seebah phd thesis final submission[1]

Molecular and ecological analysis of cellular attachment and induction of

transparent exopolymeric particle formation in diatom-bacteria interactions

by

Shalin Seebah

A thesis submitted in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

in

Marine Microbiology

Approved Thesis Committee

Prof. Dr. Matthias Ullrich Jacobs University Bremen

Prof. Dr. Laurenz Thomsen Jacobs University Bremen

Dr. habil. Uta Passow

Marine Science Institute University of California Santa Barbara

Date of defense: 23 March 2012 Jacobs University Bremen School of Engineering and Science

ACKNOWLEDGEMENTS ................................................................................................................... I

ABSTRACT .......................................................................................................................................... III

LIST OF ABBREVIATIONS ............................................................................................................. IV

INTRODUCTION ................................................................................................................................. 1

1.1 THE GLOBAL CARBON CYCLE ........................................................................................................... 1 1.1.1 Pre-industrial global carbon cycle .................................................................. 1 1.1.2 Present-day global carbon cycle ..................................................................... 2 1.2 OCEANIC CARBON CYCLE ................................................................................................................ 4 1.3 BIOLOGICAL PROCESSES OF THE OCEAN .......................................................................................... 8 1.3.1 The biological pump ....................................................................................... 8 1.3.2 Dissolved organic carbon ................................................................................ 9 1.3.3 Particulate organic carbon............................................................................... 9 1.4 MARINE SNOW............................................................................................................................... 12 1.4.1 Marine snow formation ................................................................................. 12 1.4.2 Marine gel particles....................................................................................... 13 1.5 TRANSPARENT EXOPOLYMERIC PARTICLES .................................................................................... 15 1.6 MICROSCALE INTERACTIONS ......................................................................................................... 17 1.6.1 Bacterial chemotaxis and motility ................................................................ 18 1.7 BILATERAL MODEL SYSTEM ........................................................................................................... 22 1.7.1 The diatom Thalassiosira weissflogii ........................................................... 22 1.7.2 The marine bacterium Marinobacter adhaerens sp. nov. HP15 ................... 24

AIMS OF THIS STUDY ...................................................................................................................... 26

SUMMARY OF RESULTS .................................................................................................................. 27

CHAPTER 1 .......................................................................................................................................... 29

3.1.1 Marinobacter adhaerens sp. nov., prominent in aggregate formation with the diatom Thalassiosira weissflogii............................................................................ 30 3.1.2 Complete genome sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine microorganism .......................................................... 49 3.1.3 Development of a genetic system for Marinobacter adhaerens HP15 involved in marine aggregate formation by interacting with diatom cells ............ 68

CHAPTER 2 ......................................................................................................................................... 97

3.1.4 Attachment of Marinobacter adhaerens HP15 to Thalassiosira weissflogii is not essential for the induction of transparent exopolymeric particle formation .... 98

CHAPTER 3 ....................................................................................................................................... 123

3.1.5 Combined effects of lowered pH and elevated temperature on diatom-bacteria interactions ............................................................................................. 124

DISCUSSION ..................................................................................................................................... 156

BIBLIOGRAPHY ............................................................................................................................... 164

DECLARATION ................................................................................................................................ 174

I

Acknowledgements

This work was carried out from April 2009 to February 2012 as part of the Helmholtz

Graduate School for Polar and Marine Research. The work presented in this thesis

was carried out in the laboratories of Prof. Dr. Matthias Ullrich, at the Jacobs

University Bremen and that of Dr. habil. Uta Passow at the University of California

Santa Barbara. Prof. Dr. Laurenz Thomsen was an additional committee

supervisor and helped guide the project. This work was performed in close

collaboration with Dr. Astrid Gaerdes and Dr. Eva Sonnenschein from April 2009

until January 2011. They both vastly contributed to the project as a whole.

This work was funded by Jacobs University Bremen, the Helmholtz association and

the Marine Science Institute, University of California Santa Barbara.

I would firstly like to thank Prof. Dr. Matthias Ullrich for the opportunity to learn

and develop in his laboratory, for his unwavering support and for constantly

prioritizing his busy schedule to closely supervise and interact with me. Dr. habil.

Uta Passow is thanked for giving me the unique opportunity to work and learn from

her during a three-month exchange at the Marine Science Institute, University of

California Santa Barbara. It has been a humbling experience to work under her wings

with constant optimism, motivation and good vibes. Prof. Laurenz Thomsen is

thanked for accepting to review my work and for providing to the point criticism,

which often prompted me to take a step back and re-focus on the aims of the project.

For all the caricatures of scientists as creative loners, science is a richly social

endeavor. And for that, I would like to express my heartfelt gratitude to my

colleagues for a joyful laboratory atmosphere and for intellectual sustenance. To all

the former and current members of the laboratory thank you: Dr. Astrid Gaerdes,

Dr. Eva Sonnenschein, Ingrid Torres Monroy, Daniel Pletzer, Gabriela Alfaro,

II

Shaunak Khandekar, Amna Mehmood, Maria Johansson, Antje Stahl, Desalegne

Abebew, Dr. Helge Weingart, Dr. Yannic Ramaye, Dr. Daria Zhurina, Dr. Nehaya

Al-Karablieh and Dr. Abhishek Srivastava. My students, Sumana Sharma, Zheyna

Kircheva, Yesim Yurtdas and Katharina Flenke are also thanked for giving me the

pleasure of supervising them and for their help in the advancement of my project.

Sabine Meier and Peter Tsvetkov are thanked for easing the administration and

technical matters. Likewise, I extend my warmest thanks to the UCSB team for

graciously offering me their help and sharing their equipment whenever I needed

them. I would like to especially thank Caitlin Fairfield , the invaluable technician of

the laboratory, who contributed on a daily basis both with technical help and

experience. Dr. Craig Nelson and Dr. Mary Raven are thanked for their assistance

with the epifluorescence microscope. Dr. Konrad Kulacki, Dr. Steve Sadro and Prof.

Alice Alldredge are thanked for making feel part of Building 408. I would also like to

extend my appreciation to the Bio workshop personnel who promptly repaired the

roller tanks which I inadvertly cracked.

I am grateful to the POLMAR graduate school and thank everyone who has in a way

or the other contributed to the setting up and maintenance of the program. I thank the

POLMAR coordinators: Prof. Jelle Bijma, Dr. Claudia Hanfland, Dr. Claudia

Sprengel, Dörte Burhop and Dr. Tania Michler-Cieluch who have offered me much

more support - moral, educational and financial – than I imagined. I am proud to have

been a part of this prestigious program. I would also like to thank Claudia Daniel and

Andreas Wagner for providing us with North Sea Water whenever we were in need.

In the world beyond my experimental work, I have been extremely lucky for the solid

foundation and support of my parents and sisters, even during the times when it was

difficult for them that I left home to pursue my aspirations. Thank you for always

encouraging me and being a phone call away whenever I needed to vent. My dear

friends, Petra Pop Ristova, Tim Kalvelage, Abdul Rahiman Sheik, Renzo Kottmann,

Marianne Jacob, Pier-Luigi Buttigieg and Pelin Yilmaz are thanked for making life in

Bremen abound with happy memories. Finally, I thank Maté for being my pillar of

love, support and fun and without whom none of this would have been possible.

Shalin Seebah

Bremen, March 2012

III

Abstract

Transparent exopolymeric particles (TEP) and marine snow aggregates are vital

components of the oceanic carbon cycle, leading to a substantial fraction of organic

carbon sinking to depth or being provided for further recycling. Diatom-associated

bacteria have been recently shown to directly impact TEP production and aggregate

formation. However, very little is known about the molecular components that govern

this interaction or the dynamics of TEP production and marine aggregate formation

under changing environmental conditions. By combining molecular techniques and

ecological experiments, we use an interdisciplinary approach to unveil hitherto

unknown processes of diatom-bacteria interactions. As part of a collaborative and

concerted effort, we initially established a genetically accessible bilateral model

system consisting of the diatom Thalassiosira weissflogii and the marine

gammaproteobacterium Marinobacter adhaerens HP15. Herein, we taxonomically

established M. adhaerens HP15 as a novel member of the Marinobacter genus,

revealed its genome sequence and established a genetic system to allow for the

precise manipulation of this bacterium at the molecular level. In a second part, we

used the established genetic toolbox to investigate the role of M. adhaerens HP15’s

motility during its interaction with the diatom. By generating M. adhaerens HP15

flagellum- and MSHA type IV pilus-deficient mutants, we demonstrate that a fully-

functional flagellum is a pre-requisite for the bacterial attachment to both abiotic and

diatom surfaces. We further show that the MSHA type-IV pilus is important for

attachment, albeit to a lesser extent. Although both cellular appendages were shown

to be crucial for attachment to diatom surfaces, this type of attachment was

demonstrated to not be essential for inducing the formation of diatom-borne

transparent exopolymeric particles (TEP). In the final part of this work, how TEP

production dynamics and aggregate formation might be impacted in putative future

oceanic scenarios was investigated. The results of our study suggest that the combined

effect of ocean acidification and increased temperature might lead to a significant

reduction in aggregate formation and sinking velocities of marine aggregates. We

suggest that a combination of ocean acidification and global warming may severely

impact the vertical transport of particulate organic matter in a future ocean.

IV

List of abbreviations

Amp Ampicillin

CLSM Confocal Laser Scanning Microscopy

Cm Chloramphenicol

CO2 Carbon dioxide

DAPI 4’, 6’-diamidino-2-phenylindole

DIC Dissolved Inorganic Carbon

DNA Deoxyribonucleic acid

DOC Dissolved organic carbon

EDTA Ethylenediamine Tetra-acetic acid

EPS Exopolymeric substances

EtBr Ethidium Bromide

GFP Green fluorescent protein

Gm Gentamycin

Km Kanamycin

LB Luria-Bertani

MB Marine Broth

Neo Neomycin

pCO2 Partial pressure of carbon dioxide

PCR Polymerase Chain Reaction

PgC Petagrams of Carbon

POC Particulate Organic Carbon

ppm Parts per million

SOC Super Optimal Broth with Catabolite repression medium

TA Total Alkalinity

TAE Tris-acetate-EDTA

TEM Transmission Electron Microscopy

TEP Transparent Exopolymeric Particles

1

Introduction

1.1 The global carbon cycle

1.1.1 Pre-industrial global carbon cycle

The global carbon cycle describes the exchanges of carbon between and within its

four major reservoirs: the atmosphere, oceans, terrestrial ecosystems and reserves of

fossil fuels. A combination of models and paleo-data1 reveals that carbon fluxes

during the pre-industrial global carbon cycle were in steady state [Figure 1], with a

remarkably stable atmospheric carbon dioxide (CO2) concentration of 280 ± 20 parts

per million (ppm) or approximately 600 ± 43 petagrams of carbon (PgC) [Joos and

Prentice 2004].

Figure 1 Schematic presentation of the pre-inudstrial global carbon cycle. Arrows indicate the carbon fluxes in PgC/year and the values in boxes indicate the reservoir sizes in PgC. Carbon fluxes between the different reservoirs were in steady-state [Goudie and Cuff 2002].

Carbon storage in the terrestrial ecosystem was distributed between vegetation (610

PgC), detritus and soil (1,560 PgC). The yearly terrestrial-atmospheric exchange was

in balance with 100 PgC taken up by plants and the same amount returned to the

1 measurements on marine and lake sediments, tree rings and historical documents

2

atmosphere by respiration and decomposition processes [Goudie and Cuff 2002]. The

pre-industrial ocean reservoir stored the largest amount of carbon with approximately

38,000 PgC in the intermediate and deep ocean, 1,000 PgC in the surface ocean, 3

PgC in the marine biota and 150 PgC in the sediments. Although the estimates of the

atmospheric-sea carbon exchanges vary between 70 PgC/year [Sabine et al. 2004] and

90 PgC/year [Goudie and Cuff 2002], it is generally agreed that the net CO2 flux was

in balance. Not depicted in the above figure are fossil fuel reserves, which also

significantly contributed to the pre-industrial carbon sink. The amount of carbon

stored in reserves of coal, oil and natural gas has been estimated to range between

5,000 and 10,000 PgC [Houghton 2007].

1.1.2 Present-day global carbon cycle

The redistribution of anthropogenic CO2 emissions among the atmosphere, land and

oceans dominates the present-day global carbon cycle [Figure 2]. The increase of

CO2 emissions from the burning of fossil fuels, cement making and land-use has led

to a noticeable imbalance in the carbon fluxes and to a substantial increase of carbon

stored in all major carbon reservoirs other than fossil fuel reserves. Although

estimates on the redistribution of CO2 emissions between the three major carbon

reservoirs are discrepant, the most recently reported estimates are as follows: the net

release of CO2 emissions in 2009 resulting from fossil fuel combustion and cement

making is reported to be 8.4 ± 0.5 PgC/year while that for land use change is 1.1 ± 0.7

PgC/year [Friedlingstein et al. 2010]. The net CO2 uptake flux in the carbon sinks for

the period between 1989 to 2007 have been reported to be 3.60 ± 0.28, 1.95 ± 0.25

and 1.15 ± 0.56 PgC/year for the atmosphere, oceans and land respectively

[Sarmiento et al. 2010]. These estimates portray an imbalance of approximately 3

PgC/year in the present-day global cycle. Of the various CO2 sinks, the atmosphere is

the most tractable for monitoring, and the most recent estimates of the global

concentration of CO2 in the atmosphere have been averaged to 387.2 ppm, equating to

approximately 830 PgC [Friedlingstein et al. 2010]. The next most tractable reservoir

of carbon are the oceans, for which most recent estimates indicate an additional 140 ±

25 Pg of anthropogenic carbon in present-day oceans [Khatiwala et al. 2009]. The

terrestrial ecosystem may be a significant sink for anthropogenic carbon but its

detection in this system appears to be a challenging task and cannot be accurately

estimated [Carlson et al. 2001]. Not illustrated in Figure 2 are processes such as sea

3

floor spreading and diagenesis, which further contribute to the overall carbon budget.

The amounts of carbon exchanged annually through these processes are however

small and are generally not considered [Sunquist and Visser 2004]. It is evident that

the magnitude of CO2 emissions from the burning of fossil fuels, cement making and

land-use has resulted in noticeable changes in carbon fluxes and carbon sinks. For

how long and at what rates the carbon reservoirs will continue to take up CO2 as

concentrations of atmospheric CO2 continue to rise is only partially known and is the

subject of considerable scientific investigations. The focus of this work lies in

understanding carbon cycle processes in the oceans, the largest of the carbon sinks.

Figure 2 Schematic presentation of the present-day global carbon cycle. Carbon fluxes are shown within and between the major carbon sources and reservoirs. The black arrows indicate the natural exchange of CO2 between the various reservoirs and the red arrows indicate the anthropogenic fluxes. [Adapted from the Global Carbon Project 2006. Most recent estimates in orange boxes, from Khatiwala et al. 2009 and Friedlingstein et al. 2010].

4

1.2 Oceanic carbon cycle

Four major interconnected processes control the uptake, distribution and storage of

carbon in the ocean: (i) CO2 exchange at the air-sea interface; (ii) seawater carbonate

chemistry; (iii) mixing of surface and deep waters; and (iv) ocean biology. The

interplay between these four processes has since long been and continues to be

responsible for the majority of carbon being carried by the ocean. The present-day

oceanic carbon flux is not in steady state. Instead, the ocean is taking up on average

1.95 ± 0.25 PgC/year more than it releases at the air-sea interface [Friedlingstein et al.

2010]. CO2 flux (F) is primarily controlled by the difference in CO2 partial pressure

between the ocean and the atmosphere and is described as:

F = ∆pCO2 Kw

where ∆pCO2 is the difference in CO2 partial pressure between the two reservoirs and

Kw is the piston velocity. Piston velocity describes the rate of gas exchange across the

air-sea interface and depends on many factors, of which CO2 solubility, turbulence at

the ocean surface and chemical reactivity of CO2 are among the most important [Liss

and Slater 1974; Carlson et al. 2001]. As atmospheric CO2 dissolves in seawater, it

reacts to form carbonic acid (H2CO3) which then dissociates within milliseconds to

form bicarbonate (HCO3-) and carbonate (CO3

2-) ions. This conversion effectively

reduces the pCO2 in seawater thereby allowing more CO2 uptake by the ocean.

Collectively, these carbonate species make up the dissolved inorganic carbon (DIC)

pool of the ocean, which is distributed in the amounts of 1,020 and 38,000 PgC in the

surface and deep waters respectively [Carlson et al. 2001]. The draw-down of DIC

from the surface to the deep ocean is largely the result of what has been described as

the solubility pump [Volk and Hoffert 1985]. The solubility pump is mainly driven by

ocean circulation patterns and mixing of surface and deep waters [Figure 3]. Wind-

driven circulation transports surface waters from low (warm) to high (cold) latitudes.

Cold waters enhance CO2 solubility and consequently allow more atmospheric CO2 to

be taken up at the surface layers. At high latitudes, dense water formation2 leads to the

rapid sinking of water masses until they reach depths of 2,000-4,000m where they

reside for over 1,000 years due to the slow mixing of surface and deep ocean waters.

The exchange of surface waters with the deep ocean is limited because of the strong

2 cold water is denser than warm and sinks below the less dense layer

5

density stratification of the water column. Thermohaline circulation eventually pushes

the deep waters up to the surface in the upwelling regions. Thermohaline as compared

to wind-driven circulation is a slow process and it takes over 1,000 years for the DIC-

rich deep waters to reach the surface again. These two processes of the solubility

pump both assist in the transfer of carbon to the deep ocean and maintain a steep

vertical gradient of carbon in the ocean thereby making the ocean one of the largest

carbon sinks.

