean industrymillions of dollars each year. In California andOregon, a newly emerged Phytophthora species,P. ramorum, is responsible for a disease calledsudden oak death (2) that affects not only the live

RESEARCH ARTICLES

www.sciencemag.org SCIENCE VOL 313 1 SEPTEMBER 2006 1261

LETTERS

Genome sequence and analysis of the Irish potatofamine pathogen Phytophthora infestansBrian J. Haas1*, Sophien Kamoun2,3*, Michael C. Zody1,4, Rays H. Y. Jiang1,5, Robert E. Handsaker1, Liliana M. Cano2,Manfred Grabherr1, Chinnappa D. Kodira1{, Sylvain Raffaele2, Trudy Torto-Alalibo3{, Tolga O. Bozkurt2,Audrey M. V. Ah-Fong6, Lucia Alvarado1, Vicky L. Anderson7, Miles R. Armstrong8, Anna Avrova8, Laura Baxter9,Jim Beynon9, Petra C. Boevink8, Stephanie R. Bollmann10, Jorunn I. B. Bos3, Vincent Bulone11, Guohong Cai12, Cahid Cakir3,James C. Carrington13, Megan Chawner14, Lucio Conti15, Stefano Costanzo16, Richard Ewan15, Noah Fahlgren13,Michael A. Fischbach17, Johanna Fugelstad11, Eleanor M. Gilroy8, Sante Gnerre1, Pamela J. Green18,Laura J. Grenville-Briggs7, John Griffith14, Niklaus J. Grunwald10, Karolyn Horn14, Neil R. Horner7, Chia-Hui Hu19,Edgar Huitema3, Dong-Hoon Jeong18, Alexandra M. E. Jones2, Jonathan D. G. Jones2, Richard W. Jones20,Elinor K. Karlsson1, Sridhara G. Kunjeti21, Kurt Lamour22, Zhenyu Liu3, LiJun Ma1, Daniel MacLean2, Marcus C. Chibucos23,Hayes McDonald24, Jessica McWalters14, Harold J. G. Meijer5, William Morgan25, Paul F. Morris26, Carol A. Munro27,Keith O’Neill1{, Manuel Ospina-Giraldo14, Andres Pinzon28, Leighton Pritchard8, Bernard Ramsahoye29, Qinghu Ren30,Silvia Restrepo28, Sourav Roy6, Ari Sadanandom15, Alon Savidor31, Sebastian Schornack2, David C. Schwartz32,Ulrike D. Schumann7, Ben Schwessinger2, Lauren Seyer14, Ted Sharpe1, Cristina Silvar2, Jing Song3, David J. Studholme2,Sean Sykes1, Marco Thines2,33, Peter J. I. van de Vondervoort5, Vipaporn Phuntumart26, Stephan Wawra7, Rob Weide5,Joe Win2, Carolyn Young3, Shiguo Zhou32, William Fry12, Blake C. Meyers18, Pieter van West7, Jean Ristaino19,Francine Govers5, Paul R. J. Birch34, Stephen C. Whisson8, Howard S. Judelson6 & Chad Nusbaum1

Phytophthora infestans is the most destructive pathogen of potatoand a model organism for the oomycetes, a distinct lineage offungus-like eukaryotes that are related to organisms such as brownalgae and diatoms. As the agent of the Irish potato famine in themid-nineteenth century, P. infestans has had a tremendous effect onhuman history, resulting in famine and population displacement1.To this day, it affects world agriculture by causing the most destruc-tive disease of potato, the fourth largest food crop and a criticalalternative to the major cereal crops for feeding the world’s popu-lation1. Current annual worldwide potato crop losses due to lateblight are conservatively estimated at $6.7 billion2. Managementof this devastating pathogen is challenged by its remarkable speedof adaptation to control strategies such as genetically resistant cul-tivars3,4. Here we report the sequence of the P. infestans genome,

which at 240 megabases (Mb) is by far the largest and most com-plex genome sequenced so far in the chromalveolates. Its expansionresults from a proliferation of repetitive DNA accounting for 74%of the genome. Comparison with two other Phytophthora genomesshowed rapid turnover and extensive expansion of specific familiesof secreted disease effector proteins, including many genes that areinduced during infection or are predicted to have activities that alterhost physiology. These fast-evolving effector genes are localized tohighly dynamic and expanded regions of the P. infestans genome.This probably plays a crucial part in the rapid adaptability of thepathogen to host plants and underpins its evolutionary potential.

The size of the P. infestans genome is estimated by optical map andother methods at 240 Mb (Supplementary Information). It is several-fold larger than those of the related Phytophthora species P. sojae

*These authors contributed equally to this work.

1Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02141, USA. 2The Sainsbury Laboratory, Norwich NR4 7UH, UK. 3Department of Plant Pathology, The Ohio StateUniversity, Ohio Agricultural Research and Development Center, Wooster, Ohio 44691, USA. 4Department of Medical Biochemistry and Microbiology, Uppsala University, Box 597,Uppsala SE-751 24, Sweden. 5Laboratory of Phytopathology, Wageningen University, 1-6708 PB, Wageningen, The Netherlands. 6Department of Plant Pathology and Microbiology,University of California, Riverside, California 92521, USA. 7University of Aberdeen, Aberdeen Oomycete Laboratory, College of Life Sciences and Medicine, Institute of MedicalSciences, Foresterhill, Aberdeen AB25 2ZD, UK. 8Plant Pathology Programme, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK. 9University of Warwick,Wellesbourne, Warwick CV35 9EF, UK. 10Horticultural Crops Research Laboratory, USDA Agricultural Research Service, Corvallis, Oregon 97330, USA. 11Royal Institute of Technology(KTH), School of Biotechnology, AlbaNova University Centre, Stockholm SE-10691, Sweden. 12Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca,New York 14853, USA. 13Center for Genome Research and Biocomputing and Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon 97331, USA.14Biology Department, Lafayette College, Easton, Pennsylvania 18042, USA. 15Plant Molecular Sciences Faculty of Biomedical and Life Sciences, Bower Building, University of Glasgow,Glasgow G12 8QQ, UK. 16USDA-ARS, Dale Bumpers National Rice Research Center, Stuttgart, Arkansas 72160, USA. 17Department of Molecular Biology, Massachusetts GeneralHospital, Boston, Massachsetts 02114, USA. 18Delaware Biotechnology Institute, University of Delaware, Newark, Delaware 19711, USA. 19Department of Plant Pathology, NorthCarolina State University, Raleigh, North Carolina 27695, USA. 20USDA-ARS, Beltsville, Maryland 20705, USA. 21Department of Plant and Soil Sciences, University of Delaware,Newark, Delaware 19716, USA. 22Department of Entomology and Plant Pathology, University of Tennessee, Knoxville, Tennessee 37996, USA. 23Institute for Genome Sciences,University of Maryland School of Medicine, Baltimore, Maryland 21201, USA. 24Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee 37232,USA. 25The College of Wooster, Department of Biology, Wooster, Ohio 44691, USA. 26Department of Biological Sciences, Bowling Green State University, Bowling Green, Ohio 43403,USA. 27University of Aberdeen, School of Medical Sciences, College of Life Sciences and Medicine, Institute of Medical Sciences, Foresterhill, Aberdeen AB25 2ZD, UK. 28Mycologyand Phytopathology Laboratory, Los Andes University, Bogota, Colombia. 29Institute of Genetics and Molecular Medicine, University of Edinburgh, Cancer Research Centre, WesternGeneral Hospital, Edinburgh EH4 2XU, UK. 30J. Craig Venter Institute, Rockville, Maryland 20850, USA. 31Department of Plant Sciences, Tel Aviv University, Tel Aviv 69978, Israel.32Department of Chemistry, Laboratory of Genetics, Laboratory for Molecular and Computational Genomics, University of Wisconsin Biotechnology Center, University of Wisconsin-Madison, Madison Wisconsin 53706, USA. 33University of Hohenheim, Institute of Botany 210, D-70593 Stuttgart, Germany. 34Division of Plant Science, College of Life Sciences,University of Dundee (at SCRI), Invergowrie, Dundee DD2 5DA, UK. {Present addresses: 454 Life Sciences, Branford, Connecticut 06405, USA (C.D.K.); Virginia BioinformaticsInstitute, Virginia Polytechnic and State University, Blacksburg, Virginia 24061, USA (T.T.-A.); Biomedical Diagnostics Institute, Dublin City University, Dublin 9, Ireland (K.O.).

Vol 461 | 17 September 2009 | doi:10.1038/nature08358

393 Macmillan Publishers Limited. All rights reserved©2009

2009

Features of sequenced oomycete genomes

[3,11]. Within conserved blocks, gene density is high and repeat and transposable element content is low (Figure 3a). The trend is most extreme in the genome of P. infestans in which the gene-dense and gene-sparse regions can be easily distinguished at the whole-genome level using flanking intergenic region length data (Figure 3b). Re-mark ably, effector genes mostly populate the gene-sparse, repeat-rich regions of Phytophthora genomes [3,11] (Figure 3). Because these regions evolve more rapidly than the gene-dense compartments of the genome, P. infestans has been described as having a ‘two-speed’ genome [19]. The presence of effector genes in plastic genomic regions is thought to promote rapid adap tation to new hosts and evasion of recognition by host immune receptors. It is reminiscent of the occur rence of plant immune receptors (R genes) in rapidly evolving gene clusters of plant genomes [20,21].

Not all plant pathogenic oomycetes have highly expanded, repeat-rich genomes. Phytophthora ultimum has the lowest level of repetitive DNA at 7%; this may be attributed to the presence of DNA methylases, which have been shown to inhibit repeat expansion and are absent in the P. infestans genome [13]. The relatively compact genome sizes of Albugo candida and A. laibachii (45 and 37 Mb, respectively) may reflect the loss of biosynthetic pathways in these obligate parasites [14,15]. However, to fully understand genome evolution in para-sitic oomycetes, we still need to compare the genomes of the parasites to their saprophytic kin. Fortunately, genome sequencing projects of several non-parasitic oomycete species are in progress.

Effectors and their functions in plantsEffector proteins belong to two classes that target distinct sites in the host plant: apoplastic effectors are secreted into the plant extracellular space, whereas cytoplasmic effectors are translocated inside the plant cell, where they target different subcellular compartments [22]. Both classes of effectors are modular proteins with cleavable amino-terminal secretion signals. Cytoplasmic effectors carry an additional domain after the signal peptide that mediates translocation inside host cells and is defined by conserved motifs, such as the RXLR amino acid sequence [22].

Several functional classes of apoplastic effectors have been described, including enzyme inhibitors and the NEP1-like toxin proteins (NLPs) [22,23]. One important function of apoplastic effectors is to disable extracellular plant defenses and enable the pathogen to adapt to the protease-rich environment of the plant apoplast [24,25]. Protease inhibitor effectors that target both plant serine and cysteine proteases have been reported in several oomycetes [3,11-13]. The P. infestans cystatin-like EPIC1 and EPIC2B inhibit the cysteine proteases PIP1, RCR3 and C14 from tomato and potato host plants [24-26]. Interestingly, C14 is also targeted by the cytoplasmic effector AVRblb2, which interferes with its secretion into the apoplast [27]. Overall, pathogen effectors have proved to be useful probes to identify plant proteases that have roles in immunity. For example, the tomato protease RCR3 is targeted by effectors from a fungus, an oomycete and a nematode, suggesting that it may have an important role in plant apoplastic defenses [24,28].

