seed-specific over-expression of an arabidopsis cdna ... · (1999). the arabidopsis dgat sequence...

Seed-Specific Over-Expression of an Arabidopsis cDNAEncoding a Diacylglycerol Acyltransferase Enhances SeedOil Content and Seed Weight1

Colette Jako, Arvind Kumar, Yangdou Wei, Jitao Zou, Dennis L. Barton, E. Michael Giblin,Patrick S. Covello, and David C. Taylor*

Seed Oil Biotechnology Group, National Research Council of Canada, Plant Biotechnology Institute, 110Gymnasium Place, Saskatoon, Saskatchewan S7N 0W9, Canada

We recently reported the cloning and characterization of an Arabidopsis (ecotype Columbia) diacylglycerol acyltransferasecDNA (Zou et al., 1999) and found that in Arabidopsis mutant line AS11, an ethyl methanesulfonate-induced mutation ata locus on chromosome II designated as Tag1 consists of a 147-bp insertion in the DNA, which results in a repeat of the 81-bpexon 2 in the Tag1 cDNA. This insertion mutation is correlated with an altered seed fatty acid composition, reduceddiacylglycerol acyltransferase (DGAT; EC 2.3.1.20) activity, reduced seed triacylglycerol content, and delayed seed devel-opment in the AS11 mutant. The effect of the insertion mutation on microsomal acyl-coenzyme A-dependent DGAT isexamined with respect to DGAT activity and its substrate specificity in the AS11 mutant relative to wild type. Wedemonstrate that transformation of mutant AS11 with a single copy of the wild-type Tag1 DGAT cDNA can complement thefatty acid and reduced oil phenotype of mutant AS11. More importantly, we show for the first time that seed-specificover-expression of the DGAT cDNA in wild-type Arabidopsis enhances oil deposition and average seed weight, which arecorrelated with DGAT transcript levels. The DGAT activity in developing seed of transgenic lines was enhanced by 10% to70%. Thus, the current study confirms the important role of DGAT in regulating the quantity of seed triacylglycerols andthe sink size in developing seeds.

Seed triacylglycerol (TAG) biosynthesis is locatedin the endoplasmic reticulum with glycerol-3-phosphate and fatty acyl-coenzyme A (CoAs) as theprimary substrates. There are three acyltransferasesand a phosphohydrolase involved in the plant stor-age lipid bioassembly, namely glycerol-3-phosphateacyltransferase (GPAT, EC 2.3.1.15), lyso-phospha-tidic acid acyltransferase (LPAT, EC 2.3.1.51), phos-phatidate phosphohydrolase (PAPase, EC 3.1.3.4),and diacylglycerol acyltransferase (DGAT, EC2.3.1.20). The three acyltransferases catalyze thestepwise acylation of the glycerol backbone with thefinal step being the acylation of sn-1,2-diacylglycer-ols (DAGs) by DGAT to form TAGs, a biochemicalprocess generally known as the Kennedy pathway(Kennedy, 1961; Barron and Stumpf, 1962; Stymneand Stobart, 1987). The acyl-CoA dependent acyla-tion of sn-1,2-DAG as catalyzed by DGAT is the onlyenzyme in the traditional Kennedy pathway that isexclusively committed to TAG biosynthesis.

In developing and germinating seeds of oilseedplants, TAG accumulation and DGAT activity havebeen shown to associate with the endoplasmic retic-ulum (high-speed microsomal fraction) (Cao and

Huang, 1986; Stobart et al., 1986; Stymne and Stobart,1987; Frentzen, 1993; Settlage et al., 1995; Lacey andHills, 1996). The biochemical properties of microso-mal DGAT have been examined in a number of plantsystems (Frentzen, 1993), including developing seeds(Cao and Huang, 1987; Bernerth and Frentzen, 1990;Vogel and Browse, 1996) and embryo cultures (Tay-lor et al., 1991, 1992; Weselake et al., 1991; Little et al.,1994) of Brassica napus. In general, studies with de-veloping seeds indicate that DGAT activity increasesrapidly during the active phase of oil accumulationand then decreases markedly as seed lipid contentreaches a plateau (Tzen et al., 1993; Weselake et al.,1993).

A number of studies with both mammalian (May-orek et al., 1989; Tijburg et al., 1989) and plant (Ichi-hara et al., 1988; Perry and Harwood, 1993a, 1993b;Settlage et al., 1995; Perry et al., 1999) systems havesuggested that DGAT may catalyze a rate-limitingreaction in TAG bioassembly. For example, develop-ing seeds of B. napus L., cv Shiralee, have been shownto produce significant levels of DAG during the ac-tive phase of oil accumulation (Perry and Harwood,1993a, 1993b). More recently, using light/dark treat-ments in this cultivar, it has been shown that duringconditions of high lipid accumulation, the amountsof Kennedy pathway intermediates phosphatidate,and diacylglycerol increase significantly. During thistime, the DGAT activity is the lowest of the fourKennedy pathway enzymes. The alteration in carbon

1 This work was supported by the Saskatchewan Department ofAgriculture and Food (grant nos. 96000046 and 19990362). This isNational Research Council of Canada publication no. 43794.

* Corresponding author; e-mail [email protected]; fax 306 –975– 4839.

Plant Physiology, June 2001, Vol. 126, pp. 861–874, www.plantphysiol.org © 2001 American Society of Plant Physiologists 861 www.plantphysiol.orgon September 25, 2020 - Published by Downloaded from Copyright © 2001 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

flux resulted in changes to the acyl quantity of theDAG pool but not other intermediates (Perry et al.,1999). The data collectively suggest that the DGATreaction may regulate the flow of carbon into TAG attimes of high lipid accumulation. However, this hy-pothesis has not been rigorously tested or reduced topractice by transgenically altering the expression of aDGAT gene in a seed-specific manner.

We previously characterized an ethyl methanesul-fonate (EMS)-induced mutant of Arabidopsis, desig-nated AS11, which displayed an altered fatty acidcomposition (Katavic et al., 1995). AS11 seeds havereduced levels of the very long chain fatty acid ei-cosenoic acid (20:1) and reduced oleic acid (18:1) andaccumulate a-linolenic acid (18:3) as the major fattyacid in TAGs. The AS11 mutant has a consistentlylower ratio of TAG/DAG in developing seeds, and itaccumulates an elevated amount of seed DAG, whichis the substrate of the DGAT. It was shown that AS11had reduced DGAT activities throughout seed devel-opment and thus a reduced TAG content phenotype,providing some evidence that DGAT may be control-ling flux into TAG biosynthesis. Genetic analysis in-dicated that the fatty acid phenotype in AS11 iscaused by a semidominant mutation in a nucleargene, designated Tag1. The mutation in line AS11was characterized as a 147-bp insertion in the chro-mosome II DNA, which results in a repeat of the81-bp exon 2 in the Tag1 transcript. This insertionmutation is correlated with an altered seed fatty acidcomposition, a reduced seed TAG content, reducedDGAT (EC 2.3.1.20) activity, and delayed seed devel-opment, characteristic of the AS11 mutant seed line.Tag1 was mapped to chromosome II (Katavic et al.,1995).

We recently reported the identification, functionalassignment, and cloning of this DGAT gene, Tag1,from Arabidopsis (Zou et al., 1999; GenBank acces-sion no. AJ238008) through a databank sequencesearch and assisted by map-based information. Ourdata demonstrated that the encoded product of theTag1 gene is 41% identical over a stretch of more than400 amino acids to the mouse (Cases et al., 1998;GenBank accession no. AF078752) and human (Oelk-ers et al., 1998; GenBank accession no. AF059202)DGATs and includes a signature putative diacylglyc-erol binding motif. The TAG1 gene was shown toencode an acyl-CoA-dependent DGAT by functionalexpression of the recombinant protein produced inyeast cells (Zou et al., 1999).

These results were in agreement with concurrentpublications describing the cloning of the Arabidop-sis DGAT sequence and functional expression of therecombinant protein in insect cell cultures (Hobbs etal., 1999; GenBank accession no. AJ131831) and thecloning of the Arabidopsis DGAT sequence, a similarstudy of the insertion mutation allele from AS11 (tag1-1), and the description of a new deletion mutantABX45 allele (tag 1-2) as reported by Routaboul et al.

(1999). The Arabidopsis DGAT sequence is also highlyhomologous (approximately 90% amino acid identity)to subsequently published putative DGAT sequencesfrom B. napus reported by Nykiforuk et al., 1999 (Gen-Bank accession nos. AF155224 and AF164434) andcited by Weselake and Taylor (1999), and more re-cently, a direct GenBank submission by A.P. Brown,T.P. Schierer, and A.R. Slabas (GenBank accession no.AAF64065).

Here we report that the Arabidopsis DGAT cDNAcan complement the AS11 mutant lipid phenotype,restoring the oil content and acyl composition to thatof wild type (WT). Furthermore, we demonstrate thatover-expression of the acyl-CoA-dependent DGAT ina seed-specific manner in wild-type plants results inaugmentation of seed oil deposition and averageseed weight.

