Accepted Manuscript

Analytical methods

Selection and characterization of DNA aptamers against Staphylococcus aur-eus enterotoxin C1

Yukun Huang, Xiujuan Chen, Nuo Duan, Shijia Wu, Zhouping Wang, XinlinWei, Yuanfeng Wang

PII: S0308-8146(14)00925-XDOI: http://dx.doi.org/10.1016/j.foodchem.2014.06.039Reference: FOCH 15981

To appear in: Food Chemistry

Received Date: 31 December 2013Accepted Date: 8 June 2014

Please cite this article as: Huang, Y., Chen, X., Duan, N., Wu, S., Wang, Z., Wei, X., Wang, Y., Selection andcharacterization of DNA aptamers against Staphylococcus aureus enterotoxin C1, Food Chemistry (2014), doi:http://dx.doi.org/10.1016/j.foodchem.2014.06.039

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customerswe are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, andreview of the resulting proof before it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1

1

Selection and characterization of DNA aptamers against 2

Staphylococcus aureus enterotoxin C1 3

Yukun Huang,a Xiujuan Chen,

a Nuo Duan,

a Shijia Wu,

a Zhouping Wang,

a* Xinlin 4

Wei,b Yuanfeng Wang

b 5

a State Key Laboratory of Food Science and Technology, Synergetic Innovation Center 6

of Food Safety and Nutrition, School of Food Science and Technology, Jiangnan 7

University, Wuxi 214122, China 8

b Collage of Life and Environment Sciences, Shanghai Normal University, Shanghai 9

200234, China 10

11

* Corresponding author. Tel & Fax: +86-510-85917023; E-mail: wangzp@jiangnan.edu.cn;

wangzp1974@hotmail.com

2

Abstract 12

Enterotoxins from pathogenic bacteria are known as the main reason that can cause 13

the bacterial foodborne diseases. In this study, aptamers that bound to Staphylococcus 14

aureus enterotoxin C1 (SEC1) with high affinity and selectivity were generated in 15

vitro by twelve rounds of selection based on magnetic separation technology, with a 16

low-level dissociation constant (Kd) value of 65.14 ± 11.64 nmol/L of aptamer C10. 17

Aptamer-based quantification of SEC1 in the food sample by a graphene oxide 18

(GO)-based method was implemented to investigate the potential of the aptamer 19

against SEC1 with a limit of detection of 6 ng/mL. On the basis of this work, 20

biosensors using the selected SEC1 aptamers as new molecular recognition elements 21

could be applied for innovative determinations of SEC1. 22

Keywords 23

Aptamer; Staphylococcus aureus enterotoxin C1; SELEX; graphene oxide; food 24

25

3

1. Introduction 26

27

Staphylococcus aureus enterotoxins (SEs) consist of a group of structurally related 28

serologically distinct and thermostable proteins extracellularly expressed by S. aureus, 29

with a size range from approximately 22 to 28 kDa (Dinges, Orwin, & Schlievert, 30

2000; Pinchuk, Beswick, & Reyes, 2010). Three major subtypes exist in type C 31

enterotoxins, namely SEC1, C2, C3, which are highly conserved proteins with 32

significant immunological cross-reactivity (Marr, Lyon, Roberson, Lupher, Davis, & 33

Bohach, 1993a). Staphylococcal food poisoning (SFP) caused by the ingestion of food 34

contaminated with SEs is the second most commonly reported foodborne illness, 35

which frequently contaminates food such as meat, poultry, egg, milk and dairy 36

products (Argudin, Mendoza, & Rodicio, 2010). The two separate biological activities 37

of SEs are that they can cause gastroenteritis in the gastrointestinal tract and that they 38

can act as a superantigen on the immune system (McCormick, Yarwood, & Schlievert, 39

2001; Ortega, Abriouel, Lucas, & Galvez, 2010; Schlievert, Shands, Dan, Schmid, & 40

Nishimura, 1981). Among the SEs, SEC1 is usually isolated from animals (Marr, 41

Lyon, Roberson, Lupher, Davis, & Bohach, 1993b) and is heat- and acid-resistant. As 42

a result, enterotoxins may not be completely denatured by the mild cooking of 43

contaminated food from animal products. Therefore, rapid, sensitive and reliable 44

detection methods are crucial for routine determinations of SEs to prevent and control 45

food contamination and deliberate adulterants (DeGrasse, 2012). 46

To date, there are three types of methods typically used to detect bacterial toxins in 47

4

food: bioassays, molecular biological methods and immunological techniques 48

(Hennekinne, Ostyn, Guillier, Herbin, Prufer, & Dragacci, 2010). Molecular 49

biological methods mainly involve polymerase chain reaction (PCR), which detects 50

genes encoding enterotoxins in strains of S. aureus isolated from food samples (Chen, 51

Hsiao, Chiou, & Tsen, 2001; Hsiao, Chen, & Tsen, 2003). This method demands 52

complicated handling procedures, strict laboratory conditions and professional 53

operators, and it has gradually been substituted for immunoassay-based detection 54

(Jankovic, Dordevic, Lakicevic, Borovic, Velebit, & Mitrovic, 2012; Ostyn, Guillier, 55

Prufer, Papinaud, Messio, Krys, et al., 2011). Currently, enzyme-linked 56

immunosorbent assay (ELISA) kits for SEs are commercially available and used in 57

the laboratory; however, most of them require long preparation times, have high costs 58

for the antibodies, and are susceptive to conditions (Ono, Omoe, Imanishi, Iwakabe, 59

