some terminology insert a fragment that was incorporated in a
DESCRIPTION
Some Terminology insert a fragment that was incorporated in a circular genome, and can be copied (cloned) vector the circular genome (host) that incorporated the fragment BAC Bacterial Artificial Chromosome, a type - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/1.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Some Terminologyinsert a fragment that was incorporated in a circular genome, and can be copied (cloned)
vector the circular genome (host) that incorporated the fragment
BAC Bacterial Artificial Chromosome, a type of insert–vector combination, typically of length 100-200 kb
read a 500-900 long word that comes out of a sequencing machine
coverage the average number of reads (or inserts) that cover a position in the target DNA piece
shotgun the process of obtaining many reads sequencing from random locations in DNA, to
detect overlaps and assemble
![Page 2: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/2.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Whole Genome Shotgun Sequencing
cut many times at random
genome
forward-reverse paired reads
plasmids (2 – 10 Kbp)
cosmids (40 Kbp) known dist
~800 bp~800 bp
![Page 3: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/3.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Fragment Assembly(in whole-genome shotgun sequencing)
![Page 4: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/4.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Fragment Assembly
Given N reads…Given N reads…Where N ~ 30 Where N ~ 30
million…million…
We need to use a We need to use a linear-time linear-time algorithmalgorithm
![Page 5: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/5.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Steps to Assemble a Genome
1. Find overlapping reads
4. Derive consensus sequence ..ACGATTACAATAGGTT..
2. Merge some “good” pairs of reads into longer contigs
3. Link contigs to form supercontigs
Some Terminology
read a 500-900 long word that comes out of sequencer
mate pair a pair of reads from two endsof the same insert fragment
contig a contiguous sequence formed by several overlapping readswith no gaps
supercontig an ordered and oriented set(scaffold) of contigs, usually by mate
pairs
consensus sequence derived from thesequene multiple alignment of reads
in a contig
![Page 6: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/6.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
1. Find Overlapping Reads
aaactgcagtacggatctaaactgcag aactgcagt… gtacggatct tacggatctgggcccaaactgcagtacgggcccaaa ggcccaaac… actgcagta ctgcagtacgtacggatctactacacagtacggatc tacggatct… ctactacac tactacaca
(read, pos., word, orient.)
aaactgcagaactgcagtactgcagta… gtacggatctacggatctgggcccaaaggcccaaacgcccaaact…actgcagtactgcagtacgtacggatctacggatctacggatcta…ctactacactactacaca
(word, read, orient., pos.)
aaactgcagaactgcagtacggatcta actgcagta actgcagtacccaaactgcggatctacctactacacctgcagtacctgcagtacgcccaaactggcccaaacgggcccaaagtacggatcgtacggatctacggatcttacggatcttactacaca
![Page 7: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/7.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
1. Find Overlapping Reads
• Find pairs of reads sharing a k-mer, k ~ 24• Extend to full alignment – throw away if not >98% similar
TAGATTACACAGATTAC
TAGATTACACAGATTAC|||||||||||||||||
T GA
TAGA| ||
TACA
TAGT||
• Caveat: repeats A k-mer that occurs N times, causes O(N2) read/read comparisons ALU k-mers could cause up to 1,000,0002 comparisons
• Solution: Discard all k-mers that occur “too often”
• Set cutoff to balance sensitivity/speed tradeoff, according to genome at hand and computing resources available
![Page 8: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/8.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
1. Find Overlapping Reads
Create local multiple alignments from the overlapping reads
TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGA
![Page 9: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/9.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
1. Find Overlapping Reads
• Correct errors using multiple alignment
TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAGATTACACAGATTATTGATAGATTACACAGATTACTGATAG-TTACACAGATTACTGA
TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG-TTACACAGATTATTGATAGATTACACAGATTACTGATAG-TTACACAGATTATTGA
insert A
replace T with Ccorrelated errors—probably caused by repeats disentangle overlaps
TAGATTACACAGATTACTGATAGATTACACAGATTACTGA
TAG-TTACACAGATTATTGA
TAGATTACACAGATTACTGA
TAG-TTACACAGATTATTGA
In practice, error correction removes up to 98% of the errors
![Page 10: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/10.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
2. Merge Reads into Contigs
• Overlap graph: Nodes: reads r1…..rn
Edges: overlaps (ri, rj, shift, orientation, score)
Note:of course, we don’tknow the “color” ofthese nodes
Reads that comefrom two regions ofthe genome (blueand red) that containthe same repeat
![Page 11: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/11.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
2. Merge Reads into Contigs
We want to merge reads up to potential repeat boundaries
repeat region
Unique Contig
Overcollapsed Contig
![Page 12: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/12.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
2. Merge Reads into Contigs
• Remove transitively inferable overlaps If read r overlaps to the right reads r1, r2,
and r1 overlaps r2, then (r, r2) can be inferred by (r, r1) and (r1, r2)
r r1 r2 r3
![Page 13: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/13.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
2. Merge Reads into Contigs
![Page 14: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/14.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
2. Merge Reads into Contigs
• Ignore “hanging” reads, when detecting repeat boundaries
sequencing error
repeat boundary???