RESULTS

Further Study of the AS11 Mutant Line and theEffects of the Mutation on DGAT Activity, Its Acyl-CoA Substrate Specificity, and Oil Accumulation

Using microsomal fractions prepared from WT andAS11 mid-green developing seed, we were able tocompare the acyl-CoA-dependent DGAT (EC 2.3.1.20)activity to the resultant oil content in the mature seedof each line. As shown in Figure 1, there was a strongcorrelation between the reduced DGAT activity exhib-ited in developing seed microsomes of the AS11 mu-

Figure 1. Comparisons of 18:1-CoA-dependent DGAT activity (val-ues expressed as pmol min21 mg21 protein) in microsomes preparedfrom developing seeds at the mid-green stage of embryo develop-ment in wild-type and DGAT mutant AS11 lines of Arabidopsis withthe seed oil content in WT and AS11 mature seed (values for oilcontent expressed as percentage of dry weight). In single label ex-periments, 18 mM 14C-oleoyl-CoA (10 nCi nmol 21) was the acyldonor in the absence of exogenous diolein (*18:1-CoA alone) or inthe presence of exogenous 200 mM unlabeled sn-1,2 diolein (*18:1-CoA 1 DAG). In the double label experiment, 3H-labeled oleoyl-CoA was used at a radiospecific activity of 50 nCi nmol 21 and a finalconcentration of 40 mM with 14C-labeled sn-1,2 diolein provided ata specific activity of 2 nCi nmol21 and a final concentration of 200mM (*18:1-CoA 1 *DAG).

Jako et al.

862 Plant Physiol. Vol. 126, 2001 www.plantphysiol.orgon September 25, 2020 - Published by Downloaded from Copyright © 2001 American Society of Plant Biologists. All rights reserved.


tant and the reduced oil content in the mature seed ofthis mutant line in comparison with WT. Furthermore,the AS11 DGAT activity relative to that of WT indeveloping seeds remained proportionally constantand directly correlated with mature seed oil content,regardless of whether the acyl-CoA-dependent mi-crosomal DGAT activity was measured with only theacyl-CoA donor radiolabeled (14C 18:1-CoA; AS11DGAT activity 5 73% of WT) or if both the DAGacceptor (14C sn-1,2 diolein) and acyl-CoA donor (3H-18:1-CoA) were labeled (AS11 DGAT activity 5 76%of WT).

The altered fatty acid phenotype in seeds raisedquestions about whether the acyl-CoA specificity ofthe mutant enzyme is affected. A study of the DGATacyl-CoA specificity and selectivity (as defined byCao and Huang, 1987) in WT and AS11 developingseed is shown in Figure 2. It is clear that, althoughmicrosomal DGAT activity is reduced in AS11 com-pared with WT (compare to Fig. 1; for previous crudehomogenate studies, see Katavic et al., 1995), thetrend in relative acyl-CoA preference is identical inboth WT and AS11 seed lines.

Complementation of the Arabidopsis AS11 MutantLine by Transformation with the DGAT cDNA

A napin:DGAT plasmid was introduced intoAgrobacterium tumefaciens and used to transform Ara-bidopsis mutant AS11. A number of T3 single insert

transgenic lines were isolated that complemented thefatty acid mutant phenotype found in AS11 (reduced20:1 and elevated polyunsaturated fatty acids), re-storing the wild-type seed fatty acid profile (Fig. 3A).In addition, many of these same AS11 transgeniclines exhibited oil contents restored to near WT val-ues or beyond (Fig. 3B). The level of DGAT expres-sion in the AS11 transgenic lines containing singlecopies of the napin-driven cDNA generally corre-lated well with the restoration of both the oil contentand acyl composition, with line 3-3 being the best,followed by lines 9-1, 19-5, and 14-2, respectively(Fig. 4). There was no apparent advantage of multiplecopy inserts in restoring AS11 seed oil phenotypes tothose of WT (data not shown).

Over-Expression of the DGAT cDNA inWild-Type Arabidopsis

The napin:DGAT plasmid was introduced into A.tumefaciens, used to transform wild-type Arabidopsis,and the progeny was analyzed as described in “Ma-terials and Methods.” Based on kanamycin selection,24 primary napin:DGAT transgenic lines were pro-duced, the T1 plantlets grown to maturity, and T2seeds harvested. At the same time 12 independentplasmid only control transgenic (pSE vector withoutDGAT insert) lines, as well as non-transformed (n-t)WT and AS11 lines were propagated and analyzed.

After analysis, seven independent T2 transgeniclines containing the napin:DGAT construct (lines 2, 9,10, 16, 21, 23, and 24) were selected for detailed studybased on increased oil deposition on a per seed basis,an increased average 1,000-seed weight, a strong lin-ear correlation between the two traits (correlationcoefficient r 5 0.97), and enhanced expression of theDGAT transcript, compared with a set of pSE in WTand n-t WT control lines. On a mature seed dryweight basis, oil content increased by anywhere from9% to 12% dry weight, representing net overall in-creases of 34% to 46%. Analyses of these T2 trans-genic lines by 1H-NMR, a non-destructive method,confirmed a relative increase in oil on a per seed basisof 30% to 40% (data not shown).

From the T2 progeny, segregation analyses wereperformed on the T3 generation, and homozygouslines were identified and subjected to further analy-sis. The data for the napin:DGAT transgenic lineswere compared with those acquired from 12 inde-pendent T3 pSE (empty plasmid) in WT controlplants and an equal number of n-t WT and n-t AS11control lines, all grown in the same growth chamberat the same time, in a random block design. Asshown in Figure 5, on a mature seed weight basis, thehomozygous napin: DGAT lines exhibited oil contentincreases ranging from 3 to 8 percentage points, rep-resenting net overall increases of 11% to 28%, com-pared with the range exhibited by pSE WT controls.When comparing homozygous lines containing a sin-

Figure 2. Comparison of the acyl-CoA preference of the DGAT inWT and AS11 developing seed (mid-green stage). Seeds of WT andAS11 Arabidopsis were harvested, and homogenates were preparedand DGAT activity measured as described by Katavic et al. (1995). Inthe comparative specificity studies, the DGAT activity was assayed inthe presence of 18 mM [1-14C]-labeled 18:1-CoA, 18:2-CoA, or 20:1-CoA, supplied individually, and 200 mM unlabeled sn-1,2-diolein.In the comparative selectivity study equal concentrations (18 mM) of[1-14C]-labeled 18:2-CoA and 20:1-CoA were supplied simulta-neously to the seed homogenates in the presence of 200 mM unla-beled sn-1,2-diolein. Separation and measurement of the relativeproportions of the radiolabeled TAG products (18:1/18:1/14C-18:1;18:1/18:1/14C-18:2 or 18:1/18:1/14C-20:1) was conducted byreverse-phase radio-HPLC as described by Weselake et al. (1991).

Over-Expressed Arabidopsis Diacylglycerol Acyltransferase cDNA

Plant Physiol. Vol. 126, 2001 863 www.plantphysiol.orgon September 25, 2020 - Published by Downloaded from Copyright © 2001 American Society of Plant Biologists. All rights reserved.


gle insert (lines 10, 21, 23, and 24) versus multipleinserts (lines 2, 9, 16), with respect to oil content(compare to Fig. 5), it is noteworthy that the singleinsert lines performed quite well. For reasons that arenot readily apparent, the pSE in WT transgenics dis-played approximately 2% higher oil content com-pared with the n-t WT lines (Fig. 5). It could be thatapplying the kanamycin selection pressure to the pSEWT controls added some sort of additional stress thatresulted in a slightly higher basal oil content. None-theless, we believe that for true comparison purposeswith respect to oil content, the pSE in WT control

lines are the better controls, because they reduce therisk of over estimating the oil content increase ob-served in the napin:DGAT transgenics.

In general, the average 1,000-seed weight in thenapin:DGAT homozygous transgenic lines was usu-ally increased or, as in the case of line 23-6, notsignificantly affected (Fig. 6).

The heritability of the high oil trait from the pooledsegregating T2 generation to the average of the cor-responding homozygous T3 progeny is demonstratedin Figure 7 with a linear regression correlation coef-ficient of 0.94. In addition, the number of seeds perplant (yield) was not negatively affected in most ofthe homozygous T3 transgenic lines (Fig. 8). In fact,many of the lines showed significant increases inseed yield. The two exceptions to this trend werelines 9-5 and 16-1. However, when the increase in theaverage 1,000-seed weight for these lines was takeninto account (compare with Fig. 6), the yield perplant compared with that of n-t WT plants as well asthe plasmid only (pSE in WT) average was 90% and72% for lines 9-5 and 16-1, respectively.

Figure 9A shows the relative DGAT expressionlevels in mid-developing T3 seeds (from pooled sil-iques following propagation of T2 lines). In general,in developing seeds of the napin:DGAT transgenics,the DGAT transcript was strongly over-expressedcompared with the pSE in WT (plasmid only) controllines. The DGAT transcript intensity was generallystronger in the napin:DGAT transgenic lines contain-ing multiple inserts (lines 2, 9, and 16) as comparedwith single inserts (lines 10, 21, 23, and 24) (Fig. 9A).The relative DGAT transcript level correlated quite

Figure 3. Complementation of the AS11 DGAT mutation with theWT cDNA leads to a restoration of WT seed oil composition andcontent. A, Transformation of Arabidopsis mutant line AS11 withsingle copies of the DGAT cDNA under the control of a napinpromoter, leads to a restoration of the WT fatty acid composition inthe seed oil of the transformant lines 3-3, 3-4, 9-1, 14-2, and 19-5.Fatty acid composition (% [w/w]) was determined on the seed oilextracted from Arabidopsis WT pSE and AS11 pSE (empty plasmid)control transformants, non-transformed (nt) WT and n-t AS11 con-trols, and T3 seeds of napin:DGAT transgenic lines. B, Seed oilcontent of napin:DGAT T3 transgenic AS11 mutant seed lines con-taining a single insertion of the DGAT cDNA. Oil content is ex-pressed as percentage of seed dry weight for pSE in WT (emptyplasmid) and n-t WT controls (stippled bars), for pSE in AS11 (emptyplasmid) and n-t AS11 controls (black bars), and napin:DGAT AS11transgenic lines 3-3, 3-4, 9-1,14-2, and 19-5 containing a single copyof the DGAT cDNA (gray bars). SE bars are indicated (n 5 3–5replicate analyses performed on seed lots from each line with 100–200 seeds analyzed/replicate).