Hu, Kato, et al., 2008). As a result, new methods are necessary to be developed for the 60

detection of SEs. 61

Aptamers are RNA and DNA fragments originating from in vitro selection 62

experiments, which optimize the nucleic acids for high-affinity binding to given 63

targets (Hermann, 2000). Typically, aptamers are generated by a process termed 64

systematic evolution of ligands by exponential enrichment (SELEX), in which ligands 65

are isolated from highly diverse (1013

-1015

) starting nucleic acid pools via rounds of 66

affinity capture and amplification (Hermann, 2000; Shamah, Healy, & Cload, 2008). 67

Due to their specific complex stem-loop and internal loop spatial structures, aptamers 68

can be selected for a variety of targets from small molecules to whole organisms, 69

5

including toxins (Cruz-Aguado & Penner, 2008; Tang, Yu, Guo, Xie, Shao, & He, 70

2007; Tok & Fischer, 2008) and pathogens (Bruno & Kiel, 1999; Joshi, Janagama, 71

Dwivedi, Kumar, Jaykus, Schefers, et al., 2009) related to food safety. Aptamers show 72

the following significant advantages compared with antibodies: rapid and efficient 73

recognition, economical and facile preparation, a wide range of targets, stability 74

during storage and functionalization with flexibility. However, except for SEB 75

(DeGrasse, 2012), aptamer sequences for other serological types of SEs have not yet 76

been reported. 77

In this study, SELEX was performed to select ssDNA aptamers against SEC1 using 78

fast separation and the preconcentration of SEC1 immobilized on magnetic beads 79

(Stoltenburg, Reinemann, & Strehlitz, 2005). The affinity and selectivity of the 80

selected aptamers were confirmed by binding assays and specificity tests, and the Kd 81

values were measured by nonlinear regression analysis. Moreover, the analytical 82

performance of the selected aptamer for use in the determination of SEC1 in a food 83

matrix (reconstituted milk) was investigated. This study demonstrates the promising 84

application of aptamer-based recognition in biosensors for the detection of SEC1. 85

86

2. Experimental 87

88

2.1. Reagents and materials 89

90

All chemicals for preparing the buffers and solutions were purchased from 91

6

Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). The PCR components 92

including PCR buffer, dNTPs and Taq DNA polymerase were purchased from 93

Shanghai Sangon Biological Science & Technology Company (Shanghai, China). The 94

lambda exonuclease and 1×lambda exonuclease reaction buffer were purchased from 95

New England Biolabs (Hitchin, U.K.). SEC1 was purchased from Beijing Biomai 96

(Beijing, China). The polyacrylamide gel electrophoresis (PAGE) components, such 97

as the acrylamide/bis-acrylamide 30% solution, were purchased from Sigma-Aldrich 98

Company (St. Louis, MO, U.S.A.), and both ammonium persulfate and TEMED were 99

purchased from Shanghai Sangon (Shanghai, China). The full cream sweet milk 100

powder was supplied by Yangyangxiang Dairy Co., Ltd (Shanxi, China). The 101

solutions were prepared with ultra-high purity water from a Millipore water 102

purification system. 103

The FT-IR spectra of the SEC1-coated magnetic beads were obtained with a Nicolet 104

Nexus 470 Fourier transform infrared spectrophotometer (Thermo Electron Co., 105

U.S.A.) using the KBr method. The preparations of the DNA aptamer pools were 106

completed using a C1000 PCR Amplifier, Mini-PROTEAN Tetra Cell and a 107

PowerPac Basic Power Supply and Molecular Imager® Gel Doc™ XR+ System with 108

Image Lab™ Software (Bio-Rad Co., U.S.A.). The fluorescence spectra of 109

FAM-labeled ssDNA were measured on an F-7000 fluorescence spectrophotometer 110

(Hitachi Co., Japan). 111

112

2.2. DNA library and primers 113

7

114

The starting DNA template (listed in Table S1) contained a central randomized 115

sequence of 40 nucleotides flanked by defined primer-binding sites of 20 nucleotides 116

for PCR amplification. The initial ssDNA library was synthesized by Integrated DNA 117

Technologies (IDT) (Coralville, IA) with machine mixing for the bases within the 118

center random sequence domain and was purified by PAGE (IDT). The primers (Table 119

S1) used for the amplification were obtained from Shanghai Sangon (Shanghai, China) 120

with the reverse primer labeled with 5′-phosphate for the ssDNA preparation. The 121

library and primers were respectively diluted to 100 µM with TE buffer (100 mM 122

Tris-HCl, 10 mM EDTA·Na2, pH 7.4) and were stored at -20 °C until they were used. 123

124

2.3. Preparation of SEC1-coated magnetic beads as a selection target 125

126

Amine-functionalized Fe3O4 magnetic beads with particle diameters of 127

approximately 25 nm were prepared based on modifications to Wang and Li’s method 128

(Wang, Bao, Wang, Zhang, & Li, 2006). Based on the classical glutaraldehyde method 129

