seladin-1 expression in rat adrenal gland: effect of

53

Seladin-1 expression in rat adrenal
gland: effect of adrenocorticotropichormone treatment
Marie-Claude Battista, Claude Roberge, Melissa Otis and Nicole Gallo-Payet

Service of Endocrinology, Department of Medicine, Faculte de medecine et des sciences de la sante, Universite de Sherbrooke, 3001, 12th Avenue North,Sherbrooke, Quebec, Canada J1H 5N4

(Requests for offprints should be addressed to N Gallo-Payet; Email: [email protected])

Abstract

Seladin-1 (KIAA0018) gene is the seventhmost highlyexpressed

gene in the adult adrenal gland, along with genes coding for

steroidogenic enzymes. The aim of the present study was to

investigate the localization of the Seladin-1 protein in control

and ACTH-treated rat adrenal glands and to verify whether

Seladin-1 is involved in secretion. Immunofluorescence studies

revealed that Seladin-1 was localized principally in the zona

fasciculata, cytoplasm, and nucleus. Expression of Seladin-1 was

increased byACTH treatment, in vivo and in culture conditions.

Subcellular fractionation of fasciculata cells showed that Seladin-

1 was mainly present in the nucleus, membrane, and

cytoskeleton fractions and, to a lesser extent, in the cytosol.

ACTH treatment decreased Seladin-1 expression in the cytosol,

with a concomitant increase in the nuclear fraction. In the

glomerulosa and fasciculata cells in culture, ACTH induced a

Journal of Endocrinology (2007) 192, 53–660022–0795/07/0192–053 q 2007 Society for Endocrinology Printed in Great

relocalization of Seladin-1 into specific nuclear regions. This

ACTH-induced relocalization was abrogated by the pre-

treatment of cells with 75 nM U18666A (an inhibitor of

Seladin-1). In addition, fasciculata cells exhibited an increase in

the basal level of steroid secretionwhen cultured in the presence

of U18666A (25 and 75 nM), although ACTH-induced

secretion was decreased. In summary, the present study

demonstrates that the protein expression of Seladin-1 is more

abundant in fasciculata cells than in glomerulosa cells and that

the ACTH treatment increases both expression and nuclear

localization of the protein. Results also suggest that depending

on its cellular localization, the D24-reductase activity of

Seladin-1 may play a major role in steroid secretion in the

adrenal gland.

Journal of Endocrinology (2007) 192, 53–66

Introduction

The adult adrenal cortex is composed of three concentric

layers: the zona glomerulosa, the zona fasciculata, and the zona

reticularis, all of which present different morphological and

functional properties. Zona glomerulosa is specialized in the

production of aldosterone while zona fasciculata/reticularis

synthesize cortisol in humans and bovine, and corticosterone

in rodents (for review, see Rainey 1999). The overall

production of aldosterone, however, is in the order of

picomolar, compared with the micromolar range for

cortisol/corticosterone (Gallo-Payet & Payet 1989, Rainey

1999, Sewer &Waterman 2003). The adrenal gland undergoes

constant dynamic structural changes and is generally well

acknowledged that cellular proliferation is preferentially

observed at the periphery of the gland (zona glomerulosa)

while cell death is increased in zona reticularis. The regulated

balance between proliferation and apoptosis is a prerequisite for

the integrative functionality of the gland (for review, see

Wolkersdorfer & Bornstein 1998, Vinson 2003, 2004).

Aside from angiotensin II (Ang II), adrenocorticotropin

hormone (ACTH) is the most potent stimulus of aldosterone

secretion by glomerulosa cells and of corticosterone by

fasciculata cells (Gallo-Payet & Payet 2003). ACTH acts not

only on the immediate, transcription-independent stimu-

lation of adrenal steroid synthesis and release, but also

increases the expression of a number of genes including

those involved in steroidogenesis (Sewer & Waterman 2003).

Despite several studies using both animal and human

glomerulosa and fasciculata cells, the precise molecular

mechanisms by which ACTH stimulates growth and

secretory activities are complex and poorly understood.

Over the past few years, studies on gene profiling and

regulation have provided key elements in our comprehension

as to how cell functions are regulated at the molecular level.

For instance, Seladin-1 (K1AA0018) gene is the seventh most

highly expressed known gene in the human adult adrenal

gland, along with genes coding for steroidogenic enzymes

(Hu et al. 2000). This gene is also expressed in the human fetal

adrenal gland with a fourfold increase in the expression when

compared with the adult (Rainey et al. 2001), thus being the

highest expressed known gene in human fetal adrenal gland

(Rainey et al. 2002). This protein has also been identified in

the brain and termed Seladin-1, for SELective Alzheimer

Disease INdicator 1, due to its propensity to protect neurons

from b-amyloid peptide-induced toxicity, thus promoting cell

DOI: 10.1677/joe.1.07062Britain Online version via http://www.endocrinology-journals.org

M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands54

survival (Greeve et al. 2000). Seladin-1 is a human homolog of

the Diminuto/Dwarf1 gene described in plants where it is

involved in growth and steroid synthesis (Takahashi et al.

1995, Klahre et al. 1998). In normal human adrenal cortex,

Seladin-1 mRNA expression is present throughout the gland

although more intense in the zona fasciculata (Sarkar et al.

2001). In adrenal glands from dexamethasone-treated rats

after ACTH treatment as well as in active human

adrenocortical adenomas, Seladin-1/hDiminuto mRNA is

overexpressed conversely to a reduced expression in adrenal

carcinomas (Sarkar et al. 2001, Luciani et al. 2004). In the

human adrenocortical cancer cell line H295R as well as in the

cultured human primary adrenocortical cells, Seladin-1

mRNA is regulated by the ACTH/cAMP pathway (Sarkar

et al. 2001, Luciani et al. 2004).

Seladin-1, a member of the flavin adenine dinucleotide-

dependent oxidoreductases family, is also named 3-b-hydroxysterol D-24-reductase (DHCR24; Greeve et al.

2000). This enzyme is known to catalyze the conversion of

desmosterol to cholesterol (Waterham et al. 2001), the

preferential pathway of cholesterol synthesis in the human

and the rat fetal brain (Fumagalli & Paoletti 1963). In humans,

mutations of the DHCR24 gene result in a rare and severe

recessive autosomic disorder called desmosterolosis. This

pathology is characterized by desmosterol accumulation in

plasma and tissues, by multiple congenital anomalies, and by

severe mental retardation (Waterham et al. 2001). Recently,

Seladin-1 was also described as a key regulator of Ras-induced

senescence and responses to oncogenic and oxidative stress

(Wu et al. 2004).

There is limited data available relative to Seladin-1 at the

protein level in the adrenal gland, the tissue with the highest

transcription level of Seladin-1 (Greeve et al. 2000). There-

fore, the first aim of the present study was to generate a

specific antibody to investigate the expression and cellular/

intracellular distribution of Seladin-1 protein in the adrenal

gland of both control and ACTH-treated rats. The second

aim was to compare this distribution in primary cultures of

adult rat glomerulosa and fasciculata cells, before and after

ACTH treatment. Using this model, we thereby explored

whether Seladin-1 is possibly involved in selected adreno-

cortical cell functions.

Materials and Methods

Chemicals

The chemicals used in the present study were obtained from

the following sources: Tissue-Tek from Miles (Elkhart, IN,

USA); Minimum Essential Medium (MEM Eagle’s medium)

and OPTI-MEMw from Life Technologies; collagenase from

NewEnglandNuclear (Boston,MA,USA);DNase fromSigma

Chemical Co.; ACTH 1–24 peptide (Cortrosyn) from

Organon (Toronto, Ont., Canada); ACTH 1–39 peptide

(Synacthen Depot 100 IU/ml) from Ciba Pharmaceuticals


(Caldwell, NJ, USA); angiotensin II from Bachem (Marina

Delphen, CA, USA). BrdU (5-bromo-2-deoxyuridine), anti-

BrdU, the secondary antibodies (mouse and rabbits) coupled

to Alexa-Fluor-488, Alexa-Fluor-594, the lectin wheat germ

agglutinin (WGA), and 4 0, 6 0-diamino-2-phenylindole

(DAPI) were from Molecular Probes (Eugene, OR, USA).