Figure 4. Northern analysis of TAG1 gene expression in non-transformed Arabidopsis WT and AS11 lines, a pSE (empty plasmid)AS11 control transformant, as well as napin:DGAT AS11 T3 trans-genic lines 3-3, 9-1,14-2, and 19-5, each containing a single copy ofthe DGAT cDNA. Total RNA was extracted from siliques containingmid-green (G) developing seeds. The TAG1 DNA probe was 32P-labeled by random priming.

Jako et al.



well with the averaged values from the correspond-ing homozygous T3 mature seed lines with respect tothe average seed weight (milligrams per 1,000 seeds,Fig. 9C), but the correlation was less distinct with oilcontent (Fig. 9B).

DGAT activity was assessed in microsomal prepa-rations from early-to-mid-green developing T3 seeds.In a previous study (Katavic et al., 1995) we haddetermined that the DGAT activity in WT seeds washighest at these developmental stages. Seed materialwas pooled from stage 3 to stage 6 siliques, as de-fined by Zou et al. (1996). Table I shows the DGATactivities measured in representative napin:DGAThomozygous multiple copy and single copy lines aswell as the corresponding activity in pSE controlsand compares these with the oil content measured ineach line. The DGAT activity in the napin:DGATtransgenic lines was generally approximately 10% to70% higher than that observed in the pSE controls.

We recognize both the advantages and limitationsimposed by the use of the ARASYSTEM and concedethat seed “yield” is probably more appropriately ad-dressed in a field context in a crop plant. Nonethelessthe current results with the model oilseed plant Ara-bidopsis suggest that in transgenic lines over-expressing the DGAT cDNA, both oil content andseed yield can be increased substantially.

Whereas wild-type lines containing over-expressedDGAT cDNA affected oil deposition, there were only

small changes in the fatty acid composition, and theoverall proportions of VLCFAs were not increasedsignificantly (data not shown). Rather, there was asmall but significant decrease in the proportion oftotal saturates and an increase in the mono-unsaturates and the 18:1/[18:2 1 18:3] index.

DISCUSSION

We recently identified a DGAT gene from Arabi-dopsis and cloned its corresponding cDNA. We wereable to demonstrate that the lesion at a locus desig-nated Tag1 in mutant line AS11 (Katavic et al., 1995)is an insertion mutation that results in an extra exon

Figure 5. Transformation of WT Arabidopsis with the DGAT cDNAunder the control of a napin promoter leads to a higher seed oilcontent. Homozygous T3 napin:DGAT lines were sampled in tripli-cate, each sample consisting of 100 to 200 seeds/sample, accuratelycounted and weighed. For the plasmid only pSE in WT transgeniccontrols and nt-WT and nt-AS11controls, 10 individual transgenicplants were sampled and individual control seed lots similarly ana-lyzed. Each error bar indicates SE. Seed oil content (oil as a percent-age of mature seed weight) is shown for Arabidopsis T3 seeds of pSE(empty plasmid) control WT transgenics (stippled bars show repre-sentative oil content ranges; solid black bar is the average of oilcontents in 10 independent pSE in WT plasmid only controls), nt-WTcontrols (white bar), nt-AS11 controls (checkered bar), and homozy-gous napin:DGAT transgenic lines with multiple inserts 2-2, 2-5, 9-2,9-5, and 16-1(hatched bars), and lines with single inserts 10-4, 21-1,21-6, 23-5, 23-6, 24-1, and 24-3 (gray bars).

Figure 6. Introduction of the napin:DGAT cDNA results in increasesin the average 1,000-seed weight (expressed as milligrams of weight/1,000 seeds) of Arabidopsis T3 seeds. Homozygous T3 napin:DGATlines were sampled in triplicate, each sample consisting of 100 to200 seeds/sample accurately counted and weighed. For the plasmidonly pSE controls, 10 individual transgenic plants were sampled andindividual control seed lots similarly analyzed. Each error bar indi-cates SE. Data are presented from pSE in WT (empty plasmid) controltransgenics (solid black bar), nt-WT control lines (white bar), nt-AS11control lines (checkered bar), homozygous napin:DGAT transgeniclines with multiple inserts 2-2, 2-5, 9-2, 9-5, and 16-1(hatched bars),and single insert lines 10-4, 21-1, 21-6, 23-5, 23-6, 24-1, and 24-3(gray bars).

Figure 7. Heritability of the high oil trait from the pooled segregatingT2 generation to the average values for the corresponding selectedhomozygous T3 progeny, shows a strong linear correlation. f, Inter-cepts for the pSE in WT control generations; F, intercepts for thenapin:DGAT generations.




2 sequence (81-bp) repeat in the AS11 DGAT tran-script (Zou et al., 1999).

The fact that (a) Tag1 appears to be a single copygene in Arabidopsis (Routaboul et al., 1999; Zou etal., 1999), (b) that there is no significant difference inDGAT transcript levels in mid- developing WT andAS11 seed (Zou et al., 1999; compare with Fig. 4), and(c) that the AS11 line exhibits reduced but significantacyl-CoA-dependent DGAT activity (compare withFig. 1) collectively suggest that the repeat insertion inTag1 does not totally abolish the activity of the DGATgene product. Rather, the altered fatty acid pheno-type of AS11 appears to be an indirect effect of lowerDGAT activity rather than, for example, an increasedpreference of the DGAT for polyunsaturated C18 fattyacyl-CoAs or a reduced preference for very longchain acyl-CoAs.

As discussed previously (Zou et al., 1999), the DNAaberration observed in this mutant was unexpectedsince EMS generally causes point mutations, as in thecase of the recently characterized mutant allele tag1-2 from line ABX45 wherein one base (G) at position180 in exon 1 is deleted (Routaboul et al., 1999).Although at that time we could not rule out thepossibility that this AS11 mutant was the result of aspontaneous mutation event, the study published byRoutaboul et al. (1999) concomittantly and indepen-dently confirmed our findings: AS11 does contain a147-bp repeat insertion consisting of exon 2 flankedby parts of introns 1 and 2 (Zou et al., 1999). EMS-induced deletions and insertions had been reportedin other systems (Mogami et al., 1986; Okagaki et al.,1991). However, Poirier et al. (1999) recently reportedthe characterization of two new independent EMSmutant isolates (SK353 in Columbia ecotype andSK54-3 in RLD ecotype) shown to have similar fattyacid and oil content phenotypes to that of AS11.Through complementation studies these two new

isolates were shown to be new alleles of Tag1. Thisrecent finding strongly supports the probability thatthe insertion event observed in mutant AS11 wasEMS-induced.

It has been reported that, in addition to acyl-CoA-dependent DGAT as the terminal step in theKennedy pathway (Kennedy, 1961; Barron andStumpf, 1962), there are additional mechanisms forsynthesizing TAGs in mammals, yeasts, and plants.A DAG transacylase reaction by which a fatty acylgroup may be transferred directly from one diacyl-glycerol to a second diacylglycerol acceptor, has beencharacterized from rat intestinal microsomes (Lehnerand Kuksis, 1993). In mammals, a mouse deletionmutant (Dgat2/2) devoid of DGAT still retained sig-nificant TAG synthesis activity, indicating thatDGAT-independent TAG synthesis can occur (Smith

Figure 8. Number of seeds per plant in Arabidopsis n-t WT controls(n 5 6; white bar), six individual pSE in WT T3 transgenic controlsand their average (black bars), versus homozygous napin:DGAT T3

transgenic lines with multiple inserts (2-2, 2-5, 9-2, 9-5, and 16-1,hatched bars), and single insert lines 10-4, 21-1, 21-6, 23-5, 23-6,24-1, and 24-3 (gray bars).

Figure 9. A, Northern analysis of TAG1 gene expression in pooleddeveloping T3 seed samples from Arabidopsis pSE (empty plasmid)WT control transformants, as well as developing progeny from parenttransgenic lines 2, 9, 10, 16, 21, 23, and 24, transformed with thenapin:DGAT construct. Total RNA was extracted from siliques con-taining mid-green developing seeds. The TAG1 DNA probe was32P-labeled by random priming. B, Correlation of relative DGATtranscript level (l) with oil content (percentage of mature seedweight); pSE control (black bar) or napin:DGAT multiple insert(hatched bars) and single insert (gray bars) transgenics. Values fortransgenics represent the average from the corresponding homozy-gous T3 progeny as reported in Figure 5. C, Correlation of relativeDGAT transcript level (l) with average seed weight (expressed asmilligram/1,000 seeds); pSE control (black bar) or napin:DGAT mul-tiple insert (hatched bars) and single insert (gray bars) transgenics.Values for transgenics represent the average from the correspondinghomozygous T3 progeny as reported in Figure 6.