(Hun & Zhang, 2007), homemade magnetic beads were used as immobilization 130

matrixes for the SEC1 target. 200 µg of highly purified SEC1 (purity > 99%) was 131

bound to 20 mg of magnetic beads. Following conjugation and washing, SEC1-coated 132

magnetic beads were dispersed in 10 mL of PBS (137 mM NaCl, 2.7 mM KCl, 10 133

mM Na2HPO4 and 2 mM KH2PO4, pH 7.4), and the solution was stored at 4 °C until 134

use. The blank beads used in the negative-selection experiment were treated in the 135

8

same way without a ligand. Suspensions of 100 µL of coated and uncoated beads were 136

separately taken out to dry at 37 °C for characterization by FT-IR. 137

138

2.4. Asymmetric PCR and the preparation of the single-stranded DNA (ssDNA) pool 139

140

An asymmetric PCR protocol was performed for the amplification of the target 141

sequences and the enrichment of the ssDNA pool for the subsequent round. Six 142

replicates of each 50 µL PCR mixture contained 5 µL of the templates, 25 nmol of 143

dNTPs and 0.5 µL of Taq DNA polymerase (5 U/µL), and the proportion of the 144

forward primers to the 5′-phosphorylated reverse primers was maintained in the range 145

of 50:1 and 100:1 with a consistent amount of forward primers (20 pmol). The PCR 146

reaction was carried out as follows: it started at 95 °C for 5 min; was followed by 147

18-25 cycles of 95 °C for 30 s, 57 °C for 30 s and 72 °C for 30 s; was extended at 148

72 °C for 5 min and ended with cooling to 4 °C. Successful amplification and PCR 149

product DNA fragments of the correct size were identified using 8% native 150

polyacrylamide gel electrophoresis (PAGE) by Gelred (Biotium Co., U.S.A.) staining. 151

The DNA purified via Tris-phenol extraction and ethanol precipitation was quantified 152

using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Co., U.S.A.) to 153

calculate the amount of lambda exonuclease (γ exonuclease) (5 U/µL) and 1×γ 154

exonuclease reaction buffer that was required for γ exonuclease cleavage of the 155

5′-phosphorylated sequences, which was performed according to the instructions for 156

the use of γ exonuclease (the mixture was fully blended and submerged in a water 157

9

bath at 37 °C for 30 min for the cleavage reaction followed by enzyme deactivation at 158

75 °C for 10 min). The final cleavage mixture was subjected to 8% denaturing PAGE 159

with 7 M urea to confirm the successful preparation of the ssDNA. The rest of the 160

ssDNA pool was purified using the same method and was redissolved in sterile water. 161

162

2.5. In vitro selection of the ssDNA aptamers for SEC1 163

164

For the first round of SELEX, 2 nmol of DNA random library was dissolved in 500 165

µL of binding buffer (BB) (20 mM Tris, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 166

1 mM MgCl2·6H2O, pH 7.4). The ssDNA library was denatured by heating at 95 °C 167

for 5 min and then cooled immediately on ice for 10 min while 100 µL of suspensions 168

of SEC1-coated beads were washed three times with BB. Subsequently, the denatured 169

DNA library (500 µL) was added to the washed beads and incubated at 37 °C with 170

gentle shaking for 60 min. After being magnetically separated, the beads were washed 171

twice with 500 µL of BB (37 °C) to discard the unbound ssDNA. Then, the bound 172

ssDNA fragments were thermally dissociated and eluted with 100 µL of 1×PCR 173

loading buffer at 95°C for 10 min with three repetitions. The eluates were collected 174

and purified by Tris-phenol extraction and ethanol precipitation to be used as 175

templates for PCR amplification. After the preparation of the ssDNA pool from the 176

PCR products, the amount of ssDNA was measured using a NanoDrop 2000 177

Spectrophotometer, and 200 pmol of the purified ssDNA was used in the next 178

selection round. 179

10

Altogether, 12 selection rounds were performed to generate the ssDNA aptamers 180

that bound with SEC1. From the fourth round on, negative selection and counter 181

selection were combined to reduce the enrichment of nonspecific ssDNA during the 182

course of the selection process. Each ssDNA pool was first incubated with uncoated 183

beads (negative selection) for 10 min, which was followed by the collection of the 184

unbound ssDNA, and then, it was incubated with SEC1-coated beads. In addition, the 185

substitution of SEA-coated beads for uncoated beads was used in the counter selection, 186

which was performed in the sixth, ninth and twelfth rounds. The incubation time was 187

increasingly shortened with the increased development of the selection. The other 188

procedures were similar to those of the initial round, and the selection procedure was 189

repeated until the twelfth round of PCR amplification was completed. 190

191

2.6. Cloning, sequencing, and structural analysis of the aptamers 192

193

The PCR products of last round were purified and cloned using the TaKaRa Code 194

D101A kit (TaKaRa Biotechnology, Dalian, China) and were transformed into E. coli 195

DH5α-T1R cells (Invitrogen). The colonies containing the vector were selected by 196

overnight incubation at 37 °C on LB plates containing 50 µg/mL of kanamycin. Forty 197

colonies were chosen for screening. The plasmid DNA was purified (QIAEX II Gel 198