Figure 3 Schematic presentation of the solubility pump of the ocean. The black arrows indicate the movement of carbon and the white arrows indicate the movement of water between the low and high latitudes. [Carlson et al. 2001]

It would appear intuitive from the above-described physical and chemical processes

that an increase in atmospheric CO2 would lead to an increase in pCO2 difference at

the air-sea interface thereby leading to enhanced CO2 uptake and draw-down into the

ocean. The interplay between oceanic processes are however much more complex.

Rising atmospheric CO2 concentrations are coupled to increased radiative forcing3

which result in higher sea-surface temperatures [Houghton et al. 1995]. Since CO2

solubility and the processes of the solubility pump are dependent on temperature it is

inevitable that the efficiency of the solubility pump is impacted. Climate models

suggest a weakening of the thermohaline circulation at future projected atmospheric

3 the rate of energy change per unit area as measured at the top of the atmosphere

6

CO2 and temperature levels [Joos et al. 1999; Montegro et al. 2007]. The dissociation

of dissolved CO2 into DIC is another process likely to be impacted by the increase in

atmospheric CO2 concentrations. In fact, a doubling in atmospheric CO2 is not

predicted to cause a doubling in DIC but may result in only approximately 10%

increase of DIC in the ocean [Zeebe and Wof-Gladrow 2001]. This is due to the

intricate nature of the underlying seawater carbonate chemistry. The dissociation of

dissolved CO2 into the different carbon species has been equated as:

CO2 (aq) + H20 ↔ H2CO3 ↔ HCO3- + H+ ↔ CO3

2- + 2H+

where the different carbonate species exist in defined proportions maintaining the pH

of seawater within a narrow range [Figure 4]. The carbonate species exist in the

approximate ratio of 1 : 90 : 10 [CO2] : [HCO3-] : [CO3

2-] at the average seawater pH

of 8.2 ± 0.3 [Tyrrell 2007]. [CO2] encompasses both CO2 (aq) and H2CO3.

Figure 4 The seawater carbonate system represented in a Bjerrum plot. The relative proportions of the carbonate ions control the pH of the ocean [Zeebe and Wolf-Gladrow 2001].

Compared to the pre-industrial ocean, the pH of the current ocean has already

decreased by 0.1 units which in fact corresponds to a 30% decrease [Caldeira and

Wickett 2003]. The capacity of the carbonate system to continue to buffer the changes

due to increasing CO2 concentrations is however finite and together with the potential

perturbations in the solubility pump could lead to a severe impact on the overall

functioning of the oceanic carbon sink. It is important however to realize that the

7

ocean is not an abiotic structure and understanding the interplay of oceanic biological

processes with the above-described physical and chemical processes is fundamental.

8

1.3 Biological processes of the ocean

1.3.1 The biological pump

Carbon stored in the form of marine biota is approximately 3 PgC/year [Houghton

2007]. Although the standing stock4 is small, the activity associated with the biota is

extremely important for the cycling of carbon between the atmosphere and the ocean.

Climate models suggested that pre-industrial atmospheric CO2 ranged between 450

and 530 ppm instead of 280 ppm without a functioning biological pump [Sarmiento

and Orr 1991]. The biological pump describes the biologically mediated processes

whereby DIC in the upper ocean is transformed and transported to the ocean interior

as dissolved organic matter or sinking biogenic particles [Figure 5]. Phytoplankton

use light energy in the euphotic zone to convert DIC into organic compounds by the

process of photosynthesis. Although phytoplankton encompass less than 1% of the

total photosynthetic biomass in the biosphere, they impressively account for roughly

half of the total annual primary production [Field et. al 1998].

Figure 5 Schematic presentation of the biological pump depicting oceanic biological processes responsible for the transformation of DIC into organic carbon and its re-distribution in the ocean [OCTET workshop report 2000]

4 the weight or biomass of a stock of organisms

9

The transformation of DIC into organic matter effectively leads to a reduction of

pCO2 in the upper ocean, thereby promoting more atmospheric CO2 uptake

[Falkowski and Raven 2007]. In addition to converting DIC into organic matter,

certain phytoplankton such as the coccolithophores combine calcium with carbonate

ions in the upper ocean to form hard calcium carbonate (CaCO3) body parts. CaCO3 is

dense and sinks from surface water, thereby also promoting the uptake of additional

atmospheric CO2 [Carlson et al. 2001]. The sinking of carbon in the form of organic

matter is more efficient than in CaCO3. The ratio of carbon sinking as CaCO3 to

organic carbon varies from 1:4 up to 1:17 [Li et al. 1969; Sarmiento et al. 2002].

1.3.2 Dissolved organic carbon

Dissolved organic carbon (DOC) is the largest reservoir of organic carbon in the

ocean and amounts to approximately 662 PgC [Hansell and Carlson 2001]. Although

the mechanisms leading to DOC production have not been fully elucidated, it appears

that it is mainly produced as a by-product of primary production [Kepkay et al. 1993;

Biddanda and Brenner 1997]. Newly formed DOC is labile and when channeled into

the microbial loop5, vast heterotrophic microbial populations rapidly utilize it as

substrate [Azam et al. 1983]. The microbial loop is dynamic, and active processes

such as viral cell lysis, sloppy feeding by zooplankton and dissolution of faecal pellets

continuously release DOC which then re-enters the oceanic organic carbon pool

[Lampert 1978; Middelboe and Lyck 2002]. The remineralized DOC pool is not

entirely labile but can exist as semi-labile and recalcitrant DOC. These two types of

transformed DOC can persist for months to years in the ocean and account for a

significant portion of DOC that is exported from the euphotic zone to the ocean

depths [Jiao et al. 2010].

1.3.3 Particulate organic carbon

Operationally delineated from DOC by virtue of size and ability to passively sink,

particulate organic carbon (POC) forms the second largest oceanic organic carbon

pool and amounts for up to 30 PgC [Verdugo et al. 2004; Hansell and Carlson 2001].

A global compilation of POC fluxes shows that oceanic POC concentrations are

highest at the surface and exponentially decline with depth [Figure 6]. This suggests

5 a pathway in the aquatic food web whereby DOC is taken up by bacteria and archaea, which are in turn eaten by protists and so on up the food chain

10

that the efficiency of the biological pump is low at exporting POC into the depth of

the ocean. The ocean is however not homogenous and there is considerable regional

and temporal variability in the fraction of POC that is eventually exported to depth

[De La Rocha and Passow 2007]. Primary production is tightly coupled to POC

export and during periods of bloom formation. Between 30 and 100% of the net

primary production can eventually sink out of the euphotic zone as POC [Buesseler

1998]. The sinking flux of POC below the euphotic zone is dependent on

phytoplankton community composition and on the supply of minerals. The presence

of large phytoplankton cells (≥ 5 µm) for example has been shown to be positively

correlated with an enhanced POC export from the euphotic zone to depth [Smayda

1971; Buesseler 1998; Pommier et al. 2008]. In addition, the higher concentrations of

suspended minerals at the continental margins as compared to the open ocean have

been suggested as a probable reason for the higher POC export fluxes observed at the

continental margin regions [De La Rocha and Passow 2007].

Figure 6 Mean annual global POC flux at different depths in the ocean. Figure modified from Lutz et

al. (2002) by C. De La Rocha [marum.de/en/Page9564.html]

In situ observations reveal that the majority of POC sinks out of the euphotic zone in

the form of large aggregated particles collectively termed as marine snow [Fowler and

Knauer 1986]. The fact that large aggregates enhance POC export can be correlated to

11

the enhanced sinking rates of the large particles. For example, the sinking rates of

solitary phytoplankton cells have been determined to be less than 2 m d-1 [Fowler and

Knauer 1986]. Assuming an average oceanic depth of 4000 m and no degradation of

the particles during their vertical flux, these cells would reach the bottom of the ocean

after more than 5 years. Realistically though, within this time most of the organic

carbon would have been degraded before reaching the seabed. With settling speeds

ranging between 6 and 368 m d-1, the sinking of marine snow significantly reduces the

transit time of organic carbon from surface waters thereby leading to more POC to be

exported from the euphotic zone [Turner 2002]. The formation and eventual sinking

of marine snow is a complex process and depends both on the formation and

degradation rates of the marine aggregates [Kiorboe 2001]. Understanding the

processes of marine snow formation and their eventual vertical flux is consequently of

utmost importance to further our knowledge of vertical fluxes of organic carbon in the

ocean.

12

1.4 Marine snow

Marine snow is term collectively used to describe macroscopic marine aggregates

which are greater than 500 µm in length and are variably composed of planktonic

cells, detritus material, faecal pellets as well as inorganic materials such as clay and

sediment particles [Alldredge and Silver 1988].

1.4.1 Marine snow formation

Marine snow can either be produced de novo by marine plankton or by the physical

coagulation of smaller particles. The latter process is often biologically enhanced

[Figure 7]. Additionally, members of the zooplankton community such as pteropods,

larvaceans and salps secrete mucopolysaccharide feeding webs and houses, which

together with their faecal pellets contribute to the de novo production of marine snow

particles [Alldredge and Silver 1988; Hansen et al. 1996]. The gelatinous houses of

appendicularians are particularly significant in the formation of marine snow due to

the rapid turnover between the formation and abandonment of their mucus feeding

structures [Lombard and Kiorboe 2010].

Figure 7 Schematic depiction of the major processes leading to marine snow formation. Marine plankton produce marine snow aggregates de novo as mucus webs, houses, sheaths, and flocculent fecal pellets. Small particles including phytoplankton, fecal pellets, microaggregates, bacteria and inorganic particles collide together via physical processes and adhere together by biological processes [Alldredge and Silver 1988].

13

Many species of phytoplankton especially of the diatom genus Thalassiosira and the

prymnesiophyte genus Phaeocystis produce fibrils and mucus sheaths around their

colonies and contribute to the de novo formation of marine snow [Fryxell et al. 1984;

Alldredge and Silver 1988]. The collision and coagulation of phytoplanktonic cells,

faecal pellets, microaggregates, microorganisms and inorganic particles further

contribute to the formation of marine snow. The collisions of the above-mentioned

particles are facilitated by physical processes such as differential settlement mediated

by differences in the sinking velocities of the particles, fluid shear, which is mediated

by differences in fluid movements and brownian motion, which describes the

collision of particles due to random walk [Kiorboe 2001]. Upon collision, the

subsequent coagulation into larger aggregates depends on a multitude of factors that

are often biologically enhanced. The cell surfaces of many species of phytoplankton

are sticky by nature and immediately form aggregates upon collision [Kiorboe et al.

1990]. The sticking efficiency of these species can vary depending on their

physiological state. Under nutrient-rich conditions, for example, the cell surface

stickiness of the diatom Thalassiosira pseudonana is very low but then increases by

more than two orders of magnitude as cell growth ceases and nutrient become limiting

[Kiorboe et al. 1990]. Therefore it could be speculated that in regions where these

diatoms occur in abundance, enhanced diatom flocculation and sinking would be

observed, especially at the end of diatom blooms. The stickiness of other

phytoplankton species on the other hand can be less variable. Skeletonema costatum

cells for example are sticky under nutrient replete conditions but can reach their

highest sticking efficiency during the transition from exponential to stationary phase

of growth [Kiorboe et al. 1990].

1.4.2 Marine gel particles

The successful coagulation of particles to form larger marine aggregates is also

enhanced by the presence and abundance of extracellular polymer gel particles

[Alldredge and Silver 1988; Verdugo et al. 2004]. These gel particles are mostly

exudates from living or lysed cells and have been defined as three-dimensional

networks of polymers imbedded in seawater. These particles range from single

macromolecules to complexed colloidal networks and large assembled polymer

networks several hundreds of microns or larger in size [Alldredge and Silver 1988;

Verdugo et al. 2004]. Extracellular polymer gel particles are significant in the

14

formation of larger aggregates and their sedimentation. Due to their gelatinous and

sticky nature, these gels are both able to scavenge further particles as they sink and to

self-coagulate. This provides an abiotic mechanism to increase sizes and sinking rates

[Verdugo et al. 2004]. Marine gels can form within minutes to hours from the self-

assembly of free DOC polymers [Figure 8]. The self-assembly initially forms fibrils

and thereafter nanogels of 100-150 nm and microscopic gels reaching 4-5 µm in size

[Chin et al. 1998; Verdugo 2012].

Figure 8 Schematic presentation of size distributions and abiotic processes leading to the aggregation of marine gel particles in the ocean [Verdugo et al. 2004].

Classified as POC by virtue of their size, macrogels such as transparent exopolymeric

particles (TEP) are predominantly formed by the aggregation of nano- and microgels

[Verdugo et al. 2004]. TEP have been shown to be critical in marine snow formation

and aggregation of diatom blooms as they provide a stable underlying matrix for

aggregate formation [Alldredge et al. 1993; Passow and Alldredge 1994].

15

1.5 Transparent exopolymeric particles

TEP are defined as macrogels retained on 0.4 µm polycarbonate filters and stainable

with the cationic dye alcian blue [Figure 9]. These particles are both ubiquitous and

abundant in the ocean and have been found in all aggregates investigated to date

[Alldredge et al. 1993; Passow and Alldredge 1994; Passow 2002]. Although TEP

production is predominantly associated with phytoplankton, organisms such as

bacteria, macroalgae and more recently the jellyfish Aurelia aurita have also been

shown to be TEP-producers [Stoderegger and Herndl 1999; Passow 2000; Ramaiah et

al. 2001; Dicker 2011]. TEP composition varies depending on the species producing

the primary DOC polymers. Therefore, attributing a precise chemical composition to

TEP in general is challenging. However, it has been shown that TEP primarily

comprise acidic polysaccharides, dominated by the simple sugars fucose and

rhamnose, and their acidity is derived from the presence of sulfate half ester groups

[Mopper et al. 1995; Zhou et al. 1998].

Figure 9

Microscopic view of alcian-blue stained TEP produced by the diatom Thalassiosira weissflogii.

[Gaerdes 2010]. Scale bar = 100 µm

The abiotic self-assembly of DOC polymers released by phytoplankton and other

organisms is the major pathway of TEP production [Passow 2000; Passow 2002a].

The release of these polymers in turn depends on the species releasing them as well as

their individual physiological state and the prevailing growth conditions. For

example, the production of TEP by the coccolithophore Emiliana huxleyi is

significantly lower than that produced by the prymnesiophyte Phaeocystis antarctica

16

[Passow 2002; Hong et al. 1997]. The physiological state of the organism can

influence TEP production; exponentially growing Chaetoceros sp. produce

significantly less TEP than senescent cells [Schuster and Herndl 1995]. The induction

of diatom-borne TEP production as a direct result of bacterial activity has recently

gained attention. In their study, Gaerdes et al. 2011 demonstrate that certain specific

bacterial strains enhance TEP production and aggregate formation of an axenic

culture of T. weissflogii [Figure 10].

Figure 10

Total aggregated volume of the diatom Thalassiosira weissflogii under the influence of different bacterial strains [Gaerdes et al. 2011].

The direct impact of bacteria on phytoplanktonic TEP production offers a new and

potentially important pathway for TEP production. Understanding the micro-scale

interactions between phytoplankton and those bacteria that enhance TEP production

could therefore provide important insights into TEP production and the dynamics of

marine snow formation.

17

1.6 Microscale interactions The heterogeneous spatial distribution of organic matter in the ocean creates

microscale gradients to which microbial interactions are restricted. As a pelagic

analogy to the rhizosphere6 of terrestrial plant-associated ecosystems, the

phycosphere describes the region surrounding an algal cell that favors the growth of

certain microbial taxa [Bell and Mitchell 1972; Cole 1982]. In fact, several studies

have documented species-specific bacterial interactions with phytoplankton. The

microbial diversity found in the phycosphere of the dinoflagellate Alexandrium

fundyense for example is distinctly different from that of the bacterial community in

the surrounding seawater. The majority of bacterial taxa recovered in association with

the dinoflagellate belonged to the Gammaproteobacteria class of bacteria [Hasegawa

et al. 2007]. Other phylogenetic groups known to be associated with dinoflagellates

included members of the families Alteromonadaceae, Pseudoalteromonadaceae,

Rhodobacteraceae and Flavobacteraceae [Hasegawa et al. 2007]. Diatom-associated

bacteria on the other hand have been mainly reported to belong to the Flavobacteria–

Sphingobacteria group of the Bacteroidetes phylum, whereas free-living bacteria

identified in the same study comprised mainly of members from the Roseobacter

group of Alphaproteobacteria [Grossart et al. 2005]. Predominantly studied in vitro,

four modes of interactions between bacteria and phytoplanktonic cells have been

described. Mutualism describes the interaction where both the bacteria and

phytoplankton benefit from each other. Marinobacter spp for example has been

shown to promote the algal assimilation of iron by facilitating photochemical redox

cycling and the algal cells in turn release organic molecules that are used by the

bacteria for growth [Amin et al. 2009]. Parasitism describes the interaction where the

presence of certain bacteria has detrimental effects on phytoplankton. The presence of

the algicidal bacterium Kordia algicida for example significantly inhibits the growth

of certain species of diatoms [Paul and Pohnert 2011]. Commensalism describes the

interaction whereby bacteria benefit from phytoplankton cells without having any

detrimental or beneficial effects on the algal cell. However, this type of interaction

tends to be rather transient and often reverts back to either mutualism or parasitism.

Loose associations between bacteria and phytoplankton have also been recognized

6 region of soil that is directly influenced by root secretions and associated soil microorganisms

18

and this latter type of interaction highly depends on the prevailing environmental

conditions [Rhee 1972].