Figure 2. Features of sequenced oomycete pathogen genomes. The representative phylogeny depicts oomycete pathogens with sequenced genomes and was generated using Interactive Tree Of Life (iTOL) with National Center for Biotechnology Information (NCBI) taxonomy identifiers (branch lengths are arbitrary). Pathogen lifestyles and major variations in effector gene families are indicated along the tree branches. Potential loss of particular effector classes in a lineage is indicated by a red cross. The principal host, genome size, repetitive DNA content (as a percentage of genome size), gene space (the percentage of the genome encoding genes), number of protein-coding genes and number and percentage of proteins encoding predicted secreted proteins (secretome) are indicated from left to right for each pathogen. CRN, Crinkler; ND, not determined.

Pythium ultimum

Phytophthora ramorum

Phytophthora infestans

Phytophthora sojae

Phytophthora parasitica

Hyaloperonospora arabidopsidis

Saprolegnia parasitica

Albugo candida

Albugo laibachii

CRNeffectors

CHXC effectors

Host

Varied

Arabidopsis

Arabidopsis

Vegetables

Potato,tomatoVaried

Soybean

Varied

Fish

Woody plants

53

8065

100

45

53

Genomesize (Mb)

% RepetitiveDNA content

ND

3917

ND

43

22

Proteincoding genes

20,822

16,988

14,451

14,543

15,824

20,088

Secretome (%)

1,561

1,867

1,523

727

1,255

RefsOomycetes% genespace

32

2831

17

43

49

(7.5)

(11.0)

(10.5)

(5.0)

(3.3)515

(6.2)

NPP1-like

NPP1-like

64 19 1,17619,80529 (5.9)

240 74 18,155 1,588 (8.7)10

43 7 15,291 843 (5.5)44

37 28 13,032 413 (3.2)48

Plant Biotroph

Plant Necrotroph Fish Saprotroph/Necrotroph

Non-repetitive Repetitive Non-coding Coding

Phytophthora capsici

RXLR effectors

YxSL[RK]& RXLReffectors

YxSL[RK] effectors

[6]

[11]

[12][13]

[13]

[14]

[15][16]

[17][18]

Apoplastic effectors Cytoplasmic effecttors

Plant Hemibiotroph

Key (i): Key (ii):

Pais et al. Genome Biology 2013, 14:211 http://genomebiology.com/2013/14/6/211

Page 3 of 10

Pais et al. Genome Biology, 2013

The 240 Mbp genome of Phytophthora infestans – a repeat and transposon driven expansion

P. infestans

P. sojae

P. ramorum

P. sojae

P. infestans

P. ramorum

B. Haas, S. Kamoun et al. Nature, 2009

Phytophthora infestans genome architecture - repeat-rich and gene-poor loci interrupt colinear regions

RXLR

Crinklers

Protease inhibitors

Phytophthora infestans genome: so many effectors!

Apoplastic

Host-translocated

~38

~550

~200 ~250ψ

P. infestans

P. sojae

P. ramorum

P. sojae RXLR effector gene

P. infestans

P. ramorum


RSLR

43 47 100 22 1

AVRblb2

Host translocation Effector activity

Signal Peptide

Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci

Length of intergenic regions (kb)

Nb of genes :80-8575-8070-7565-7060-6555-6050-5545-5040-4535-4030-3525-3020-2515-2010-155-100-5

1615141312111098765432100-5

11-1516-20

6-10

21-25

31-3536-40

26-30

41-45

51-5556-60

46-50

61-65

71-7576-80

66-70

81-85

P. infestans (16442 genes)

Core orthologs (7580) RXLR effectors (520)

Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci


The “two-speed genome” of P. infestans underpins high evolutionary potential

P. sojae

P. infestans

P. ramorum

§  Gene-sparse regions of genome show highest rates of structural and sequence variation, signatures of adaptive selection

§  Gene-sparse regions underpin rapid evolution of virulence (effector) genes and host adaptation; cradle for adaptive evolution

Several filamentous plant pathogens (fungi and oomycetes) have a “two-speed” genome architecture

A C

D

B

O, Fifi the oomycete

Was as virulent as she’s been;

and scientists say she secretes her way

Inside potatoes and bean.

Virulence mechanisms: effector biology

bacterium

fungus

oomycete

haustorium

apoplas4c effectors

plant cell

Microbes alter plant cell processes using secreted “effector” molecules

Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010

Cytoplasmic effectors

targets

targets

Alter plant cell processes

Help microbe colonize plant

Ü Effectors have been described in bacteria, oomycetes,

fungi, nematodes, insects etc.

Ü Current paradigm - effector activities are key to

understanding parasitism (and symbiosis)

Ü Operationally effectors are plant proteins - Encoded by

genes in pathogen genomes but function in (inside)

plant cells

Key concepts about plant pathogen effectors

Effectors - sensus Dawkins in “The extended phenotype: the long reach of the gene” p. 210, 1981

“...parasite genes having phenotypic expression in host bodies and behavior”

Phytoplasmas see Saskia Hogenhout’s lectures

RXLR

Crinklers

Protease inhibitors

The diverse effectors of Phytophthora infestans

Apoplastic

Host-translocated

~38

~550

~200 ~250ψ

Apoplastic effectors are typically small cysteine-rich secreted proteins

-  often get processed upon secretion

-  disulfide bridges provide stability in apoplast

Targeting Function

(tomato cell)

(apoplast)

RCR3 PIP1 C14 CYP3 CatB1ALP CatB2

Immune response

EPIC1 EPIC2B

Phytophthora infestansOomycete

Phytophthora and fungal effectors inhibit the same plant immune proteases

with Renier van der Hoorn

Cladosporium fulvumFungus

AVR2

RLLR SEER

21 44 59 147

Signal Peptide

1

RSLR DEER

21 51 72 152 1

Signal Peptide

RFLR EER

23 54 69 168 1

Signal Peptide

PEX-RD3

IPIO1

NUK10

AVR3a

RQLR GEER Signal Peptide

19 50 77 213 1

Cytoplasmic effectors of oomycetes have a conserved domain defined by the RXLR motif