Extraction Kit; Qiagen, Mississauga, ON, Canada) and analyzed for the presence of 199

an 80 bp insert by digestion with 1 U of EcoR1 at 37 °C for 30 min followed by 7.5% 200

native PAGE. A total of 52 inserts were sequenced by BigDye® Terminator v3.1 201

11

Cycle Sequencing Kits (Applied Biosystems, U.S.A.) by Shanghai Boshang 202

Biological Technology Company (Shanghai, China), which yielded 42 useable 203

sequences. Ten families of sequences were grouped by DNAMAN and ClustalW2 204

software. The secondary structure of each sequence was predicted using the RNA 205

structure 4.6. 206

207

2.7. Binding assay and measurement of Kd values 208

209

The selected aptamer clones were assayed for their binding affinity to SEC1, 210

mainly in accordance with the selection process. 5′-FAM-labeled ssDNA aptamers 211

synthesized from Shanghai Sangon were diluted to 10 µM with BB and kept at -20 °C 212

until use. The aptamers were individually diluted to concentrations of 30, 80, 130, 180, 213

230 and 280 nM with BB (500 µL). Each fresh aliquot of SEC1-coated beads (100 µL 214

suspension mixed well) was washed three times with BB in a tube, and each aptamer 215

solution was mixed with the beads for incubation at 37 °C for 1 h. Following the 216

binding reaction, the unbound ssDNA was removed by magnetic separation, and the 217

beads were washed several times with 500 µL of BB (37 °C). Then, the beads were 218

heat eluted twice with 200 µL of BB at 95 °C for 10 min. The eluates were collected 219

and the fluorescence intensity of ssDNA was measured by an F-7000 fluorescence 220

spectrophotometer using excitation and emission wavelengths of 492 and 532 nm, 221

respectively. The same assays were performed with uncoated beads to inspect the 222

non-specific adsorption of bead matrix to the aptamers. Saturation curves of relative 223

12

fluorescence intensity of the eluted aptamers versus the concentrations of total 224

incubated aptamers were obtained by GraphPad Prism 5.0 software, and from these 225

curves, the Kd values were estimated by nonlinear regression analysis. Each point on 226

the saturation binding curves was determined by three parallel experiments, and the 227

assays throughout the entire procedure were protected from light. 228

229

2.8. Specificity tests by a GO-based method 230

231

Based on the results of binding assays, the dominant aptamers were selected to test 232

their specificities for SEC1 and other protein analogues via the use of water-soluble 233

GO as a sensor (Lu, Yang, Zhu, Chen, & Chen, 2009). GO was prepared from 234

graphite powder by a modified Hummer’s method (Hummers & Offeman, 1958), 235

which was explained in the previous work by our group (Wu, Duan, Ma, Xia, Wang, 236

Wang, et al., 2012). A 1 mg/mL GO aqueous solution was prepared by ultrasonication 237

and was kept at room temperature. In the beginning of the GO sensing, each 238

5′-FAM-labeled ssDNA aptamer was heated at 95 °C for 10 min and immediately 239

cooled to 0 °C for 10 min to denature the aptamer into unfolded structure. The critical 240

amount of GO used to quench the fluorescence of individual 50 nM 5′-FAM-labeled 241

ssDNA aptamers was previously determined. Equivalents of different targets (SEC, 242

SEA, SEB, IgG, BSA and casein along with a blank control) were individually added 243

into the ssDNA for incubation at 37 °C for 45 min. Then, the mixtures were mixed 244

with GO at 37 °C for 20 min to quench the fluorescence completely (Lu, Yang, Zhu, 245

13

Chen, & Chen, 2009). Finally, the fluorescence intensity of the mixture was measured 246

directly by an F-7000 fluorescence spectrophotometer without separation using 247

excitation and emission wavelengths of 492 and 532 nm, respectively. The experiment 248

was performed on each sample in triplicate, and the entire operation was protected 249

from light. 250

251

2.9. An aptamer-based detection of SEC1 in a food sample 252

253

The aptamer-based detection of SEC1 was further applied in practical samples, and 254

a complex food matrix of reconstituted milk was chosen because milk and milk 255

products were estimated as food products that were frequently contaminated (Cretenet, 256

Even, & Le Loir, 2011). Based on the same mode with specificity tests, the interaction 257

between GO and ssDNA was used in this bioassay (Lu, Yang, Zhu, Chen, & Chen, 258

2009). The reconstituted milk was made according to the instructions on the package 259

of milk powder, which was diluted seven fold by sterile deionized water (W/V = 1:7). 260

A series of SEC1 standard solutions at concentration gradient were individually added 261

to the samples (100 µL). Each spiked sample was centrifuged at 4,000 g at 25 °C for 262

10 min. Subsequently, the fat layer was discarded, and the liquid was diluted to 400 263

µL. A 40 pmol aliquot of 5′-FAM-labeled ssDNA aptamer C10 and 30 µg GO were 264

introduced into the sample for incubation at 37 °C for 60 min. Subsequently, the 265

fluorescence intensity of the complex solutions were measured by an F-7000 266

fluorescence spectrophotometer using excitation and emission wavelengths of 485 and 267

14

528 nm, respectively. The calibration curve of the aptamer-based detection of SEC1 268

was made by plotting the fluorescence intensity against the SEC1 concentration. Each 269

point was determined in three parallel samples, and the entire operation was protected 270

from light. 271

The accuracy of the selected aptamer, C10, was also evaluated. According to the 272

calibration curve, six different concentrations of spiked SEC1 samples were assayed 273

to determinate the recovery rate. Each experiment was repeated three times, and 274

throughout the entire operation the samples were protected from light. 275

276

3. Results and discussion 277

278

3.1. Characterization of the SEC1-coated magnetic beads 279

280

The coupling process involved the amino groups of the SEC1 protein binding to the 281

amino groups on the surface of magnetic beads using glutaraldehyde as a crosslinking 282

agent. SEC1-bead conjugates were analyzed by FT-IR spectroscopy. As shown in 283

Figure 1, characteristic absorption peaks of the SEC1-protein appeared at 1576 and 284