1.6.1 Bacterial chemotaxis and motility

In the context of organic matter transformations, bacteria have evolved various

adaptive strategies among which chemotaxis, motility and production of hydrolytic

enzymes are thought to be the most significant [Figure 11]. Marine bacteria cluster

around living and lysed marine plankton to take advantage of the organic exudates

released by these cells [Azam and Ammerman 1984; Blackburn et al. 1998]. This

active clustering requires that the bacterial cells sense gradients of the chemicals

released by plankton and respond to them by movement. Chemotaxis describes the

process by which bacteria sense the concentration changes of chemical stimuli within

their immediate microenvironment. Chemotaxis further comprises bacterial motility,

which describes their active movement towards or away from attractants and

repellents, respectively and is common among marine bacteria. Chemical attractants

in the ocean include dissolved low-molecular-weight organic matter, photosynthetic

products, zooplankton excretion products, marine plankton lysates and organic matter

leaking from particles [Bell and Mitchell 1972; Blackburn et al. 1998; Malmcrona-

Friberg et al. 1990, Fenchel 2002; Barbara and Mitchell 2003a; Seymour et al. 2010].

As a consequence of chemotaxis and motility, heterotrophic bacteria are often found

in close spatial associations with phytoplanktonic cells.

Figure 11

Schematic depiction of the adaptive strategies of bacteria coupling to organic matter. Bacterial motility and chemotaxis as well as hydrolytic enzymes play important roles in the coupling of bacteria to organic matter [Azam and Malfatti 2007].

Although bacterial motility is a common phenotype in the ocean, the fraction of

bacteria that are motile vary anywhere between 5 and 70% depending on the study

19

and used analysis method [Grossart et al. 2001]. It was suggested that most

microorganisms are motile only in part of their life cycle [Fenchel 2002]. One

probable reason for this could be that since the expression of chemotaxis and motility

genes are energetically costly, bacteria possessing these adaptations preferentially use

them under certain defined environmental conditions. In fact, motility in the ocean

has been described as being highly intermittent, with bacterial swimming speeds

reaching up to 407 µm s-1 during bursts of nutrients [Mitchell et al. 1995]. The most

predominant strategy of bacterial motility is movement mediated by their flagella. By

the usage of their flagella, motile bacteria can swim or swarm, depending on the

viscosity of the medium they encounter [Jarell 2009]. Twitching motility is another

type of bacterial motility that is mediated by the Type IV pilus. This mode of motility

is especially relevant when bacteria move on solid surfaces [Jarell 2009].

Flagellum-mediated motility

The significance of flagellum-mediated motility and attachment of bacteria to both

abiotic and biotic surfaces has been evidenced in various studies. In the formation of

biofilms for example, the initial attachment of Pseudomonas aeruginosa to both

abiotic and biotic surfaces has been shown to be mediated by the bacterial flagellum

[O' Toole and Kolter 1998]. The symbiotic interaction between Vibrio fischeri and the

squid Euprymna scolopes also depends on the flagellum-mediated attachment of the

bacterium to its host and bacteria deficient in flagellum are unable to cause

bioluminescence of the squid organ, an important survival strategy for this bacterial

species [Nvholm and McFall-Ngai 2004]. The bacterial flagellum is a complex multi-

component structure that spans both cell membranes to the outside of the cell. The

flagellum self-assembles to form a helical propeller that enables prokaryotic cells to

either swim or swarm in their environments. The flagellum comprises three major

subunits: (a) the basal body which is embedded in the inner cell membrane and

contains the motor, the switch complex and the rod, (b) the hook, which is a short,

highly curved structure made by the polymerization of about 100 copies of the FlgE

protein and serves as the junction between the basal body and the filament of the

flagellum, and, (c) the filament, which is made by the polymerization of tens of

thousands of copies of the flagellin protein FliC and which acts as a propeller when

rotated at its base [Figure 12]. The formation and assembly of the proteins involved

20

in creating the flagellum structure is orchestrated by the interplay between more than

50 gene products [Jarrell 2009].

Figure 12

Schematic depiction of the structure of the bacterial flagellum [Adapted from Liu and Ochman 2007]

Type IV pilus-mediated motility

Although different Type IV pili in bacteria have been shown to have diverse functions

that provide bacteria with selective advantages to perform their functions, the

prevalence of the MSHA Type IV pilus in bacteria from marine environments

indicate an advantageous role of this type of cell appendage for microbes in the ocean.

The significance of Type IV-mediated motility and attachment of bacteria to both

abiotic and biotic surfaces has been evidenced in several diverse studies. The

attachment of the marine bacterium Pseudoalteromonas tunicata to both abiotic

substrata and cellulose-containing surfaces of the green alga Ulva australis has been

shown to be mediated by the MSHA pilus [Dalisay et al. 2006]. Analysis of the

genome of V. parahaemolyticus, the causative agent of seafood-associated

gastroenteritis, revealed that this bacterium contains two sets of Type IV pili: a chitin-

regulated pilus (ChiRP) and the MSHA pilus [Shime-Hattori et al. 2006]. Although

both pili have been reported to be crucial in biofilm formation, each pilus has a

21

defined function during the formation of the biofilm. While the initial attachment of

the bacterium to surfaces is mediated by the MSHA pilus, ChiRP plays a role in

bacterial agglutination during the later steps of biofilm formation [Shime-Hattori et al.

2006]. The MSHA pili are produced by a wide variety of V. cholerae strains [Albert

et al. 1997] and similarly to the biogenesis of the Type IV pilus in P. aeruginosa,

which is well characterized. It appears that the MSHA biogenesis and structural genes

are organized as an operon.

Figure 13

Schematic representation of the predicted MSHA gene locus in P. tunicata (top) and V. cholera El Tor (bottom). The entire locus is 17,525 bp in length and consists of 17 continuous ORFs. The scale bar represents approximately 2 kb. Black shading >45% identity; dark grey 35-45% identity, pale grey 25-35%, white <25% identity [Figure and legend from Dalisay et al. 2006]

Although there is ample evidence that bacterial motility promotes bacterial-eukaryotic

interactions, it remains to be investigated whether bacterial motility and the

attachment to phytoplanktonic cells, such as diatoms, induce the production of TEP,

thereby impacting marine snow formation and the vertical flux of carbon. In this

context, establishing a bilateral model system to mechanistically investigate the

interactions at a molecular level is therefore imperative.

22

1.7 Bilateral model system Diatom aggregation significantly contributes to the formation of marine snow and is

especially relevant during diatom blooms. TEP have been shown to be critical in

marine snow formation and aggregation of diatom blooms as they provide a stable

underlying matrix for aggregate formation [Alldredge et al. 1993; Passow and

Alldredge 1994]. Although the main pathway for TEP production is the abiotic

coagulation of smaller gel particles, the presence of certain specific bacteria has been

shown to be important for the induction of TEP production in diatoms (Gaerdes et al.

2011). This interaction represents a new and potentially significant pathway for TEP

production. In an attempt to investigate the underlying molecular mechanisms of

diatom-bacteria interactions with relevance to bacterial attachment, TEP production

and marine snow formation, an in vitro bilateral model system consisting of the

diatom Thalassiosira weissflogii and the marine gammaproteobacterium

Marinobacter adhaerens sp. nov. HP15 was previously established [Figure 14].

.

Figure 14

Scannning electron micrograph showing the close interaction between the diatom T. weissflogii and the marine bacterium M. adhaerens [Gaerdes et al. 2011].

1.7.1 The diatom Thalassiosira weissflogii Taxonomically affiliated to the phylum Bacillariophyta, the class

Coscinodiscophycea, order Thalassiosirales, family Thalassiosiraceae and genus

23

Thalassiosira, the ubiquitously distributed diatom T. weissflogii belongs to a diverse

and ecologically successful group of microalgae found in most aquatic environments

[Fryxell and Hasle 1977; Fryxell 1981; Hallegraeff 1992]. The Thalassiosira genus

encompasses approximately 180 marine and 12 freshwater species [Round et al. 1990;

Silva and Hasle 1994]. Due to their predominance in diverse regions of the ocean they

are reasonably considered as a representative model for marine diatoms.

Characteristic of diatoms, T.weissflogii possesses an ornamented siliceous cell wall

with a frustule composed of two overlapping thecae: an epitheca and a hypotheca

[Figure 15]. Each theca consists of a silica valve, one or more girdle bands that

possess a distinctive micro-architecture of pores, and slits displayed in a highly

organized arrangement [Fryxell and Hasle 1977]. These structures facilitate cell

growth and provide avenues for nutrient and gas exchange as well as for

exopolysaccharide secretion [Molino and Wetherbee 2008].

Figure 15

Micrograph of the marine diatom T. weissflogii showing the typical structure of diatoms with the silica cell wall and frustules. [Courtesy of F. Hinz, Alfred-Wegener Institute, Bremerhaven, Germany].

T. weissflogii typically occur as solitary cells ranging between 12 - 22 µm in length

and 10 - 12 µm in width [Provasoli-Guillard National Center for Marine Algae and

Microbiota]. With a doubling time of approximately 1.1 days and ease of cultivation

and maintenance under laboratory conditions, T. weissflogii has become an attractive

diatom model to work with. Diverse studies including diatom physiology [Armbrust

24

et al. 2004], copepod grazing experiments [Koski et al. 2008; Ceballos and Ianora

2003], gene expression analysis [Armsbrust 1999] and toxicity studies [Casotti et al.

2005; Windust et al. 1997] have made use of this model. T. pseudonana is the only

species of Thalassiosira that has its genome sequence determined thus far, which

allows for more in-depth molecular investigations of the diatom [Armbrust et al.

2004].

1.7.2 The marine bacterium Marinobacter adhaerens sp. nov. HP15 M. adhaerens sp. nov. HP15 is a gram-negative, heterotrophic marine bacterium,

taxonomically affiliated to the phylum Proteobacteria, the class of

Gammaproteobacteria, order Alteromonadales, family Alteromonadaceae and the

genus Marinobacter. The marine bacterium M. adhaerens sp. nov. HP15 was isolated

from a pool of particle-associated bacteria from the surface waters of the German

Wadden Sea [Grossart et al. 2004]. The Marinobacter genus encompasses

approximately 30 species and has attracted increasing interest because together with

the genera Alcanivorax, Thallassolituus, Cycloclasticus and Oleispira, they form the

hydrocarbonoclastic group of bacteria recognized to play a significant role in the

biological removal of petroleum hydrocarbons from polluted marine waters [Gauthier

et al. in 1992; Yakimov et al. 2007]. Marinobacter are ubiquitously distributed and

have been isolated from a variety of marine environments ranging from oil-

contaminated environments to surface waters and polar regions [Huu et al. 1999;

Yoon et al. 2003; Grossart et al. 2004; Green et al. 2006; Montes et al. 2008].

Marinobacter species have also been isolated from living cultures of dinoflagellate,

bryzooan and from the marine sponge Xestospongia testudinaria [Romanenko et al.

2005; Green et al. 2006; Lee et al. 2011]. From a pool of 82 bacterial strains, M.

adhaerens sp. nov. HP15 was selected as the bacterial counterpart of the bilateral

model system based on the observation that it showed optimal attachment to diatom

cells and significantly enhanced TEP production and aggregate formation during its

interaction with the axenic T. weissflogii cultures [Gaerdes et al. 2011]. M. adhaerens

sp. nov. HP15 forms brownish mucoid colonies when grown on marine broth agar

plates and appears rod-shaped with a single polar flagellum when observed under the

transmission electron microscope [Figure 16]. 16S rRNA gene sequence analysis in

the Ribosomal Database Project [Cole et al. 2003] revealed that the closest relative of

25

M. adhaerens sp. nov. HP15 is M. flavimaris, with a similarity score of 0.985. At the

start of this thesis work, the genome sequences of three Marinobacter species had

been determined: M. aquaeolei VT8 (similarity score 0.811), M. algicola DG893

(similarity score 0.913) and Marinobacter sp. ELB17 (no open access data available).

Figure 16

Upper left panel: M. adhaerens HP15 grown on MB agar plates; Upper right panel: M. adhaerens HP15 as observed under the light microscope; Lower panel: M. adhaerens HP15 as observed under transmission electron microscope. [TEM micrograph courtesy of Y. Ramaye, Jacobs University Bremen].

26

Aims of this study

TEP and marine snow aggregates are vital components of the oceanic carbon cycle,

leading to a substantial fraction of organic carbon sinking to depth or being provided

for further recycling. Diatom-associated bacteria have been recently shown to directly

impact TEP production and aggregate formation. However, very little is known about

the molecular components that govern this interaction or the dynamics of TEP

production and marine aggregate formation under changing environmental conditions.

Through a combination of molecular and ecological experiments, this work aimed to

clarify the molecular basis of diatom-bacteria interactions and to uncover hitherto

unknown dynamics of TEP production and aggregate formation under future ocean

scenarios. The initial aim of this work was the characterization and establishment

of a genetic system that allows the precise manipulation of the bacterial counterpart

of the bilateral model system. Once established, the second aim of this work was the

elucidation of the roles of M. adhaerens HP15 motility appendages during its

interaction with the diatom T. weissflogii. The final aim of this work was the

characterization of TEP production and aggregate formation dynamics under

changed carbonate chemistry and temperature regimes. Taken together, the ultimate

aim of the study was to gain a better mechanistic understanding of the molecular

components governing diatom-bacteria interactions, and understand how the

conditions of a future ocean will impact TEP production and aggregate formation

dynamics.

27

Summary of Results

Chapter 1

Taxonomic affiliation and establishment of a genetic system for M. adhaerens

HP15

As part of a collaborative and concerted effort, M. adhaerens HP15 was

taxonomically described as a novel member of the Marinobacter genus [Kaeppel et

al. 2012], the genome sequence of M. adhaerens HP15 was determined and

annotated [Gaerdes et al. 2010] and a powerful genetic system involving mutagenic

approaches and reporter gene expression was established to allow for the precise

manipulation of M. adhaerens HP15 [Sonnenschein et al. 2011].

Chapter 2

Attachment of M. adhaerens HP15 to T. weissflogii is not essential for the

induction of transparent exopolymeric particle formation

The role of M. adhaerens HP15 motility during its interaction with the diatom was

investigated. By generating M. adhaerens HP15 flagellum- and MSHA type IV pilus-

deficient mutants, we demonstrated that a fully-functional flagellum is a pre-requisite

for the attachment of M. adhaerens HP15 to both an abiotic surface and to T.

weissflogii cells. The MSHA type-IV pilus was also found to be important for

attachment, albeit to a lesser extent. We additionally showed that although both

cellular appendages are crucial for bacterial attachment to diatom surfaces, this

attachment was not essential for inducing diatom-borne TEP production. It was

suggested that additional yet-to-be determined mechanisms govern the induction of

TEP formation following the initial cell-to-cell contacts mediated by bacterial flagella

and pili [Seebah et al., in preparation].

28

Chapter 3

Combined effects of lowered pH and elevated temperature on diatom-bacteria

interactions

In the final part of this work, we studied TEP production dynamics and aggregate

formation in putative future oceanic scenarios. The results of our study cautiously

suggested that the combination of ocean acidification and global warming impacted

TEP production, marine aggregate formation and the sinking velocities of those

aggregates. It was suggested that the transport of particulate organic carbon might be

critically reduced in a future ocean [Seebah et al., in preparation].

29

Chapter 1

Taxonomic affiliation and establishment of a genetic system for M. adhaerens HP15

30

MARINOBACTER ADHAERENS SP. NOV., PROMINENT IN AGGREGATE FORMATION WITH

THE DIATOM THALASSIOSIRA WEISSFLOGII

3.1.1 Marinobacter adhaerens sp. nov., prominent in aggregate formation with the diatom Thalassiosira weissflogii

The following manuscript was published in its present form in the International

Journal of Systematic and Evolutionary Microbiology (2012) 62:124-128

31

MARINOBACTER ADHAERENS SP. NOV., PROMINENT IN AGGREGATE FORMATION WITH THE DIATOM THALASSIOSIRA WEISSFLOGII

Marinobacter adhaerens sp. nov., prominent in aggregate

formation with the diatom Thalassiosira weissflogii

Eva C. Kaeppel1, Astrid Gärdes1 Shalin Seebah1, Hans-Peter Grossart2 and

Matthias S. Ullrich1*

1Jacobs University Bremen, School of Engineering and Science, Bremen, Germany 2

IGB-Neuglobsow, Dept. Limnology of Stratified Lakes, Stechlin, Germany

* Corresponding author:

Jacobs University Bremen

School of Engineering and Science

Campus Ring 6

28759 Bremen

Germany

Tel: +49 421 200 3245

Fax: +49 421 200 3249

[email protected]

Running title: Description of the novel species Marinobacter adhaerens

Subject category: New taxa (Proteobacteria)

The GenBank/EMBL/DDBJ accession number for the 16S rRNA gene

sequence strain HP15T is AY241552.

32


Summary

The Gram-negative, motile, and rod-shaped bacterial strain, HP15T, was isolated

from particles sampled in surface waters of the German Wadden Sea. It was

identified among 82 other marine isolates due to its high potential to induce

production of transparent exopolymeric particles and aggregate formation while

interacting with the diatom, Thalassiosira weissflogii. HP15T grew optimally at a

range of 34-38 °C, a pH of 7-8.5, and was able to tolerate salt concentrations

between 0.5-20 % (w/v) NaCl. HP15T was chemotaxonomically characterized by

possessing ubiquinone-9 as the major respiratory lipoquinone as well as C16:0,

C18:1ω9c, and C16:1ω7c/C15:0 iso 2-OH as predominant fatty acids. The G+C

content of its DNA was 56.9 mol%. The closest relative by means of 16S rRNA

sequence analysis was Marinobacter flavimaris with a similarity level of 99 %.