Jako et al.



et al., 2000). In the yeast Saccharomyces cerevisiae, agene designated LRO1, a homolog of the mamma-lian lecithin:cholesterol acyltransferase (LCAT, EC2.3.1.43), encodes an enzyme capable of esterifyingdiacylglycerol using phosphatidylcholine as theacyl donor. This novel enzymatic reaction is respon-sible for the majority of TAG synthesis in the yeastcell during exponential growth (Oelkers et al., 2000).

Pioneering plant research in developing oilseedshas revealed that, in addition to the traditionalDGAT reaction, TAG synthesis can occur in the ab-sence of acyl-CoA. An acyl-CoA-independent selec-tive channeling or transfer of acyl moieties from oneDAG to another to give TAG, was reported (Dahl-qvist et al., 1997; Stobart et al., 1997). Dahlqvist et al.(2000) recently reported the presence of an enzyme indeveloping oilseeds of castor and Crepis involved inTAG synthesis via direct acyl transfer from the sn-2position of PC to the sn-3 position of DAG yieldingTAG. This enzyme has been named phospholipid:DGAT (PDAT) and was proposed to be involved inthe accumulation of the high levels of ricinoleic acidand vernolic acid found in castor (Ricinus communis)and hawk’s beard (Crepis palaestina) TAGs, respec-tively. It was demonstrated that the enzyme ispresent in yeast microsomes, and the PDAT-encoding gene (YNR008w) from yeast, an LCAT ho-molog, was identified. Whereas the authors alsoidentified a sequence from Arabidopsis, which wasmore closely related to the yeast PDAT than to any ofthe cloned LCATs, there was no data reported oncloning or expression of the putative ArabidopsisPDAT.

In the current study, we performed an experimentwherein the microsomal fractions prepared from WTand AS11 developing seed were assayed for PDATactivity in reaction mixtures containing labeled sn-1palmitoyl-, sn-2 [1-14C]oleoyl-PC, and sn-1,2 diolein.A small amount of radiolabeled TAG was produced.Our results with Arabidopsis are similar to thoseobserved for sunflower microsomes by Dahlqvist etal. (2000); that is, when sn-2 14C-oleoyl-radiolabeledPC is supplied, the apparent PDAT activity is quite

low. The low amount of radiolabeled TAG producedin our “PDAT” reactions precluded an accurate ste-reospecific analysis to assess whether there had beentransfer of the sn-2 labeled oleoyl moiety from PC tothe sn-3 position of DAG to give sn-3 oleoyl-labeledTAG. Furthermore, when we performed the experi-ment using sn-1 palmitoyl-, sn-2 [1-14C] linoleoyl-PC,we could not detect any significant PDAT activity ineither WT or AS11 microsomes. Given our previouswork, which showed that in AS11 TAGs, the propor-tion of 18:2 in the sn-3 position was 31% comparedwith only 8% in WT (Katavic et al., 1995), one wouldexpect that if an alteration in a PDAT-type of reactionwas responsible for the AS11 acyl composition phe-notype, it would have been apparent with this exper-iment. Thus, whereas our results are inconclusive asto whether an acyl-CoA-independent PDAT activityexists in Arabidopsis based on our measurementof radiolabeled TAG, the putative acyl-CoA-independent PDAT activity in WT and AS11 micro-somes was similar (approximately 0.7 pmol min21

mg21 protein) and significantly lower, by an order ofmagnitude, than the WT DGAT activity.

There have also been very different acyl-CoA-dependent DGATs identified from Mortierella and S.cereviseae (Lardizabal et al., 2000). These have nosignificant homology (6%–14% identity overall) toany of the plant DGATs isolated thus far and do not,for example, contain a signature DAG binding motifor significant stretches of conserved amino acid res-idues. However, an Arabidopsis homolog to theyeast gene cloned by Calgene (putative protein ac-cession no. CAB 63016) recently has been reported,which has 21% overall identity and 29% identity overa stretch of 243 amino acids, to the yeast DGAT. Todate, there have been no data reported on the relativelevel of expression of this “DGAT homolog” in Ara-bidopsis nor a confirmation of its gene product as afunctional DGAT.

Nonetheless, ectopic expression of the fungal,yeast, or other plant DGATs, or manipulation ofPDAT expression in certain oilseed plants may pro-

Table I. Acyl-CoA-dependent DGAT activity in microsomal fractions prepared from pooled mid-developing T3 seed produced from T2 transgenic lines of pSE control and napin:DGAT transformedArabidopsis are compared to the seed oil content of mature T3 transgenic seed lines

Assays were conducted using sn-1,2 diolein and 1-14C oleoyl-CoA as the acyl acceptor and donor,respectively. Values represent the average of three independent determinations.

Transgenic Line Seed Oil Content (6SE) DGAT Activitya (6SE) Relative DGAT Activity

% mature seed wt pmol/min/mg protein % pSE control set at 100%

pSE controls 29.1 (0.8) 13.0 (0.6) 1002 (Multiple insert) 35.9 (0.6) 15.2 (0.6) 1179 (Multiple insert) 35.4 (0.3) 18.0 (0.5) 13821 (Single insert) 34.1 (0.3) 22.1 (3.1) 17023 (Single insert) 35.5 (0.7) 14.1 (0.6) 10924 (Single insert) 34.1 (1.0) 17.0 (1.7) 131

a Total 14C-TAGs measured using TLC, scraping, and scintillation counting; in all cases, 14C-trioleinwas a major product.




vide additional glimpses into the malleability of TAGbioassembly processes in oilseeds.

While we acknowledge that additional mecha-nisms for TAG synthesis (e.g. PDAT) may exist inArabidopsis, the apparent WT and AS11 PDAT ac-tivities are essentially identical, but also very low,suggesting that there is no differential contribution ofsuch alternate mechanisms to the phenotype ob-served in AS11. Rather, the results from our biochem-ical comparisons of the AS11 and WT microsomalacyl-CoA-dependent DGAT activity and specificitystrongly suggest that the reduction in AS11 oil con-tent is largely attributable to the reduced DGAT ac-tivity of the mutated AS11 TAG1 gene product. Pre-viously (Zou et al., 1999), we suggested a mechanismwhereby such a reduced DGAT activity in AS11 mayresult in the altered acyl composition observed inAS11 seed TAGs (i.e. a reduction in monounsatu-rated [e.g. 18:1 and 20:1] and an enrichment in poly-unsaturated [e.g. 18:3] fatty acyl moieties).

The accumulated biochemical and molecular bio-logical data known for the Arabidopsis DGAT andrelated acyl-CoA-dependent acyltransferases pro-vide a glimpse of the structure-function relationshipsinvolved. In sequences of GPATs and LPATs there isa motif designated box I that contains the conservedsequence XHXXX(X)D (Frentzen and Wolter, 1998).Via site-directed mutagenesis studies in LPATs, thebox I motif has been suggested to be an importantpart of the active site, in particular, the conserved Hisand Asp residues. It has been suggested that the Hisresidue abstracts a proton from the hydroxy group ofthe acyl acceptor (LPA) and thereby facilitates itsnucleophilic attack on the thioester bond of the acyldonor (acyl-CoA). The closely spaced Asp residuehas been suggested to stabilize the positive charge onthe His imidazole ring (Frentzen and Wolter, 1998).In the DGAT sequences examined, the consensussequence N(S/A/G)R(L/V)(I/F/A)(I/L)EN(L/V)has been identified (Fig. 10). We propose that theinvariant Arg (R) and Glu (E) residues in DGATs

could perform similar functions to those of the basicHis (H) and acidic Asp (D) residues, respectively,found in GPATs and LPATs. It is notable that theamino acid sequence predicted for human acyl-CoA:cholesterol acyltransferase genes (Yang et al., 1997;GenBank accession nos. L21934 and AF059203) alsohave RLXXXE motifs that align in the vicinity of theDGAT motif (data not shown).

It is significant that there is a concensus aminoacid sequence for an acyl-CoA binding motif(116RTRESPLSSDAIFKQSHAG134) immediately up-stream (and ending with the first four residues) of theAS11 exon 2 repeat insertion mutation site (Weselakeet al., 2000). If our proposal is correct, the exon 2repeat in mutant AS11 yields a protein altered withrespect to its active site region. This could result inperturbed access of substrates to the active site, analtered interaction of the box I motif with the diacyl-glycerol binding site (Zou et al., 1999), an alteredtopology proximal to the acyl-oA binding site, orprotein instability, and result in reduced DGAT ac-tivity. Site-directed mutagenesis of the invariant Rand/or E in the DGAT sequence will help to establishif this hypothesis is correct.

To study the effect of DGAT expression in plants,we transformed wild-type and AS11 Arabidopsisplants with the DGAT cDNA. We have demonstratedthat the insertion mutation in the mutant AS11DGAT (resulting in an extra exon 2 sequence in itstranscript) can be complemented by transgenicallyexpressing a single copy of the WT cDNA in a seed-specific manner in the AS11 background. The fattyacid composition and oil contents in the AS11 DGATtransformants are restored essentially to wild-typelevels. These experiments are essential to report be-cause the findings confirm the nature of the lesion inAS11 and directly tie the AS11 lipid phenotype to thismutation.