1631 cm-1, which can be attributed to the stretching vibration of C=O band and the 285

bending vibration of N-H band, respectively. More complex, stronger and broader 286

peaks near 3445 cm-1

corresponding to the stretching vibration of N-H band appeared 287

in the spectrum, which could be distinctly compared with spectrum of the uncoated 288

beads. 289

15

290

3.2. In vitro selection of the ssDNA aptamers against SEC1 291

292

In this study, asymmetric PCR was chosen and performed before the experiment for 293

amplification. Initially, symmetric PCR was used and high molecular weight products 294

were generated, which affected the enrichment of target aptamers. However, 295

asymmetric PCR preferentially increased the target ssDNA and decreased the primer 296

dimers as well as non-specific production. When the PAGE results of asymmetric 297

PCR productions showed a clear strap, the correct molecular weight, specific 298

amplification and the brightness of the strap increased regularly with the development 299

of the selection, it was indicated that the selected ssDNA pool had been enriched in 300

every round. However, asymmetric PCR productions contained a fraction of 301

double-stranded DNA, and thus, γ exonuclease cleavage was used to prepare the 302

ssDNA pool (as shown in Figure S1). 303

Magnetic separation technology was applied to concentrate and harvest the targeted 304

aptamers, with advantages such as easy handling, use of a very small amount of target, 305

rapid and efficient separation of the bound from the unbound DNA and stringent 306

washing steps (Stoltenburg, Reinemann, & Strehlitz, 2005). To enhance the affinity of 307

binding of aptamers to SEC1, the selection conditions were made increasingly strict, 308

including shortening the incubation time and decreasing the amounts of the target. 309

Additionally, negative selection and counter selection were conducted to reduce the 310

non-specific physical adsorption of uncoated magnetic beads to the ssDNA and isolate 311

16

the common aptamers that could recognize other target SEs, respectively. 312

313

3.3. Sequence analysis of the selected aptamers 314

315

From the results of the sequencing clones, %GC was in the range of 38.75 ~ 47.50. 316

Ten families were grouped based on the homology and conserved sequences of the 317

primary sequence motifs. One sequence with low energy within each of ten families 318

was picked out to reflect the stability of the ssDNA when combined with the target, as 319

shown in Table 1. The results indicated diversification in the central section of the 320

selected aptamers, which can be attributed to various binding sites owing to α-fold 321

and β-lamellar structures and several amino acids over the SEC1. Similarly, the 322

secondary structural predictions (Figure 2A) revealed that these aptamers were mainly 323

hairpin and bulge loops structures primarily composed of T, which were speculated as 324

the probable binding sites to SEC1. 325

326

3.4. Measurement of the Kd values 327

328

To measure the Kd values of ten selected aptamers against their target, relative 329

fluorescence intensity values were determined in magnetic beads-based affinity assays. 330

To determine the interference in the measurements from non-specific absorption, the 331

affinity of the ssDNA to bare magnetic beads was also studied. The results showed 332

that some experimental aptamers were inclined to bind to SEC1-coated beads with 333

17

high affinity. However, some aptamers displayed an unsaturation trend of binding to 334

both SEC1-coated and uncoated beads with increasing concentrations of the aptamers, 335

suggesting a low binding affinity to SEC1. From the binding curves (Figure 2B), three 336

aptamers (C36.2, C10 and C9) showed relatively high affinities for SEC1, and they 337

barely bound to uncoated beads after three repetitions of the washing steps. 338

339

3.5. Specificity tests by a GO sensor 340

341

According to the results of the affinity assays, three aptamers with affinities to 342

SEC1 were selected for specificity tests. Based on the interaction of GO with DNA 343

nucleobases and nucleosides (Varghese, Mogera, Govindaraj, Das, Maiti, Sood, et al., 344

2009), 5′-FAM-labeled aptamers adsorbed onto GO can trigger FRET between FAM 345

and GO, where FAM acts as an excited donor fluorophore and GO acts as an acceptor 346

fluorophore through long-range dipole-dipole interactions for the detection of SEC1 347

(as shown in Figure 3) (Liu, Aizen, Freeman, Yehezkeli, & Willner, 2012; Sheng, Ren, 348

Miao, Wang, & Wang, 2011). When GO-based homogeneous sensing between ssDNA 349

aptamers and various target proteins is used in specificity tests, it has some 350

advantages over traditional competition assays, including convenient handling in 351

solutions, less target consumption and rapid detection (Mehta, Rouah-Martin, Van 352

Dorst, Maes, Herrebout, Scippo, et al., 2012). Here, the interaction of GO and ssDNA 353

was characterized by atomic force microscope (AFM) in the previous work of our 354

group(Wu, et al., 2012). As the results show, aptamers preferred to bind to targets by 355

18

conformational recognition, giving rise to the fluorescence of complexes of aptamers 356

and SEC1. However, the amount of GO had an effect on the fluorescence intensity 357

measurements such that when the amount of GO was excess, the fluorescence of FAM 358

was not determined with enough sensitivity. This result may be because adsorption of 359

excess GO to ssDNA may restrain the folded ssDNA from binding to free targets. 360