The whole genome relatedness of HP15T to M. flavimaris, M. salsuginis, M.

lipolyticus, and M. algicola was determined to be lower than 70 % by DNA-DNA

hybridization. On the basis of phenotypic and chemotaxonomic properties as

well as phylogenetic analyses, strain HP15T (=DSM 23420T = CIP 110141T) is

proposed to represent the novel species, Marinobacter adhaerens sp. nov..

33


Introduction

The genus Marinobacter was established with the species Marinobacter

hydrocarbonoclasticus in 1992 (Gauthier et al., 1992). A total of 26 further species

have been described until today. These species are tolerant to various conditions as

they were isolated from diverse locations - from the sediment (Gorshkova et al.,

2003), the water column (Yoon et al., 2004), from coastal (Roh et al., 2008) and deep

sea waters (Takai et al., 2005), from the Antarctic (Montes et al., 2008) and from the

Red Sea (Antunes et al., 2007). Furthermore, representatives of this genus were

isolated from oil-contaminated areas (Huu et al., 1999), hot springs (Shieh et al.,

2003), and salines (Martin et al., 2003). Two species were identified based on their

interactions with other organisms - M. algicola isolated from dinoflagellate cultures

(Green et al., 2006) and M. bryozoorum derived from Bryozoa (Romanenko et al.,

2005).

The aggregation of phytoplankton cells is an important process in marine ecosystems

leading to the sinking of particulate organic matter in form of marine snow.

Heterotrophic bacteria were suggested to increase aggregation of microalgae and

other particles (Decho, 1990). To study the interaction of diatoms with bacteria and its

role in aggregate formation, a bilateral model system was established (Gärdes et al.,

2010a). Among 82 bacterial isolates from aggregates (0.1-1 mm in diameter) sampled

in surface waters of the German Bight (Grossart et al., 2004), strain HP15T was

shown to induce highest transparent exopolymeric particle production and aggregate

formation during its interaction with the diatom Thalassiosira weissflogii. Thus, strain

HP15T proofed to be a suitable model organism to study bacteria microalgae

interactions and its consequences for the organic matter sinking flux in the sea. The

aim of the present study was to determine the taxonomic position of this species by

analyzing its phenotypic properties and genotypic relatedness.

34


For phenotypic examination, HP15T was grown aerobically on Marine Broth (MB)

agar plates (5 g peptone, 1 g yeast extract, 0.1 g FePO4, 6 g agar in 750 ml of

North Sea water and 250 ml of distilled water, pH adjusted to 7.4) at 28 °C for 48 h.

The reference strains Marinobacter flavimaris DSM 16070T , Marinobacter

salsuginis DSM18347T,Marinobacter lipolyticus DSM15157T, Marinobacter algicola

DSM16394T, and Marinobacter hydrocarbonoclasticus synonym: aquaeolei)

DSM11845 were obtained from the Deutsche Sammlung von Mikroorganismen und

Zellkulturen GmbH (DSMZ).

The Gram staining reaction, cell morphology, and motility were examined by light

microscopy and transmission electron microscopy (EM 900, Zeiss). Enzyme activities

and carbon utilization were analyzed by using the API 20NE system (bioMérieux)

and the BIOLOG GN2 system (Biolog, Hayward, CA, USA) in artificial seawater

medium without carbon source using established procedures (Martinez & Butler,

2007) and as recommended by the manufacturer. The analysis of growth conditions

were examined in MB medium at 37 °C and 250 rpm. For salinity tests, the indicated

NaCl concentration was added to distilled water instead of using sea water. For pH

tests, pH was adjusted by using NaOH or HCl. The temperature range analysis (4-60

°C) was performed in Marine Broth (Difco 279110) by DSMZ. The optimal growth

temperature was defined by testing bacterial growth at the temperatures of 28, 30, 32,

34, 36, 38, 40, and 42 °C. The salinity range was studied between 0 and 35 % (w/v)

NaCl and the pH range between 4 and 11. Cellular fatty acid composition and quinone

analysis were carried out by DSMZ. Cells were grown on Marine Broth (Difco 2216)

at 28 °C for 24 h. Fatty acid methyl esters were obtained from 40 mg cells scraped

from Petri dishes by saponification, methylation, and extraction using minor

modifications of the methods of Miller (1982) and Kuykendall et al. (1988),

separated, and analysed using the Sherlock Microbial Identification System (MIS)

(Version 4.5) (97 MIDI, Microbial ID, Newark, DE, USA) as described previously

(Kämpfer & Kroppenstedt, 1996).

35


For quinone analysis, cells were grown in MB at 28 °C and 250 rpm to an OD of 0.3

and harvested. Extraction, separation, and analysis of lipoquinones was conducted as

described by Tindall (1990a, b). DNA-DNA hybridization tests were conducted in

duplicates between HP15T and the closest neighbouring strains derived from 16S

rRNA analysis: M. flavimaris DSM 16070T, M. salsuginis DSM18347T, M. lipolyticus

DSM15157T, and M. algicola DSM16394T. The hybridization was performed by

DSMZ as described by De Ley et al. (1970) under consideration of the modifications

described by Huss et al. (1983) in 2 x SSC with 5% formamid at 68 °C.

For the phylogenetic analysis, the complete 16S rRNA gene of HP15T (AY241552,

1531 bp) was obtained from the genome sequence (GenBank accession no.

CP001978) (Gärdes et al. 2010b). The analysis was performed using the ARB

software package (Ludwig et al., 2004) and the reference alignment was provided by

the Living Tree Project database (Yarza et al., 2008). The phylogenetic tree was

based on the HP15T sequence, all type strains of the genus Marinobacter, and the type

strains of Halospina denitrificans HGD 1-3T (DQ072719) and Salicola marasensis

7Sm5T (DQ019934) as outgroups. The G+C content of the HP15T genome was

calculated using the complete genomic sequence (GenBank accession nos. CP001978,

CP001979, and CP001980).

The cells of strain HP15T were rod-shaped and motile by one polar flagellum

(Supplementary Fig. S1). HP15T grew between 4 and 45 °C, at a pH from 5.5 to 10

and between 0.5-20% (w/v) NaCl. The API 20 NE test of HP15T was negative for

nitrate reduction, indole production, arginine dihydrolase, urease, β-glucosidase,

gelatinase, β-galactosidase, and the 123 utilization of D-glucose, L-arabinose, D124

mannose, D-mannitol, N-acetylglucosamine, maltose, D-gluconate, capric acid, adipic

acid, and citric acid (Tab. 1). HP15T utilized malate and phenylacetate. The results of

the BIOLOG GN2 plate were positive for the utilization of dextrin, Tween 40 and 80,

pyruvic acid methyl ester, succinic acid mono-methyl-ester, cis-aconitic acid, β-

hydroxybutyric acid,

36


γ-hydroxybutyric acid, α-keto glutaric acid, α-keto valeric acid, D,L-lactic acid,

bromosuccinic acid, L-alaninamide, D-alanine, L-alanine, L-glutamic acid, L-leucine,

and L-proline (Tab. 1). The API 20 NE and BIOLOG GN2 tests were conducted in

parallel for HP15T, M. flavimaris strain DSM 16070T, M. salsuginis SD-14BT, M.

algicola DG893T, and M. lipolyticus DSM15157T. HP15 differed in the ability to

utilize specific substrates such as citric acid, D-gluconate, L-arginine, and malate in

comparison to closely related Marinobacter type strains. Results for M. flavimaris

DSM 16070T were identical to those reported by Yoon et al. (2004) and were clearly

distinguishable for some substrates from those obtained for strain HP15T.

Interestingly, the herein observed utilization pattern of M. lipolyticus DSM15157T for

maltose as well as the lack of gelantinase and urease activities in M. salsuginis SD-

14BT and M. algicola DG893T, respectively, did not match those obtained by others

(Martin et al., 2003; Antunes et al., 2007; Green et al., 2006). These discrepancies

might be due to minor variations in cultivation conditions such as inocculum density,

incubation temperature, or time of incubation.

The fatty acid profile of HP15T was composed of C16:0 (21.7 %), C18:1ω9c (21.6 %),

C16:1ω7c/iso C15:0 2-OH (14.6 %), C16:1ω9c (9.0 %), C12:0 3-OH (7.9 %) and C12:0 (6.0

%). Thus, it is similar to that of other Marinobacter type strains by comparison of the

most common fatty acids of the genus (Supplementary Tab. S1) although most of

the previously published strains were grown under an array of diverse cultivation

conditions (growth temperatures ranging from 15 to 37°C; incubation times ranging

from 1 to 4 days prior to analyis). The predominant ubiquinone was ubiquinone-9,

which is consistent with that of other Marinobacter species except M. lutaeoensis,

which contained ubiquinone-8 (Shieh et al., 2003).

Based on its 16S rRNA sequence, strain HP15T was affiliated to the Marinobacter

genus of the Gammaproteobacteria. It is most closely related to the type strains of M.

flavimaris (99 %), M. salsuginis (98 %), M. lipolyticus (98 %), and M. algicola (98

%) (Antunes et al., 2007; Green et al., 2006; Martin et al., 2003; Yoon et al., 2004).

Beside M. lipolyticus, these type strains form a discrete cluster as evident in the

phylogenetic tree (Fig. 1).

37


The G+C content of the genome of HP15T is 56.9 mol% (Tab. 1) and thus is similar

to those of other Marinobacter species. As determined by DNA-DNA hybridization

in duplicates, genomic DNA of HP15T showed similarities of 63.6 (68.7), 40.0 (38.0),

28.9 (26.0), and 28.2 (24.5) % to those of M. flavimaris, M. salsuginis, M. lipolyticus,

and M. algicola, respectively. These similarities were below the generally accepted

species differentiation limit of 70 % (Wayne et al., 1987). Their order of relatedness

was the same as that for the 16S rRNA sequences. Due to DNA-DNA hybridization

results, the type strain of M. flavimaris seemed to be closely related to the herein

proposed species. However, both strains differed significantly in the following

distinct characteristics: i) utilization of glycerol, D-fructose, DL-lactic acid, D-

gluconate, L-alanine, phenylacetate, and L-glutamate; ii) the ability to reduce nitrate

to nitrite (Tab. 1); and iii) colony pigmentation, for which HP15T exhibited brownish

pigmentation on MB agar whereas colonies of M. flavimaris were cream-colored.

Based on the herein determined specific phenotypic and phylogenetic characteristics

and based on the genomic differences towards other Marinobacter type strains, strain

HP15T should be placed in the genus Marinobacter and should be considered as a

novel species. Due to its unique and characteristic attachment properties in the

presence of marine particle surfaces, we propose for HP15T the name Marinobacter

adhaerens sp. nov..

Description of Marinobacter adhaerens sp. nov.

Marinobacter adhaerens [ad.hae'rens. L. part. adj. adhaerens: hanging on, sticking

to].

The cells are motile by means of a single polar flagellum, Gram-negative, and non-

spore-forming rods (0.6-0.8 x 1.7-2.4 µm). Colonies on MB agar are brownish

translucent and have a circular shape (1-2 mm in diameter) with smooth edges after 2

days of incubation at 28 °C. Colour intensity increased with time of incubation.

HP15T grew between 4 and 45 °C with an optimum at 34-38 °C and at a pH ranging

from 5.5 to 10 with an optimum of pH at 7 to 9. No growth was observed at a pH of 5

or lower and 10.5 or higher.

38


The strain grew optimally at NaCl concentrations from 2 to 6 % (w/v). It resisted

down to 0.5 % NaCl, but not 0 % and up to 20 % NaCl, but not 25 % NaCl. HP15T

was negative for nitrate reduction, indole production, arginine dihydrolase, urease, β-

glucosidase, gelatinase, and β-galactosidase activity. Malate, phenylacetate, dextrin,

Tween 40 and 80, pyruvic acid methyl ester, succinic acid mono-methyl-ester, cis-

aconitic acid, β-hydroxybutyric acid, γ-hydroxybutyric acid, α-keto glutaric acid, α-

keto valeric acid, D,L-lactic acid, bromosuccinic acid, L-alaninamide, D-alanine, L-

alanine, L-glutamic acid, L-leucine, and L-proline are utilized as sole carbon source.

HP15T did not utilize α-cyclodextrin, N-acetyl-D-galactosamine, N-acetyl-D-

glucosamine, adonitol, L-arabinose, D-arabitol, D-cellobiose, i-erythritol, D-fructose,

L-fucose, D-galactose, gentiobiose, D-glucose, m-inositol, α-D-lactose, lactulose,

maltose, D-mannitol, D-mannose, D-melibiose, β-methyl-D-glucoside, D-psicose, D-

raffinose, L-rhamnose, D-sorbitol, sucrose, D-trehalose, turanose, xylitol, adipic acid,

capric acid, citric acid, formic acid, D-galactonic acid lactone, D-galacturonic acid,

D-gluconic acid, D-glucosaminic acid, D-glucuronic acid, α-hydroxybutyric acid, p-

hydroxy phenylacetate, itaconic acid, malonic acid, propionic acid, quinic acid, D-

saccharic acid, sebacic acid, glucuronamide, L-alanyl-glycine, L-aspartic acid, glycyl-

L-aspartic acid, glycyl-L-glutamic acid, L-histidine, hydroxy-L-proline, L-ornithine,

L-phenylalanine, L-pyroglutamic acid, D-serine, L-serine, L-threonine, D,L-carnitine,

γ-amino butyric acid, urocanic acid, inosine, uridine, thymidine, phenylethylamine,

putrescine, 2- aminoethanol, 2,3-butanediol,glycerol, D,L-α-glycerol phosphate, α-D-

glucose-1-phosphate, and D-glucose-6-phosphate. The major fatty acids are C16:0

(21.7 %), C18:1ω9c (21.6 %), and C16:1ω7c/iso C15:0 2-OH (14.6 %). The quinone

system consists of quinone-9. The type strain is HP15T (=DSM 23420T =CIP

110141T). The G+C content is 56.9 mol%. The strain was isolated from marine

aggregates (0.1-1 mm) of surface waters of the German Bight.

39


Acknowledgements

The authors thank Pablo Yarza and Nikolaus Sonnenschein for help in computational

analysis. This work was financially supported by Jacobs University Bremen, the

Helmholtz Graduate School for Polar and Marine Research, and the Max Planck

Society.

References

Antunes, A., Franca, L., Rainey, F. A., Huber, R., Nobre, M. F., Edwards, K. J.

& DaCosta, M. S. (2007). Marinobacter salsuginis sp. nov., isolated from the brine

seawater interface of the Shaban Deep, Red Sea. Int J Syst Evol Microbiol 57, 1035-

1040.

De Ley, J., Cattoir, H. & Reynaerts, A. (1970). The quantitative measurement of

DNA hybridization from renaturation rates. European Journal of Biochemistry 12,

133-142.

Decho, A. W. (1990). Microbial exopolymer secretions in ocean environments: their

role(s) in food webs and marine processes. In Oceanography and Marine Biology,

vol. 28, pp. 73-153. Edited by H. Barnes. Oabn, Argyll, Scotland.

Gärdes, A., Iversen, M., Grossart, H., Passow, U. & Ullrich, M. (2010a). Diatom-

associated bacteria are required for aggregation of Thalassiosira weissflogii. ISME J,

Advance online publication, 9 September 2010, Epub ahead of print.

Gärdes, A., Kaeppel, E. C., Shehzad, A., Seebah, S., Teeling, H., Yarza, P.,

Glöckner, F. O., Grossart, H.-P. & Ullrich, M. S. (2010b). Complete genome

sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine

microorganism. Stand Genomic Sci 3, 97-107.

40


Gauthier, M. J., Lafay, B., Christen, R., Fernandez, L., Acquaviva, M., Bonin, P.

& Bertrand, J. C. (1992). Marinobacter hydrocarbonoclasticus gen. nov., sp. nov., a

new, extremely halotolerant, hydrocarbon-degrading marine bacterium. Int J Syst

Evol Microbiol 42, 568-576.

Gorshkova, N. M., Ivanova, E. P., Sergeev, A. F., Zhukova, N. V., Alexeeva, Y.,

Wright, J. P., Nicolau, D. V., Mikhailov, V. V. & Christen, R. (2003).

Marinobacter excellens sp. nov., isolated from sediments of the Sea of Japan. Int J

Syst Evol Microbiol 53, 2073-2078.

Green, D. H., Bowman, J. P., Smith, E. A., Gutierrez, T. & Bolch, C. J. S. (2006).

Marinobacter algicola sp. nov., isolated from laboratory cultures of paralytic shellfish

toxin-producing dinoflagellates. Int J Syst Evol Microbiol 56, 523-527.

Grossart, H. P., Schlingloff, A., Bernhard, M., Simon, M. & Brinkhoff, T. (2004).

Antagonistic activity of bacteria isolated from organic aggregates of the German

adden Sea. FEMS Microbiology Ecology 47, 387-396.

Huss, V. A. R., Festl, H. & Schleifer, K. H. (1983). Studies on the

spectrophotometric etermination of DNA hybridization from renaturation rates. Syst

Appl Microbiol 4, 184-192

Huu, N. B., Denner, E. 260 B. M., Ha Dang, T. C., Wanner, G. & Stan-Lotter, H.

(1999). Marinobacter aquaeolei sp. nov., a halophilic bacterium isolated from a

Vietnamese oil-producing well. Int J Syst Evol Microbiol 49, 367-375.