The anti-actin was from Chemicon International, Inc.

(Temecula, CA, USA); Vectamount from Vector Laboratories

(Burlingame, CA, USA); horseradish peroxidase-conjugated

anti-rabbit and anti-mouse antibodies and enhanced chemi-

luminescence (ECL) system from Amersham. The ProteoEx-

tract Subcellular Proteome Extraction Kit and the Seladin-1

inhibitor, U18666A (3b-(2-diethylaminoethoxy)androst-5-

en-17-one), were purchased from Calbiochem (San Diego,

CA, USA) and the RNAaqueous-4PCR Kit from Ambion

(Austin, TX, USA). [3H]aldosterone (76 Ci/mmol) and

[3H]corticosterone (70 Ci/mmol) were obtained from New

England Nuclear, Dupont (Boston, MA, USA) and the anti-

corticosterone from Medicorp (Montreal, Quebec, Canada).

Aldosterone antiserum was purchased from ICN Bio-

chemicals (Costa Mesa, CA, USA). All the other chemicals

were of A-grade purity.

Animals

Long–Evans female rats weighing 200–250 g were purchased

from Charles River, St Constant, Quebec, Canada. Upon

arrival, the rats were kept under controlled light and

temperature in our institution’s animal care facilities for 2

weeks prior to the start of the experimental procedure to

allow the animals to adapt to their environment, thereby

reducing stress. Rats were then randomly distributed in

control or in ACTH-treated groups. Animals were treated

once a day (1500 h) for 7 days either with saline (control) or

with Synacthen Depot subcutaneously (8 IU/250 g body

weight per day) and killed by decapitation on the morning of

the eighth day. All the protocols were approved by the Animal

Care and Ethics Committee of our faculty. A number of three

to five animals were used for each experiment and three

different experiments were performed.

Generation and characterization of Seladin-1 antiserum

The Seladin-1 antiserum was produced by Affinity Bior-

eagents (Golden CO, USA): rabbits were immunized with the

same peptide as the one used by Greeve et al. (2000),

consisting of amino acid residues 203–218 of Seladin-1 H3N-

TPSENSDLFYAVPWSC-COOH, maleimide-conjugated

to keyhole-limpet hemocyanin. This sequence is identical

in human, rat, and mouse. Specificity of the antibody was

confirmed by western blotting. Briefly, following electro-

phoresis and transfer, polyvinylidene difluoride membranes

were incubated as described below with Seladin-1 antiserum

(dilution 1:1000), with the pre-immune serum (dilution

1:1000) or with the Seladin-1 antiserum neutralized by the

peptide raised against at 175-fold molar excess. The

www.endocrinology-journals.org

Seladin-1 localization in rat adrenal glands . M-C BATTISTA and others 55

expression of Seladin-1 was compared with total rat adrenal

gland, brain, and cerebellum for equal protein loading

(20 mg). Seladin-1 antiserum detected two bands (77 and

47 kDa) in the adrenal gland (lane 2), and three bands (77, 60,

and 47 kDa) in the brain (lane 3) and cerebellum (lane 4;

Fig. 1A). Lane 5 shows a negative control (Leammli buffer).

Since the pre-immune serum (Fig. 1B) detected one band in

the adrenal gland (47 kDa) and two bands in the brain and

A1 2 3 4 5

1 2 3 4 5

1 2 3 4 5

125

38

85

7760

47

B

125

31

38

85

7760

47

C

125

38

857760

47

Figure 1 Representative western blot analysis of Seladin-1expression. (A) Seladin-1 antiserum detection in rat adrenal gland(lane 2), rat brain (lane 3), and rat cerebellum (lane 4) for equalprotein loading (20 mg). Lane 1 shows kaleidoscope markers andlane 5 serves as a negative control (Laemmli Buffer). In the adrenalgland, both the 77 and the 47 kDa bands are present while in thebrain and cerebellum; there is an additional band at 60 kDa. (B)Immunoblot in the presence of pre-immune serum. In the adrenalgland, only the 77 kDa band is specific since the 60 and 47 kDabands are also detected with the pre-immune serum. (C) Peptideneutralization assay confirming the specificity of the 77 kDa band,since the latter disappears in all three tissues. All the assays wereperformed at identical dilutions and exposure times.


cerebellum (60 and 47 kDa), these were deemed non-specific

bands. Therefore, the 77 kDa band observed in Fig. 1A

appeared as specific for Seladin-1. With the peptide

neutralized-Seladin-1 antiserum, the 77 kDa band was no

longer detected in the three tissues (Fig. 1C), indicating

specificity of this band. Similar observation was also made in

the human fetal adrenal gland (data not shown).

Preparation of glomerulosa and fasciculata cell cultures

Glomerulosa and fasciculata cells were obtained from adrenal

glands of female Long–Evans rats and isolated according to the

method previously described in detail (Gallo-Payet & Payet

1989). Isolation and cell dissociation of glomerulosa and

fasciculata zones were performed in MEM (supplemented

with 2% fetal bovine serum (FBS), 100 U/ml penicillin, and

100 mg/ml streptomycin). After a 20-min incubation at 37 8C

with collagenase (2 mg/ml) and DNase (25 g/ml), cells were

disrupted by gentle aspiration with a sterile 10 ml pipette,

filtered, and centrifuged for 10 min at 100 g. For western blot

analyses (Fig. 6) from freshly isolated cells, 1!106 glomerulosa

and fasciculata cells were immediately processed for subcellular

protein extraction, and frozen until western blotting. For cell

cultures, cell pellets were resuspended in OPTI-MEMw

supplemented with 2% fetal bovine serum, 100 U/ml

penicillin, and 100 g/ml streptomycin. The glomerulosa and

fasciculata cells were plated in triplicate for immunofluores-

cence experiments (5!104 cells per dish). The cells were left

to adhere to the Petri dishes for 45 min before adding the

culture medium. The cells were cultured at 37 8C in a

humidified atmosphere composed of 95% air–5% CO2. The

culture medium was changed 6 h after initial addition of the

medium, and the cells were used after 3 days of culture. The

glomerulosa cells were stimulated with either Ang II (100 nM)

or ACTH (10 nM) for 3-day treatments, twice a day and

fasciculata cellswere stimulatedwithACTH(10 nM) for 3-day

treatments, also twice a day.

Fasciculata cells (5!104 cells)were also treated for 3dayswith

orwithoutACTH (10 nM, twice a day) alone or in the presence

of the Seladin-1 inhibitor, U18666A (25–75 nM, once a day).

U18666A, a cell-permeable, amphiphilic amino-steroid, is a

high-affinity binding inhibitor of the D24-reductase activity ofSeladin-1 (IC50: 0.15 mM), resulting in desmosterol accumu-

lation. At low concentrations (nanomolar range), U18666A

inhibits the D24-reductase activity of Seladin-1, with no effect

on cell viability (Bae & Paik 1997, Fliesler et al. 2000, Cenedella

et al. 2004). It inhibits the cholesterol metabolism activity of

Seladin-1. The cells were examined daily, and phase-contrast

images were taken using a microscope (Leica Corp., Deerfield,

IL, USA) equipped with a!32 objective.