It is interesting that even in the AS11 lines comple-mented with multiple copies of the napin-drivenDGAT cDNA (average oil contents of 26.1% 6 0.3%dry weight; data not shown), the effect on oil contentwas not as strong as those observed in the WT singlecopy napin-driven DGAT cDNA over-expressiontransgenics. It may be that in the WT experiment theendogenous DGAT activity is augmented, whereas inAS11 there is significant competition for substratesbetween the introduced wild-type DGAT and themutated DGAT of lower activity already resident inthe AS11 mutant. This phenomenon clearly needsfurther investigation.

From a biotechnological viewpoint, it is importantthat we have demonstrated that the DGAT cDNA isuseful in manipulating DGAT expression and TAGaccumulation in plants. By transforming wild-typeplants with a construct containing the DGAT gene ina sense orientation under the control of a seed-specific promoter (napin), DGAT activity, the accu-mulation of seed oil, and average seed weight were

Figure 10. Alignment of DGAT sequences (and GenBank accessionnos.) from Arabidopsis (AJ238008 and AJ131831), B. napus(AF155224), Nicotiana tabacum (AF129003), mouse (AF078752),human (AF059202), and Caenorhabditis elegans (Z75526) in theregion covering the insertion repeat found in mutant AS11. Theconserved R and E residues, indicated by an asterisk, are proposed toconstitute key residues at the active site. A proposed “box I” type ofmotif, which is conserved in all DGAT sequences reported thus far(and analogous to the motif found in other acyl-CoA acyltransferases)is underlined.

Jako et al.



enhanced. In contrast, the use of a B. napus DGATcDNA in an anti-sense orientation under the controlof the cruciferin promoter recently has apparentlyresulted in a reduction in seed oil content (Shorrosh,2000). Thus, there appears to be some correlationbetween DGAT expression levels and oil content. It issurprising that despite what we had predicted basedon the fatty acid composition of mutant AS11 seed oil(Katavic et al., 1995), the over-expression of theDGAT and increased oil content and seed weightwere not accompanied by an increase in proportionsof the VLCFAs. The acyl composition of seed oil fromthe napin:DGAT T3 transgenics remained insignifi-cantly different from that found in the pSE (plasmidonly) controls.

To our knowledge, this is the first report of en-hanced seed oil deposition and seed weight achievedby over-expression of a DGAT in plants. The degreeto which oil content increases could account for theobserved increases in average seed weight rangedfrom 40% to 100%. We previously demonstrated thattransformation of Arabidopsis and rapeseed (B. na-pus) with a yeast sn-2 acyltransferase (LPAT) resultedin seed oils with increased proportions of 22:1 andother very long-chain fatty acids and significant in-creases in seed oil content and average seed weight(Zou et al., 1997; Marillia et al., 2000). These resultshave been confirmed in two transgenic field trials(Katavic et al., 2001). Taken together, both resultssuggest a certain plasticity in the developing seedwith respect to increasing the quantity of TAG de-posited and, in some way perhaps by signaling, theoverall sink size and resultant seed weight. Clearly inmany cases a proportion of the added seed weightmust be due to increases in e.g. oleosin or seed stor-age protein biomass.

Not unexpectedly, there was not necessarily a di-rect linear correlation between the relative transcriptlevel (compare with Fig. 9A), the degree of DGATactivity enhancement, and oil content (Fig. 9B; TableI). The correlation between the latter two parameterswas not high (a scatter plot of the data from Table I,the r2 value 5 0.11; data not shown). The relationshipbetween these measures of altered metabolism at thetranscript, enzyme activity, and oil content levels isclearly complex and will require more detailedstudy: There may be tight control of transcript stabil-ity that would not necessarily be evident in our sam-pling window. As well, it is difficult to directly de-termine the embryo stage for sampling. Poolingsiliques 7 through 18 may dilute the peak value forDGAT activity (on a per milligram protein basis) andresult in an apparently lower DGAT rate. The napinpromoter may also contribute by broadening the pe-riod of DGAT expression and oil deposition. In ad-dition, there is perhaps some degree of post-transcriptional regulation affecting DGAT activity.Nonetheless, it can be said that all lines with in-

creased DGAT transcript did exhibit increasedDGAT activity and an increase in oil content.

It is tempting, metabolically, to speculate that in-creases in DGAT activity may lower the size ofthe acyl-CoA pools, thereby signaling a need forenhanced fatty acid synthesis (e.g. enhancement ofACCase activity).

In summary, the current results in Arabidopsis andrecent studies of DGAT expression in tobacco(Bouvier-Nave et al., 2000) have important implica-tions for the modification of other crops throughbiotechnology by altering DGAT expression. Some ofthe manipulations that may be possible using DGATgenes or parts thereof include seeds with increased ordecreased oil content, seeds containing oils with anenhanced diacylglycerol content, seed oils with analtered acyl composition, plants producing larger orheavier seeds, plants exhibiting an enhanced or al-tered capacity to accumulate TAGs, or other storagecompounds in other organs (e.g. tubers, roots,leaves). Clearly the next wave of research will entailaltering the expression of DGAT in commercial oil-seed crops. Such studies will allow one to determinethe critical role of DGAT in regulating carbon fluxinto TAGs and the effect of such manipulations onoverall oil deposition, average seed weight, and seedyield in a field context.

MATERIALS AND METHODS

Substrates and Reagents

[1-14C]Oleic acid (56 mCi mmol21) and [1-14C]linoleicacid (55.6 mCi mmol21) were purchased from NENResearch Products (Mississauga, Ontario, Canada).[1-14C]Eicosenoic acid (55 mCi mmol21), 1-palmitoyl-2-oleoyl phosphatidylcholine (58 mCi mmol21), 1-palmitoyl-2-linoleoyl [1-14C-linoleoyl] phosphatidylcholine (58 mCimmol21), and diolein [1-14C-oleoyl] (55 mCi mmol21) werepurchased from American Radiolabeled Chemicals (St.Louis). [9,10-3H]Oleic acid (8 Ci mmol21) was purchasedfrom Amersham Pharmacia Biotech (Quebec). Labeledfatty acids were converted to the corresponding acyl-CoAthioesters using the method described by Taylor et al.(1990). Specific activities were adjusted as required by di-luting with authentic unlabeled standards. Unlabeled acyl-CoAs, ATP, CoASH, polar lipid standards, and most otherbiochemicals were purchased from Sigma (St. Louis). Neu-tral lipid standards were obtained from NuChek Prep (Ely-sian, MN), whereas FAME standards were supplied bySupelco Canada (Oakville, Ontario, Canada). The sn-1,2-diolein from 14C-labeled diolein [1-14C oleic] (55 mCimmol21) and unlabeled diolein (already enriched in thesn-1,2 isomer) were both further purified by thin layerchromatography (TLC) on 10% (v/v) borate-impregnatedTLC plates and the isolated sn-1,2 isomer emulsified inHEPES buffer the presence of 0.2% (v/v) Tween 20 asdescribed by Taylor et al. (1991). Mixed TAG and diacyl-glycerol standards for gas chromatography, which werenot commercially available, were synthesized from the




corresponding di- or mono-acylglycerols by condensationwith the appropriate acyl chloride and purified as de-scribed by Taylor et al. (1991). HPLC-grade solvents(Omni-Solv, BDH Chemicals, Toronto) were usedthroughout these studies.

Plant Material

The Arabidopsis mutant line AS11 was generated andcharacterized relative to WT Arabidopsis ecotype Colum-bia as described by Katavic et al. (1995). Arabidopsisecotype Columbia WT, mutant AS11 (AS11 seeds weredeposited at the American Type Culture Collection, ATCCDeposit No. PTA 1013) and all napin:DGAT transgeniclines were grown in the same growth chamber, at the sametime, at 22°C with a diurnal photoperiod of 16-h light (120mE m22 s21) and 8-h dark. For consistency in comparison,especially with respect to the reproducibility of oil contentand seed weight measurements, transgenic lines were al-ways grown along with n-t WT and AS11, and plasmidonly WT (pSE WT) and AS11 (pSE AS11) controls, in thesame chamber and at the same time. The Arasystem (LehleSeeds, Tuscon, AZ), a plastic cone, and cylinder supportsystem was used throughout these studies to isolate indi-vidual transgenic lines and facilitate seed harvesting fromall lines.

Lipid Analyses in AS11, WT, and DGATTransgenic Lines

Total lipid extracts (TLEs) and lipid class analyses in WTand the AS11 mutant and determination of oil content andcomposition in all seed lines were performed as describedpreviously (Taylor et al., 1991, 1992; Katavic et al., 1995;Zou et al., 1997). In all cases, the data represent the aver-ages of four to eight determinations.

In some cases, relative seed oil content was also mea-sured by magic angle sample spinning 1H-NMR, accordingto the method of Rutar (1989). Analyses were conductedwith 50-seed samples of intact wild type and AS11 seedsusing a Bruker AM wide-bore spectrometer (Bruker Ana-lytische Masstechnik, Silberstreifen, Germany) operating at360 MHz. To reduce anisotropic line broadening, the seedsample was rotated at 1 kHz in a zirconium rotor oriented54.7° to the magnetic field. The integration response forresonances attributable to liquid-like oil were summed,and the value for transgenic seed was recorded relative tothe response for the WT control seed sample, the latter setat a value of 1.00.