Kämpfer, P. & Kroppenstedt, R. M. (1996). Numerical analysis of fatty acid

patterns of coryneform bacteria and related taxa. Can J Microbiol 42, 989-1005.

Kuykendall, L. D., Roy, M. A., O'Neill, J. J. & Devine, T. E. (1988). Fatty acids,

antibiotic resistance, and deoxyribonucleic acid homology groups of Bradyrhizobium

japonicum. Int J Syst Evol Microbiol 38, 358.

Ludwig, W., Strunk, O., Westram, R., Richter, L. & Meier, H. (2004). ARB: a

software environment for sequence data. Nucleic Acids Res 32, 1363.

Martin, S., Marquez, M. C., Sanchez-Porro, C., Mellado, E., Arahal, D. R. &

Ventosa, A. (2003). Marinobacter lipolyticus sp. nov., a novel moderate halophile

with lipolytic activity. Int J Syst Evol Microbiol 53, 1383-1387.

41


Martinez, J. S. & Butler, A. (2007). Marine amphiphilic siderophores: Marinobactin

structure, uptake, and microbial partitioning. J Inorg Biochem 101, 1692-1698.

Miller, L. T. (1982). Single derivatization method for routine analysis of bacterial

whole-cell fatty acid methyl esters, including hydroxy acids. J Clin Microbiol 16,

584.

Montes, M. J., Bozal, N. & Mercade, E. (2008). Marinobacter guineae sp. nov., a

novel moderately halophilic bacterium from an Antarctic environment. Int J Syst Evol

Microbiol 58, 1346.

Roh, S. W., Quan, Z. X., Nam, Y. D., Chang, H. W., Kim, K. H., Rhee, S. K., Oh,

H. M., Jeon, C. O., Yoon, J. H. & other authors (2008). Marinobacter

goseongensis sp. nov., from seawater. Int J Syst Evol Microbiol 58, 2866.

Romanenko, L. A., Schumann, P., Rohde, M., Zhukova, N. V., Mikhailov, V. V.

& Stackebrandt, E. (2005). Marinobacter bryozoorum sp. nov. and Marinobacter

sediminum sp. nov., novel bacteria from the marine environment. Int J Syst Evol

Microbiol 55, 143-148.

Shieh, W. Y., Jean, W. D., Lin, Y. T. & Tseng, M. (2003). Marinobacter lutaoensis

sp. nov. a thermotolerant marine bacterium isolated from a coastal hot spring in

Lutao, Taiwan. Can J Microbiol 49, 244-252.

Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic

analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688-2690.

Takai, K., Moyer, C. L., Miyazaki, M., Nogi, Y., Hirayama, H., Nealson, K. H. &

Horikoshi, K. (2005). Marinobacter alkaliphilus sp. nov., a novel alkaliphilic

bacterium isolated from subseafloor alkaline serpentine mud from Ocean Drilling

Program Site 1200 at South Chamorro Seamount, Mariana Forearc. Extremophiles 9,

17-27.

Tindall, B. J. (1990a). Lipid composition of Halobacterium lacusprofundi. FEMS

Microbiol Lett 66, 199-202.

Tindall, B. J. (1990b). A comparative study of the lipid composition of

Halobacterium saccharovorum from various sources. Syst Appl Microbiol 13, 128-

130.

42


Wayne, L. G., Brenner, D. J., Colwell, R. R., Grimont, P. A. D., Kandler, O.,

Krichevsky, M. I., Moore, L. H., Moore, W. E. C., Murray, R. G. E. & other

authors (1987). Report of the ad hoc committee on reconciliation of approaches to

bacterial systematics. Int J Syst Evol Microbiol 37, 463-464.

Yarza, P., Richter, M., Peplies, J., Euzeby, J., Amann, R., Schleifer, K. H.,

Ludwig, W., Glöckner, F. O. & Rosselló-Móra, R. (2008). The All-Species Living

Tree project: a 16S rRNA-based phylogenetic tree of all sequenced type strains. Syst

Appl Microbiol 31, 241-250.

Yoon, J. H., Yeo, S. H., Kim, I. G. & Oh, T. K. (2004). Marinobacter flavimaris sp.

nov. and Marinobacter daepoensis sp. nov., slightly halophilic organisms isolated

from sea water of the Yellow Sea in Korea. Int J Syst Evol Microbiol 54, 1799-1803.

43


Figure legends

Fig. 1. Maximum likelihood phylogenetic tree based on 16S rRNA sequences of

HP15T, all type strains of the genus Marinobacter and the type strains of Halospina

denitrificans HGD 1-3T (DQ072719) and Salicola marasensis 7Sm5T (DQ019934)

as out groups. The tree was inferred from 1531 alignment positions using the RAxML

algorithm (Stamatakis, 2006). Support values from 1,000 bootstrap replicates were

displayed above branches if larger than 50 %. Bar, 0.01 nucleotide substitutions per

site.

Table 1. Phenotypic and genotypic differentiation between HP15T and the closest

related Marinobacter type strains. Strains: 1, HP15T; 2, M. flavimaris DSM16070T;

3, M. salsuginis SD-14BT; 4, M. algicola DG893T; 5, M. lipolyticus DSM15157T; 6,

M. aquaeolei DSM11845; 7, M. hydrocarbonoclasticus SP.17T. +, positive; -,

negative; ND,

44


not determined. Data for growth temperature ranges and G+C contents of M.

flavimaris (Yoon et al., 2004), M. salsuginis (Antunes et al., 2007), M. algicola

DG893T (Green et al., 2006), and M. lipolyticus DSM15157T (Martin et al., 2003)

were taken from the cited references. Additional data for growth temperature, G+C

content, and the utilization of glycerol, D-fructose, DL-lactic acid, L-alanine, L-

phenylalanine, and L-glutamate for M. aquaeolei DSM11845 (Huu et al., 1999) as

well as all data for M. hydrocarbonoclasticus (Gauthier et al., 1992) were added as

reported in the cited references. All other data were experimentally determined in the

current study.

45


Supplementary Fig. S1. Transmission electron micrograph of strain HP15T cultivated

in MB for 24 h. Bar 250 nm.

46


Supplementary Table S1. Cellular fatty acid composition (%) of Marinobacter type

strains

Strains: 1, HP15T; 2, M. flavimaris SW-145T (Yoon et al., 2004); 3, M. salsuginis SD-

14BT (Antunes et al., 2007); 4, M. algicola DG893T (Green et al., 2006); 5, M.

guineae LMG 24048T (Montes et al., 2008); 6, M. lipolyticus SM19T (Martin et al.,

2003); 7, M. sediminum R65T (Romanenko et al. 2005); 8, M. aquaeolei VT8T (Huu

et al., 1999); 9, M. hydrocarbonoclasticus SP17T (Marquez & Ventosa, 2005). Values

are percentages of total fatty acid content. ND, not detected.

*Rare fatty acids present are (%): iso-C13:0 (0.13); C16:0 N alcohol (3.19); iso-C17:0 10-

methyl (1.09); C18:3 ω6c(6,9,12) (1.65); unknown peak 11.799 (0.2). Incubation

temperature, 28 °C; length of incubation prior to analysis, 1 day.

47


†Values of samples 2-9 were derived from the respective references cited above. In

each of these studies, variable incubation temperatures (15-37 °C) and different

lengths of incubation time (1-4 days) prior to analysis were used.

Supplementary References

Antunes, A., Franca, L., Rainey, F.A., Huber, R., Nobre, M.F., Edwards, K.J. &

da Costa, M.S. (2007). Marinobacter salsuginis sp. nov., isolated from the brine-

seawater interface of the Shaban Deep, Red Sea. Int J Syst Evol Microbiol 52, 1035-

1040.

Green, D.H., Bowman, J.P., Smith, E.A., Gutierrez, T. & Bolch, C.J.S. (2006).

Marinobacter algicola sp. nov., isolated from laboratory cultures of paralytic shellfish

toxin-producing dinoflagellates. Int J Syst Evol Microbiol 56, 523-527.

Huu, N.B., Denner, E.B.M., Ha, D.T., Wanner, G. & Stan-Lotter, H. (1999).

Marinobacter aquaeolei sp. nov., a halophilic bacterium isolated from a Vietnamese

oil-producing well. Int J Syst Evol Microbiol 49, 367-375

Marquez, M.C. & Ventosa, A. (2005). Marinobacter hydrocarbonoclasticus

Gauthier et al. 1992 and Marinobacter aquaeolei Nguyen et al. 1999 are heterotypic

synonyms. Int J Syst Evol Microbiol 55, 1349-1351.

Martin, S., Marquez, M.C., Sanchez-Porro, C., Mellado, E., Arahal, D.R., &

Ventosa, A. (2003). Marinobacter lipolyticus sp. nov., a novel moderate halophile

with lipolytic activity. Int J Syst Evol Microbiol 53, 1383-1387.

Montes, M.J., Bozal, N. & Mercade, E. (2008). Marinobacter guineae sp. nov., a

novel moderately halophilic bacterium from an Antarctic environment. Int J Syst Evol

Microbiol 58, 1346-1349.

Romanenko, L.A., Schumann, P., Rohde, M. Zhukova, N.V., Mikhailov, V.V &

Stackebrandt, E. (2005). Marinobacter bryozoorum sp. nov. and Marinobacter

sediminum sp. nov., novel bacteria from the marine environment. Int J Syst Evol

Microbiol 55, 143-148.

48


Yoon, J.H., Yeo, S.H., Kim, I.G. & Oh, T.K. (2004). Marinobacter flavimaris sp.

nov. and Marinobacter daepoensis sp. nov., slightly halophilic organisms isolated

from sea water of the Yellow Sea in Korea. Int J Syst Evol Microbiol 54, 1799-1803.

49

COMPLETE GENOME SEQUENCE OF MARINOBACTER ADHAERENS TYPE STRAIN (HP15), A DIATOM-INTERACTING MARINE MICROORGANISM

3.1.2 Complete genome sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine microorganism

The following manuscript was published in its present form in Standards in Genomic

Sciences (2010) 3: 97-107.

50


Complete genome sequence of Marinobacter adhaerens type

strain (HP15), a diatom-interacting marine microorganism

Astrid Gärdes1, Eva Kaeppel1, Aamir Shehzad1, Shalin Seebah1, Hanno Teeling2,

Pablo Yarza3, Frank Oliver Glöckner2, Hans-Peter Grossart4 and Matthias S.

Ullrich1*

1Jacobs University Bremen, School of Engineering and Science, Bremen, Germany

2Max Planck Institute for Marine Microbiology, Microbial Genomics and

Bioinformatics Group, Bremen, Germany

3Institut Mediterrani d’Estudis Avançats, Marine Microbiology Group, Esporles,

Spain

4IGB-Neuglobsow, Dept. Limnology of Stratified Lakes, Stechlin, Germany




Campus Ring 6

28759 Bremen

Germany

Tel: +49 421 200 3245

Fax: +49 421 200 3249

[email protected]

Keywords: marine heterotrophic bacteria, diatoms, attachment, marine aggregate

formation

51


Abstract

Marinobacter adhaerens HP15 is the type strain of a newly identified marine

species, which is phylogenetically related to M. flavimaris, M. algicola, and M.

aquaeolei. It is of special interest for research on marine aggregate formation

because it showed specific attachment to diatom cells. In vitro it led to

exopolymer formation and aggregation of these algal cells to form marine

snow particles. M. adhaerens HP15 is a free-livi ng, motile, rod-shaped,

Gram-negative gammaproteobacterium, which was originally isolated from

marine particles sampled in the German Wadden Sea. M. adhaerens HP15

grows heterotrophically on various media, is easy to access genetically, and

serves as a model organism to investigate the cellular and molecular

interactions with the diatom Thalassiosira weissflogii. Here we describe the

complete and annotated genome sequence of M. adhaerens HP15 as well as

some details on flagella-associated genes. M. adhaerens HP15 possesses three

replicons; the chromosome comprises 4,422,725 bp and codes for 4,180

protein-coding genes, 51 tRNAs and three rRNA operons, while the two

circular plasmids are ~187 kb and ~42 kb in size and contain 178 and 52

protein-coding genes, respectively.

52


Introduction

Strain HP15 (DSM 23420) is the type strain of the newly established species

Marinobacter adhaerens sp. nov. and represents one of 27 species currently assigned

to the genus Marinobacter [1]. Strain HP15 was first described by Grossart et al. in

2004 [2] as a marine particle-associated, Gram-negative, gammaproteobacterium

isolated from the German Wadden Sea. The organism is of interest because of its

capability to specifically attach in vitro to the surface of the diatom Thalassiosira

weissflogii-inducing exopolymer and aggregate formation and thus generating

marine snow particles [3]. Marine snow formation is an important process of the

biological pump, by which atmospheric carbon dioxide is taken up, recycled, and

partly exported to the sediments. This sink of organic carbon plays a major role for

marine biogeochemical cycles [4]. Several studies reported on the formation and

properties of marine aggregates [5-8]. Although it was shown that heterotrophic

bacteria control the development and aggregation of marine phytoplankton [3],

specific functions of individual bacterial species on diatom aggregation have not

been explored thus far. A better understanding of the molecular basis of bacteria-

diatom interactions that lead to marine snow formation is currently gained by

establishing a bilateral model system, for which M. adhaerens sp. nov. HP15

serves as the bacterial partner of the easy-to-culture diatom, T. weissflogii [3].

Herein, we present a set of features for M. adhaerens sp. nov. HP15 (Table 1)

together with its annotated complete genomic sequence, and a detailed analysis of its

flagella-associated genes.

Classification and features

M. adhaerens sp. nov. strain HP15 is a motile, Gram-negative, non-spore-

forming rod (Figure 1). Based on its 16S rRNA sequence, strain HP15 was assigned

to the Marinobacter genus of Gammaproteobacteria.

53


Two other Marinobacter were based on their interactions with eukaryotes - M.

algicola isolated from dinoflagellate cultures [20] and M. bryozoorum derived

from Bryozoa [21]. The 16S rRNA gene of strain HP15 is most closely related to

those of the type strains of M. flavimaris (99%), M. salsuginis (98%) and M.

algicola (96%). These four type strains form a discrete cluster in the phylogenetic

tree (Figure 2). In contrast, DNA-DNA hybridization experiements revealed that the

genome of M. adhaerens sp. nov. HP15 showed about 64% binding to that of M.

flavimaris [1], which is below the generally accepted species differentiation limit of

70% [25].

Figure 1: Transmission electron micrograph of M. adhaerens sp. nov. strain HP15

54


Chemotaxonomy

Strain HP15 can grow in artificial seawater with a nitrogen-to-phosphorus ratio of

15:1 supplemented with glucose as the sole carbon source. In presence of diatom cells

but without glucose, HP15 utilized diatom-produced carbohydrates as sole source of

carbon. Furthermore, M. adhaerens sp. nov. HP15 differed from M. flavimaris and

other Marinobacter species in a number of chemotaxonomic properties, such as

utilization of glycerol, fructose, lactic acid, gluconate, alanine and glutamate [1].

Additionally, strain HP15 showed a unique fatty acid composition pattern.

Figure 2: Maximum likelihood phylogenetic tree based on 16S rRNA sequences of

M. adhaerens type strain (HP15) plus all type strains of the genus Marinobacter

and the type species of the neighbor order Pseudomonadales. Sequence selection

and alignment improvements were carried out using the Living Tree Project

database [22] and the ARB software package [23]. The tree was inferred from

1,531 alignment positions u s i n g RAxML [24] w i th GTRGAMMA model.

Support values from 1,000 bootstrap replicates are displayed above branches if

larger than 50%. The scale bar indicates substitutions per site.

55


Table 1. Classification and general features of M. adhaerens sp. nov. HP15 according to MIGS recommendations [9].

Evidence codes – IDA: inferred from Direct Assay (first time in publication); TAS: Traceable Author Statement (i.e., a direct report exists in the literature); NAS: Non-traceable Author Statement (i.e., not directly observed for the living, isolated sample, but based on a generally accepted property of the species, or anectodal evidence). These evidence codes are from the Gene Ontology project [19]. If evidence code is IDA, then the property was directly observed for a live isolate by one of the authors or an expert mentioned in the acknowledgements.

56

COMPLETE GENOME SEQUENCE OF MARINOBACTER ADHAERENS TYPE STRAIN (HP15), A DIATOM-INTERACTING MARINE MICROORGANISM Genome sequencing and annotation Genome project history M. adhaerens HP15 was selected for sequencing because of its phylogenetic

position, its particular feature as a diatom-interacting marine organism [3], and

its feasible genetic accessibility to act as a model organism. The respective

genome project is deposited in the Genome OnLine Database [19] and the

complete genome sequence in GenBank. The main project information is

summarized in Table 2.

Table 2: Genome sequencing project information for M. adhaerens sp. nov.

HP15

Growth conditions and DNA isolation

M. adhaerens sp. nov. HP15 was grown in 100 ml Marine Broth medium [26]

at 28°C. A total of 23 µg DNA was isolated from the cell paste using Qiagen

57


DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the

manufacturer’s instructions.

Genome sequencing and assembly

The Marinobacter adhaerens sp. nov. HP15 genome was sequenced at AGOWA

(AGOWA GmbH, Berlin, Germany) using the 454 FLX Ti platform of 454 Life

Sciences (Branford, CT, USA). The sequencing library was prepared according to

the 454 instructions from genomic M. adhaerens sp. nov. HP15 DNA with a final

concentration of 153 ng/µl. Sequencing was carried out on a quarter of a 454

picotiterplate, yielding 258.645 reads with an average length of 405 bp, totaling to

almost 105 Mb. These reads were assembled using the Newbler assembler version

2.0.00.22 (Roche), resulting in 253.285 fully and 4.763 partially assembled reads,

leaving 932 singletons, 226 repeats and 371 outliers. The assembly comprised 112

contigs, with 40 exceeding 500 bp. The latter comprised more than 4.6 Mb, with an

average contig size of almost 116 kb and a longest contig of more than 1.2 Mb.

