sequence alignments
DESCRIPTION
Introduction to Bioinformatics. Sequence Alignments. Sequence Alignments. Cornerstone of bioinformatics What is a sequence? Nucleotide sequence Amino acid sequence Pairwise and multiple sequence alignments We will focus on pairwise alignments What alignments can help - PowerPoint PPT PresentationTRANSCRIPT
Intro to Bioinformatics – Sequence Alignment 2
Sequence AlignmentsSequence Alignments Cornerstone of bioinformatics What is a sequence?
• Nucleotide sequence• Amino acid sequence
Pairwise and multiple sequence alignments• We will focus on pairwise alignments
What alignments can help• Determine function of a newly discovered gene sequence• Determine evolutionary relationships among genes, proteins,
and species• Predicting structure and function of protein
Acknowledgement: This notes is adapted from lecture notes of both Wright State University’s Bioinformatics Program and Professor Laurie Heyer of Davidson College with permission.
Intro to Bioinformatics – Sequence Alignment 3
DNA ReplicationDNA Replication Prior to cell division, all the
genetic instructions must be “copied” so that each new cell will have a complete set
DNA polymerase is the enzyme that copies DNA• Reads the old strand in the 3´ to 5´
direction
Intro to Bioinformatics – Sequence Alignment 4
Over time, genes accumulate Over time, genes accumulate mutationsmutations Environmental factors
• Radiation• Oxidation
Mistakes in replication or repair Deletions, Duplications Insertions, Inversions Translocations Point mutations
Intro to Bioinformatics – Sequence Alignment 5
Codon deletion:ACG ATA GCG TAT GTA TAG CCG…• Effect depends on the protein, position, etc.• Almost always deleterious• Sometimes lethal
Frame shift mutation: ACG ATA GCG TAT GTA TAG CCG… ACG ATA GCG ATG TAT AGC CG?…• Almost always lethal
DeletionsDeletions
Intro to Bioinformatics – Sequence Alignment 6
IndelsIndels Comparing two genes it is generally impossible
to tell if an indel is an insertion in one gene, or a deletion in another, unless ancestry is known:
ACGTCTGATACGCCGTATCGTCTATCTACGTCTGAT---CCGTATCGTCTATCT
Intro to Bioinformatics – Sequence Alignment 7
The Genetic CodeThe Genetic Code
SubstitutionsSubstitutions are mutations accepted by natural selection.
Synonymous: CGC CGA
Non-synonymous: GAU GAA
Intro to Bioinformatics – Sequence Alignment 8
Comparing Two SequencesComparing Two Sequences Point mutations, easy:ACGTCTGATACGCCGTATAGTCTATCTACGTCTGATTCGCCCTATCGTCTATCT
Indels are difficult, must align sequences:ACGTCTGATACGCCGTATAGTCTATCTCTGATTCGCATCGTCTATCT
ACGTCTGATACGCCGTATAGTCTATCT----CTGATTCGC---ATCGTCTATCT
Intro to Bioinformatics – Sequence Alignment 9
Why Align Sequences?Why Align Sequences? The draft human genome is available Automated gene finding is possible Gene: AGTACGTATCGTATAGCGTAA
• What does it do?What does it do? One approach: Is there a similar gene in
another species?• Align sequences with known genes• Find the gene with the “best” match
Intro to Bioinformatics – Sequence Alignment 11
Scoring a Sequence AlignmentScoring a Sequence AlignmentGivenMatch score: +1Mismatch score: +0Gap penalty: –1SequencesACGTCTGATACGCCGTATAGTCTATCT ||||| ||| || ||||||||----CTGATTCGC---ATCGTCTATCTMatches: 18 × (+1)Mismatches: 2 × 0Gaps: 7 × (– 1)
Score = +11Score = +11
Intro to Bioinformatics – Sequence Alignment 12
Origination and Length PenaltiesOrigination and Length Penalties Note that a bioinformatics computational model or
algorithm must be “biologically meaningful” or even “biologically significant”
We want to find alignments that are evolutionarily likely.