Immunofluorescence studies in whole glands and cultured cells

Control and 7-day ACTH-treated female Long–Evans rats

were killed and adrenal glands dissected and retrieved. Glands

were either embedded in paraffin for hematoxylin–eosin



counterstaining in order to identify morphological structures

or frozen and embedded in a cryoprotectant optimal cutting

temperature (OCT Tissue-Tek) for immunofluorescence

studies. Tissue sections (5 mm) or glomerulosa and fasciculata

cells grown in culture for immunofluorescence were fixed in

3.7% formaldehyde, permeabilized in PBS–0.2% Triton

X-100, and blocked in PBS–0.5% BSA, 0.2% Triton. Tissue

sections and cells were then incubated with the primary anti-

Seladin-1 antiserum or with the pre-immune serum (both

1:1000) followed by incubation with a secondary conjugated

anti-rabbit antibody coupled with Alexa-Fluor-594 nm

(1:500; red, frozen tissue) or Alexa-Fluor-488 nm (1:500;

green, cultured cells) for 1 h at room temperature. The cells

were also incubated with the lectin WGA, known as a Golgi

apparatus marker (5 mg/ml; red) coupled to Alexa-594 (1:500,

red; Kovacs et al. 2004). Tissues and cells were also stained with

DAPI (1:1000; blue) for visualization of nuclei. Slides were

mountedwithVectashieldmountingmedium and imageswere

acquired with a Hamamatsu, ORCA-ER digital camera and

examined under a fluorescence Nikon Eclipse 2000 inverted

microscope (Nikon, Mississauga, ON, Canada) equipped for

epi-illumination. Tissue images were acquired using a!10 or

!20 objectives, whereas cell images were acquired using a

!100 objective. Images were processed with Metamorph

(version 4.6r10) software (Universal Imaging Corporation,

Downingtown, PA, USA). In all the cases, no specific staining

was observed when primary antiserum was replaced by pre-

immune serum at the same dilution and exposure time. Images

were acquired using identical camera settings for contrast and

brightness. To better evaluate Seladin-1 nuclear expression

within the zona glomerulosa (under the capsule, four to five

cell layers), zona fasciculata, and zona reticularis, results were

expressed as the percentage of Seladin-1-stained nuclei found

within each cortical zone when compared with the total

number of nuclei present in that zone. Seladin-1 staining

within the nuclei was defined as the resulting pink color

obtained by the superposition of DAPI and anti-Seladin-1,

while total number included blue-colored nuclei.

Tissue protein extraction and subcellular fractionation

The glomerulosa and fasciculata zones were isolated from the

adrenal gland and separately snap-frozen in liquid nitrogen

and stored at K80 8C for tissue protein extraction, or cells

were immediately processed for subcellular protein fraction-

ation, as described below. The zona fasciculata fraction also

contains the zona reticularis, which is difficult to separate

from the medulla which we attempted to discard with two

small scapel cuts, but remnants are always possible. Since this

fraction contains predominantly fasciculata, it is referred to as

zona fasciculata throughout the text. Total tissue protein

extraction was performed after addition of boiling 2%

SDS/1% Triton/PBS solution to the zona glomerulosa and

zona fasciculata tissues (0.2 g tissue/ml). Tissues were

homogenized using a Teflon potter and heated at 100 8C

for 5 min. This procedure was repeated thrice. Subcellular


protein fractionation (cytosol, membranes, nucleus, and

cytoskeleton fractions) was done using the ProteoExtract

Subcellular Proteome Extraction Kit according to the

manufacturer’s instructions (Calbiochem). This kit contains

four extraction buffers prepared with ultra-pure chemicals

to ensure high reproducibility, protease inhibitor cocktail to

prevent protein degradation and benzonase nuclease to

remove contaminating nucleic acids. ProteoExtract Subcel-

lular Proteome Extraction Kit yields the total proteome

fractionated into four subproteomes of decreased complexity.

This kit has a high efficiency for subcellular fractionation

(Abdolzade-Bavil et al. 2004) and is widely used (Singh et al.

2004, Zhang & Insel 2004). All samples were assayed for

protein content before western blotting. Equivalent amounts

of proteins (15–30 mg for each fraction of subcellular

fractionation of isolated cells and 15 mg for total tissue proteinextraction) were compared in each experiment.

Western blotting

All the samples were separated on 12% SDS-polyacrylamide

gels and proteins transferred electrophoretically onto poly-

vinylidene difluoride membranes. After two washes with

Tris-buffered saline (pH 7.5)–Tween 20 (0.05%; TBS-T),

membranes were blocked with 5% milk/TBS-T. Membranes

were incubated with Seladin-1 antiserum (dilution 1:1000).

Detection was performed by reaction with horseradish

peroxidase-conjugated anti-rabbit secondary antibody and

visualized by enhanced chemiluminescence (ECL system)

according to the manufacturer’s instructions. Immunoreactive

bands were scanned by laser densitometry and expressed in

arbitrary units.

For whole zona glomerulosa and zona fasciculata protein

extracts, since the cell volume of glomerulosa cells is lower

than that of fasciculata cells, quantification of blots were

normalized to actin. For whole gland lysate immunoblotting,

after Seladin-1 incubation, membranes were stripped for 2 h

with glycine 0.2 M (pH 2.5) at 70 8C, then washed, blocked

in 1% gelatin, and further incubated with the anti-actin

antibody for 16 h (dilution 1:1000). In the experiments

involving subcellular fractionation, the results are expressed

as the percentage of Seladin-1 protein within each

subcellular fraction relative to total Seladin-1 content within

the cell.

RNA extraction and quantitative real-time PCR

Total RNA from glomerulosa and fasciculata zones, obtained

from control and ACTH-treated rats, was extracted and

treated with DNase I (to digest contaminating genomic

DNA) using RNAaqueous-4PCR Kit according to the

manufacturer’s recommendations. RNA content was

measured spectrophotometrically while RNA quality was

assessed by electrophoresis on denaturing 1% agarose gel.

Total RNA (0.5 mg) was denatured (65 8C, 5 min) in the

presence of 0.5 mg oligo(deoxythymidine)12–18 (Invitrogen)



and 0.5 mM dNTP (Amersham Pharmacia Biotech) and

reverse transcribed at 42 8C for 60 min in 20 ml of 1! first

strand buffer (250 mM Tris–HCl (pH 8.3), 375 mM KCl,

15 mM MgCl2) containing 10 mM dithiothreitol, 40 U

RNAse OUT inhibitor (Invitrogen), and 200 U SuperScript

II Reverse Transcriptase (Invitrogen). Inactivation of the

enzyme (70 8C, 15 min) was followed by glyceraldehyde-3-

phosphate dehydrogenase (GAPDH) PCR to asses the quality

of the template cDNA. Real-time PCR primers for rat

Seladin-1 and GAPDH (Invitrogen) were designed with

Beacon Designer 2.0 software (PREMIER, Biosoft Inter-

national, Palo Alto, CA, USA). Primer pairs are located on

both sides of an intron or on an exon–exon junction.

GAPDH: sense, TGGTGCCAAAAGGGTCATC; antisense,

CTTCCACGATGCCAAAGTTG; and Seladin-1: sense,

GGGTGTTTGTGTGCCTCTTCC; antisense, GCTCCT-

TCCACTCCCGTACC. Real-time PCR was performed

with an iCycler iQ Detection System using iQ SYBR Green

Supermix (Bio-Rad Laboratories) according to the manu-

facturer’s instructions and as described previously (Salzmann

et al. 2004). Annealing temperature was 60.4 8C. Real-time

PCR products were analyzed on 1! Tris/acetate/EDTA-

buffered 2.5% agarose gel and visualized by ethidium bromide

staining. To ensure the specificity of each real-time PCR,

prior melting curve analyses were performed for all detected

products with only a single peak recorded corresponding to a

unique melting temperature specific to each product. Sizes of

the amplicons obtained were 176 pb for GAPDH and 156 pb

for Seladin-1.

Incubation and measurement of aldosterone and corticosteronesecretion

Fasciculata and glomerulosa cells were plated in 24-well

plates (50!104 cells/well) and were treated daily for 3 days

with or without ACTH (10 nM, twice a day) alone or in the

presence of the Seladin-1 inhibitor, U18666A (25–75 nM,

once a day). After 3 days, the incubation medium was

removed by aspiration and stored at K20 8C for RIAs. For

acute stimulations, on the third day of cell culture, cells were

stimulated with or without ACTH (10 nM) alone or in the

presence of U18666A (25–75 nM), during a 2-h period.

Prior to each experiment, the medium from cultured cells

was aspirated, and the cells washed twice with cold Hanks’

buffered saline (HBS; 130 mM NaCl, 3.5 mM KCl, 1.8 mM

CaCl2, 0.5 mM MgCl2, 2.5 mM NaHCO3, and 5 mM

HEPES) supplemented with 1 g/l glucose and 0.5% BSA.