Gaps between contigs were closed in a conventional PCR-based gap closure

approach, resulting in a fully closed circular chromosome of 4.421.911 bp, and

two plasmids of 187.465 bp and 42.349 bp, respectively. Together all sequences

provided 22.5x coverage of the genome. The error rate of the completed genome

sequence is about 3 in 1,000 (99.7%).

Genome annotation

Potential protein-coding genes were identified using GLIMMER v3.02 [27], transfer

RNA genes were identified using tRNAScan-SE [28] and ribosomal RNA genes

were identified via BLAST searches [29] against public nucleotide databases.

The annotation of the genome sequence was performed with the GenDB v2.2.1

system [30].

58


For each predicted gene, similarity searches were performed against public

sequence databases (nr, SwissProt, KEGG) and protein family databases (Pfam,

InterPro, COG). Signal peptides were predicted with SignalP v3.0 [31, 32] and

trans-membrance helices with TMHMM v2.0 [33]. Based on these observations,

annotations were derived in an automated fashion using a fuzzy logic-based

approach [34]. Finally, the predictions were manually checked with respect to

missing genes in intergenic regions and putative sequencing errors, and the

annotations were manually curated using the Artemis 11.3.2 program and refined for

each putative gene [35].

Genome properties

The genome of strain HP15 comprises three circular replicons: the 4,422,725 bp

chromosome and two plasmids of ~187 kb and ~42 kb, respectively (Table 3A and

Figure 3). The genome possesses a 56.9% GC content (Table 3B). Of the 4,482

predicted genes, 4,422 were protein coding genes, and 60 RNAs; 391 pseudogenes

were also identified. The majority of the protein-coding genes (67.5%) were

assigned with a putative function, while those remaining were annotated as

hypothetical proteins. The distribution of genes into COGs functional categories is

presented in Table 4.

Table 3A. Genome composition for M. adhaerens HP15

§ Number of protein-coding genes: 4,180; ¶ Number of protein-coding genes:

178; * Number of protein-coding genes: 52

59


Table 3B: Genome statistics for M. adhaerens HP15

a) The total is based on either the size of the genome in base pairs or the total number of protein coding genes in the annotated genome. b) Also includes 54 pseudogenes and 5 other genes

60


Figure 3. Graphical circular maps of the genome and the two plasmids of HP15. From outside to the center: Genes on forward strand (color

by COG categories), Genes on reverse strand (color by COG categories), RNA genes (tRNAs green, rRNAs red, other RNAs black), GC

content, GC skew.

61


Table 4: Number of genes associated with the 21 general COG functional categories

a) The total is based on the total number of protein coding genes in the annotated genome

62


Flagella-associated gene clusters of M. adhaerens HP15

M. adhaerens HP15 was experimentally shown to adhere to diatom cells. The gene

clusters coding for secretion, assembly, and mechanistic function of the polar

flagellum were analyzed in detail (Figure 4). Besides several other chemotactic

mechanisms and various cell surface interactions, bacterial flagella and other cell

appendages had previously been shown to be instrumental for chemotactic

movement towards and adhesion to biotic surfaces [36, 37]. The amino acid sequences

of proteins encoded by the three identified gene clusters showed significant

similarities to orthologous and experimentally well-described gene products of P.

aeruginosa PAO1 and various other bacterial species as determined by BLASTP

algorithm comparison using the Blosum 62 substitution matrix [29]. Not

surprisingly, hook and motor switch complex components were most conserved.

However, gene products involved in flagellar filament formation encoded by Cluster II

also showed 53 to 78% similarity to the Respective PAO1 proteins. Mutagenesis of

flagella-associated genes of M. adhaerens HP15 will be carried out in the near

future to study the role of flagella in bacteria-diatom interactions and to further our

understanding of the cell-to-cell communication between those organisms.

63


Figure 4: Schematic presentation of the three flagella-associated gene clusters of M.

adhaerens HP15 coding for the basal body, the filament, and the hook and motor switch

complex. Identities to the respective orthologs in the genome of P. aeruginosa PAO1 are

indicated by gray-scale code. Numbers of CDS are shown below gene names.

64


Acknowledgements We thank Yannic Ramaye for help with TEM operation and Christian Quast for

computer support. The work was financially supported by the Max-Planck Society,

the Helmholtz Foundation and Jacobs University Bremen

References

1. Kaeppel EC, Gärdes A, Seebah S, Grossart HP, Ullrich MS. Marinobacter adhaerens sp. nov., prominent in aggregate formation with the diatom Thalassiosira weissflogii. Int J Syst Evol Microbiol 2010 (Submitted). 2. Grossart HP, Schlingloff A, Bernhard M, Simon M, Brinkhoff T. Antagonistic activity of bacteria isolated from organic aggregates of the German Wadden Sea. FEMS Microbiol Ecol 2004; 47:387- 396 3. Gärdes A, Iversen M, Grossart H, Passow U, Ullrich MS. Diatom-associated bacteria are required for Thalassiosira weissflogii aggregation. ISME J 2010. (In Press) 4. Fowler SW, Knauer GA. Role of large particles in the transport of elements and organic compounds through the oceanic water column. Prog Oceanogr 1986; 16:147-194 5. Alldredge AL, Silver MW. Characteristics, dynamics and significance of marine snow. Prog Oceanogr 1988; 20:41-82 6. Passow U. Transparent exopolymer particles (TEP) in aquatic environments. Prog Oceanogr 2002; 55:287-333 7. Simon M, Grossart HP, Schweitzer B, Ploug H. Microbial ecology of organic aggregates in aquatic ecosystems. Aquat Microb Ecol 2002; 28:175- 211 8. Verdugo P, Alldredge AL, Azam F, Kirchman DL, Passow U, Santschi PH. The oceanic gel phase: a bridge in the DOM-POM continuum, p. 67-85. Symposium on New Approaches in Marine Organic Biogeochemistry held in Honor of the Life and Science of John I Hedges. 2003; Elsevier Science Bv

65

COMPLETE GENOME SEQUENCE OF MARINOBACTER ADHAERENS TYPE STRAIN (HP15), A DIATOM-INTERACTING MARINE MICROORGANISM 9. Field D, Garrity G, Gray T, Morrison N, Selengut J, Sterk P, Tatusova T, Thomson N, Allen MJ, Angiuoli SV. Towards a richer description of our complete collection of genomes and metagenomes: the “Minimum Information about a Genome Sequence” (MIGS) specification. Nat. Biotechnol 2008; 26:541-547 10. Woese CR, Kandler O, Wheelis ML. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci USA 1990; 87:4576-4579. 11. Garrity GM, Holt JG. The Road Map to the Manual. In: Garrity GM, Boone DR, Castenholz RW (eds), Bergey's Manual of Systematic Bacteriology, Second Edition, Volume 1, Springer, New York, 2001, p. 119-169 12. List Editor. Validation of publication of new names and new combinations previously effectively published outside the IJSEM. List no. 106. Int J Syst Evol Microbiol 2005; 55:2235 2238. 13. Garrity GM, Bell JA, Lilburn T. Class III. Gammaproteobacteria class. nov. In: Garrity GM, Brenner DJ, Krieg NR, Staley JT (eds), Bergey's Manual of Systematic Bacteriology, Second Edition, Volume 2, Part B, Springer, New York, 2005, p. 1. 14. Bowman JP, McMeekin TA. Order X. Alteromonadales ord. nov. In: Garrity GM, Brenner DJ, Krieg NR, Staley JT (eds), Bergey's Manual of Systematic Bacteriology, Second Edition, Volume 2, Part B, Springer, New York, 2005, p. 443. 15. List Editor. Validation List no. 81. Validation of publication of new names and new combinations previously effectively published outside the IJSEM. Int J Syst Evol Microbiol 2001; 51:1229. 16. Ivanova EP, Mikhailov VV. A new family, Alteromonadaceae fam. nov., including marine proteobacteria of the genera Alteromonas, Pseudoalteromonas, Idiomarina, and Colwellia. Microbiology 2001; 70:10-17 17. Ivanova EP, Flavier S, Christen R. Phylogenetic relationships among marine Alteromonas-like proteobacteria: emended description of the family Alteromonadaceae and proposal of Pseudoalteromonadaceae fam. nov., Colwelliaceae fam. nov., Shewanellaceae fam. nov., Moritellaceae fam. nov., Ferrimonadaceae fam. nov., Idiomarinaceae fam. nov. and Psychromonadaceae fam. nov. Int J Syst Evol Microbiol 2004; 54:1773- 1788

66

COMPLETE GENOME SEQUENCE OF MARINOBACTER ADHAERENS TYPE STRAIN (HP15), A DIATOM-INTERACTING MARINE MICROORGANISM 18. Gauthier MJ, Lafay B, Christen R, Fernandez L, Acquaviva M, Bonin P, Bertrand JC. Marinobacter hydrocarbonoclasticus gen. nov., sp. nov., a new, extremely halotolerant, hydrocarbon-degrading marine bacterium. Int J Syst Bacteriol 1992; 42:568-576 19. Liolios K, Mavromatis K, Tavernarakis N, Kyrpides NC. The Genome On Line Database (GOLD) in 2007: Status of genomic and metagenomic projects and their associated metadata. Nucleic Acids Res 2008; 36:D475-D479 20. Green DH, Bowman JP, Smith EA, Gutierrez T, Bolch CJS. Marinobacter algicola sp. nov., isolated from laboratory cultures of paralytic shellfish toxin-producing dinoflagellates. Int J Syst Evol Microbiol 2006; 56:523-527 21. Romanenko LA, Schumann P, Rohde M, Zhukova NV, Mikhailov VV, Stackebrandt E. Marinobacter bryozoorum sp. nov. and Marinobacter sediminum sp. nov., novel bacteria from the marine environment. Int J Syst Evol Microbiol 2005; 55:143-148. 22. Yarza P, Richter M, Peplies J, Euzéby J, Amann R, Schleifer KH, Ludwig W, Glöckner FO, Rosselló- Móra R. The All-Species Living Tree Project: a 16S rRNA-based phylogenetic tree of all sequenced type strains. Syst Appl Microbiol 2008; 31:241-250 23. Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhukumar A, Buchner T, Lai S, Steppi G, Jobb W, et al. ARB: a software environment for sequence data. Nucleic Acids Res 2004; 32:1363-1371 24. Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 2006; 22:2688 25. Wayne LG, Brenner DJ, Colwell RR, Grimont PAD, Kandler O, Krichevsky MI, Moore LH, Moore WEC, Murray RGE, Stackebrandt E, et al. Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int J Syst Evol Microbiol 1987; 37:463 26. Zobell CE. Studies on marine bacteria. I. The cultural requirements of heterotrophic aerobes. J Mar Res 1941; 4:42-75. 27. Delcher AL, Bratke KA, Powers EC, Salzberg SL. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 2007; 23:673-679

67

COMPLETE GENOME SEQUENCE OF MARINOBACTER ADHAERENS TYPE STRAIN (HP15), A DIATOM-INTERACTING MARINE MICROORGANISM 28. Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 1997; 25:955-964 29. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215:403-410 30. Meyer F, Goesmann A, McHardy AC, Bartels D, Bekel T, Clausen J, Kalinowski J, Linke B, Rupp O, Giegerich R, Puhler A. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res 2003; 31:2187- 2195 31. Emanuelsson O, Brunak S, Von Heijne G, Nielsen H. Locating proteins in the cell using TargetP, SignalP and related tools. Nat Protoc 2007; 2:953-971 32. Nielsen H, Brunak S, Von Heijne G. Machine learning approaches for the prediction of signal peptides and other protein sorting signals. Protein Eng 1999; 12:3-9 33. Krogh A, Larsson B, Von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 2001; 305:567- 580 34. Quast C. MicHanThi - design and implementation of a system for the prediction of gene functions in genome annotation projects. Master Thesis 2006 (Available on request). 35. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B. Artemis: sequence visualization and annotation. Bioinformatics 2000; 16:944-945 36. O'Toole GA, Kolter R. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 1998; 30:295-304 37. Pallen MJ, Matzke NJ. From The Origin of Species to the origin of bacterial flagella. Nat Rev Microbiol 2006; 4:784-790

68

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS

3.1.3 Development of a genetic system for Marinobacter adhaerens HP15 involved in marine aggregate formation by interacting with diatom cells

The following manuscript was published in its present form in the Journal of

Microbiological methods (2011) 87(2): 97-107.

69


Development of a genetic system for Marinobacter adhaerens

HP15 involved in marine aggregate formation by interacting

with diatom cells

Eva C. Sonnenschein1#, Astrid Gaerdes1#, Shalin Seebah1, Ingrid Torres-Monroy1,

Hans-Peter Grossart2 and Matthias S. Ullrich1*

# E.C.S and A.G contributed equally

1Jacobs University Bremen, School of Engineering and Science, Bremen, Germany

2 IGB-Neuglobsow, Dept. Limnology of Stratified Lakes, Stechlin, Germany




Campus Ring 6

28759 Bremen

Germany

Tel: +49 421 200 3245

Fax: +49 421 200 3249

[email protected]

Keywords: Marinobacter, marine aggregates, genetic toolbox, mutagenesis, bacterial

motility

70


ABSTRACT

Diatom aggregation is substantial for organic carbon flux from the photic zone

to deeper waters. Many heterotrophic bacteria ubiquitously found in diverse

marine environments interact with marine algae and thus impact organic matter

and energy cycling in the ocean. In particular, Marinobacter adhaerens HP15

induces aggregate formation while interacting with the diatom, Thalassiosira

weissflogii. To study this effect at the molecular level, a genetic tool system was

developed for strain HP15. The antibiotics susceptibility spectrum of this

organism was determined and electroporation and conjugation protocols were

established. Among various plasmids of different incompatibility groups, only

two were shown to replicate in M. adhaerens. 1.4 x 10-3 transconjugants per

recipient were obtained for a broad-host-range vector. Electroporation efficiency

corresponded to 1.1 x 105 CFU per µg of DNA. Transposon and gene-specific

mutageneses were conducted for flagellum biosynthetic genes. Mutant

phenotypes were confirmed by swimming assay and microscopy. Successful

expression of two reporter genes in strain HP15 revealed useful tools for gene

expression analyses, which will allow studying diverse bacteria-algae interactions

at the molecular level and hence to gain a mechanistic understanding of micro-

scale processes underlying ocean basin-scale processes. This study is the first

report for the genetic manipulation of a Marinobacter species which specifically

interacts with marine diatoms and serves as model to additionally analyze

various previously reported Marinobacter-algae interactions in depth.

71


INTRODUCTION

Marine heterotrophic bacteria interacting with micro-algae play an important role in

the formation of marine snow particles and are thus important for the carbon cycling

in marine pelagic systems (Grossart et al., 2006a; Sapp et al., 2008; Geng and Belas,

2010). Besides their role in degradation of organic carbon and re-mineralization of

nutrients (Cole, 1982), these bacteria promote aggregation of phytoplankton cells

(Decho, 1990) and are thus important for the biological carbon pump (Longhurst &

Harrison, 1989). Understanding their impact during the interaction with micro-algae

is essential to gain knowledge about the ecological relevance of these bacteria on the

growth of algae in natural habitats. Bacteria interacting with algal cells might feed on

them or their products, or support their growth by re-mineralization of nutrients

(Grossart and Simon, 2007). Since various scenarios can be envisioned, it remained to

be determined whether bacteria enhancing aggregate formation inhibit or promote the

metabolism and growth of algae and how they accomplish that. Most previous studies

focused on bacterial communities associated with phytoplankton at the ecological

level (Grossart et al., 2006b; Sapp et al., 2008), which did not allow to distinguish

between the algal and bacterial contribution to specific ecosystem processes.

Consequently, very little is known about the genetic characteristics and functional

strategies that algae-associated bacteria have adopted to cope with environmental

parameters and phytoplankton cells.

The genus Marinobacter is one of the most ubiquitous in the oceans and assumed to

significantly impact various biogeochemical cycles (Singer et al., 2011; Gauthier et

al., 1992; Rotani et al., 2003; Gorshkova et al., 2003). Due to their high functional

diversity, different Marinobacter species have gained intense attention by the research

community. Members of the Marinobacter genus were frequently isolated from algal

samples, corroborating the hypothesis that several species of Marinobacter are

frequently associated with phytoplankton (Green et al., 2006, Amin et al., 2009, Alavi

et al., 2001, Hold et al., 2001; Gärdes et al., 2011).