Which of the following alignments seems more likely to you?ACGTCTGATACGCCGTATAGTCTATCTACGTCTGAT-------ATAGTCTATCTACGTCTGATACGCCGTATAGTCTATCTAC-T-TGA--CG-CGT-TA-TCTATCT
We can achieve this by penalizing more for a new gap, than for extending an existing gap
Intro to Bioinformatics – Sequence Alignment 13
Scoring a Sequence Alignment (2)Scoring a Sequence Alignment (2)Given Match/mismatch score: +1/+0Gap origination/length penalty: –2/–1Sequences ACGTCTGATACGCCGTATAGTCTATCT ||||| ||| || ||||||||----CTGATTCGC---ATCGTCTATCTMatches: 18 × (+1)Mismatches: 2 × 0Origination: 2 × (–2)Length: 7 × (–1)
Caution: Sometime “gap extension” used instead of “gap length” …
Score = +7Score = +7
Intro to Bioinformatics – Sequence Alignment 14
How can we find an optimal alignment?How can we find an optimal alignment? Finding the alignment is computationally hard:ACGTCTGATACGCCGTATAGTCTATCTCTGAT---TCG-CATCGTC--T-ATCT
C(27,7) gap positions = ~888,000 possibilities It’s possible, as long as we don’t repeat our
work! Dynamic programming: The Needleman &
Wunsch algorithm
Intro to Bioinformatics – Sequence Alignment 15
Dynamic ProgrammingDynamic Programming Technique of solving optimization problems
• Find and memorize solutions for subproblems• Use those solutions to build solutions for larger
subproblems• Continue until the final solution is found
Recursive computation of cost function in a non-recursive fashion
Intro to Bioinformatics – Sequence Alignment 16
Dynamic ProgrammingDynamic Programming Example
• Solving Fibonacci number f(n) = f(n-1) + f(n-2) recursively takes exponential time
Because many numbers are recalculated • Solving it using dynamic programming only takes a
linear time Use an array f[] to store the numbers
f[0] = 1;f[1] = 1;for (i = 2; i <= n; i++) f[i] = f[i – 1] + f[i – 2];
Intro to Bioinformatics – Sequence Alignment 17
Global Sequence AlignmentGlobal Sequence Alignment Needleman-Wunsch algorithm
Suppose we are aligning:a with a …
a0 -1
a -1
Di,j = max{ Di-1,j + d(Ai, –), Di,j-1 + d(–, Bj), Di-1,j-1 + d(Ai, Bj) }
i-1
j-1 j
i
Seq1
Seq2
A
B
Intro to Bioinformatics – Sequence Alignment 18
Dynamic Programming (DP) ConceptDynamic Programming (DP) Concept Suppose we are aligning:
CACGA CGA
Intro to Bioinformatics – Sequence Alignment 19
DP – Recursion PerspectiveDP – Recursion Perspective Suppose we are aligning:ACTCGACAGTAG
Last position choices:G +1 ACTCG ACAGTA
G -1 ACTC- ACAGTAG
- -1 ACTCGG ACAGTA
Intro to Bioinformatics – Sequence Alignment 20
What is the optimal alignment?What is the optimal alignment? ACTCGACAGTAG
Match: +1 Mismatch: 0 Gap: –1
Intro to Bioinformatics – Sequence Alignment 21
Needleman-Wunsch: Step 1Needleman-Wunsch: Step 1 Each sequence along one axis Gap penalty multiples in first row/column 0 in [1,1] (or [0,0] for the CS-minded)
A C T C G0 -1 -2 -3 -4 -5
A -1 1C -2A -3G -4T -5A -6G -7
Intro to Bioinformatics – Sequence Alignment 22
Needleman-Wunsch: Step 2Needleman-Wunsch: Step 2 Vertical/Horiz. move: Score + (simple) gap penalty Diagonal move: Score + match/mismatch score Take the MAX of the three possibilities
A C T C G0 -1 -2 -3 -4 -5
A -1 1C -2A -3G -4T -5A -6G -7
Intro to Bioinformatics – Sequence Alignment 23