Targeting Function

P. infestans RXLR effectors target a variety host proteins and processes

Ü  AVR3a targets an E3 Ubiquitin Ligase CMPG1 to suppress

immunity (Bos et al. PNAS, 2010)

Ü  AVR2 targets a Kelch repeat phosphatase BSL1 to suppress

immunity (Saunders et al. Plant Cell, 2012)

Ü  PexRD54 binds ATG8 and antagonizes selective autophagy to

counteract plant defense (Dagdas, Belhaj et al. eLife 2016)

Ü  AVRblb2 interferes with secretion of cysteine protease C14 to

counteract plant defense (Bozkurt et al. PNAS, 2011)

Kamoun & van der Hoorn Labs

EPIC C14

P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases


EPIC C14

C14



EPIC C14

AVRblb2


Fifi the oomycete found

A resistant plant that day,

So she said, "Let's run and

There’ll be no fun

Until I mutate away."

Host resistance and evasion of resistance

Resistance to Phytophthora infestans

§  The Hypersensitive Response (HR): a programmed cell death response

§  Activation of a plant immune receptor (R) by an effector

effectors

bacterium

fungus

oomycete

haustorium

plant cell

Some effectors “trip the wire” and activate immunity in particular plant genotypes


targets

NB-‐LRR/NLR immune receptors

NLR-‐ triggered immunity


effectors

bacterium

fungus

oomycete

haustorium

plant cell

Concept: Host Resistance and Susceptibility genes


targets

NB-‐LRR/NLR immune receptors

NLR-‐ triggered immunity


R

S

Wheat

Potato

Tomato

Corn

Rice

Barley

Bacteria

Nematodes

Oomycetes

Insects

Fungi

Viruses

CC

NB-

ARC

LR

R (xx

LxLx

x)

Plants utilize a ubiquitous disease resistance toolkit to defend against unrelated pathogens

NLR / NB-‐LRR immune receptors

How do pathogen effectors evade immunity?

AVR effector §  Effectors evade activating immune receptors by acquiring stealthy mutations

target

§  But, they have to maintain their virulence activity!

§  Still many effectors become nonfunctional (pseudogenes) or get deleted in the pathogen genome

Functional redundancy among pathogen effectors enables “bet-hedging”

Ü Many effectors are functionally redundant; affect different steps or converge on same target

Ü Functional redundancy enables robustness in the face of the evolving plant immune system

Ü  “Bet-hedging”

Win, J., et al. Cold Spring Harbor Symposium on Quantitative Biology, 2013

For Fifi the oomycete

Keeps evolving in her way,

But don’t wave her goodbye,

Don't you even try,

She’ll be back again some day.

Breeding host resistance: prospects and challenges

An arms race between the plant breeder/biotechnologist and the pathogen?

•  Ability of the pathogen to adapt is astounding

•  “Don’t bet against the pathogen” – silver bullet solutions unlikely to be durable

•  Framework to rapidly generate new resistance specificities and introduce these traits into crop genomes

•  Can we generate and deploy new resistance traits faster than the pathogen can evolve?

09/08/2013 10:19

Can GMO corn cause allergies? Don’t believe Elle’s scary story. - Slate Magazine

Page 1 of 7

http://www.slate.com/articles/health_and_science/science/2013/08/ca…y.single.html?original_referrer=https%253A%252F%252Fm.facebook.com

HOME / SCIENCE : THE STATE OF THE UNIVERSE.

No, You Shouldn’t Fear GMO

CornHow Elle botched a story about genetically modified food.

By Jon Entine Posted Wednesday, Aug. 7, 2013, at 2:45 PM

Most science says fear of GMO foods is overblown.

Photo by Olivier Morin/AFP/Getty Images

A few weeks ago, Amy Harmon, a respected science journalist at the New York Times, turned

her attention to the GMO debate, writing a masterfully textured story about the plight of the

Florida orange and the role biotechnology might play in rescuing it from a potentially deadly

disease. It was widely praised by independent journalists for its even-handed analysis of the

costs and benefits associated with adopting new technologies, like genetic modification, to

food.

As influential as the Times may be among the chattering classes, don’t expect this story to

alter the trajectory of the debate over GMO foods. While every major scientific regulatory

oversight body in the world, including the National Academies of Science and the Food and

Drug Administration in the United States, has concluded that genetically modified foods pose

no harm not also found in conventional or organic foods, the public remains deeply suspicious

of them. A survey published in the same newspaper the day before Harmon’s piece ran found

that 37 percent of those interviewed worried about GMOs, saying they feared that such foods

cause cancer or allergies.

Those fear-based views are regularly reinforced by popular lifestyle magazines and the echo

chamber of the Web. In the past two weeks alone, Details and Elle have run pieces that

credulously stoke conspiratorial fears that the government is covering up evidence that GMO

foods can damage the public health.

Caitlin Shetterly’s long feature, “The Bad Seed: The Health Risks of Genetically Modified

Corn,” in Elle—a magazine with more than 1.1 million monthly readers—was particularly

appalling.

George Clooney's Next

Movie Is Based on a

Story You Won't Believe

Edward Snowden's Email

Provider Abruptly Shuts

Down, Issues Cryptic

Statement

Are Millennials Really

More Narcissistic?

Flight Delays Don’t Have

to Ruin Your Trip. Here’s

How to Game the

System.

Follow Follow @slate@slate 638K followers

LOG IN/REGISTER

|

1.2k

1784

Like 5.1k TweetTweet 181

NEWS & POLITICS TECH BUSINESS ARTS LIFE HEALTH & SCIENCE SPORTS DOUBLE X PODCASTS PHOTOS VIDEO SLATEST BLOGS MYSLATE

... for peace of mind in potato cultivation

UNDER DEVELOPMENT FOR YOUR CONVENIENCEOn top of that, you have to ensure that the

weather is favorable in terms of wind strength

and precipitation. If you want to put an end to

precisely that situation, Fortuna is the right

potato variety for you, as it provides lasting

protection against late blight. So there’s no

more need for you to regularly inspect your

fi elds and check for signs of this disease. With

Fortuna, you no longer have to worry about the

right time and the right weather. And best of all,

when you plant out your crops you can look for-

ward to an extremely high yield and outstanding

quality without any stress.

