some terminology insert a fragment that was incorporated in a

25
273a Lecture 4, Autumn 08, Batzoglou Some Terminology insert a fragment that was incorporated in a circular genome, and can be copied (cloned) vector the circular genome (host) that incorporated the fragment BAC Bacterial Artificial Chromosome, a type of insert–vector combination, typically of length 100-200 kb read a 500-900 long word that comes out of a sequencing machine coverage the average number of reads (or inserts) that cover a position in the target DNA piece shotgun the process of obtaining many reads sequencing from random locations in DNA, to detect overlaps and assemble

Upload: fruma

Post on 02-Feb-2016

34 views

Category:

Documents


0 download

DESCRIPTION

Some Terminology insert a fragment that was incorporated in a circular genome, and can be copied (cloned) vector the circular genome (host) that incorporated the fragment BAC Bacterial Artificial Chromosome, a type - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Some Terminologyinsert a fragment that was incorporated in a circular genome, and can be copied (cloned)

vector the circular genome (host) that incorporated the fragment

BAC Bacterial Artificial Chromosome, a type of insert–vector combination, typically of length 100-200 kb

read a 500-900 long word that comes out of a sequencing machine

coverage the average number of reads (or inserts) that cover a position in the target DNA piece

shotgun the process of obtaining many reads sequencing from random locations in DNA, to

detect overlaps and assemble

Page 2: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Whole Genome Shotgun Sequencing

cut many times at random

genome

forward-reverse paired reads

plasmids (2 – 10 Kbp)

cosmids (40 Kbp) known dist

~800 bp~800 bp

Page 3: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Fragment Assembly(in whole-genome shotgun sequencing)

Page 4: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Fragment Assembly

Given N reads…Given N reads…Where N ~ 30 Where N ~ 30

million…million…

We need to use a We need to use a linear-time linear-time algorithmalgorithm

Page 5: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Steps to Assemble a Genome

1. Find overlapping reads

4. Derive consensus sequence ..ACGATTACAATAGGTT..

2. Merge some “good” pairs of reads into longer contigs

3. Link contigs to form supercontigs

Some Terminology

read a 500-900 long word that comes out of sequencer

mate pair a pair of reads from two endsof the same insert fragment

contig a contiguous sequence formed by several overlapping readswith no gaps

supercontig an ordered and oriented set(scaffold) of contigs, usually by mate

pairs

consensus sequence derived from thesequene multiple alignment of reads

in a contig

Page 6: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

1. Find Overlapping Reads

aaactgcagtacggatctaaactgcag aactgcagt… gtacggatct tacggatctgggcccaaactgcagtacgggcccaaa ggcccaaac… actgcagta ctgcagtacgtacggatctactacacagtacggatc tacggatct… ctactacac tactacaca

(read, pos., word, orient.)

aaactgcagaactgcagtactgcagta… gtacggatctacggatctgggcccaaaggcccaaacgcccaaact…actgcagtactgcagtacgtacggatctacggatctacggatcta…ctactacactactacaca

(word, read, orient., pos.)

aaactgcagaactgcagtacggatcta actgcagta actgcagtacccaaactgcggatctacctactacacctgcagtacctgcagtacgcccaaactggcccaaacgggcccaaagtacggatcgtacggatctacggatcttacggatcttactacaca

Page 7: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

1. Find Overlapping Reads

• Find pairs of reads sharing a k-mer, k ~ 24• Extend to full alignment – throw away if not >98% similar

TAGATTACACAGATTAC

TAGATTACACAGATTAC|||||||||||||||||

T GA

TAGA| ||

TACA

TAGT||

• Caveat: repeats A k-mer that occurs N times, causes O(N2) read/read comparisons ALU k-mers could cause up to 1,000,0002 comparisons

• Solution: Discard all k-mers that occur “too often”

• Set cutoff to balance sensitivity/speed tradeoff, according to genome at hand and computing resources available

Page 8: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

1. Find Overlapping Reads

Create local multiple alignments from the overlapping reads

TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGA

Page 9: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

1. Find Overlapping Reads

• Correct errors using multiple alignment

TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAGATTACACAGATTATTGATAGATTACACAGATTACTGATAG-TTACACAGATTACTGA

TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG-TTACACAGATTATTGATAGATTACACAGATTACTGATAG-TTACACAGATTATTGA

insert A

replace T with Ccorrelated errors—probably caused by repeats disentangle overlaps