Needleman-Wunsch: Step 2 (cont’d)Needleman-Wunsch: Step 2 (cont’d) Fill out the rest of the table likewise…
a c t c g0 -1 -2 -3 -4 -5
a -1 1 0 -1 -2 -3c -2a -3g -4t -5a -6g -7
Intro to Bioinformatics – Sequence Alignment 24
Needleman-Wunsch: Step 2 (cont’d)Needleman-Wunsch: Step 2 (cont’d) Fill out the rest of the table likewise…
The optimal alignment score is calculated in the lower-right corner
a c t c g0 -1 -2 -3 -4 -5
a -1 1 0 -1 -2 -3c -2 0 2 1 0 -1a -3 -1 1 2 1 0g -4 -2 0 1 2 2t -5 -3 -1 1 1 2a -6 -4 -2 0 1 1g -7 -5 -3 -1 0 2
Intro to Bioinformatics – Sequence Alignment 25
a c t c g0 -1 -2 -3 -4 -5
a -1 1 0 -1 -2 -3c -2 0 2 1 0 -1a -3 -1 1 2 1 0g -4 -2 0 1 2 2t -5 -3 -1 1 1 2a -6 -4 -2 0 1 1g -7 -5 -3 -1 0 2
But what But what isis the optimal alignment the optimal alignment To reconstruct the optimal alignment, we must
determine of where the MAX at each step came from…
Intro to Bioinformatics – Sequence Alignment 26
A path corresponds to an alignmentA path corresponds to an alignment = GAP in top sequence = GAP in left sequence = ALIGN both positions One path from the previous table: Corresponding alignment (start at the end):
AC--TCGACAGTAG
Score = +2
Intro to Bioinformatics – Sequence Alignment 27
Algorithm AnalysisAlgorithm Analysis Brute force approach
• If the length of both sequences is n, number of possibility = C(2n, n) = (2n)!/(n!)2 22n / (n)1/2, using Sterling’s approximation of n! = (2n)1/2e-nnn.
• O(4n) Dynamic programming
• O(mn), where the two sequence sizes are m and n, respectively
• O(n2), if m is in the order of n
Intro to Bioinformatics – Sequence Alignment 28
Practice ProblemPractice Problem Find an optimal alignment for these two
sequences:GCGGTTGCGT
Match: +1 Mismatch: 0 Gap: –1
g c g g t t0 -1 -2 -3 -4 -5 -6
g -1c -2g -3t -4
Intro to Bioinformatics – Sequence Alignment 29
Practice ProblemPractice Problem Find an optimal alignment for these two
sequences:GCGGTTGCGT g c g g t t
0 -1 -2 -3 -4 -5 -6g -1 1 0 -1 -2 -3 -4c -2 0 2 1 0 -1 -2g -3 -1 1 3 2 1 0t -4 -2 0 2 3 3 2
GCGGTTGCG-T- Score = +2
Intro to Bioinformatics – Sequence Alignment 30
g c g0 -1 -2 -3
g -1 1 0 -1g -2 0 1 1c -3 -1 1 1g -4 -2 0 2
Semi-global alignmentSemi-global alignment Suppose we are aligning:GCGGGCG
Which do you prefer?G-CG -GCGGGCG GGCG
Semi-global alignment allows gaps at the ends for free.• Terminal gaps are usually the result of incomplete
data acquisition no biologically significant
Intro to Bioinformatics – Sequence Alignment 31
Semi-global alignmentSemi-global alignment
g c g0 0 0 0
g 0 1 0 1g 0 1 1 1c 0 0 2 1g 0 1 1 3
Semi-global alignment allows gaps at the ends for free.
Initialize first row and column to all 0’s Allow free horizontal/vertical moves in last row
and column
Intro to Bioinformatics – Sequence Alignment 32
Local alignmentLocal alignment Global alignments – score the entire alignment Semi-global alignments – allow unscored gaps
at the beginning or end of either sequence Local alignment – find the best matching
subsequence CGATGAAATGGA
This is achieved by allowing a 4th alternative at each position in the table: zero.
Intro to Bioinformatics – Sequence Alignment 33
Local Sequence Alignment Local Sequence Alignment Why local sequence alignment?