Preparation of Microsomal Fractions and DGAT andPDAT Assays

Two-hundred siliques (pooled silique stages 3–6 inclu-sive, as described by Zou et al., 1996) were harvested fromn-t WT, n-t AS11, pSE in WT control, and napin:DGATtransgenic lines. Developing seeds (early-to-mid-greenstage) were harvested and immediately powdered withliquid nitrogen in a mortar and pestle. Grinding medium

(100 mm HEPES-KOH, pH 7.4 containing 0.32 m Suc, 1 mmEDTA, and 1 mm dithiothreitol) was immediately added,and grinding continued on ice for 3 min. The slurried cellfree homogenate was filtered through two layers of Mira-cloth (Calbiochem, La Jolla, CA), and centrifuged at 10,000gfor 20 min using a centrifuge (model RC5C, Sorvall/Man-del Scientific Co., Guelph, ON, Canada) equipped with anSS-34 rotor. The supernatant was then recentrifuged at105,000g for 1 h on a Sorvall Ultra Pro 80 ultracentrifugeusing an SW 40Ti rotor. The supernatant was discarded,the 105,000g microsomal pellet fraction was resuspended ina minimum volume of grinding medium, and the prepara-tion was disbursed by probe sonication on ice for 2 min in30-s cycles using a Labsonic 2,000-U probe sonicator (B.Braun Biotech, Allentown, PA) on the low setting. Theconcentration of protein was then determined by themethod of Bradford (1976), and relative microsomal pro-tein concentrations were normalized by adjusting the vol-ume of each preparation with grinding medium.

Acyl-CoA-dependent DGAT activity (EC 2.3.1.20) assayswere conducted at pH 7.4 with shaking at 100 revolutionsmin21 in a water bath at 30°C for 30 to 60 min. Assaymixtures (500 mL final volume) contained microsomal pro-tein (100–200 mg), 90 mm HEPES-NaOH, 0.5 mm ATP, 0.5mm CoASH, 1 mm MgCl2, 200 mm sn-1,2 diolein in 0.02%(v/v) Tween 20, and 18 mm or 40 mm acyl-CoA. In mostcases, the acyl-CoA donor was 14C-labeled and supplied ata radiospecific activity of 10 nCi nmol 21 and a finalconcentration of 18 mm. In double label DGAT assays,3H-labeled oleoyl-CoA was used at a radiospecific activityof 50 nCi nmol 21 and a final concentration of 40 mm with14C-labeled sn-1,2 diolein provided at a specific activity of2 nCi nmol 21 and a final concentration of 200 mm.

Acyl-CoA-independent phospholipid:DGAT (PDAT) ac-tivity was tested essentially as described by Dahlqvist et al.(2000) at 30°C for 60 min in the presence of 18 mm1-palmitoyl-2-[1-14C-oleoyl] phosphatidylcholine (58 mCimmol21) or 1-palmitoyl-2-[1-14C-linoleoyl] phosphatidyl-choline (58 mCi mmol21) as the acyl donor, 200 mm sn-1,2diolein in 0.02% (v/v) Tween 20 as the acyl acceptor, and200 mg of microsomal protein in 100 mm HEPES-NaOH,pH 7.4, containing 0.5 mm ATP, 0.5 mm CoASH, 1 mmMgCl2 in a final reaction volume of 500 mL. All assays wereconducted in triplicate, and each experiment replicatedtwice.

All acyltransferase reactions were terminated by the ad-dition of CH2Cl2:iso-propanol (1:2), phases were separated,and labeled TAGs were isolated and purified by TLC onsiliga gel G plates developed in hexane:diethyl ether:aceticacid (70:30:1 v/v/v), as described by Taylor et al. (1991).The radiolabeled TAG spots were visualized on a BioscanAR-2,000 radio-TLC scanner using Win-Scan 2D software(Bioscan, Washington, D.C.) and the bands scraped andquantified on a liquid scintillation counter.

General Molecular Techniques, DNA and RNAManipulation, and Analyses

Isolation of plasmid DNA, restriction digestions, modi-fication and ligation of DNA, PCR, agarose, PAGE, trans-

Jako et al.



formation and culture of Escherichia coli strains, DNA gel-blot analyses (Southern, 1975), and RNA gel-blot analyseswere carried out according to standard protocols (Sam-brook et al., 1989).

The Arabidopsis TAG1 DGAT amino acid sequence wascompared with sequences available in databanks using theBLAST program (Altschul et al., 1990).

Construction of DGAT cDNA TransformationVector for Seed-Specific Expression

The cloned full-length DGAT cDNA was used as a tem-plate for PCR amplification with the primers DGATXbaI(CTAGTCTAGAATGGCGATTTTGGA) and DGATXhoI(GCGCTCGAGTTTCATGACATCGA) to provide new re-striction sites on each end of the sequence. The PCR profilewas as follows: 94°C for 1 min; 30 cycles of 94°C for 30 s,55°C for 30 s, 72°C for 1 min; and 72°C for 5 min. The PCRproduct was then ligated into the PCR-2.1 vector (Invitro-gen, Carlsbad, CA). A 1.6-kb fragment was excised by aXbaI/KpnI digestion and ligated into the correspondingsites of the pSE. The plant transformation vector pSE wasprepared from pRD400 (Datla et al., 1992) by introducing aHindIII/XbaI fragment containing the B. napus napin pro-moter (Josefsson et al., 1987) and a KpnI/EcoRI fragmentcontaining the Agrobacterium nos terminator (Bevan, 1983).The 1.6-kb DGAT cDNA fragment was ligated into XbaI/KpnI-digested pSE in the sense orientation. The resultingplasmid was designated napin:DGAT. Hence in the napin:DGAT construct, the Arabidopsis DGAT cDNA is underthe control of the napin promoter. The construct integritywas confirmed by sequencing.

Transformation of Agrobacterium with Plant DGATVector Constructs

Electrocompetent Agrobacterium cells, GV3101 (pMP90)strain, were prepared as follows. An Agrobacterium culturewas grown 24 to 48 h in 23 YT Medium (double-strengthyeast extract 1 tryptone; Becton Dickinson, Sparks, MD),and when the A600 reached 0.5 to 0.7, the cells were chilledon ice and pelleted by centrifugation (5,000g, 10 min in aglutamate semialdehyde rotor at 4°C). The pellet waswashed in 1, 0.5, and 0.02 volumes of cold 10% (v/v) sterileglycerol and resuspended in 0.01 volume of cold 10% (v/v)glycerol. The electrocompetent cells were then frozen inliquid N2 and stored at 270°C. The Agrobacterium cellswere transformed by electroporation with 20 to 50 ng oftransforming DNA (napin:DGAT) according to the manu-facturer’s instructions, plated on a selective medium(Luria-Bertani broth with 50 mg mL21 kanamycin), andincubated for 48 h at 28°C. Single transformed cells weregrown for 16 h (28°C, 225 rpm) in 5 mL Luria-Bertani brothwith 50 mg mL21 kanamycin and 25 mg mL21 gentamycin.DNA extraction and purification were performed with aQiaprep Spin Miniprep kit (Qiagen, Valencia, CA). Thefidelity of the construct was rechecked by DNA sequencingbefore plant transformation.

Transformation of Arabidopsis

Seeds of Arabidopsis ecotype Columbia WT and mutantAS11 (Katavic et al., 1995) were grown at 22°C underfluorescent illumination (120 mE m22 s21) in a 16-h-light/8-h-dark regime. Four to six plants typically were raised ina 10 cm2 pot in moistened Terra-lite Redi-earth (W.R. Graceand Company, Ajax, Ontario, Canada). To prevent the soilmix in the pot from falling into the inoculation media, soilwas mounded as a platform with seeds sown on top, andthe whole pot covered by a nylon window screen andsecured by a rubber band. To grow Agrobacterium, a 5-mLsuspension in Luria-Bertani medium containing 50 mgmL21 kanamycin and 25 mg mL21 gentamycin was cul-tured overnight at 28°C. The day before infiltration, this“seed culture” was divided into four flasks containing 250mL of Luria-Bertani medium supplemented with 50 mgmL21 kanamycin and 25 mg mL21 gentamycin. These cul-ture were grown overnight at 28°C. Plants were vacuuminfiltrated in an Agrobacterium suspension when the firstflowers started opening.

The transformation was performed as described byClough and Bent (1998), using Silwet L-77 at a concentra-tion of 0.005% in the dipping solution. The next day, theplants were uncovered, set upright, and allowed to growfor approximately 4 weeks in a growth chamber undercontinuous light conditions as described by Katavic et al.(1995). When the siliques were mature and dry, seeds wereharvested and selected for positive transformants.