ba
a
b
…
![Page 15: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/15.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Overlap graph after forming contigs
Unitigs:Gene Myers, 95
![Page 16: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/16.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Repeats, errors, and contig lengths
• Repeats shorter than read length are easily resolved Read that spans across a repeat disambiguates order of flanking regions
• Repeats with more base pair diffs than sequencing error rate are OK We throw overlaps between two reads in different copies of the repeat
• To make the genome appear less repetitive, try to:
Increase read length Decrease sequencing error rate
Role of error correction:Discards up to 98% of single-letter sequencing errors
decreases error rate decreases effective repeat content increases contig length
![Page 17: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/17.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
3. Link Contigs into Supercontigs
Too dense Overcollapsed
Inconsistent links Overcollapsed?
Normal density
![Page 18: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/18.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Find all links between unique contigs
3. Link Contigs into Supercontigs
Connect contigs incrementally, if 2 forward-reverse links
supercontig(aka scaffold)
![Page 19: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/19.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Fill gaps in supercontigs with paths of repeat contigsComplex algorithmic step• Exponential number of paths• Forward-reverse links
3. Link Contigs into Supercontigs
![Page 20: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/20.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
4. Derive Consensus Sequence
Derive multiple alignment from pairwise read alignments
TAGATTACACAGATTACTGA TTGATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGCGTAAACTATAG TTACACAGATTATTGACTTCATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGGGTAA CTA
TAGATTACACAGATTACTGACTTGATGGCGTAA CTA
Derive each consensus base by weighted voting
(Alternative: take maximum-quality letter)
![Page 21: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/21.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Some Assemblers
• PHRAP• Early assembler, widely used, good model of read errors
• Overlap O(n2) layout (no mate pairs) consensus
• Celera• First assembler to handle large genomes (fly, human, mouse)
• Overlap layout consensus
• Arachne• Public assembler (mouse, several fungi)
• Overlap layout consensus
• Phusion• Overlap clustering PHRAP assemblage consensus
• Euler• Indexing Euler graph layout by picking paths consensus
![Page 22: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/22.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Quality of assemblies—mouse
Terminology: N50 contig lengthN50 contig lengthIf we sort contigs from largest to smallest, and startCovering the genome in that order, N50 is the lengthOf the contig that just covers the 50th percentile.
7.7X sequence coverage
![Page 23: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/23.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Quality of assemblies—dog
7.5X sequence coverage
![Page 24: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/24.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
Quality of assemblies—chimp
3.6X sequence Coverage
AssistedAssembly
![Page 25: Some Terminology insert a fragment that was incorporated in a](https://reader035.vdocuments.mx/reader035/viewer/2022062323/5681599f550346895dc6ebd7/html5/thumbnails/25.jpg)
CS273a Lecture 4, Autumn 08, Batzoglou
History of WGA
• 1982: -virus, 48,502 bp
• 1995: h-influenzae, 1 Mbp
• 2000: fly, 100 Mbp
• 2001 – present human (3Gbp), mouse (2.5Gbp), rat*, chicken, dog, chimpanzee,
several fungal genomes
Gene Myers
Let’s sequence the human genome with the shotgun strategy
That is impossible, and a bad idea anyway
Phil Green
1997