4 | 5

What is Fortuna?

Fortuna is a further development of the leading

European potato variety used for making fries.

Fortuna is identical to its parent variety, but has

one key additional benefi t: It provides complete

protection against late blight. Fortuna therefore

offers impressively high tuber yield and thanks

to its tuber form, color and taste, it satisfi es all

the requirements to be used in making fries or

as fresh produce.

How was Fortuna developed?

Dutch researchers have undertaken extensive

research into the special resistance of the wild

potato. They managed to identify the genes

which give the wild potato protection against

late blight. Agricultural and biotechnological

experts at BASF then transferred these genes

to the leading French fries potato variety using

the soil bacterium Agrobacterium. This resulted

in Fortuna which is equipped with the wild po-

tato‘s effective protection against late blight –

without modifying its outstanding agronomic

characteristics.

Why is Fortuna so useful to you?

If you’re a potato farmer, you’re sure to be fami-

liar with the following situation. July and August

are mainly wet. Late blight attacks all of your

potato fi elds, which you cared for intensively

throughout the whole year. All you can do is

wait until the rain subsides and machinery can

move on the soil again. Now you have the prob-

lem of, on the one hand, choosing the right

time to use fungicides to protect against late

blight. On the other hand, you don‘t want to risk

driving on the land and causing soil compaction.

20 30

P

40

P+A

50

P P P

Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)

60

P+A

70

P P PP P P

80

Fungicide treatments in conventionally improved potatoes

20 30 40

A

50

Application against Alternaria (A) and Phytophthora (P)

60

A

70 80

Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)

Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora

On top of that, you have to ensure that the

weather is favorable in terms of wind strength

and precipitation. If you want to put an end to

precisely that situation, Fortuna is the right

potato variety for you, as it provides lasting

protection against late blight. So there’s no

more need for you to regularly inspect your

fi elds and check for signs of this disease. With

Fortuna, you no longer have to worry about the

right time and the right weather. And best of all,

when you plant out your crops you can look for-

ward to an extremely high yield and outstanding

quality without any stress.

4 | 5

What is Fortuna?

Fortuna is a further development of the leading

European potato variety used for making fries.

Fortuna is identical to its parent variety, but has

one key additional benefi t: It provides complete

protection against late blight. Fortuna therefore

offers impressively high tuber yield and thanks

to its tuber form, color and taste, it satisfi es all

the requirements to be used in making fries or

as fresh produce.

How was Fortuna developed?

Dutch researchers have undertaken extensive

research into the special resistance of the wild

potato. They managed to identify the genes

which give the wild potato protection against

late blight. Agricultural and biotechnological

experts at BASF then transferred these genes

to the leading French fries potato variety using

the soil bacterium Agrobacterium. This resulted

in Fortuna which is equipped with the wild po-

tato‘s effective protection against late blight –

without modifying its outstanding agronomic

characteristics.

Why is Fortuna so useful to you?

If you’re a potato farmer, you’re sure to be fami-

liar with the following situation. July and August

are mainly wet. Late blight attacks all of your

potato fi elds, which you cared for intensively

throughout the whole year. All you can do is

wait until the rain subsides and machinery can

move on the soil again. Now you have the prob-

lem of, on the one hand, choosing the right

time to use fungicides to protect against late

blight. On the other hand, you don‘t want to risk

driving on the land and causing soil compaction.

20 30

P

40

P+A

50

P P P

Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)

60

P+A

70

P P PP P P

80

Fungicide treatments in conventionally improved potatoes

20 30 40

A

50

Application against Alternaria (A) and Phytophthora (P)

60

A

70 80

Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)

Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora

Ü Genomics-enabled gene mapping and cloning

Ü  Impacting plant breeding: from Marker Assisted Selection

(MAS) to Genomic Selection (GS)

Ü Applicable to both Resistance and Susceptibility genes

Next-generation crop (disease resistance) breeding

©20

12 N

atur

e A

mer

ica,

Inc.

All

righ

ts r

eser

ved.

NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION 1

A RT I C L E S

The world population is predicted to reach 9 billion within the next 40 years, requiring a 70–100% increase in food production relative to current levels1. It is a major challenge to ensure sustainable food production without further expanding farmland and damaging the environment, in the midst of adverse conditions such as rapid climatic changes. Crop breeding is important for improving yield and toler-ance to existing and emerging biotic and abiotic stresses2. However, current breeding approaches are mostly inefficient, and have not incorporated the findings of the genomics revolution3.

Most crop traits relevant to agronomic improvement are con-trolled by several loci, including quantitative trait loci (QTL), that when disrupted lead to minor phenotypic effects4. To enable plant breeding by marker-assisted selection, it is important to identify the locus or chromosome region harboring each gene contributing to an improved trait. However, compared with genes with major effects that determine discrete characteristics, allelic substitutions at agronomic trait loci lead to only subtle changes in phenotype. Consequently, cloning genes that control agronomic traits is not straightforward.

Here we describe MutMap, a method of rapid gene isolation using a cross of the mutant to wild-type parental line, and apply it to a large population of mutant lines of an elite Japanese rice cultivar. We used MutMap to localize genomic positions of rice genes controlling agronomically important traits including semidwarfism. As mutant plants and associated molecular markers can be made available to plant breeders, this approach could markedly accelerate crop breed-ing and genetics.