Selection of Putative Transformants (TransgenicPlants) and Analysis of Transgenic Plants andSeed Weights

For each construct, seeds were harvested in bulk. Seedswere surface-sterilized by submerging them in a solutioncontaining 20% (v/v) bleach and 0.01% (v/v) Triton X-100for 20 min, followed by three rinses with sterile water.Sterilized seeds were then plated by resuspending them insterile 0.1% (w/v) phytagar at room temperature (approx-imately 1 mL phytagar for every 500–1,000 seeds), and thenapplying a volume containing 2,000 to 4,000 seeds onto150 3 15-mm kanamycin selection plate. Plates were incu-bated for 2 d in the cold without light and then grown for7 to 10 d in a controlled environment (22°C under fluores-cent illumination [120 mE m22 s21] in a 16-h-light/8-h-darkregime). The selection media contained one-half MurashigeSkoog Gamborg medium, 0.8% (w/v) phytagar, 3% (w/v)Suc, 50 mg mL21 kanamycin, and 50 mg mL21 timentin.Petri dishes and lids were sealed with a Micropore surgicaltape (3M Canada, Inc., London, ON, Canada). After 7 to10 d, drug-resistant plants that had green leaves and wellestablished roots within the medium were identified as T1

transformants, and at the 3- to 5-leaf stage selected trans-formants were transplanted into flats filled with heavilymoistened soil mix. Transformants were grown to matu-rity, and mature seeds (T2 generation as defined in Katavicet al., 1994) were harvested from individual plants andfurther analyzed or propagated. Segregation analyses wereperformed on T2 plantlets screened on kanamycin to de-




termine whether there were single (expected ratio of resis-tant:susceptible plantlets 5 3:1) or multiple copies of thenapin:DGAT transgene. Homozygous single and multipleinsert T2 lines exhibiting enhanced oil deposition andDGAT expression compared with one-dozen plasmid-onlycontrol transgenics were propagated to give T3 seed lines,for which further data on oil content, average seed weight,and yield per plant were collected. Average seed weightswere determined from pooled T2 or individual T3 seg-regant seed lots and based upon six to eight individualsamplings of 150 to 250 seeds/sample, with the seeds ofeach replicate being accurately counted on an ElectronicDual Light Transilluminator (Ultra Lum, Paramount, CA),using Scion Image software (Scion Corporation, Frederick,MD). Weights of these samples were then individuallyrecorded.

DNA and RNA Isolation from Transformants:Southern and Northern Analyses

Genomic DNA was isolated from individual T1 plantsfollowing the protocol of Dellaporta et al. (1983). A PCRamplification using the paired primers described previ-ously for the DGAT cDNA or for the DGAT gene, wasperformed to confirm the presence of the cDNA in the T1

transformants. Southern analyses (Southern, 1975) wereperformed to further confirm and select those transfor-mants containing single or multiple copies of the insertedfragment. DNA samples were digested with restrictionenzymes BglII, resolved by electrophoresis on a 1% (w/v)agarose gel, and Southern blotting performed using a ny-lon filter (Hybond N1, Amersham) according to Sambrooket al. (1989). The DGAT cDNA fragment, labeled witha-[32P]dCTP (NEN/Mandel Scientific Co., Guelph, ON,Canada) using the Random Primer DNA labeling kit (LifeTechnologies/Gibco-BRL, Cleveland) was used as a probe.Hybridization was performed at 60°C according to Churchand Gilbert (1984). The filter was then exposed toX-OMAT-AR film (Kodak, Rochester, NY).

Northern analyses of DGAT transcripts in both controland transgenic lines were performed as follows: Using themethod of Lindstrom and Vodkin (1991), total RNA wasextracted from developing T3 seeds at the mid-green stageof development (as defined previously by Katavic et al.,1995; Zou et al., 1996). RNA samples were denatured withformaldehyde and separated on 1.2% (v/v) formaldehyde-agarose gels. Ten to 40 mg of total RNA was loaded, and theamount of RNA per lane was calibrated by the ethidiumbromide-staining intensity of the rRNA bands. The DGATDNA probe was 32P-labeled by random-priming accordingto protocols of the manufacturer (Life Technologies/Gibco-BRL), and the blots were hybridized with 32P-labeled Ara-bidopsis DGAT cDNA under stringent conditions (60°C).Relative intensities of hybridization signals in autoradio-grams from northern analyses were measured with anUltra Lum Electronic Dual Light Transilluminator usingScion Image software.

ACKNOWLEDGMENTS

The authors thank B. Panchuk, D. Schwab and Dr. L.Pelcher of the PBI DNA Technologies Unit for sequencingand primer synthesis, Dr. J. Giraudat for the gift of theArabidopsis silique-specific cDNA library, B. Chatson forthe 1H-NMR analyses, L. Steinhauer for additional techni-cal assistance, and K. Yao and D. Hunter for constructingthe pSE vector. Critical reviews of this manuscript werekindly provided by Drs. A.J. Cutler and F. Georges.

Received February 8, 2001; accepted March 12, 2001.

LITERATURE CITED

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ(1990) Basic local alignment search tool. J Mol Biol 215:403–410

Barron EJ, Stumpf PK (1962) The biosynthesis of triglyc-erides by avocado mesocarp enzymes. Biochem BiophysActa 60: 329–337

Bernerth R, Frentzen M (1990) Utilization of erucoyl-CoAby acyltransferases from developing seeds of Brassicanapus (L.) involved in triacylglycerol biosynthesis. PlantSci 67: 21–28

Bevan M (1983) Binary Agrobacterium vectors for planttransformation. Nucleic Acid Res 12: 8711–8721

Bouvier-Nave P, Benveniste P, Oelkers P, Sturley SL,Schaller H (2000) Expression in yeast and tobacco ofplant cDNAs encoding acyl CoA:diacylglycerol acyl-transferase. Eur J Biochem 267: 85–96

Bradford MM (1976) A rapid and sensitive method for thequantitation of microgram quantities of protein utilizingthe principle of protein-dye binding. Anal Biochem 72:248–254

Cao Y-Z, Huang AHC (1986) Diacylglycerol acyltrans-ferase in maturing oil seeds of maize and other species.Plant Physiol 82: 813–820

Cao Y-Z, Huang AHC (1987) Acyl coenzyme A preferenceof diacylglycerol acyltransferase from maturing seeds ofCuphea, maize, rapeseed and canola. Plant Physiol 84:762–765

Cases S, Smith JS, Zheng Y-W, Myers HM, Lear SR,Sande E, Novak S, Collins C, Welch CB, Lusis AJ et al.(1998) Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacyl-glycerol synthesis. Proc Natl Acad Sci USA 95: 13018–13023

Church GM, Gilbert W (1984) Genomic sequencing. ProcNatl Acad Sci USA 81: 1991–1995

Clough SJ, Bent AF (1998) Floral dip: a simplified methodfor Agrobacterium-mediated transformation of Arabidopsisthaliana. Plant J 16: 735–743

Dahlqvist A, Banas A, Stymne S (1997) Selective channel-ling of unusual fatty acids into triacylglycerols. In JSanchez, E Cerda-Olmedo, E Martinez-Force, eds, Ad-vances in Plant Lipid Research. Universidad de Sevilla,Seville, Spain, pp 211–214

Jako et al.



Dahlqvist A, Ståhl U, Lenman M, Banas A, Lee M,Sandager L, Ronne H, Stymne S (2000) Phospholipid:diacylglycerol acyltransferase: an enzyme that catalyzesthe acyl-CoA-independent formation of triacylglycerol inyeast and plants. Proc Natl Acad Sci USA 97: 6487–6492

Datla RSS, Hammerlindl JK, Panchuk B, Pelcher LE,Keller WA (1992) Modified binary plant transformationvectors with the wild-type gene encoding NPTII. Gene211: 383–384

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNAminipreparation: version II. Plant Mol Biol Rep 1: 19–21

Frentzen M (1993) Acyltransferases and triacylglycerols. InTS Moore Jr, ed, Lipid Metabolism in Plants. CRC Press,Boca Raton, FL, pp 195–230

Frentzen M, Wolter FP (1998) Plant lipid biosynthesis:fundamentals and agricultural applications. In JL Hard-wood, ed, Society of Experimental Biology Seminar Se-ries, Vol 67. Cambridge University Press, New York, pp247–272

Hobbs HD, Chaofu L, Hills M (1999) Cloning of a cDNAencoding acyltransferase from Arabidopsis thaliana and itsfunctional expression. FEBS Lett 452: 145–149

Ichihara K, Takahashi T, Fujii S (1988) Diacylglycerolacyltransferase in maturing safflower seeds: its influ-ences on the fatty acid composition of the triacylglyceroland on the rate of triacylglycerol synthesis. Biochim Bio-phys Acta 958: 125–129

Josefsson L-G, Lenman M, Ericson ML, Rask L (1987)Structure of a gene encoding the 1.7S storage protein,napin, from Brassica napus. J Biol Chem 262: 12196–12201

Katavic V, Friesen W, Barton DL, Gossen KK, Giblin EM,Luciw T, An J, Zou J-T, MacKenzie SL, Keller WA et al.(2001) Improving erucic acid content in rapeseedthrough biotechnology: what can the Arabidopsis FAE1and the yeast SLC1-1 genes contribute? Crop Sci 41: (inpress)

Katavic V, Haughn GW, Reed D, Martin M, Kunst L(1994) In planta transformation of Arabidopsis thaliana.Mol Gen Genet 245: 363–370

Katavic V, Reed DW, Taylor DC, Giblin EM, Barton DL,Zou J-T, MacKenzie SL, Covello PS, Kunst L (1995)Alteration of fatty acid composition by an EMS-inducedmutation in Arabidopsis thaliana affecting diacylglycerolacyltransferase activity. Plant Physiol 108: 399–409