Thus, the critical amount of GO was used throughout the specificity tests. Histograms 361

of the restoration fluorescence intensity of the aptamers were plotted as shown in 362

Figure 4. As can be seen, the three aptamers that bound to SEC1 also showed partial 363

cross-binding to other SEs (SEA and SEB) and barely bound to IgG, BSA and casein 364

with a blank control. Combined with the results of these confirmatory analyses, C10 365

was considered as the optimal aptamer that recognized SEC1 with high affinity and 366

selectivity. 367

368

3.6. An aptamer-based fluorescent detection of SEC1 in a food sample 369

370

To explore the potential application of the aptamer-based quantification of SEC1, a 371

fluorescent bioassay was conducted. Due to the fact that the dynamic balance of the 372

interaction between GO and aptamer was affected by interaction time, temperature 373

and ion concentration, it was necessary to control the conditions of the aptamer-based 374

quantitative determination of SEC1 through the GO platform. The milk sample, when 375

diluted fourfold, could reach the lowest autofluorescence interference and not affect 376

the measurement. Under the optimal conditions, the fluorescence intensity increased 377

19

proportionally with higher concentrations of SEC1. A calibration curve was performed 378

over the range of 0.01-10 µg/mL of SEC1, with a limit of detection of 6 ng/mL (y = 379

3.485x + 78.28, R2 = 0.9962, Figure 5). 380

The recovery analysis was studied for the evaluation of the accuracy of SEC1 381

quantification in milk by this developed method. The recovery rates ranged from 382

90.39% to 101.48% (listed in Table S2), which demonstrated that the selected aptamer 383

could be available for the detection of SEA in real-world samples. 384

385

4. Conclusions 386

387

This study describesd the development of a set of aptamers that recognized SEC1 388

with high affinity and favorable selectivity through a twelve-round selection process. 389

Ten sequences from different families were selected for further characterization via 390

binding assays and specificity tests. The optimal aptamer C10 bound to SEC1 with Kd 391

below 100 nM. In addition, GO sensing was performed to investigate the analytical 392

potential of the selected aptamer for the detection of SEC1 in the milk sample by 393

aptamer-based recognition for the first time. This study implied that aptamer-based 394

detection of SEC1 was a feasible process compared to detection with antibodies, 395

which can be expected to broaden the modes of detection for SEs. 396

397

Acknowledgements 398

399

20

This work was partly supported by the S&T Supporting Project of Jiangsu Province 400

(BE2011621, BE2012614) and Guangdong Province (2011B031500025), National 401

S&T Support Program of China (2012BAK08B01), Research Fund for the Doctoral 402

Program of Higher Education (20110093110002), NCET-11-0663, and 403

JUSRP51309A. 404

405

Appendix A. Supplementary data 406

Supplementary data associated with this article can be found, in the online version, at 407

doi:10.1016/j.foodchem.2014.xx.xxx. 408

409

References 410

411

Argudin, M. A., Mendoza, M. C., & Rodicio, M. R. (2010). Food Poisoning and Staphylococcus aureus 412

Enterotoxins. Toxins, 2(7), 1751-U1342. 413

Bruno, J. G., & Kiel, J. L. (1999). In vitro selection of DNA aptamers to anthrax spores with 414

electrochemiluminescence detection. Biosensors & Bioelectronics, 14(5), 457-464. 415

Chen, T. R., Hsiao, M. H., Chiou, C. S., & Tsen, H. Y. (2001). Development and use of PCR primers 416

for the investigation of C1, C2 and C3 enterotoxin types of Staphylococcus aureus strains isolated 417

from food-borne outbreaks. International Journal of Food Microbiology, 71(1), 63-70. 418

Cretenet, M., Even, S., & Le Loir, Y. (2011). Unveiling Staphylococcus aureus enterotoxin production 419

in dairy products: a review of recent advances to face new challenges. Dairy Science & Technology, 420

91(2), 127-150. 421

Cruz-Aguado, J. A., & Penner, G. (2008). Determination of Ochratoxin A with a DNA Aptamer. J Agric 422

Food Chem, 56(22), 10456-10461. 423

DeGrasse, J. A. (2012). A Single-Stranded DNA Aptamer That Selectively Binds to Staphylococcus 424

aureus Enterotoxin B. PLOS ONE, 7(3), e33410-33416. 425

Dinges, M. M., Orwin, P. M., & Schlievert, P. M. (2000). Exotoxins of Staphylococcus aureus. Clinical 426

Microbiology Reviews, 13(1), 16-21. 427

Hennekinne, J. A., Ostyn, A., Guillier, F., Herbin, S., Prufer, A. L., & Dragacci, S. (2010). How Should 428

Staphylococcal Food Poisoning Outbreaks Be Characterized? Toxins, 2(8), 2106-2116. 429

Hermann, T. (2000). Adaptive Recognition by Nucleic Acid Aptamers. Science, 287(5454), 820-825. 430

Hsiao, M. H., Chen, T. R., & Tsen, H. Y. (2003). Novel PCR primers for specific detection of C1, C2 431

21

and C3 enterotoxin genes in Staphylococcus aureus. Journal of Food and Drug Analysis, 11(4), 432