The cells were incubated in a 1 ml solution consisting of

0.9 ml HBS-glucose supplemented with 0.5% BSA–

0.1 mg/ml bacitracin and 0.1 ml stimuli. After a 2-h

incubation at 37 8C in a 95% air–5% CO2 environment,

the incubation medium was removed by aspiration and

stored at K20 8C until assayed for steroid content

determined by RIA, using specific antiserum and tritiated

steroid as tracer.


Proliferation assays

The cell proliferation was measured using fluorescence BrdU

incorporation as previously described (Otis et al. 2005). The

glomerulosa and fasciculata cells were plated in 24-well plates

(30!104 cells/well). The cells were treated daily for 3 days

with or without ACTH (10 nM twice a day) alone or in the

presence of the inhibitor, U18666A (25–75 nM, once a day).

On the third day, cells were fixed with 3.7% (v/v)

formaldehyde in HBS for 10 min at room temperature and

permeabilized for 10 min with 0.2% Triton X-100 in HBS.

The cells were then incubated with anti-BrdU Alexa-Fluor-

594 (1:500). Fluorescence intensity was determined using a

Microplate Fluorescence Reader FL600 (Bio-Tek; excitation:

560/40 nm; emission: 645/40 nm).

Data analysis

The data are presented as meansGS.E.M. of the number of

experiments indicated in parentheses. Statistical analyses of

the data were performed using one-way ANOVA, followed

by a test of simple effects when appropriate. Homogeneity of

variance was assessed by Bartlett’s test and P values were

obtained by Tukey honestly significant differences. For simple

comparisons between two groups, Student’s t-test was

performed.

Results

Localization and protein expression of Seladin-1 in adrenal tissueand cells from control and ACTH-treated rats

Using the Seladin-1 antibody characterized in Fig. 1, the

distribution and cellular localization of Seladin-1 were first

studied by immunofluorescence on frozen adult rat adrenal

glands. As shown in Fig. 2A, the highest expression of

Seladin-1 was found at the periphery of the adrenal gland,

in the zona glomerulosa and zona fasciculata, while the

lowest expression was found in the zona reticularis and

medulla. To better differentiate intracellular expression,

colocalization with nuclear labeling (Fig. 2B) highlighted

that, in zona glomerulosa (Fig. 2B, inset a) and zona

fasciculata (Fig. 2B, inset b), labeling was observed in both

the nucleus (arrow) and the cytoplasm (arrowhead).

However, labeling in the nucleus was greater and stronger

in zona fasciculata than in zona glomerulosa. In zona

reticularis (Fig. 2B, inset c), nuclear labeling was present but

less in the other zones while cytoplasmic labeling was very

weak. In the medulla, Seladin-1 labeling was practically

absent. A 7-day treatment with ACTH increased overall

expression of Seladin-1 throughout the gland (Fig. 2C and

D). As shown in corresponding insets (Fig. 2D, insets a, b

and c), labeling was increased in the nuclei in the three

zones. Labeling was completely abrogated when Seladin-1


E

B

ZG

ZF

ZR

M V

aA

ZG

ZF

ZR

M V

D

ZG

ZF

M

ZR

*

V

ZG

ZF

VM

ZR

C

ZR

*

b

c

b

c

a

B

ZG

ZF

ZR

D inset a

inset c

inset b

inset a

inset c

inset b

ZG

ZF

ZR

Figure 2 Immunofluoresence detection of Seladin-1 in rat adrenal gland. Frozen sections were processed as described in Materials andMethods. Seladin-1 labeling was detected using anti-Seladin-1 (1:1000) antibody coupled to Alexa-Fluor-594 nm (A, C, red) or combinedwith visualization of nuclei with DAPI (blue) (B, D, merged images) in zona glomerulosa (ZG), zona fasciculata (ZF), zona reticularis (ZR),and medulla (M) of control (A and B) and ACTH-treated rats (8 IU/250 g body weight/day per 7 days) (C and D). The resulting pink color inmerged images indicates colocalization of Seladin-1 within the nucleus. Non-specific labeling of Seladin-1 pre-immune serum (E). Insets a, b,and c are magnifications of selected areas of zona glomerulosa (ZG), zona fasciculata (ZF), and zona reticularis (ZR) of B and D. Arrowsidentify labeling in the nucleus, while arrowheads indicate labeling in the cytoplasm. V, central vein in the medulla. Images were acquiredwith a !10 objective. Scale bars, 50 mm for A and B, 150 mm for C and D, 25 mm for E, and 10 mm for insets a, b, and c. *Saturated signal.


Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

A

B

ZG

ZF

ZG

ZF

Figure 3 Hematoxylin–eosin staining of control (A) and ACTH-treated (8 IU/250 g body weight/day per 7 days) (B) rat adrenalglands from the capsule to the mid-fasciculata zone. Lines delineatezona glomerulosa (ZG) from zona fasciculata (ZF).


antiserum was replaced by its pre-immune serum at

matching dilution and similar exposure time (Fig. 2E).

For quantification of Seladin-1 expression in the various

adrenal zones, histological comparisons with hematoxylin–

eosin staining was used to clearly delineate zones in frozen

sections, which were then identified by dashed lines in Fig. 2.

As shown in Fig. 3A and B, in adrenal glands from control

animals, the zona glomerulosa and zona fasciculata were

0

20

40

60

80

100

Sel

adin

-1 in

nuc

leus

(% o

f tot

al e

xpre

ssio

n)

ZG ZF ZR

ControlACTH*

*

Figure 4 Quantification of Seladin-1 immunofluorescence labelingin whole frozen adrenal gland sections. Results represent thepercentage of nuclei labeled with Seladin-1 protein relative to thetotal number of nuclei within each adrenocortical section of zonaglomerulosa (ZG), zona fasciculata (ZF), and zona reticularis (ZR)from control (nZ3) and ACTH-treated rats (8 IU/250 g bodyweight/day per 7 days; nZ3). Results are expressed as meansGS.E.M. Statistical significance when compared with respectivecontrol conditions: *P!0.05.


clearly distinct, while after ACTH treatment, zonation was

not as clearly delineated. A progressive change from small to

large cells was observed, which rendered the separation from

zona glomerulosa to zona fasciculata difficult to identify.

Results from Fig. 4 confirm that the basal level of expression

in the nucleus was similar between zona glomerulosa and

fasciculata and lower in zona reticularis. ACTH treatment did

not modify the number of Seladin-1-labeled nuclei in zona

glomerulosa, while increasing the number of labeled nuclei

from 67.5G1.8 to 84.6G4.4% (P!0.05) in zona fasciculata

and from 32.1G7.6 to 58.0G5.2% (P!0.05) in the zona

reticularis. Western blotting further confirmed the morpho-

logical observations that the overall expression of Seladin-1

was higher in the zona fasciculata than in the glomerulosa.

Seladin-1 protein appeared as a single band of 77 kDa, with

expression levels fivefold higher in the zona fasciculata than in

the zona glomerulosa (Fig. 5A and B; P!0.05). ACTH

treatment increased overall expression in both zona glomer-

ulosa and zona fasciculata (Fig. 5C and D).

The above results on protein expression were also

corroborated with real-time PCR analysis of Seladin-1

mRNA expression, which indicated that the expression in

zona fasciculata was indeed twofold greater than in zona

glomerulosa and that ACTH increased Seladin-1 expression

by twofold, in both zona glomerulosa and zona fasciculata

(Table 1). Together, these results indicate that in vivo, Seladin-

1 is largely expressed in the zona fasciculata and to a lesser

extent in the zona glomerulosa. Following ACTH treatment,

a preferential localization of Seladin-1 was observed in the

nucleus of fasciculata cells.