Kennedy EP (1961) Biosynthesis of complex lipids. Fed ProFed Am Soc Exp Biol 20: 934–940

Lacey DJ, Hills MJ (1996) Heterogeneity of the endoplas-mic reticulum with respect to lipid synthesis in develop-ing seeds of Brassica napus L. Planta 199: 545–551

Lardizabal KD, Hawkins D, Thompson GA, inventors.January 13, 2000. Diacylglycerol acyltransferase proteins.Patent Application Nos. PCT/US99/15243 and WO 00/01713

Lehner R, Kuksis A (1993) Triacylglycerol synthesis by ansn-1,2 (2, 3)-diacylglycerol transacylase from rat intesti-nal microsomes. J Biol Chem 268: 8781–8786

Lindstrom JT, Vodkin LO (1991) A soybean cell wallpro-tein is affected by seed color genotype. Plant Cell 3:561–571

Little D, Weselake RJ, Pomeroy MK, Furukawa-Stoffer T,Bagu J (1994) Solubilization and characterization of di-acylglycerol acyltransferase from microspore-derivedcultures of oilseed rape. Biochem J 304: 951–958

Marillia E-F, Zou JT, Katavic V, Qi Q, Jako C, Barton DL,Friesen W, Giblin EM, Gossen KK, Kumar A et al.(2000) Metabolic engineering of Brassica seeds oils: im-provement of oil quality and quantity and alteration ofcarbon flux. In AD Arencibia, ed, Plant Genetic Engineer-ing: Towards the Third Millenium. Elsevier Science Pub-lishing, New York, pp 182–188

Mayorek N, Grinstein I, Bar-Tana J (1989) Triacylglycerolsynthesis in cultured rat hepatocytes: the rate-limitingrole of diacylglycerol acyltransferase. Eur J Biochem 182:395–400

Mogami K, O’Donnell PT, Bernstein SI, Wright TRF,Emerson CP Jr (1986) Mutations of the Drosophila myosinheavy-chain gene: effects on transcription, myosin accu-mulation, and muscle function. Proc Natl Acad Sci USA83: 1393–1397

Nykiforuk C, Laroche A, Weselake RJ (1999) Isolation andsequence analysis of a novel cDNA encoding a putativediacylglycerol acyltransferase from a microspore-derived cell suspension culture of Brassica napus L. cv JetNeuf. Plant Physiol 120: 99–123

Oelkers P, Behar A, Cromley D, Billheimer JT, Sturley ST(1998) Characterization of two human genes encodingacyl coenzyme A: cholesterol acyltransferase-related en-zymes. J Biol Chem 273: 26765–26771

Oelkers P, Tinkelenberg A, Erdeniz N, Cromley D, Bill-heimer JT, Sturley SL (2000) A lecithin cholesterolacyltransferase-like gene mediates diacylglycerol esteri-fication in yeast. J Biol Chem 275: 15609–15612

Okagaki RJ, Neuffer MG, Wessler SR (1991) A deletioncommon to two independently derived Waxy mutationsin maize. Genetics 128: 425–431

Perry HY, Bligny R, Gout E, Harwood JL (1999) Changesin Kennedy pathway intermediates associated with in-creased triacylglycerol synthesis in oil-seeds rape. Phy-tochemistry 52: 799–804

Perry HY, Harwood JL (1993a) Changes in the lipid contentof developing seeds of Brassica napus. Phytochemistry 32:1411–1415

Perry HY, Harwood JL (1993b) Use of [2–3H] glycerolprecursor in radiolabelling studies of acyl lipids in de-veloping seeds of Brassica napus. Phytochemistry 34:69–73

Poirier Y, Ventre G, Caldelari D (1999) Increased flow offatty acids toward b oxidation in developing seeds ofArabidopsis deficient in diacylglycerol acyltransferase ac-tivity or synthesizing medium-chain-length fatty acids.Plant Physiol 121: 1359–1366

Routaboul J-M, Benning C, Bechtold N, Caboche M, Lepi-niec L (1999) The TAG1 locus of Arabidopsis encodes fora diacylglycerol acyltransferase. Plant Physiol Biochem37: 831–840

Rutar V (1989) Magic angle sample spinning NMR spec-troscopy of liquids as a non-destructive method for stud-ies of plant seeds. J Agric Food Chem 37: 67–70




Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Clon-ing, A Laboratory Manual, Ed 2. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY

Settlage SH, Wilson RF, Kwanyuen P (1995) Localizationof diacylglycerol acyltransferase to oil body associatedendoplasmic reticulum. Plant Physiol Biochem 33:399–407

Shorrosh BS, inventor. November 9, 2000. Plant acyltrans-ferases. International Patent Application No. WO00/66749

Smith SJ, Cases S, Jensen DR, Chen HC, Sande E, Tow B,Sanan DA, Raber J Eckel RH, Farese Jr RV (2000) Obe-sity resistance and multiple mechanisms of triglyceridesynthesis in mice lacking DGAT. Nat Genet 25: 87–90

Southern EM (1975) Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J MolBiol 98: 503–517

Stobart AK, Stymne S, Hoglund S (1986) Safflower micro-somes catalyze oil accumulation in vitro: a model sys-tem. Planta 169: 33–37

Stobart K, Mancha M, Lenman M, Dahlqvist A, Stymne S(1997) Triacylglycerols are synthesized and utilized bytransacylation reactions in microsomal preparations ofdeveloping safflower (Cartharmus tinctorius L.) seeds.Planta 203: 58–66

Stymne S, Stobart AK (1987) Triacylglycerol biosynthesis.In PK Stumpf, ed, The Biochemistry of Plants, Vol 9.Academic Press, New York, pp 175–214

Taylor DC, Barton DL, Rioux KP, MacKenzie SL, ReedDW, Underhill EW, Pomeroy MK, Weber N (1992) Bio-synthesis of acyl lipids containing very-long chain fattyacids in microspore-derived embryos of Brassica napus L.cv. Reston. Plant Physiol 99: 1609–1618

Taylor DC, Weber N, Barton DL, Underhill EW, HoggeLR, Weselake RJ, Pomeroy MK (1991) Triacylglycerolbioassembly in microspore-derived embryos of Brassicanapus L. cv Reston. Plant Physiol 97: 65–79

Taylor DC, Weber N, Hogge LR, Underhill EW (1990) Asimple enzymatic method for the preparation of radiola-beled erucoyl-CoA and other long-chain fatty acyl-CoAsand their characterization by mass spectrometry. AnalBiochem 184: 311–316

Tijburg LB, Geelen MJ, van Golde LM (1989) Regulationof the biosynthesis of triacylglycerol, phosphatidylcho-

line and phosphatidylethanloamine in the liver. BiochimBiophy Acta 1004: 1–19

Tzen TC, Cao Y, Laurent P, Ratnayake C, Huang HC(1993) Lipids, proteins and structures of seed oil bodiesfrom diverse species. Plant Physiol 101: 267–276

Vogel G, Browse J (1996) Cholinephosphotransferase anddiacylglycerol acyltransferase: substrate specificities at akey branch point in seed lipid metabolism. Plant Physiol110: 923–931

Weselake RJ, Laroche A, Taylor DC, Zou J-T (2000) De-velopment of Canola Germplasm with Increased Oil For-mation Capacity: Final Report to the Alberta AgriculturalResearch Institute/Farming for the Future Program. Co-lin Bate Books, Calgary, Canada

Weselake RJ, Pomeroy MK, Furukawa TL, Golden JL,Little DB, Laroche A (1993) Developmental profile ofdiacylglycerol acyltransferase in maturing seeds of oil-seed rape and safflower and micro-spore-derived cul-tures of oilseed rape. Plant Physiol 102: 565–571

Weselake RJ, Taylor DC (1999) The study of storage lipidbiosynthesis using microspore-derived cultures of oil-seed rape. Prog Lipid Res 38: 401–460

Weselake RJ, Taylor DC, Pomeroy MK, Lawson SL, Un-derhill EW (1991) properties of diacylglycerol acyltrans-ferase from microspore-derived embryos of Brassica na-pus L. Phytochemistry 30: 3533–3538

Yang H, Cromley D, Wang H, Billheimer JT, Sturley SL(1997) Functional expression of a cDNA to human acyl-coenzyme A: cholesterol acyltransferase in yeast. J BiolChem 272: 3980–3985

Zou J-T, Brokx SJ, Taylor DC (1996) Cloning of a cDNAencoding the 21.2 kDa oleosin isoform from Arabidopsisthaliana and down-regulation of its expression in a mu-tant defective in diacylglycerol acyltransferase activity.Plant Mol Biol 31: 429–433

Zou J-T, Katavic V, Giblin EM, Barton DL, MacKenzieSL, Keller WA, Hu X, Taylor DC (1997) Modification ofseed oil content and acyl composition in the Brassicaceaeby expression of a yeast sn-2 acyltransferase gene. PlantCell 9: 909–923

Zou J-T, Wei Y, Jako C, Kumar A, Selvaraj G, Taylor DC(1999) The Arabidopsis thaliana TAG1 mutant has a muta-tion in a diacylglycerol acyltransferase gene. Plant J 19:645–653

Jako et al.



seed-specific over-expression of an arabidopsis cdna ... · (1999). the arabidopsis dgat sequence...

Documents