RESULTSMutMap methodWe explain the principle of MutMap (Fig. 1) using the example of rice. We first use a mutagen (for example, ethyl methanesulfonate) to mutagenize a rice cultivar (X) that has a reference genome sequence. Mutagenized plants of this first mutant generation (M1) are self- pollinated and brought to the second (M2) or more advanced genera-tions to make the mutated gene homozygous. Through observation of phenotypes in the M2 lines or later generations, we identify recessive mutants with altered agronomically important traits such as plant height, tiller number and grain number per spike. Once the mutant is identified, it is crossed with the wild-type plant of cultivar X, the same cultivar used for mutagenesis. The resulting first filial generation (F1) plant is self-pollinated, and the second generation (F2) progeny (>100) are grown in the field for scoring the phenotype. Because these F2 progeny are derived from a cross between the mutant and its parental wild-type plant, the number of segregating loci responsible for the phenotypic change is minimal, in most cases one, and thus segrega-tion of phenotypes can be unequivocally observed even if the pheno-typic difference is small. All the nucleotide changes incorporated into the mutant by mutagenesis are detected as single-nucleotide polymor-phisms (SNPs) and insertion-deletions (indels) between mutant and wild type. Among the F2 progeny, the majority of SNPs will segregate in a 1:1 mutant/wild type ratio. However, the SNP responsible for the change of phenotype is homozygous in the progeny showing the mutant phenotype. If we collect DNA samples from recessive mutant F2 progeny and bulk sequence them with substantial genomic coverage

Genome sequencing reveals agronomically important loci in rice using MutMapAkira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, Hideo Matsumura3,4, Kakoto Yoshida3, Chikako Mitsuoka3, Muluneh Tamiru3, Hideki Innan5, Liliana Cano6, Sophien Kamoun6 & Ryohei Terauchi3

The majority of agronomic traits are controlled by multiple genes that cause minor phenotypic effects, making the identification of these genes difficult. Here we introduce MutMap, a method based on whole-genome resequencing of pooled DNA from a segregating population of plants that show a useful phenotype. In MutMap, a mutant is crossed directly to the original wild-type line and then selfed, allowing unequivocal segregation in second filial generation (F2) progeny of subtle phenotypic differences. This approach is particularly amenable to crop species because it minimizes the number of genetic crosses (n = 1 or 0) and mutant F2 progeny that are required. We applied MutMap to seven mutants of a Japanese elite rice cultivar and identified the unique genomic positions most probable to harbor mutations causing pale green leaves and semidwarfism, an agronomically relevant trait. These results show that MutMap can accelerate the genetic improvement of rice and other crop plants.

1Iwate Agricultural Research Center, Kitakami, Japan. 2United Graduate School of Agricultural Sciences, Iwate University, Morioka, Japan. 3Iwate Biotechnology Research Center, Kitakami, Japan. 4Gene Research Center, Shinshu University, Ueda, Japan. 5Graduate University for Advanced Studies, Hayama, Japan. 6The Sainsbury Laboratory, Norwich Research Park, Norwich, UK. 7These authors contributed equally to this work. Correspondence should be addressed to R.T. ([email protected]).

Received 28 July 2011; accepted 14 December 2011; published online 22 January 2012; doi:10.1038/nbt.2095

©20

12 N

atur

e A

mer

ica,

Inc.

All

righ

ts r

eser

ved.

NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION 1

A RT I C L E S

The world population is predicted to reach 9 billion within the next 40 years, requiring a 70–100% increase in food production relative to current levels1. It is a major challenge to ensure sustainable food production without further expanding farmland and damaging the environment, in the midst of adverse conditions such as rapid climatic changes. Crop breeding is important for improving yield and toler-ance to existing and emerging biotic and abiotic stresses2. However, current breeding approaches are mostly inefficient, and have not incorporated the findings of the genomics revolution3.

Most crop traits relevant to agronomic improvement are con-trolled by several loci, including quantitative trait loci (QTL), that when disrupted lead to minor phenotypic effects4. To enable plant breeding by marker-assisted selection, it is important to identify the locus or chromosome region harboring each gene contributing to an improved trait. However, compared with genes with major effects that determine discrete characteristics, allelic substitutions at agronomic trait loci lead to only subtle changes in phenotype. Consequently, cloning genes that control agronomic traits is not straightforward.

Here we describe MutMap, a method of rapid gene isolation using a cross of the mutant to wild-type parental line, and apply it to a large population of mutant lines of an elite Japanese rice cultivar. We used MutMap to localize genomic positions of rice genes controlling agronomically important traits including semidwarfism. As mutant plants and associated molecular markers can be made available to plant breeders, this approach could markedly accelerate crop breed-ing and genetics.

RESULTSMutMap methodWe explain the principle of MutMap (Fig. 1) using the example of rice. We first use a mutagen (for example, ethyl methanesulfonate) to mutagenize a rice cultivar (X) that has a reference genome sequence. Mutagenized plants of this first mutant generation (M1) are self- pollinated and brought to the second (M2) or more advanced genera-tions to make the mutated gene homozygous. Through observation of phenotypes in the M2 lines or later generations, we identify recessive mutants with altered agronomically important traits such as plant height, tiller number and grain number per spike. Once the mutant is identified, it is crossed with the wild-type plant of cultivar X, the same cultivar used for mutagenesis. The resulting first filial generation (F1) plant is self-pollinated, and the second generation (F2) progeny (>100) are grown in the field for scoring the phenotype. Because these F2 progeny are derived from a cross between the mutant and its parental wild-type plant, the number of segregating loci responsible for the phenotypic change is minimal, in most cases one, and thus segrega-tion of phenotypes can be unequivocally observed even if the pheno-typic difference is small. All the nucleotide changes incorporated into the mutant by mutagenesis are detected as single-nucleotide polymor-phisms (SNPs) and insertion-deletions (indels) between mutant and wild type. Among the F2 progeny, the majority of SNPs will segregate in a 1:1 mutant/wild type ratio. However, the SNP responsible for the change of phenotype is homozygous in the progeny showing the mutant phenotype. If we collect DNA samples from recessive mutant F2 progeny and bulk sequence them with substantial genomic coverage