• Subsequence comparison between a DNA sequence and a genome
• Protein function domains• Exons matching
Smith-Waterman algorithm
Di,j = max{ Di-1,j + d(Ai, –), Di,j-1 + d(–,Bj), Di-1,j-1 + d(Ai,Bj), 0 }
Initialization: D1,j = , Di,1 =
Intro to Bioinformatics – Sequence Alignment 34
Local alignmentLocal alignment Score: Match = 1, Mismatch = -1, Gap = -1
CGATGAAATGGA
c g a t g0 0 0 0 0 0
a 0 0 0 1 0 0a 0 0 0 1 0 0a 0 0 0 1 0 0t 0 0 0 0 2 1g 0 0 1 0 1 3g 0 0 1 0 0 2a 0 0 0 2 1 1
Intro to Bioinformatics – Sequence Alignment 36
More ExampleMore Example Align
ATGGCCTCACGGCTCMismatch = -3Gap = -4
-- A C G G C T C0 -4 -8 -12 -16 -20 -24 -28
1 -3-3
--ATGGCCTC
-4-8-12-16-20-24-28-32
-7 -11 -15 -19 -23-2 -6 -10 -14 -14 -18
-7 -6 -1 -5 -9 -13 -17-11 -10 -5 0 -4 -8 -12-15 -10 -9 -4 1 -3 -7-19 -14 -13 -8 -3 -2 -2-23 -18 -17 -12 -7 -2 -5-27 -22 -21 -16 -11 -6 -1
GlobalAlignment:
ATGGCCTCACGGC-TC
Intro to Bioinformatics – Sequence Alignment 37
More ExampleMore Example Local
Alignment:
ATGGCCTCACGG CTC
or
ATGGCCTCACGGC TC
-- A C G G C T C0 0 0 0 0 0 0 0
1 00
--ATGGCCTC
00000000
0 0 0 0 00 0 0 0 1 0
0 0 1 1 0 0 00 0 1 2 0 0 00 1 0 0 3 0 10 1 0 0 1 0 10 0 0 0 0 2 00 1 0 0 1 0 3
Intro to Bioinformatics – Sequence Alignment 38
Scoring Matrices for DNA SequencesScoring Matrices for DNA Sequences Transition: A G C T Transversion: a purine (A or G) is replaced by a
pyrimadine (C or T) or vice versa
Intro to Bioinformatics – Sequence Alignment 39
Scoring Matrices for Protein Sequence Scoring Matrices for Protein Sequence PAM 250
Intro to Bioinformatics – Sequence Alignment 40
Scoring Matrices for Protein Sequence Scoring Matrices for Protein Sequence PAM (Percent Accepted Mutations)
1 PAM unit can be thought of as the amount of time in which an “average” protein mutates 1 out of every 100 amino acids.
Perform multiple sequence alignment on a “family” of proteins that are at least 85% similar. Find the frequency of amino acid i and j are aligned to each other and normalize it.
Entry mij in PAM1 represents the probability of amino acid i substituted by amino acid j in 1 PAM unit PAM 2 = PAM 1 × PAM 1 PAM n = (PAM 1)n, e.g., PAM 250 = (PAM 1)250
Questions Why are values in a PAM matrix integers? Shouldn’t a probability be
between 0 and 1? Why is PAM250 possible? Shouldn’t a probability be less than or equal
to 100%?
Intro to Bioinformatics – Sequence Alignment 41
Scoring Matrices for Protein Sequence Scoring Matrices for Protein Sequence BLOSUM (BLOcks SUbstitution Matrix) 62
Intro to Bioinformatics – Sequence Alignment 42
Using Protein Scoring MatricesUsing Protein Scoring Matrices Divergence
BLOSUM 80 BLOSUM 62 BLOSUM 45PAM 1 PAM 120 PAM 250Closely related Distantly relatedLess divergent More divergentLess sensitive More sensitive
Looking for• Short similar sequences → use less sensitive matrix• Long dissimilar sequences → use more sensitive matrix• Unknown → use range of matrices
Comparison• PAM – designed to track evolutionary origin of proteins• BLOSUM – designed to find conserved regions of proteins
43
Multiple Sequence AlignmentMultiple Sequence Alignment Why multiple sequence alignment (MSA)
• Two sequences might not look very similar.• But, some “similarity” emerges with more sequences,
however. Is dynamic programming still applicable? CLUSTALW
• One of most popular tools for MSA • Heuristic-based approach• Basic
1) Calculate the distance matrix based on pairwise alignments2) Construct a guide tree
NJ (unrooted tree) Mid-point (rooted tree)3) Progressive alignment using the guide tree