72


Genome data of algae-associated Marinobacter species suggested tight relationships

to their algal partners since a number of genes coding for proteins and secretion

systems typical for bacterial pathogens or symbionts have been identified in M.

algicola DG893 (Amin et al., 2009) and M. adhaernes HP15 (Gärdes et al., 2010) as

well as in genomes of other algae-associated bacteria (Worden et al., 2006). For an in-

depth molecular analysis of diatom-bacteria interactions and for determining its actual

nature and mechanism(s), a bilateral model system consisting of the unicellular

diatom, Thalassiosira weissflogii, and the bacterial strain, Marinobacter adhaerens

HP15, was established recently (Gärdes et al., 2011; Kaeppel et al., 2011). M.

adhaerens HP15 had been isolated from marine particles taken from surface water

samples of the German Wadden Sea (Grossart et al., 2004). Close and specific

interaction of HP15 and T. weissflogii was demonstrated in vitro by attachment and

aggregate formation assays as well as determination of transparent exopolymer

particle (TEP) production concluding that strain HP15 plays an important role in T.

weissflogii aggregation dynamics (Gärdes et al., 2011). Interestingly, this type of

interaction required photosynthetic activity of diatom cells and led to improved

growth of both interaction partners. This prompted the cautious assumption that the

interaction might be symbiotic and not purely saprophytic. Hence, the actual nature of

this symbiosis still remains to be elucidated. The genome sequence of M. adhaerens

HP15 was determined exhibiting interesting features known from other gram-negative

bacteria interacting with eukaryotic hosts (Gärdes et al., 2010). M. adhaerens HP15

was taxonomically established as a novel member of the Marinobacter genus

(Kaeppel et al., 2011). Other members of the genus Marinobacter were found in

various marine habitats (Gauthier et al., 1992; Rotani et al., 2003; Gorshkova et al.,

2003) as well as in interactions with eukaryotic organisms such as Bryozoa or

dinoflagellates (Green et al., 2006; Romanenko et al., 2005). Genetic studies with M.

adhaerens HP15 have the potential to dissect cell-to-cell interactions of this organism

as well as other Marinobacter species with phytoplankton cells at the molecular level.

This might lead to the identification of novel processes of sensing, cellular

73


communication, and nutrient exchange and might thus help us to better understand

globally important processes and biogeochemical cycles such as marine aggregate

formation. As previously shown for other environmentally important bacterial species

(Bakersmans et al., 2009; Piekarski et al., 2009; Wöhlbrand and Rabus, 2008),

establishment of the genetic accessibility of individual strains represents the pivotal

base for detailed and accelerated research on these organisms. Herein, for the first

time the genetic accessibility of a Marinobacter species was comprehensively

analyzed. The suitability of M. adhaerens HP15 for molecular studies was

demonstrated by transfer of plasmids via electroporation and conjugation and by two

types of mutagenesis. As proof-of-principle, motility-deficient mutants were

generated by transposon insertion as well as by gene-specific mutagenesis using

homologous recombination. Expression of reporter genes such as enhanced green

fluorescent protein and β-galactosidase was successfully demonstrated for strain

HP15.

MATERIALS AND METHODS

Bacterial strains, plasmids and media

The bacterial strains and plasmids used are listed in Table 1. Oligonucleotide primers

used are listed in Table 2. M. adhaerens HP15 was isolated from marine particles

collected from surface waters of the German Bight (Grossart et al., 2004).

Marinobacter cells were cultivated in marine broth (MB) medium (5 g peptone, 1 g

yeast extract, 0.1 g FePO4, 6 g agar in 750 ml of North Sea water and 250 ml of

distilled water, pH 7.4). For electroporation, cells were cultivated on MB agar

medium overnight at 37 °C. Escherichia coli strains were maintained in Luria-Bertani

(LB) agar medium. For conjugation, Marinobacter cells were grown in 100 ml MB

liquid culture at 250 rpm overnight at 28°C. The donor strain E. coli ST18 was grown

in LB medium containing 50 µg ml-1 5-aminolevulinic acid (ALA). The following

antibiotics were added to media when needed (in µg ml-1): chloramphenicol, 25;

74


kanamycin, 500; and ampicillin, 50. To analyze the antibiotics susceptibility as

selection marker for transformation, strain HP15 was grown in MB medium at 28°C

to an OD600 of 1, and 20 µl of cell suspensions were spotted on MB agar medium

containing various concentrations of ampicillin, chloramphenicol, gentamycin,

kanamycin, spectinomycin, or tetracycline. The MICs for these antibiotics in MB

were determined by the micro-dilution assay as described previously (Burse et al.,

2004).

DNA procedures

Plasmids were isolated using the NucleoSpin® Plasmid kit (Macherey-Nagel, Düren,

Germany). Restriction enzymes and DNA-modifying enzymes were used as

recommended by the manufacturer (Fermentas, St. Leon-Rot, Germany). DNA

fragments were resolved in 1% agarose gel and extracted with NucleoSpin® Extract

kit (Macherey-Nagel). Preparation of genomic DNA was conducted with

NucleoSpin® Tissue kit (Macherey-Nagel).

Plasmid conjugation

Recombinant plasmids were introduced to the recipient M. adhaerens HP15 by

biparental conjugation with E. coli ST18 as a donor. Additionally, triparental mating

with the plasmid-mobilizing helper strain E. coli HB101 (pRK2013) was performed.

Bacterial strains were grown as described above overnight and the OD600 was

adjusted to 0.1 (~ 3 x 107 cells ml-1). 107-108 cells of donor and recipient were mixed

in a ratio of 1:2. For triparental mating, recipient, donor, and helper strain were mixed

in a ratio of 3:1:1. For both types of mating, cells were re-suspended in 500 µl of LB

medium supplemented with ALA, spotted on LB agar plates supplemented with ALA,

and incubated for 24, 48, or 72 h at 28°C. After incubation, the cell mass was scraped

off the agar plates and re-suspended in MB medium for subsequent dilution plating.

Transconjugants were selected on MB agar supplemented with chloramphenicol after

incubation for 2-5 days at 28°C. All experiments were conducted in triplicates.

75


Electroporation

Electro-competent Marinobacter cells were prepared directly before electroporation

and kept on ice during all steps of the washing procedure. The cell mass of two fully

covered MB agar plates was re-suspended in 1 ml of pre-cooled 300 mM sucrose and

washed two times with 1 ml of cold 300 mM sucrose using centrifugations at 13,000

rpm and 4°C for 3 min. The final pellet was re-suspended in 200 µl of 300 mM

sucrose to obtain a dense suspension (OD600 of ~30). 50 µl of cell suspension was

mixed with 0.3 to 1.5 µg of plasmid DNA for electroporation (cuvette width 0.2 cm,

resistance 200 Ω, capacitance 25 µF, pulse 2.5 kV for ~5 ms). Immediately after the

pulse, 950 ml of SOC medium was added to the cuvette. The cell suspension was

transferred to a sterile 1.5-ml tube and incubated by shaking for 15-20 hrs at 37°C. 50

to 400 µl of suspensions were subsequently plated on MB agar medium supplemented

with the appropriate antibiotics and incubated at 37°C. Electro-transformation of

strain HP15 was tested in triplicates with the following plasmids: pBBR1MCS,

pSUP106, pWeb-Cm, pGEM.Km, pEx18Tc, pK18mob, pLAFR3, pKnock-Cm,

pPH1JI, pRK415, and pSU18 (Table 3).

Transposon mutagenesis

Plasmids pBK-miniTn7-gfp1, pEP4351, and pRL27 (Table 1) containing different

transposons were tested for transposon mutagenesis efficiency in HP15 using

electroporation. Resulting mutant colonies were grown in MB medium supplemented

with kanamycin in 96-well microtiter plates overnight, re-suspended in 15% glycerol,

and stored at -80°C. For screening of flagellum-deficient mutants, mutant cells were

grown in MB medium containing kanamycin and picked on 10-fold diluted MB soft

agar plates (0.3% agar). Swimming-deficient mutants were identified by lack of the

typical motility pattern of the HP15 wild type. The genomic DNA of promising

mutants was extracted, treated with the restriction enzyme NcoI, re-ligated with T7

DNA ligase, and introduced to E. coli DH5α λ-pir by electroporation. Nucleotide

sequencing of transposon-flanking regions was conducted with the primers TnF and

76


TnR. The obtained sequence data were aligned with the GenBank sequence database

entries using BlastX (Altschul et al., 1990).

Gene-specific mutagenesis by homologous recombination

As a candidate gene for gene-specific mutagenesis, the flagellin-encoding gene, fliC,

was selected using the M. adhaerens HP15 genome sequence (GenBank accession no.

CP001978) (Gärdes et al., 2010), GenDB 2.2, and BlastN analysis (Altschul et al.,

1990). A 1,002-bp upstream and a 1,236-bp downstream flanking regions of fliC were

amplified using the primer pairs FliCupF/FliCupR and FliCdownF/FliCdownR,

respectively. Both fragments were sub-cloned to vector pGEM®-T Easy (Promega,

Mannheim, Germany) resulting in plasmids, pAS3 and pAS4. A chloramphenicol

resistance cassette was excised from pFCM1 with a KpnI restriction digest and

inserted into KpnI-treated pAS3 yielding plasmid pAS5. Plasmid pAS5 was treated

with the restriction enzymes BamHI and SpeI, the fragment was purified, and ligated

into the BamHI-SpeI-treated plasmid pAS4, resulting in plasmid pAS6, which

contained the 6,338-bp knock-out fragment consisting of the chloramphenicol

resistance gene flanked by fliC upstream and downstream fragments. The knock-out

fragment was excised with enzyme EcoRI and ligated to the EcoRI-treated suicide

vectors pEX18Ap and pK19mobsacB, respectively, generating pAS7 and pAS8 as

mutagenic constructs. After biparental conjugation and subsequent homologous

recombination, correct insertion of knock-out fragments in the M. adhaerens HP15

chromosome by double crossover was confirmed by antibiotics selection and PCR

with primer pairs FliCF/FliCR and CmF/CmR, respectively.

Determination of mutant phenotype by swimming assay and transmission electron

microscopy

Flagellum-deficient mutants and the wild-type strain HP15 were grown overnight in

MB medium containing – when needed – kanamycin or chloramphenicol,

respectively, inoculated to 10-fold diluted MB soft agar plates (0.3% agar) with a

sterile toothpick, and incubated for 48 h. For transmission electron microscopy, cells

77


were grown in MB medium as described above. A 300-µm-mesh carbon-coated

copper grid (Plano, Wetzlar, Germany) was incubated for 30 s in 20 µl of cell

suspension, excess liquid was removed, adhering cells were stained with 1% uranyl

acetate, washed with distilled water, and dried. The stained cells were visualized

using an EM900 transmission electron microscope (Zeiss, Jena, Germany).

Expression of enhanced green fluorescent protein and ß-galactosidase in M.

adhaerens HP15

Plasmid pBBR.EGFP carries the egfp gene encoding enhanced green fluorescent

protein in pBBR1MCS downstream of the promoter of lacZ′. pBBR.EGFP was

introduced to strain HP15 by electroporation. Expression of egfp in single cells was

visualized using a LSM510 META confocal laser scanning microscope (Zeiss). The

wild type of HP15 carrying the pBBR1MCS vector served as a negative control.

The E. coli lacZ gene was amplified from plasmid pMC1871 with primers LacZF and

LacZR, each containing a recognition site for KpnI. The resulting 3,057-bp fragment

was treated with KpnI and was ligated to KpnI-treated pBBR1MCS in both

orientations resulting in plasmids, pITM1 or pITM2. In pITM1, lacZ is in opposite

direction to the lacZ’ promoter, whereas in pITM2 it is under the control of the lacZ’

promoter. Both plasmids were introduced to HP15 via electroporation. Transformants

were selected on MB agar plates containing chloramphenicol and X-Gal.

RESULTS

Antibiotics susceptibility of M. adhaerens HP15

Growth of M. adhaerens HP15 was inhibited by a number of commonly used

antibiotics (Table 3). Minimal inhibitory concentrations (MIC) were generally higher

on agar than those observed in liquid medium. The highest susceptibility of strain

HP15 on agar medium with MICs of 25 µg ml-1 was observed for ampicillin and

chloramphenicol, the latter one being further used as selection marker for

78

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS transformation. Furthermore, dense M. adhaerens HP15 cell suspensions with an

optical density at 600 nm (OD600) of ~30 were plated on MB agar plates

supplemented with either 25 µg ml-1 of chloramphenicol and ampicillin, respectively,

or with 100 µg ml-1 of kanamycin, respectively. Not a single spontaneously resistant

colony could be obtained (Data not shown) indicating that chloramphenicol,

ampicillin, and kanamycin are suitable resistance markers for strain HP15.

Transformation efficiency and expression of reporter genes

From various vectors tested, only plasmids pBBR1MCS and pSUP106 were found to

replicate in M. adhaerens HP15. Other plasmids, such as pWEB-Cm, pGEM-Km,

pLAFR3, pPH1JI, pRK415, and pSU18 (Table 1) could not be transformed or did not

replicate in strain HP15. Highest conjugation efficiencies were obtained via biparental

mating at a donor-to-recipient ratio of 1:2 and after 24 hrs of mating time (Table 4).

For plasmid pBBR1MCS, 1.4 x 10-3 transconjugants per number of recipients and for

plasmid pSUP106 2.7 x 10-4 transconjugants per number of recipients were obtained.

Using electroporation, transformation efficiencies of 5.1 x 10-5 transformants per

number of recipients for pBBR1MCS and 9.2 x 10-7 transformants per number of

recipients for pSUP106 were observed. These values corresponded to 1.1 x 105 CFU

µg-1 DNA for pBBR1MCS and 1.6 x 103 CFU µg-1 DNA for pSUP106 (Table 4).

When plasmid pBBR.EGFP carrying the egfp gene encoding enhanced green

fluorescent protein was introduced to strain HP15, transformants exhibited

fluorescence when excited at a wavelength of 488 nm, thus demonstrating that egfp

was expressed (Fig. 1A). In contrast, no fluorescence was observed for strain HP15

carrying vector pBBR1MCS (Fig. 1B) suggesting that egfp is a suitable reporter gene

for this bacterium.

Colonies of HP15 wild type were white-brownish on MB agar. HP15 transformants

harboring plasmid pITM1, which contains the ß-galactosidase gene lacZ in opposite

direction to the Plac promoter, were white-brownish on MB agar containing X-Gal

similar to the wild type (Fig. 2B). However, transformants containing pITM2, which

harbors lacZ under control of the Plac promoter, grew in form of blue-colored colonies

79


on MB agar containing X-Gal thus expressing the reporter gene lacZ (Fig. 2A). Next,

plasmid pITM2 was isolated from blue transformants of strain HP15. Multiple

restriction enzyme treatments of this plasmid extract proved a correction orientation

of lacZ in the recovered plasmid.

Transposon and gene-specific mutagenesis of M. adhaerens HP15

Transposon-carrying plasmids pBK-miniTn7-gfp1, pEP4351, and pRL27 were

assayed for their potential to be used for transposon insertion mutagenesis of M.

adhaerens HP15 via electroporation. Transformation with pBK-miniTn7-gfp1 and

pEP4351 did not yield in transposon mutants. In contrast, transformation of strain

HP15 with plasmid pRL27 carrying transposon Tn5 resulted in an efficiency of 6.8 x

102 CFU µg-1 DNA (1.8 x 10-7 mutants per number of recipients). A group of 18

randomly chosen mutants was subjected to cloning of the transposon insertion

regions. Subsequent nucleotide sequencing of the transposon-flanking regions

revealed 18 distinct and unique insertion sites (Data not shown) thus confirming the

randomness of transposon insertions. Testing a total of 768 transposon mutants by

soft agar swimming assay revealed two swimming-deficient mutants. For these HP15

mutants, nucleotide sequencing of the transposon-flanking DNA regions revealed that

their phenotype correlated to individual transposon insertions in the motility-

associated genes fliG and fliR (Data not shown). A mutant with the transposon

insertion in fliG termed HP15-fliG::tn5 was used for further phenotypic analysis.

Gene-specific mutagenesis was conducted by introducing the suicide plasmids pAS7

and pAS8, respectively, harboring the fliC mutagenic construct by biparental

conjugation. Transconjugants were selected on MB agar plates supplemented with

chloramphenicol, and double crossover of the chloramphenicol resistance cassette in

the fliC gene of strain HP15 was demonstrated by PCR with primers FliCF and FliCR

yielding the expected 1,734-bp fragment. In contrast, PCR with the HP15 wild type

using the same primer set yielded an intact fliC amplification of 2,487 bp. Absence of

plasmids pAS7 and pAS8, respectively was confirmed by lack of recombinant

80


plasmids in extractions from the transconjugants (Data not shown). One of the

mutants was designated HP15-∆fliC. The results confirmed a successful gene-specific

mutagenesis using homologous recombination in M. adhaerens HP15. Conjugation of

the respective vectors, pEX18Ap and pKmobsacB, without insert DNA homologous

to genes of strain HP15 did not yield antibiotics-resistant HP15 transformants.

Phenotypic characterization of M. adhaerens HP15 mutants

In contrast to the HP15 wild type, motility-deficient mutants HP15-∆fliC and HP15-

fliG:: tn5 were not motile on soft agar demonstrating that genes fliC and fliG were

essential for flagellar movement of HP15 (Fig. 3). Furthermore, transmission electron

microscopy revealed that HP15 wild type possessed one polar flagellum (Fig. 4A)

while mutant HP15-∆fliC did not produce a visible flagellum but retained the flagellar

hook (Fig. 4B) demonstrating the accurate gene-specific mutation. In contrast,

transposon insertion in the hook-associated fliG gene led to a total loss of the

flagellum as seen for mutant HP15-fliG::tn5 (Fig. 4C).

DISCUSSION

In contrast to well-established bacterial model organisms in medical, veterinary or

plant pathology as well as in microbial biotechnology, environmentally important

microbes - particularly of marine origin - are often not readily accessible for

molecular laboratory work. However, in order to understand the molecular basis of

microbial processes in the oceans, genetically accessible model systems are needed.

The current study was part of a concerted action, in which the pivotal role of M.

adhaerens in marine aggregate formation was demonstrated (Gärdes et al., 2011), its

genome analyzed (Gärdes et al., 2010), and its taxonomic affiliation as a new species

determined (Kaeppel et al., 2011). For the first time, we show that a single marine

bacterial species being directly and specifically involved in marine aggregate

formation (Gärdes et al., 2011) is genetically accessible in terms of transformation,

transposon and gene-specific mutagenesis, as well as reporter gene expression.