Genome sequencing reveals agronomically important loci in rice using MutMapAkira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, Hideo Matsumura3,4, Kakoto Yoshida3, Chikako Mitsuoka3, Muluneh Tamiru3, Hideki Innan5, Liliana Cano6, Sophien Kamoun6 & Ryohei Terauchi3

The majority of agronomic traits are controlled by multiple genes that cause minor phenotypic effects, making the identification of these genes difficult. Here we introduce MutMap, a method based on whole-genome resequencing of pooled DNA from a segregating population of plants that show a useful phenotype. In MutMap, a mutant is crossed directly to the original wild-type line and then selfed, allowing unequivocal segregation in second filial generation (F2) progeny of subtle phenotypic differences. This approach is particularly amenable to crop species because it minimizes the number of genetic crosses (n = 1 or 0) and mutant F2 progeny that are required. We applied MutMap to seven mutants of a Japanese elite rice cultivar and identified the unique genomic positions most probable to harbor mutations causing pale green leaves and semidwarfism, an agronomically relevant trait. These results show that MutMap can accelerate the genetic improvement of rice and other crop plants.

1Iwate Agricultural Research Center, Kitakami, Japan. 2United Graduate School of Agricultural Sciences, Iwate University, Morioka, Japan. 3Iwate Biotechnology Research Center, Kitakami, Japan. 4Gene Research Center, Shinshu University, Ueda, Japan. 5Graduate University for Advanced Studies, Hayama, Japan. 6The Sainsbury Laboratory, Norwich Research Park, Norwich, UK. 7These authors contributed equally to this work. Correspondence should be addressed to R.T. ([email protected]).

Received 28 July 2011; accepted 14 December 2011; published online 22 January 2012; doi:10.1038/nbt.2095

www.sciencemag.org SCIENCE VOL 341 23 AUGUST 2013 833

BACTERIA MAY NOT ELICIT MUCH SYMPA-

thy from us eukaryotes, but they, too, can get

sick. That’s potentially a big problem for the

dairy industry, which often depends on bac-

teria such as Streptococcus thermophilus to

make yogurts and cheeses. S. thermophilus

breaks down the milk sugar lactose into tangy

lactic acid. But certain viruses—bacterio-

phages, or simply phages—can debilitate the

bacterium, wreaking havoc on the quality or

quantity of the food it helps produce.

In 2007, scientists from Danisco, a

Copenhagen-based food ingredient com-

pany now owned by DuPont, found a way to

boost the phage defenses of this workhouse

microbe. They exposed the bacterium to

a phage and showed that this essentially

vaccinated it against that virus (Science,

23 March 2007, p. 1650). The trick has

enabled DuPont to create heartier bacterial

strains for food production. It also revealed

something fundamental: Bacteria have a

kind of adaptive immune system, which

enables them to fi ght off repeated attacks

by specifi c phages.

That immune system has suddenly

become important for more than food scien-

tists and microbiologists, because of a valu-

able feature: It takes aim at specific DNA

sequences. In January, four research teams

reported harnessing the system, called

CRISPR for peculiar features in the DNA of

bacteria that deploy it, to target the destruc-

tion of specifi c genes in human cells. And in

the following 8 months, various groups have

used it to delete, add, activate, or suppress tar-

geted genes in human cells, mice, rats, zebra-

fi sh, bacteria, fruit fl ies, yeast, nematodes,

and crops, demonstrating broad utility for the

The CRISPR CrazeA bacterial immune system yields a potentially

revolutionary genome-editing technique

CR

ED

IT: E

YE

OF

SC

IEN

CE

/SC

IEN

CE

SO

UR

CE

NEWSFOCUS

Fighting invasion. When

viruses (green) attack

bacteria, the bacteria

respond with DNA-targeting

defenses that biologists

have learned to exploit

for genetic engineering.

Published by AAAS

on

Augu

st 2

3, 2

013

ww

w.s

cien

cem

ag.o

rgD

ownl

oade

d fro

m

www.sciencemag.org SCIENCE VOL 341 23 AUGUST 2013 833

BACTERIA MAY NOT ELICIT MUCH SYMPA-

thy from us eukaryotes, but they, too, can get

sick. That’s potentially a big problem for the

dairy industry, which often depends on bac-

teria such as Streptococcus thermophilus to

make yogurts and cheeses. S. thermophilus

breaks down the milk sugar lactose into tangy

lactic acid. But certain viruses—bacterio-

phages, or simply phages—can debilitate the

bacterium, wreaking havoc on the quality or

quantity of the food it helps produce.

In 2007, scientists from Danisco, a

Copenhagen-based food ingredient com-

pany now owned by DuPont, found a way to

boost the phage defenses of this workhouse

microbe. They exposed the bacterium to

a phage and showed that this essentially

vaccinated it against that virus (Science,

23 March 2007, p. 1650). The trick has

enabled DuPont to create heartier bacterial

strains for food production. It also revealed

something fundamental: Bacteria have a

kind of adaptive immune system, which

enables them to fi ght off repeated attacks

by specifi c phages.

That immune system has suddenly

become important for more than food scien-

tists and microbiologists, because of a valu-

able feature: It takes aim at specific DNA

sequences. In January, four research teams

reported harnessing the system, called

CRISPR for peculiar features in the DNA of

bacteria that deploy it, to target the destruc-

tion of specifi c genes in human cells. And in

the following 8 months, various groups have

used it to delete, add, activate, or suppress tar-

geted genes in human cells, mice, rats, zebra-

fi sh, bacteria, fruit fl ies, yeast, nematodes,

and crops, demonstrating broad utility for the

The CRISPR CrazeA bacterial immune system yields a potentially

revolutionary genome-editing technique

CR

ED

IT: E

YE

OF

SC

IEN

CE

/SC

IEN

CE

SO

UR

CE

NEWSFOCUS

Fighting invasion. When

viruses (green) attack

bacteria, the bacteria

respond with DNA-targeting

defenses that biologists

have learned to exploit

for genetic engineering.