Since specific functions are associated with specific

intracellular structures, subcellular fractionation followed by

western blotting was performed on isolated zona glomerulosa

and zona fasciculata, obtained fromcontrol andACTH-treated

rats. As shown in Fig. 6A, in glomerulosa cells, Seladin-1 was

mainly present in themembrane and nuclear fractions and, to a

lesser extent in the cytosol and cytoskeleton. ACTH treatment

decreased Seladin-1 expression in the cytosol (from 19.4G1.8to 1.7G0.5%; P!0.001) and membrane fraction (from

30.5G1.9 to 18.6G1.8%; P!0.01), with a concomitant

increase in the cytoskeletal fraction (from 18.6G1.2 to 38.8G4.4%; P!0.001). Although Seladin-1 was also increased in thenuclear fraction, it did not reach statistical significance. In

fasciculata cells (Fig. 6B), Seladin-1 was mainly present in the

nucleus, and to a lesser extent in the cytoskeleton andmembrane

fractions. ACTH treatment decreased cytosolic content and

increasednuclear localizationof Seladin-1 (37.5G0.3 to 48.0G5.0%; P!0.05). Therefore, in control conditions, the

cytoplasmic distribution was higher in zona glomerulosa than

in zona fasciculata, while the association with cytoskeleton was

higher in zona fasciculata when compared with zona

glomerulosa. On the other hand, ACTH-treatment favored

cytoskeletal localization within glomerulosa cells and as

demonstrated previously in vivo, nuclear localization within

fasciculata cells. Such observations could be associated with

differential effects for each respective zone.


Control

43 kDaactin

A

77 kDaseladin-1

Zona glomerulosa Zona fasciculata

0

1

2

3

4

5

Rat

io s

elad

in-1

/act

in

B

*

Zona glomerulosa

Zona fasciculata

C

Zona glomerulosa Zona fasciculata

ACTH treatment

43 kDa

77 kDa

0

1

2

3

4

5

Rat

io s

elad

in-1

/act

in

*

D

Figure 5 Western blotting of Seladin-1 in adrenal zona glomerulosa and zona fasciculata from control (A and B)and ACTH-treated rats (C and D). Samples were obtained from experiments shown in Fig. 2. Analyses wereperformed on whole frozen sections as described in Materials and Methods. The cell lysates containing 15 mgproteins were subjected to western blotting using specific antibodies against Seladin-1 (1:1000) and actin (1:1000).Representative immunoblot of Seladin-1 expression in adrenal glands of control animals (A) and ACTH-treated rats(C). Seladin-1 was detected at approximately 77 kDa and actin at 43 kDa. Densitometric quantification of Seladin-1expression in control animals (B) and in ACTH-treated animals (D). Results are expressed as meansGS.E.M. (nZ3).Statistical significance when compared with respective control conditions: *P!0.05.

Table 1 Expression of Seladin-1 mRNA in zona glomerulosa andzona fasciculata in adrenal glands from control and ACTH-treatedrats

ZF/ZG ratio ZG (fold increase) ZF (fold increase)

TreatmentControl 2.00 – –ACTH 1.91ACTH/control rats – 2.13 2.03

Quantitative real-time PCR performed on in vivo rat adrenal gland zonaglomerulosa (ZG) and zona fasciculata (ZF) from control and ACTH-treatedrats (8 IU/250 g body weight/day per 7 days). Glands were processed asdescribed in Materials and Methods. The results indicate the fold differencein Seladin-1 mRNA expression between zona fasciculata versus zonaglomerulosa (ZF/ZG ratio) in control (nZ3) and ACTH-treated cells (nZ3)and the fold increase of Seladin-1 mRNA expression in ACTH-treated versuscontrol rats in zona glomerulosa and zona fasciculata.


Localization of Seladin-1 in primary cultures of glomerulosa andfasciculata cells

Since Seladin-1 has been described for its involvement in

senescence (Wu et al. 2004), it appeared important to use

primary cell cultures rather than cell lines or transfected cell lines

as a more appropriate tool to better understand its role in

cellular functions. Figure 7 illustrates the results from

fasciculata cells, although glomerulosa cells also exhibited

similar labeling (data not shown). Control cells exhibited both

cytoplasmic and nuclear labeling (Fig. 7A), and all the cells

responded to ACTH treatment with a Seladin-1 relocalization

in specific nuclear regions (Fig. 7B). To better delineate

intracellular Seladin-1 localization, studies were focused on

single cells. In control conditions, Seladin-1 labeling was

localized within the cytoplasm and the nucleus (Fig. 7C). In

the cytoplasm, labeling was associated with specific cellular

structures. Double immunofluorescence studies with the

WGA lectin revealed a colocalization of Seladin-1 with the

Golgi apparatus as depicted by the overlapping yellow color in

the merged images. In the nucleus, labeling was mostly

diffused, except in certain particular foci (Fig. 7C). In ACTH-

treated cells, Seladin-1 remained localized to the Golgi, which

was more condensed around the nuclei, as well as in the

nucleus, concentrated into specific nuclear regions (Fig. 7D).

Similar cultures were also performed on glomerulosa cells


stimulated with Ang II, without any modification relative to

control conditions (data not shown).

The Seladin-1 inhibitor, U18666A, which results in

desmosterol accumulation, was used to better evaluate whether

the D24-reductase activity of Seladin-1 is implicated in

ACTH-induced relocalization into specific nuclear regions. In

fasciculata cells pre-incubated with 75 nM U18666A, local-

ization of Seladin-1 in control cells was not modified (Fig. 7E).


†

*

†

% o

f Sel

adin

-1 p

rote

inin

sub

cellu

lar

com

part

men

ts

0

10

20

30

40

50

60

cytosol

cytoskeletonmembrane

nucleus

cytosol

cytoskeletonmembrane

nucleus

A%

of S

elad

in-1

pro

tein

in s

ubce

llula

r co

mpa

rtm

ents

0

10

20

30

40

50

60

*

*

B

Control

ACTH

Figure 6 Western blot analysis of Seladin-1 performed insubcellular fractions of adrenocortical cells. Subcellular fraction-ation was performed from isolated zona glomerulosa cells (A) andzona fasciculata cells (B). Results are expressed as the percentage ofSeladin-1 protein expression within each subcellular fractionrelative to total intracellular expression of Seladin-1 in control andACTH-treated rats (8 IU/250 g body weight/day per 7 days). Resultsare expressed as meansGS.E.M. of three different experiments.Statistical significance when compared with respective controlconditions: *P!0.05; †P!0.01.


However, in ACTH-stimulated cells, Seladin-1 was retained in

the Golgi apparatus (Fig. 7F), indicating that pre-incubation

with U18666A abrogated the ACTH-induced relocalization of

Seladin-1 into specific nuclear regions.

Effect of Seladin-1 inhibitor (U18666A) on steroid secretion andproliferation

In order to investigate the possible involvement of Seladin-1

in steroid secretion, glomerulosa and fasciculata cells were


treated with or without ACTH alone or with U18666A (25

and 75 nM), either for 2 h or 3 days. Results from Fig. 8

indicate that both 2-h and 3-day treatments with U18666A

increased basal steroid output in glomerulosa and fasciculata

cells, but decreased ACTH-induced aldosterone and corti-

costerone secretion. The inhibitory action of U18666A on

ACTH-induced steroid secretion was more pronounced

however after 3 days than after acute 2-h treatment, and

was more pronounced for aldosterone secretion in glomer-

ulosa cells than for corticosterone secretion in fasciculata cells

(63 versus 43% reduction respectively). These results suggest

that Seladin-1 is differentially implicated in basal and in

ACTH-induced steroid secretion. On the other hand, 3-day

treatment with U18666A did not modify active cell

proliferation observed in cultured cells (data not shown).

Discussion

This study characterizes for the first time the expression,

distribution, intracellular localization, and dynamics of

Seladin-1 protein in adrenal glands and in primary cultures

of adrenocortical cells, in control and in ACTH-treated rats.

The most notable findings of this study are that Seladin-1 (1)

is localized both in the cytoplasm and in the nucleus; (2)

subcellular localization is regulated by ACTH; and (3) is

differentially involved in basal and in ACTH-stimulated

steroid secretion.

In virtually all studies, Seladin-1 has been studied at the

mRNA level in transfected or retroviral-transducted cells,

under non-physiological stimulations (Greeve et al. 2000, Wu

et al. 2004) or in vivo in normal and pathological conditions in

human (Sarkar et al. 2001, Fuller et al. 2005, Luciani et al.