338-343. 433

Hummers, W. S., & Offeman, R. E. (1958). Preparation of Graphitic Oxide. J Am Chem Soc, 80, 1. 434

Hun, X., & Zhang, Z. J. (2007). Functionalized fluorescent core-shell nanoparticles used as a 435

fluorescent labels in fluoroimmunoassay for IL-6. Biosensors & Bioelectronics, 22(11), 2743-2748. 436

Jankovic, V., Dordevic, V., Lakicevic, B., Borovic, B., Velebit, B., & Mitrovic, R. (2012). 437

DETERMINATION OF STAPHYLOCOCCAL ENTEROTOXINS IN CHEESE BY 438

IMMUNOENZYME ASSAYS. Archives of Biological Sciences, 64(4), 1449-1454. 439

Joshi, R., Janagama, H., Dwivedi, H. P., Kumar, T. M. A. S., Jaykus, L. A., Schefers, J., & Sreevatsan, 440

S. (2009). Selection, characterization, and application of DNA aptamers for the capture and detection 441

of Salmonella enterica serovars. Mol Cell Probes, 23(1), 20-28. 442

Liu, X. Q., Aizen, R., Freeman, R., Yehezkeli, O., & Willner, I. (2012). Multiplexed Aptasensors and 443

Amplified DNA Sensors Using Functionalized Graphene Oxide: Application for Logic Gate 444

Operations. Acs Nano, 6(4), 3553-3563. 445

Lu, C. H., Yang, H. H., Zhu, C. L., Chen, X., & Chen, G. N. (2009). A graphene platform for sensing 446

biomolecules. Angew Chem Int Ed Engl, 48(26), 4785-4787. 447

Marr, J. C., Lyon, J. D., Roberson, J. R., Lupher, M., Davis, W. C., & Bohach, G. A. (1993a). 448

Characterization of Novel Type C-Staphyloccal Enterotoxins - Biological and Evolutionary 449

Implications. Infection and Immunity, 61(10), 4254-4262. 450

Marr, J. C., Lyon, J. D., Roberson, J. R., Lupher, M., Davis, W. C., & Bohach, G. A. (1993b). 451

CHARACTERIZATION OF NOVEL TYPE C-STAPHYLOCCAL ENTEROTOXINS - 452

BIOLOGICAL AND EVOLUTIONARY IMPLICATIONS. Infect Immun, 61(10), 4254-4262. 453

McCormick, J. K., Yarwood, J. M., & Schlievert, P. M. (2001). Toxic shock syndrome and bacterial 454

superantigens: An update. Annual Review of Microbiology, 55, 77-104. 455

Mehta, J., Rouah-Martin, E., Van Dorst, B., Maes, B., Herrebout, W., Scippo, M. L., Dardenne, F., 456

Blust, R., & Robbens, J. (2012). Selection and Characterization of PCB-Binding DNA Aptamers. 457

Anal Chem, 84(3), 1669-1676. 458

Ono, H. K., Omoe, K., Imanishi, K., Iwakabe, Y., Hu, D. L., Kato, H., Saito, N., Nakane, A., Uchiyama, 459

T., & Shinagawa, K. (2008). Identification and Characterization of Two Novel Staphylococcal 460

Enterotoxins, Types S and T. Infect Immun, 76(11), 4999-5005. 461

Ortega, E., Abriouel, H., Lucas, R., & Galvez, A. (2010). Multiple Roles of Staphylococcus aureus 462

Enterotoxins: Pathogenicity, Superantigenic Activity, and Correlation to Antibiotic Resistance. Toxins, 463

2(8), 2117-2131. 464

Ostyn, A., Guillier, F., Prufer, A. L., Papinaud, I., Messio, S., Krys, S., Lombard, B., & Hennekinne, J. 465

A. (2011). Intra-laboratory validation of the Ridascreen (R) SET Total kit for detecting 466

staphylococcal enterotoxins SEA to SEE in cheese. Lett Appl Microbiol, 52(5), 468-474. 467

Pinchuk, I. V., Beswick, E. J., & Reyes, V. E. (2010). Staphylococcal Enterotoxins. Toxins, 2(8), 468

2177-2197. 469

Schlievert, P. M., Shands, K. N., Dan, B. B., Schmid, G. P., & Nishimura, R. D. (1981). Identification 470

and characterization of an exotoxin from Staphylococcus aureus associated with toxic-shock 471

syndrome. The Journal of infectious diseases, 143(4), 509-516. 472

Shamah, S. M., Healy, J. M., & Cload, S. T. (2008). Complex target SELEX. Accounts of Chemical 473

Research, 41(1), 130-138. 474

Sheng, L. F., Ren, J. T., Miao, Y. Q., Wang, J. H., & Wang, E. K. (2011). PVP-coated graphene oxide 475

22

for selective determination of ochratoxin A via quenching fluorescence of free aptamer. Biosensors & 476

Bioelectronics, 26(8), 3494-3499. 477

Stoltenburg, R., Reinemann, C., & Strehlitz, B. (2005). FluMag-SELEX as an advantageous method for 478

DNA aptamer selection. Anal Bioanal Chem, 383(1), 83-91. 479

Tang, J. J., Yu, T., Guo, L., Xie, J. W., Shao, N. S., & He, Z. K. (2007). In vitro selection of DNA 480

aptamer against abrin toxin and aptamer-based abrin direct detection. Biosensors & Bioelectronics, 481