Published by AAAS

on

Augu

st 2

3, 2

013

ww

w.s

cien

cem

ag.o

rgD

ownl

oade

d fro

m

infects plant scientists

REVIEW Open Access

Plant genome editing made easy: targetedmutagenesis in model and crop plants using theCRISPR/Cas systemKhaoula Belhaj†, Angela Chaparro-Garcia†, Sophien Kamoun* and Vladimir Nekrasov*

Abstract

Targeted genome engineering (also known as genome editing) has emerged as an alternative to classical plantbreeding and transgenic (GMO) methods to improve crop plants. Until recently, available tools for introducingsite-specific double strand DNA breaks were restricted to zinc finger nucleases (ZFNs) and TAL effector nucleases(TALENs). However, these technologies have not been widely adopted by the plant research community due tocomplicated design and laborious assembly of specific DNA binding proteins for each target gene. Recently, aneasier method has emerged based on the bacterial type II CRISPR (clustered regularly interspaced short palindromicrepeats)/Cas (CRISPR-associated) immune system. The CRISPR/Cas system allows targeted cleavage of genomic DNAguided by a customizable small noncoding RNA, resulting in gene modifications by both non-homologous endjoining (NHEJ) and homology-directed repair (HDR) mechanisms. In this review we summarize and discuss recentapplications of the CRISPR/Cas technology in plants.

Keywords: CRISPR, Cas9, Plant, Genome editing, Genome engineering, Targeted mutagenesis

IntroductionTargeted genome engineering has emerged as an alter-native to classical plant breeding and transgenic (GMO)methods to improve crop plants and ensure sustainablefood production. However, until recently the availablemethods have proven cumbersome. Both zinc fingernucleases (ZFNs) and TAL effector nucleases (TALENs)can be used to mutagenize genomes at specific loci, butthese systems require two different DNA binding proteinsflanking a sequence of interest, each with a C-terminalFokI nuclease module. As a result these methods have notbeen widely adopted by the plant research community.Earlier this year, a new method based on the bacterialCRISPR (clustered regularly interspaced short palindromicrepeats)/Cas (CRISPR-associated) type II prokaryoticadaptive immune system [1] has emerged as an alter-native method for genome engineering. The ability toreprogram CRISPR/Cas endonuclease specificity usingcustomizable small noncoding RNAs has set the stagefor novel genome editing applications [2-8]. The system is

based on the Cas9 nuclease and an engineered singleguide RNA (sgRNA) that specifies a targeted nucleic acidsequence. Given that only a single RNA is required to gen-erate target specificity, the CRISPR/Cas system promisesto be more easily applicable to genome engineering thanZFNs and TALENs.Recently, eight reports describing the first applications

of the Cas9/sgRNA system to plants have been published[9-16]. In this review, we summarise the methods andfindings described in these publications and provide anoutlook for the application of the CRISPR/Cas system as agenome engineering tool in plants.

Plant genome editing using the CRISPR/Cas systemThe application of the bacterial CRISPR/Cas system toplants is very recent. In the August 2013 issue of NatureBiotechnology three short reports described the first ap-plications of the Cas9/sgRNA system to plant genomeengineering [9-11]. Shortly after, five more reportsfollowed [12-16]. The papers mainly focused on testingthe CRISPR/Cas technology using transient expressionassays (Table 1 and Figure 1), such as protoplast trans-formation and in planta expression using Agrobacterium

* Correspondence: [email protected]; [email protected]†Equal contributorsThe Sainsbury Laboratory, Norwich Research Park, Norwich, UK

PLANT METHODS

© 2013 Belhaj et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedicationwaiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwisestated.

Belhaj et al. Plant Methods 2013, 9:39http://www.plantmethods.com/content/9/1/39

Humans have been modifying the genomes of animals and plants…

…using mutagens (chemicals, irradiation) and selective breeding

§  We are now moving into an era of precise genome editing (synthetic biology, biohacking etc.); ultimate in editing

§  Accessing and generating genetic diversity will not be a limiting factor anymore; key is to know which genes influence agronomically important traits

500 -

400 -

300 -

bp 1 2 8 10 WT

500 - 400 -

300 -

bp

200 -

1 2 8 3 4 5 6 7 9 10

ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG!ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG!ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!ACATAGTAAAAGGTGTACCTGTGGTGGA-------------------------------------------------TTGATTAACTTTGTACTCTTTCAGG -49!

WT Plant 1 Plant 2 Plant 8

Plant 10

PAM PAM Target 1 Target 2

500 - 400 - 300 -

8-1 500 - 400 - 300 -

bp 8-2 8-3 8-4 8-5 WT 8-6

SlMlo1

T-DNA

8-4

T-DNA: - - + -

WT slmlo1&8-6

a

b c

d

e

f

Figure 1

Transform with Cas9/sgRNAs

Callus tissue

T0 plantlets

T1 seeds slmlo1 T-DNA segregating

Regenerate T0 plants and screen

for slmlo1 homozygotes

Screen T1 generation for T-DNA-free plants

3.5 months

T2 seeds slmlo1 T-DNA-free

Supplementary Figure 1

0 3 6 9.5 Time, months 3 months 3 months 3.5 months

Tomelo – A DNA deletion results in fungus resistanceTomelo – A DNA deletion in the S gene mlo results in resistance to powdery mildew fungus

Vladimir Nekrasov

Deletion of CMPG1 in tomato reduces infection by P. infestans Le

sion

siz

e (m

m2 )

Wild-Type

cmpg1 mutants

Mutant 1 Mutant 2 Mutant 3

P. infestans 88069 (5 dpi)

Wild-Type

cmpg1 mutant Angela Chaparro-Garcia