2005). Herein, the antibody generated to conduct the present

investigations revealed a single band with a molecular weight

(MW) of 77 kDa band for Seladin-1 in the rat adrenal gland,

brain, and cerebellum. This band was not detected when

Seladin-1 antiserum was replaced by the pre-immune serum

at same dilution and exposure time or when the Seladin-1

antiserum was neutralized by the peptide raised against

Seladin-1, indicating specificity of the antibody. A previous

study had reported a Seladin-1 MWof 60 kDa in normal and

Alzheimer’s disease brain tissues from 62- to 92-year-old

patients (Greeve et al. 2000). The differences between these

values may be related to differences in species (human versus

rat) or age. However, we cannot rule out the presence of the

60 kDa Seladin-1 band in the rat brain and cerebellum since it

could be masked by the strong non-specific 60 kDa band

observed in those rat tissues with the pre-immune serum and

the Seladin-1 antiserum. This observation is strengthened by

the fact that the intensity of 60 kDa band was reduced by the

antiserum neutralization assay. Since there is no stop codon

before the putative initiation codon for the 60 kDa Seladin-1

transcripts (human, rat, and mouse), the putative 5 0-

unstranslated Seladin-1 mRNA extremity may be a coding

sequence for the actual amino-terminal end of Seladin-1.


Golgi apparatusSeladin-1 Merge

Con

trol

D

C

AC

TH

U18

666A

E

U18

666A

+A

CT

H

Control ACTH

A

Low

er m

agni

ficat

ion

B

F

Figure 7 Immunofluorescence detection of Seladin-1 in 3-day zona fasciculata cultured cells. Impact of ACTH and U18666A(Seladin-1 inhibitor). The cells were cultured for 3-days in the absence (control, A, C) or in the presence of ACTH (10 nM) (B and D) andin the presence of 75 nM U18666A alone (E) or in combination with ACTH (F). After formaldehyde fixation and permeabilizationwith 0.1% Triton X-100, the cells were processed for immunofluorescence detection of Seladin-1 (1:1000) coupled to Alexa-488 (1:500,green), Golgi apparatus by the use of wheat germ agglutinin (WGA) lectin coupled to Alexa-594 (1:500, red) and nucleus (DAPI, blue).The resulting yellow color in merged images indicates colocalization of Seladin-1 with the WGA (Golgi apparatus) while the resultinglight blue color indicates colocalization of Seladin-1 with DAPI (nucleus). All images were acquired with a !100 objective. Scale bars,5.6 mm (magnification: !3500 for C, D and !4500 for E, F).


Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

†*

*† ††

Ald

oste

rone

(Fol

d in

crea

se o

ver

cont

rol)

0

5

10

15

20

‡

§

none 25 nM 75 nM

U18666A

Cor

ticos

tero

ne(F

old

incr

ease

ove

r co

ntro

l)

0

5

10

15

20

none 25 nM 75 nM

U18666A

‡

2 h stimulation

A

2 h stimulationC

none 25 nm 75 nm

U18666A

Ald

oste

rone

(Fol

d in

crea

se o

ver

cont

rol)

0

5

10

15

20

§§

3-days stimulationB

Cor

ticos

tero

ne(F

old

incr

ease

ove

r co

ntro

l)

0

5

10

15

203-days stimulation

none 25 nM 75 nM

U18666A

‡

D

ControlACTH

Figure 8 Impact of Seladin-1 inhibitor, U18666A, on steroid secretion by zona glomerulosa cells(aldosterone) (A and B) and zona fasciculata cells (corticosterone) (C and D) cultured for 3 days. Steroids weremeasured by RIA as described in Materials and Methods. Secretion was measured after stimulation for 2 h(A and C) or after 3-day treatment (B and D) with ACTH (10 nM) or in the absence or in the presence of 25 and75 nM U18666A. Results are expressed as meansGS.E.M. (nZ4). Statistical significance when compared withrespective control conditions: *P!0.05; †P!0.01, comparison between control U18666A groups of cells;‡P!0.05; §P!0.01, comparison between ACTH-treated cells.


There are currently a number of Seladin-1 mRNA sequences

and predictive sequences that are now associated with a

Seladin-1 protein larger than 60 kDa. For example, two

recent predictive rat Seladin-1 sequences were shown to have

a calculated MWof 86 kDa, hence clearly over 60 kDa.

At both the mRNA and the protein levels, Seladin-1 was

observed to be more abundant in the zona fasciculata of

control and ACTH-treated animals. This result is in

agreement with previous studies conducted on human

adrenal gland and human fasciculata cells in culture, at the

mRNA level (Sarkar et al. 2001, Luciani et al. 2004).

Moreover, the present results indicate that Seladin-1 is

localized both in the cytoplasm and in the nucleus, with a

differential gradient of expression from the outer to the inner

portion of the gland. Our hypothesis is that Seladin-1

localization is ubiquitous in the adrenal gland and that its


presence is more important for adrenocortical than for adrenal

medullar functions.

In control glomerulosa cells, Seladin-1 was mostly

expressed in the membrane and nuclear fractions. Upon

ACTH-treatment, the protein was greatly reduced in the

cytosolic and membrane compartments, while conversely

increasing in the cytoskeletal fraction. In fasciculata cells, the

protein was localized mainly in nuclear, cytoskeletal, and

membrane fractions. ACTH treatment reduced expression in

the cytoplasm, with a concomitant relocalization into the

nuclear fraction. These results suggest that the nuclear

Seladin-1 function is more important in fasciculata than in

glomerulosa cells. Through the use ofWGA lectin as a marker

of the Golgi apparatus, immunofluorescence studies demon-

strate that, in the cytoplasm, the protein was mainly associated

with the Golgi apparatus. Such localization has also been



reported by Greeve et al. (2000) where, in a transfected

human neuroglioma H4 cell line, Seladin-1–enhanced green

fluorescent protein was localized in the endoplasmic

reticulum and to the Golgi complex. Localization of

Seladin-1 in Golgi may be correlated with a role in

steroidogenesis since it is well known that in adrenocortical

cells, the Golgi apparatus plays important functional and

regulatory roles in corticosterone synthesis and that ACTH

stimulation often leads to Golgi hypertrophy (Magalhaes et al.

1991, Cheng & Kowal 1997). These data may explain why a

modification in Golgi structure is observed in cells stimulated

with ACTH in the present model. This may suggest that the

Seladin-1 localization to the Golgi apparatus is important for

steroid secretion.

Furthermore, when glomerulosa and fasciculata cells in

culture are stimulated with ACTH, there is a relocalization of

Seladin-1 in specific nuclear regions. Wu et al. (2004) have

recently described a massive translocation of Seladin-1 from

the cytoplasm to the nucleus in Seladin-1-transfected

fibroblasts, in cells exposed to 0.5 mM H2O2. The authors

attributed a major role of Seladin-1 in the cellular response to

oxidative stress, due to its ability to bind both the tumor

suppressor p53 and the E3-ubiquitin-ligase Mdm2 and to

displace Mdm2 from p53, thus protecting p53 from Mdm2-

induced degradation and enabling p53 accumulation (Wu

et al. 2004). It is well established that intense steroidogenesis in

zona fasciculata leads to oxidative stress due to the occurrence

of lipid peroxidation and the production of reactive oxygen

species and toxic derivatives, such as isocaproaldehyde

(Hornsby & Crivello 1983, Lefrancois-Martinez et al.

1999). This may explain the important quantity of

endogenous anti-oxidant compounds (vitamin E,

b-carotene, and vitamin C; Hornsby & Crivello 1983) and

the presence of enzymes implicated in the endogenous

detoxification of steroidogenesis by-products (Martinez et al.

2001) in the adrenal gland. Since Seladin-1 is an oxido-

reductase enzyme (Mushegian & Koonin 1995), and in

agreement with the results of Wu et al. (2004), the present

results of a prominent Seladin-1 accumulation in specific

nuclear regions may thus reflect an ACTH-induced

regulation of Seladin-1 association with nuclear partners,

such as p53 and Mdm2. The ACTH-induced Seladin-1

relocalization into specific nuclear regions is inhibited by

U18666A suggesting an implication of the D24-reductaseactivity of Seladin-1. This hypothesis is supported by the

observation that ACTH has a protective effect against

oxidative stress (Pomeraniec et al. 2004). Together, the

observation that ACTH induces relocalization in specific

intranuclear compartments raises the hypothesis that Seladin-

1 may play a major role in protecting adrenocortical cells

against negative side effects due to intense steroidogenesis,

either as a new major participant in the p53-Mdm2 interplay

and/or through its own oxidoreductase activity. Such nuclear

relocalization was not observed with Ang II treatment in

glomerulosa cells, further supporting the notion that nuclear

relocalization is associated with intense steroidogenesis.