TAGATTACACAGATTACTGATAGATTACACAGATTACTGA

TAG-TTACACAGATTATTGA

TAGATTACACAGATTACTGA

TAG-TTACACAGATTATTGA

In practice, error correction removes up to 98% of the errors

Page 10: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

2. Merge Reads into Contigs

• Overlap graph: Nodes: reads r1…..rn

Edges: overlaps (ri, rj, shift, orientation, score)

Note:of course, we don’tknow the “color” ofthese nodes

Reads that comefrom two regions ofthe genome (blueand red) that containthe same repeat

Page 11: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

2. Merge Reads into Contigs

We want to merge reads up to potential repeat boundaries

repeat region

Unique Contig

Overcollapsed Contig

Page 12: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

2. Merge Reads into Contigs

• Remove transitively inferable overlaps If read r overlaps to the right reads r1, r2,

and r1 overlaps r2, then (r, r2) can be inferred by (r, r1) and (r1, r2)

r r1 r2 r3

Page 13: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

2. Merge Reads into Contigs

Page 14: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

2. Merge Reads into Contigs

• Ignore “hanging” reads, when detecting repeat boundaries

sequencing error

repeat boundary???

ba

a

b

Page 15: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Overlap graph after forming contigs

Unitigs:Gene Myers, 95

Page 16: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Repeats, errors, and contig lengths

• Repeats shorter than read length are easily resolved Read that spans across a repeat disambiguates order of flanking regions

• Repeats with more base pair diffs than sequencing error rate are OK We throw overlaps between two reads in different copies of the repeat

• To make the genome appear less repetitive, try to:

Increase read length Decrease sequencing error rate

Role of error correction:Discards up to 98% of single-letter sequencing errors

decreases error rate decreases effective repeat content increases contig length

Page 17: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

3. Link Contigs into Supercontigs

Too dense Overcollapsed

Inconsistent links Overcollapsed?

Normal density

Page 18: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Find all links between unique contigs

3. Link Contigs into Supercontigs

Connect contigs incrementally, if 2 forward-reverse links

supercontig(aka scaffold)

Page 19: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Fill gaps in supercontigs with paths of repeat contigsComplex algorithmic step• Exponential number of paths• Forward-reverse links

3. Link Contigs into Supercontigs

Page 20: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

4. Derive Consensus Sequence

Derive multiple alignment from pairwise read alignments

TAGATTACACAGATTACTGA TTGATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGCGTAAACTATAG TTACACAGATTATTGACTTCATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGGGTAA CTA

TAGATTACACAGATTACTGACTTGATGGCGTAA CTA

Derive each consensus base by weighted voting

(Alternative: take maximum-quality letter)

Page 21: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Some Assemblers

• PHRAP• Early assembler, widely used, good model of read errors

• Overlap O(n2) layout (no mate pairs) consensus

• Celera• First assembler to handle large genomes (fly, human, mouse)

• Overlap layout consensus

• Arachne• Public assembler (mouse, several fungi)

• Overlap layout consensus

• Phusion• Overlap clustering PHRAP assemblage consensus

• Euler• Indexing Euler graph layout by picking paths consensus

Page 22: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Quality of assemblies—mouse

Terminology: N50 contig lengthN50 contig lengthIf we sort contigs from largest to smallest, and startCovering the genome in that order, N50 is the lengthOf the contig that just covers the 50th percentile.

7.7X sequence coverage

Page 23: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Quality of assemblies—dog

7.5X sequence coverage

Page 24: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

Quality of assemblies—chimp

3.6X sequence Coverage

AssistedAssembly

Page 25: Some Terminology insert   a fragment that was incorporated in a

CS273a Lecture 4, Autumn 08, Batzoglou

History of WGA

• 1982: -virus, 48,502 bp

• 1995: h-influenzae, 1 Mbp

• 2000: fly, 100 Mbp

• 2001 – present human (3Gbp), mouse (2.5Gbp), rat*, chicken, dog, chimpanzee,

several fungal genomes

Gene Myers

Let’s sequence the human genome with the shotgun strategy

That is impossible, and a bad idea anyway

Phil Green

1997