22(11), 2456-2463. 482

Tok, J. B. H., & Fischer, N. O. (2008). Single microbead SELEX for efficient ssDNA aptamer 483

generation against botulinum neurotoxin. Chemical Communications(16), 1883-1885. 484

Varghese, N., Mogera, U., Govindaraj, A., Das, A., Maiti, P. K., Sood, A. K., & Rao, C. N. (2009). 485

Binding of DNA nucleobases and nucleosides with graphene. Chemphyschem, 10(1), 206-210. 486

Wang, L. Y., Bao, J., Wang, L., Zhang, F., & Li, Y. D. (2006). One-pot synthesis and bioapplication of 487

amine-functionalized magnetite nanoparticles and hollow nanospheres. Chemistry-a European 488

Journal, 12(24), 6341-6347. 489

Wu, S. J., Duan, N., Ma, X. Y., Xia, Y., Wang, H. G., Wang, Z. P., & Zhang, Q. (2012). Multiplexed 490

Fluorescence Resonance Energy Transfer Aptasensor between Upconversion Nanoparticles and 491

Graphene Oxide for the Simultaneous Determination of Mycotoxins. Anal Chem, 84(14), 6263-6270. 492

493

494

495

23

Figure Captions 496

497

Figure 1. Infrared spectra of the amine-functionalized magnetic beads (without SEC1) 498

(a) and SEC1-coated magnetic beads (b). 499

500

Figure 2. Analysis of representative aptamer sequences. (A) Predicted secondary 501

structures of clones C36.2, C10 and C9 as determined by RNA structure 4.6. (B) 502

Saturation curves of aptamers C36.2, C10 and C9. The Kd values are 49.43 ± 11.76 503

nM, 65.14 ± 11.64 nM and 154.9 ± 45.67 nM, respectively. The data are presented as 504

the mean ± SD for n = 3 measurements of the same sample. 505

506

Figure 3. Scheme for target incubation-induced fluorescence-labeled aptamer 507

liberation from GO. 508

509

Figure 4. Selectivity of the GO-FRET-based SEC1 sensor over SEA, SEB, IgG, BSA 510

and casein (all of 30 µg/mL), with a blank contrast. Data are presented as mean ± SD, 511

n = 3 measurements of the same sample, in a column graph format. 512

513

Figure 5. Analysis of the detection of SEC1 in the milk sample through the 514

aptamer-based fluorescent bioassay. 515

516

24

517

Figure 1 518

519

25

520

C36.2 C10 C9 521

A 522

523

B 524

Figure 2 525

526

26

527

Figure 3 528

529

27

530

Figure 4 531

532

28

533

Figure 5 534

535

29

Table 1. The representative sequences of the aptamers (5′-3′) from the ten families 536

with the central regions underlined. 537

Family Sequence of the selected aptamer No.

I AGCAGCACAGAGGTCAGATGTATCAGAATTAATGCTCTCGTA

ATTTTCGAATCGTCGTGTCCTATGCGTGCTACCGTGAA

C36.2

II AGCAGCACAGAGGTCAGATGCTTTCATTTTTATTCTTTTTGAC

TGTATTTTATGTACCATCCTATGCGTGCTACCGTGAA

C34.1

III AGCAGCACAGAGGTCAGATGCTAACCTAATTCGACCGTGTAT

TCTTCTGCGTTATTTACCCCTATGCGTGCTACCGTGAA

C4

IV AGCAGCACAGAGGTCAGATGTATACTTCTAAAATTTGTTTGTA

TCTACGATGTTCTTCGTCCTATGCGTGCTACCGTGAA

C10

V AGCAGCACAGAGGTCAGATGTCCATTATCAGGTTCTTTATTC

TGTTGTTCAACTTATTAACCTATGCGTGCTACCGTGAA

C9

VI AGCAGCACAGAGGTCAGATGTTTTAGATTTAGCTCTTATTTGT

TCGAGCAATCCCAAAGACCTATGCGTGCTACCGTGAA

C32.1

VII AGCAGCACAGAGGTCAGATGGCCAACTCAATTTTTTGTTTTG

TCTTTCCGATTGATCTTACCTATGCGTGCTACCGTGAA

C2

VIII AGCAGCACAGAGGTCAGATGCATATCGAATTTTCCTCGTGAT

TTTTCTTTCATTCTTAGACCTATGCGTGCTACCGTGAA

C6

IX AGCAGCACAGAGGTCAGATGTAGTTAATGGATTTTTCTTCTTT

ATCTTCTTATTTCTTGACCTATGCGTGCTACCGTGAA

C11

X AGCAGCACAGAGGTCAGATGATGTTTTCCCTTATCACTACTT

TTATTTGTCTTTTTGCACCCTATGCGTGCTACCGTGAA

C30

538

539

30

Highlights of the manuscript entitled "Selection and 540

characterization of DNA aptamers against Staphylococcus 541

aureus enterotoxin C1" 542

543

1. Aptamers against Staphylococcus aureus enterotoxin C1 (SEC1) with high affinity 544

and selectivity were in vitro selected by a twelve-round selection process. 545

2. Detection of SEC1 by an aptamer-based fluorescent bioassay was successfully 546

achieved in the real-world sample of milk. 547

3. This study laid a good foundation for the development of the rapid, exact and 548

dependable detection methods of SEC1 and other enterotoxins in the field of food 549

safety. 550

551