Indeed, Ang II stimulates aldosterone secretion by 2- to

5-fold, compared with the 30- to 60-fold increase observed

with ACTH (Gallo-Payet & Payet 1989, Campbell et al.

2003).

The role of Seladin-1 in steroid secretion was assessed

herein through the use of U18666A. At low concentrations

(nM–mM), U18666A is a high-affinity binding inhibitor of

the D24-reductase activity of Seladin-1, resulting in

desmosterol accumulation (Bae & Paik 1997, Fliesler et al.

2000, Cenedella et al. 2004). In the present study, U18666A

was used at concentrations ranging from 25 to 75 nM

because, at this concentration, it does not induce adrenal cell

toxicity and has little impact on cholesterol trafficking (Feng

et al. 2003). Our results indicate that U18666A increases basal

steroid secretion, but decreases ACTH-responsiveness for

both aldosterone and corticosterone. The observation that

U18666A effects on basal- and on ACTH-stimulated cells are

more pronounced on aldosterone production than on

corticosterone production may stem from a lower expression

level of Seladin-1 in zona glomerulosa cells, resulting in less

residual functional Seladin-1 following U18666A treatment.

Stimulation of basal secretion by this inhibitor may be due

to desmosterol accumulation produced by U18666A-induced

Seladin-1 inhibition. Desmosterol is a better substrate than

cholesterol for steroidogenesis. It is more efficiently esterified

than cholesterol, an essential step in sterol transport (Nordby

& Norum 1975), and is fourfold more efficient as a substrate

for the side chain cleavage reaction that produces precursors

for steroidogenesis (Arthur et al. 1976, Mason et al. 1978).

However, desmosterol has also been recently identified as a

major negative regulator of cholesterol metabolism, being a

strong inhibitor of sterol-regulatory element-binding protein

2 processing and a strong repressor of hydroxy-methyl-

glutaryl-coenzymeA (HMG-CoA) reductase and low-density

lipoprotein receptor expression (Yang et al. 2006). Therefore,

by controlling desmosterol levels, the D24-reductase activity

of Seladin-1 may play a major and dual role in regulating

cholesterol uptake and biosynthesis, thereby modulating

steroidogenesis. From these observations, low desmosterol

concentrations may have positive effects on steroidogenesis, as

a better substrate than cholesterol, which may explain the

observed U18666A-induced increase in basal secretion.

However, in ACTH-treated cells, the U18666A-induced

desmosterol accumulation may impair the larger ACTH-

induced increase in steroidogenic machinery. Seladin-1 may

therefore act as a negative regulator of basal steroidogenesis

when localized in the Golgi. Conversely, ACTH actions on

Seladin-1 expression and subcellular localization may have

two complementary effects: the first being the removal of the

inhibition of secretion in the cytoplasm, whereas the second

action would be associated with protection against ACTH-

induced oxidative stress.

Seladin-1 expression has also been reported to be altered in

adrenocortical adenomas and carcinomas, being overex-

pressed or repressed depending on tumor type (Sarkar et al.

2001, Luciani et al. 2004). However, Seladin-1 is also



abundantly expressed in mesenchymal stem cells (Benvenuti et

al. 2006). On the other hand, U18666A induces apoptosis in

cortical neurons in primary cultures (Koh & Cheung 2006).

These observations suggest that Seladin-1 is involved in the

balance between proliferation and apoptosis. However, such a

role was not observed in glomerulosa cell cultures, since

U18666A treatment had no effect on the high level of

proliferation.

In summary, the results obtained in the present study are

the first to assess Seladin-1 expression and distribution in the

adrenal gland in vivo and in the rat primary cultures of

adrenocortical cells. Using a multi-faceted approach, the

study demonstrates that the protein expression of Seladin-1 is

more abundant in fasciculata cells than in glomerulosa cells

and that ACTH treatment increases both expression and

nuclear localization of Seladin-1. Taken together, the results

obtained herein, combined with previous data, suggest that

depending on its cellular localization, Seladin-1 plays a major

role in steroid secretion in the adrenal gland. It is proposed

that the D24-reductase activity of Seladin-1 may be engaged

in maintaining low levels of steroidogenesis. ACTH treatment

induces a relocalization of Seladin-1 into the nucleus, thus

facilitating ACTH-induced stimulation of steroidogenesis in

the cytoplasm. Concomitantly, Seladin-1, in the nucleus,

could be involved (through possible association with p53 and

Mdm2 as partners), in protection against ACTH-induced

oxidative stress, an undesirable consequence of intense

steroidogenesis.

Acknowledgements

The authors thank Lucie Chouinard for her invaluable

experimental assistance and stimulating discussions. This

work was supported by grants from the Fondation pour la

Recherche sur les Maladies Infantiles and the Canadian

Research Chair Program to. N G-P is also a recipient of a

Canada Research Chair in Endocrinology of the Adrenal

Gland. The authors declare that there is no conflict of interest

that would prejudice the impartiality of this scientific work.

References

Abdolzade-Bavil A, Hayes S, Goretzki L, Kroger M, Anders J & Hendriks R

2004 Convenient and versatile subcellular extraction procedure, that

facilitates classical protein expression profiling and functional protein

analysis. Proteomics 4 1397–1405.

Arthur JR, Blair HA, Boyd GS, Mason JI & Suckling KE 1976 Oxidation of

cholesterol and cholesterol analogues by mitochondrial preparations of

steroid-hormone-producing tissue. Biochemical Journal 158 47–51.

Bae SH & Paik YK 1997 Cholesterol biosynthesis from lanosterol:

development of a novel assay method and characterization of rat liver

microsomal lanosterol delta 24-reductase. Biochemical Journal 326 609–616.

Benvenuti S, Saccardi R, Luciani P, Urbani S, Deledda C, Cellai I, Francini F,

Squecco R, Rosati F, Danza G et al. 2006 Neuronal differentiation of

human mesenchymal stem cells: changes in the expression of the

Alzheimer’s disease-related gene seladin-1. Experimental Cell Research 312

2592–2604.


Campbell S, Otis M, Cote M, Gallo-Payet N & Payet M 2003 Connection

between integrins and cell activation in rat adrenal glomerulosa cells. A role

for RGD peptide in the activation of the p42/p44MAPK pathway and of

intracellular calcium. Endocrinology 144 486–495.

CenedellaRJ, JacobR,BorchmanD,TangD,Neely AR, Samadi A,MasonRP

& Sexton P 2004 Direct perturbation of lens membrane structure may

contribute to cataracts caused by U18666A, an oxidosqualene cyclase

inhibitor. Journal of Lipid Research 45 1232–1241.

Cheng B & Kowal J 1997 Role of the Golgi complex in adrenocortical

steroidogenesis. Microscopy Research and Technique 36 503–509.

Feng B, Yao PM, Li Y, Devlin CM, Zhang D, Harding HP, Sweeney M,

Rong JX, Kuriakose G, Fisher EA et al. 2003 The endoplasmic reticulum is

the site of cholesterol-induced cytotoxicity in macrophages. Nature Cell

Biology 5 781–792.

Fliesler SJ, Richards MJ, Miller C, Peachey NS & Cenedella RJ 2000 Retinal

structure and function in an animal model that replicates the biochemical

hallmarks of desmosterolosis. Neurochemical Research 25 685–694.

Fuller P, Alexiadis M, Jobling T & McNeilage J 2005 Seladin-1/DHCR24

expression in normal ovary, ovarian epithelial and granulosa tumours.

Clinical Endocrinology 63 111–115.

Fumagalli R & Paoletti R 1963 The identification and significance of

desmosterol in the developing human and animal brain. Life Sciences 5

291–295.

Gallo-Payet N & Payet MD 1989 Excitation–secretion coupling: involvement

of potassium channels in ACTH-stimulated rat adrenocortical cells.

Journal of Endocrinology 120 409–421.

Gallo-Payet N & Payet MD 2003 Mechanism of action of ACTH: beyond

cAMP. Microscopy Research and Technique 61 275–287.

Greeve I, Hermans-Borgmeyer I, Brellinger C, Kasper D, Gomez-Isla T,

Behl C, Levkau B & Nitsch RM 2000 The human DIMINUTO/

DWARF1 homolog seladin-1 confers resistance to Alzheimer’s disease-

associated neurodegeneration and oxidative stress. Journal of Neuroscience 20

7345–7352.

Hornsby P & Crivello J 1983 The role of lipid peroxidation and biological

antioxidants in the function of the adrenal cortex. Part 2. Molecular and

Cellular Endocrinology 30 123–147.

HuRM,HanZG,SongHD,PengYD,HuangQH,RenSX,GuYJ,HuangCH,

Li YB, Jiang CL et al. 2000 Gene expression profiling in the human

hypothalamus–pituitary–adrenal axis and full-length cDNAcloning.PNAS97

9543–9548.

Klahre U, Noguchi T, Fujioka S, Takatsuto S, Yokota T, Nomura T, Yoshida S

& Chua NH 1998 The Arabidopsis DIMINUTO/DWARF1 gene encodes

a protein involved in steroid synthesis. Plant Cell 10 1677–1690.

Koh CH & Cheung NS 2006 Cellular mechanism of U18666A-mediated

apoptosis in cultured murine cortical neurons: bridging Niemann-Pick

disease type C and Alzheimer’s disease. Cellular Signalling 18 1844–1853.

Kovacs WJ, Schrader M, Walter I & Stangl H 2004 The hypolipidemic

compound cetaben induces changes in Golgi morphology and vesicle

movement. Histochemistry and Cell Biology 122 95–109.

Lefrancois-Martinez AM, Tournaire C, Martinez A, Berger M, Daoudal S,

Tritsch D, Veyssiere G & Jean C 1999 Product of side-chain cleavage of

cholesterol, isocaproaldehyde, is an endogenous specific substrate of mouse

vas deferens protein, an aldose reductase-like protein in adrenocortical cells.

Journal of Biological Chemistry 274 32875–32880.

Luciani P, Ferruzzi P, Arnaldi G, Crescioli C, Benvenuti S, Nesi G, Valeri A,

Greeve I, Serio M, Mannelli M et al. 2004 Expression of the novel

adrenocorticotropin-responsive gene selective Alzheimer’s disease

indicator-1 in the normal adrenal cortex and in adrenocortical adenomas

and carcinomas. Journal of Clinical Endocrinology and Metabolism 89

1332–1339.

Luciani P, Gelmini S, Ferrante E, Lania A, Benvenuti S, Baglioni S,MantovaniG,

Cellai I,Ammannati F, SpadaA et al. 2005Expressionof the antiapoptotic gene

seladin-1 and octreotide-induced apoptosis in growth hormone-secreting and

nonfunctioning pituitary adenomas. Journal of Clinical Endocrinology and

Metabolism 90 6156–6161.

Magalhaes M, Serra T, Pinto P & Magalhaes M 1991 The effects of monensin

on Golgi complex of adrenal cortex and steroidogenesis. Tissue and Cell 23

209–215.



Martinez A, Aigueperse C, Val P, Dussault M, Tournaire C, Berger M,

Veyssiere G, Jean C & Lefrancois Martinez A 2001 Physiological functions

and hormonal regulation of mouse vas deferens protein (AKR1B7) in

steroidogenic tissues. Chemico-Biological Interactions 130–132 903–917.

Mason JI, Arthur JR & Boyd GS 1978 Control of sterol metabolism in rat

adrenal mitochondria. Biochemical Journal 174 1045–1051.

Mushegian A & Koonin E 1995 A putative FAD-binding domain in a distinct

group of oxidases including a protein involved in plant development. Protein

Science 4 1243–1244.

Nordby G & Norum KR 1975 Substrate specificity of lecithin:cholesterol

acyltransferase. Esterification of desmosterol, b-sitosterol, and cholecalci-

ferol in human plasma. Scandinavian Journal of Clinical and Laboratory

Investigation 35 677–682.

Otis M, Campbell S, Payet MD & Gallo-Payet N 2005 Angiotensin II

stimulates protein synthesis and inhibits proliferation in primary cultures of

rat adrenal glomerulosa cells. Endocrinology 146 633–642.

Pomeraniec Y, Grion N, Gadda L, Pannunzio V, Podesta EJ & Cymeryng CB

2004 Adrenocorticotropin induces heme oxygenase-1 expression in adrenal

cells. Journal of Endocrinology 180 113–124.

Rainey WE 1999 Adrenal zonation: clues from 11beta-hydroxylase and

aldosterone synthase. Molecular and Cellular Endocrinology 151 151–160.

Rainey WE, Carr BR, Wang ZN & Parker CR Jr 2001 Gene profiling of

human fetal and adult adrenals. Journal of Endocrinology 171 209–215.

Rainey WE, Parker CR Jr, Rehman K & Carr BR 2002 The adrenalgenetic

puzzle: how do the fetal and adult pieces differ?Endocrine Research 28 611–622.

Salzmann C, Otis M, Long H, Roberge C, Gallo-Payet N &Walker CD 2004

Inhibition of steroidogenic response to adrenocorticotropin by leptin:

implications for the adrenal response to maternal separation in neonatal rats.

Endocrinology 145 1810–1822.

Sarkar D, Imai T, Kambe F, Shibata A, Ohmori S, Siddiq A, Hayasaka S,

Funahashi H & Seo H 2001 The human homolog of Diminuto/Dwarf1

gene (hDiminuto): a novel ACTH-responsive gene overexpressed in benign

cortisol-producing adrenocortical adenomas. Journal of Clinical Endocrinology

and Metabolism 86 5130–5137.

Sewer M & Waterman M 2003 ACTH modulation of transcription factors

responsible for steroid hydroxylase gene expression in the adrenal cortex.

Microscopy Research and Technique 61 300–307.


Singh LP, Green K, Alexander M, Bassly S & Crook ED 2004 Hexosamines

and TGF-beta1 use similar signaling pathways to mediate matrix protein

synthesis in mesangial cells. American Journal of Physiology. Renal Physiology

286 F409–F416.

Takahashi T, Gasch A, Nishizawa N & Chua NH 1995 The DIMINUTO

gene of Arabidopsis is involved in regulating cell elongation. Genes and

Development 9 97–107.

Vinson GP 2003 Adrenocortical zonation and ACTH.Microscopy Research and

Technique 61 227–239.

Vinson GP 2004 Glomerulosa function and aldosterone synthesis in the rat.

Molecular and Cellular Endocrinology 217 59–65.

WaterhamHR,Koster J,RomeijnGJ,HennekamRC,VrekenP,AnderssonHC,

FitzPatrick DR, Kelley RI &Wanders RJ 2001 Mutations in the 3beta-

hydroxysterol Delta24-reductase gene cause desmosterolosis, an autosomal

recessive disorder of cholesterol biosynthesis.American Journal ofHumanGenetics

69 685–694.

Wolkersdorfer G & Bornstein S 1998 Tissue remodelling in the adrenal gland.

Biochemical Pharmacology 56 163–171.

Wu C, Miloslavskaya I, Demontis S, Maestro R & Galaktionov K 2004

Regulation of cellular response to oncogenic and oxidative stress by

Seladin-1. Nature 432 640–645.

Yang C, McDonald JG, Patel A, Zhang Y, Umetani M, Xu F, Mangelsdorf DJ,

Westover EJ, Covey DF, Cohen JC et al. 2006 Sterol intermediates from

cholesterol biosynthetic pathway as LXR ligands. Journal of Biological

Chemistry 281 27816–27826.

Zhang L & Insel PA 2004 The pro-apoptotic protein Bim is a convergence

point for cAMP/protein kinase A- and glucocorticoid-promoted apoptosis

of lymphoid cells. Journal of Biological Chemistry 279 20858–20865.

Received in final form 17 October 2006Accepted 20 October 2006Made available online as an Accepted Preprint30 October 2006


seladin-1 expression in rat adrenal gland: effect of

Documents