81


This study is distinctive from that of Kato et al. (1998), who established a genetic

transformation system for algae-lysing Alteromonas strains. These bacteria were

shown to lyse different species of diatoms including Thalassiosira sp. In the future, a

comparative functional analysis of algae-aggregating and algae-lysing bacteria based

on mutagenic approaches and gene expression analyses might reveal important new

insights into the mechanisms of their interactions with diatoms.

The genus of Marinobacter is assumed to contribute significantly to different marine

biogeochemical cycles (Singer et al., 2011). Various ubiquitously distributed and

environmentally prominent representatives of the Marinobacter genus have been

under research for almost 20 years in terms of their oil-degrading capacity (Gauthier

et al., 1992; Yakimov et al., 2007), wax ester production (Rontani et al., 2003),

siderophores (Barbeau et al., 2002; Martinez and Butler, 2007), particle colonization

(Grossart et al., 2003), and interactions with phytoplankton (Jasti et al., 2005; Sher et

al., 2011; Gärdes et al., 2011). The currently available genome sequences of four

Marinobacter species are highly similar to each other (Gärdes et al., 2010; Singer et

al., 2011). Consequently, the herein developed genetic tool box for M. adhaerens will

assist researchers studying specific functional traits in other Marinobacter species.

Essential methods to allow molecular analyses of a given bacterium are plasmid

transformation techniques, different types of mutagenesis, and reporter gene

expression. Herein, plasmid introduction to M. adhaerens HP15 by electroporation

and conjugation, random and gene-specific mutagenesis, as well as expression of

reporter genes were reported as a first proof-of-principle. With the established

techniques, it is now possible to identify the particular role of genes and to quantify

gene products important for the interaction of this bacterium with diatom cells. In

turn, this might lead to the identification of molecular signals and environmental

patterns underlying this interaction.

The current study was conducted with a marine diatom-associated γ-proteobacterium

and thus is complementary to but also clearly distinctive from very impressive

approaches with representatives of the Roseobacter clade of α-proteobacteria, which

are living in symbiosis with heterotrophic dinoflagellates, such as Pfiesteria piscicida

82


(Miller et al., 2006; Geng et al., 2008; Geng and Belas, 2010). On the one hand – to

be highly effective – genetic tools and protocols need to be specific and need to be

optimized for bacteria phylogenetically belonging to different proteobacterial

sections, i.e. α- and γ-proteobacteria (Davidson, 2002). On the other hand, our future

molecular analyses of M. adhaerens might reveal fundamentally novel mechanisms of

the biotrophic interaction of this bacterium with a photosynthetic marine eukaryote, T.

weissflogii.

The determined antibiotics susceptibility spectrum of M. adhaerens HP15 allowed

selection of transformants or mutants by antibiotics resistance markers, i.e.

chloramphenicol, ampicillin, and kanamycin. The relative low susceptibility of strain

HP15 to other antibiotics might be due to the high salt concentration in the used

medium as concluded previously for other marine organisms (Piekarski et al., 2009).

Resistance to different antibiotics was earlier claimed to be a suitable taxonomic

marker for marine bacteria (Gorshkova and Ivanova, 2001). Herein obtained data are

comparable to those for M. aquaeolei (Huu et al., 1999) but not to those of M.

vinifirmus and M. alkaliphilus (Liebgott et al., 2006; Takai et al., 2005) and thus did

not result in a clear genus-specific pattern.

Recombinant plasmids of different incompatibility groups were tested for replication

in M. adhaerens HP15. Interestingly, transformation with plasmids of the

incompatibility group IncQ was successful whereas plasmids of incompatibility

groups IncP, IncX, colE1, or pMB1 did not replicate, could not be introduced to strain

HP15, or did not allow for the expression of the respective resistance gene. It remains

to be analyzed whether the two native plasmids of strain HP15 with molecular sizes

of 42 and 187 kb (Gärdes et al, 2010), respectively, possibly interfere with replication

of the latter plasmid groups.

The herein obtained electroporation efficiency was comparable to that of the marine

γ-proteobacterium Pseudoalteromonas (Kurusu et al., 2001) but was lower than that

described for Alteromonas (Kato et al., 1998). Plasmid conjugation efficiency for

strain HP15 was found to be similar to those of other marine γ-proteobacteria

(Dahlberg et al., 1998) or α-proteobacteria of the Roseobacter clade

83


(Piekarski et al., 2009). The reporter genes egfp and lacZ were introduced in trans to

strain HP15 and showed a clear phenotypic expression making both genes suitable for

in vivo labeling and for reporter gene analyses in future studies.

The transposon delivery plasmid pRL27 (Larsen et al., 2002) was used to generate a

library of mutants of M. adhaerens HP15. Efficiency of mutagenesis was lower than

that for the close relative, Pseudomonas stutzeri (Larsen et al., 2002). However, it was

sufficient to readily generate a library characterized by a high degree of randomness.

For homologous recombination, derivatives of the mobilizable vectors pEX18Ap and

pK18mobsacB were used due to their inability to replicate in non-enterobacterial

species (Hoang et al., 1998; Schäfer et al., 1994). As expected, conjugation of these

vectors without insert DNA homologous to genes of strain HP15 did not yield HP15

transformants indicating that they could be used as suicide vectors.

To demonstrate the ability to knock-out any specific gene, motility of obtained

transposon mutants was screened. The flagellum-deficient transposon mutants HP15-

fliG::tn5 and HP15-fliR::tn5, as well as the gene-specific mutant HP15-∆fliC were

non-motile in soft agar in contrast to the HP15 wild type. As expected, in mutant

HP15-fliG::tn5 the flagellum was not formed at all since this gene is required for the

flagellar hook formation as described earlier for Salmonella enterica (Thomas et al.,

2001). In contrast, mutant HP15-∆fliC exhibited the flagellar hook but was missing

the flagellar filament confirming previous data obtained for Heliobacter pylori and

other bacteria (Macnab, 2003; Seong et al., 1999). These results demonstrated that the

flagellar filament of M. adhaerens HP15 is encoded by a flagellin gene. The

flagellum-deficient mutants will next be tested during their interaction with diatoms to

study the role of bacterial motility in chemotaxis and attachment.

CONCLUSIONS

An easy-to-work-with and powerful genetic toolbox for M. adhaerens HP15 was

established, which renders this bacterium a suitable model organism for molecular

analysis of diatom-bacteria interactions. This genetic toolbox can be used for other

84


members of the Marinobacter clade involved in phytoplankton interactions and

oceanic biogeochemical cycles. Herein tested and established methods and procedures

will be applied to knock-out and functionally analyze genes involved in i.e. motility,

surface attachment, chemotaxis, biofilm formation, as well as nutrient sensing and

acquisition. Use of reporter genes will serve in differential gene expression studies

and in a currently being established in vivo expression technology screen (Slauch et

al., 1994) allowing the identification of novel genes important for the biotrophic

interaction of M. adhaerens with its diatom host. As shown by previous studies,

which established genetic systems for other environmentally important bacteria

(Bakersmans et al., 2009; Piekarski et al., 2009; Wöhlbrand and Rabus, 2008), the

current study has built the technical base for intense future research on a globally

important process: bacteria-induced formation of diatom aggregates and thus their

sinking behavior in the ocean. Improving our understanding of specific cell-to-cell

interactions at the molecular level provides the basis for a mechanistic understanding

of the “biological carbon pump” and is crucial to identify specific environmental

parameters and cellular factors contributing to or triggering the ecological

consequences of a globally changing world.

Acknowledgements

We thank Helge Weingart, Sabrina Thoma, William Metcalf, and Ingo Leibiger for

providing bacterial strains and plasmids. This work was financially supported by

Jacobs University Bremen, the Max Planck Society and the Helmholtz Graduate

School for Polar and Marine Research.

85

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS REFERENCES Alavi, M., Miller, T., Erlandson, K., Schneider, R., Belas, R., 2001. Bacterial community associated with Pfiesteria-like dinoflagellate cultures. Environ. Microbiol. 3, 380-396. Alexeyev, M. F., 1999. The pKNOCK series of broad-host-range mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of gram-negative bacteria. Biotechniques 26, 824-826. Altschul, S. F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403-410. Amin, S.A., Green, D.H., Hart, M.C., Küpper, F.C., Sunda, W.G., Carrano, C.J., 2009. Photolysis of iron–siderophore chelates promotes bacterial–algal mutualism. PNAS 106, 17071-17076. Bakermans, C., Sloup, R.E., Zarka, D.G., Tiedje, J.M., Thomashow, M.F., 2009. Development and use of genetic system to identify genes required for efficient low-temperature growth of Psychrobacter arcticus 273-4. Extremophiles 13, 21-30. Barbeau, K., Zhang, G., Live, D.H., Butler, A., 2002. Petrobactin, a photoreactive siderophore produced by the oil-degrading marine bacterium Marinobacter hydrocarbonoclasticus. J. Am. Chem. Soc. 124, 378-379.

Bartolome, B., Jubete, Y., Martinez, E., de la Cruz, F., 1991. Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102, 75-78. Burse, A., Weingart, H., Ullrich, M.S., 2004. NorM, an Erwinia amylovora multidrug efflux pump involved in in vitro competition with other epiphytic bacteria. Appl. Environ. Microbiol. 70, 693-703. Choi, K. H., Schweizer, H.P., 2005. An improved method for rapid generation of unmarked Pseudomonas aeruginosa deletion mutants. BMC Microbiol. 23, 30. Cole, J.J., 1982. Interactions between bacteria and algae in aquatic ecosystems. Annu. Rev. Ecol. Syst. 13, 291-314 Cooper, A.J., Kalinowski, A.P., Shoemaker, N.B., Salyers, A.A., 1997. Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is RecA independent. J. Bacteriol. 179, 6221-6227.

86

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B.B., Molin, S., Hermansson, M., 1998. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol. Biol. Evol. 15, 385-390. Davison J., 2002. Genetic tools for pseudomonads, rhizobia, and other gram-negative bacteria. Biotechn. 32, 386-388. Decho, A.W., 1990. Microbial exopolymer secretions in ocean environments: their role(s) in food webs and marine processes, p. 73-153. In H. Barnes (ed.), Oceanography and Marine Biology, vol. 28, Oabn, Argyll, Scotland. Figurski, D.H., Helinski, D.R., 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. U.S.A. 76, 1648-1652. Gärdes, A., Iversen, M., Grossart, H., Passow, U., Ullrich, M.S., 2011. Diatom-associated bacteria are required for aggregation of Thalassiosira weissflogii. ISME J. 5, 436-454. Gärdes, A., Kaeppel, E.C., Shehzad, A., Seebah, S., Teeling, H., Yarza, P., Glöckner, F.O., Grossart, H.-P., Ullrich, M.S., 2010. Complete genome sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine microorganism. Stand. Genomic Sci. 3, 97-107.

Gauthier, M.J., Lafay, B., Christen, R., Fernandez, L., Acquaviva, M., Bonin, P., Bertrand. J.C., 1992. Marinobacter hydrocarbonoclasticus gen. nov., sp. nov., a new, extremely halotolerant, hydrocarbon-degrading marine bacterium. Int. J. Syst. Bacteriol. 42, 568-576.

Geng, H., Bartholin Bruhn, J., Nielsen, K.F., Gram, L., Belas, R., 2008. Genetic dissection of tropodithietic acid biosynthesis by marine roseobacters. Appl. Environ. Microbiol. 74, 1535-1545. Geng, H., Belas, R., 2010. Molecular mechanisms underlying roseobacter-phytoplankton symbioses. Curr. Opin. Biotech. 21, 332-338. Gorshkova, N.M., Ivanova, E.P., 2001. Antibiotic Susceptibility as a Taxonomic Characteristic of Proteobacteria of the Genera Alteromonas, Pseudoalteromonas, Marinomonas, and Marinobacter. Russ. J. Mar. Biol. 27, 116-120

87

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Gorshkova, N.M., Ivanova, E.P., Sergeev, A.F., Zhukova, N.V., Alexeeva, Y., Wright, J.P., Nicolau, D.V., Mikhailov, V.V., Christen, R., 2003. Marinobacter excellens sp. nov., isolated from sediments of the Sea of Japan. Int. J. Syst. Evol. Microbiol. 53, 2073-2078. Green, D.H., Bowman, J.P., Smith, E.A., Gutierrez, T., Bolch, C.J.S., 2006. Marinobacter algicola sp. nov., isolated from laboratory cultures of paralytic shellfish toxin-producing dinoflagellates. Int. J. Syst. Evol. Microbiol. 56, 523-527. Grossart, H.-P., Czub, G., Simon, M., 2006a. Algae-bacteria interactions and their effects on aggregation and organic matter flux in the sea. Environ. Microbiol. 8, 1074-1084. Grossart, H.-P., Kioerboe, T., Tang, K.W., 2006b. Interactions between marine snow and heterotrophic bacteria: aggregate formation and microbial dynamics. Aquat. Microb. Ecol. 42, 19-26. Grossart, H.-P., Kiørboe, T., Tang, K., Ploug, H., 2003. Bacterial colonization of particles: growth and interactions. Appl. Environ. Microbiol. 69, 3500-3509 Grossart, H.-P., Schlingloff, A., Bernhard, M., Simon, M., Brinkhoff, T., 2004. Antagonistic activity of bacteria isolated from organic aggregates of the German Wadden Sea. FEMS Microbiol. Ecol. 47, 387-396. Grossart, H.-P., Simon, M., 2007. Interactions of planktonic algae and bacteria: effects on algal growth and organic matter dynamics. Aquat. Microb. Ecol. 47, 163-176. Hirsch, P.R., Beringer, J.E., 1984. A physical map of pPH1JI and pJB4JI. Plasmid 12, 139-141. Hoang, T.T., Karkhoff-Schweizer, R.A.R., Kutchma, A.J., Schweizer, H.P., 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212, 77-86. Hold, G.L., Smith, E.A., Rappe, M.S., Maas, E.W., Moore, E.R.B., Stroempl, C., Stephen, J.R., Prosser, J.I., Birkbeck, T.H., Gallacher, S., 2001. Characterisation of bacterial communities associated with toxic and non-toxic dinofagellates: Alexandrium spp. and Scrippsiella trochoidea. FEMS Microbiol. Ecol. 37, 161-173.

88

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Huu, N.B., Denner, E.B.M., Ha Dang, T.C., Wanner, G., Stan-Lotter, H., 1999. Marinobacter aquaeolei sp. nov., a halophilic bacterium isolated from a Vietnamese oil-producing well. Int. J. Syst. Evol. Microbiol. 49, 367-375. Jasti, S., Sieracki, M.E., Poulton, N.J., Giewat, M.W., Rooney-Varga. J.N., 2005. Phylogenetic diversity and specificity of bacteria closely associated with Alexandrium spp. and other phytoplankton. Appl. Environ. Microbiol. 71, 3483-3494. Kaeppel, E.C., Gärdes, A., Seebah, S., Grossart, H.-P., Ullrich, M.S., 2011. Marinobacter adhaerens nov. sp. HP15, a marine bacterium prominent in diatom aggregation. Int. J. Syst. Evol. Microbiol.,Feb 18 [Epub ahead of print]. Kato, J., Amie, J., Murata, Y., Kuroda, A., Mitsutani, A., Ohtake, H., 1998. Development of a genetic transformation system for an alga-lysing bacterium. Appl. Environ. Microbiol 64, 2061–2064. Keen, N.T., Tamaki, S., Kobayashi, D., Trollinger, D., 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70, 191-197. Koch, B., Jensen, L.E., Nybroe, O., 2001. A panel of Tn7-based vectors for insertion of the gfp marker gene or for delivery of cloned DNA into Gram-negative bacteria at a neutral chromosomal site. J. Microbiol. Methods 45, 187-195. Kovach, M.E., Phillips, R.W., Elzer, P.H., Roop, R.M. , Peterson, K.M., 1994. pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16, 800-802. Kurusu, Y., Yoshimura, S., Tanaka, M., Nakamura, T., Maruyama, A., Higashihara, T., 2001. Genetic transformation system for a psychrotrophic deep-sea bacterium: isolation and characterization of a psychrotrophic plasmid. Mar. Biotechnol., 96-99. Larsen, R.A., Wilson, M.M., Guss, A.M., Metcalf, W.W., 2002. Genetic analysis of pigment biosynthesis in Xanthobacter autotrophicus Py2 using a new, highly efficient transposon mutagenesis system that is functional in a wide variety of bacteria. Arch. Microbiol. 178, 193-201. Liebgott, P.P., Casalot, L., Paillard, S., Lorquin, J., Labat, M., 2006. Marinobacter vinifirmus sp. nov., a moderately halophilic bacterium isolated from a wine-barrel-decalcification wastewater. Int. J. Syst. Evol. Microbiol. 56, 2511-2516.

89

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Longhurst, A.R., Harrison, W.G., 1989. The biological pump: Profiles of plankton production and consumption in the upper ocean. Prog. Oceanogr. 22, 47-123. Macnab, R.M., 2003. How bacteria assemble flagella. Annu. Rev. Microbiol. 57, 77-100. Martinez, J.S., Butler, A., 2007. Marine amphiphilic siderophores: marinobactin structure, uptake, and microbial partitioning. J. Inorg. Biochem. 101, 1692-1698. Miller, T.R., Belas, R., 2006. Motility is involved in Silicibacter sp. TM1040 interaction with dinoflagellates. Env. Microbiol. 8, 1648–1659. Piekarski, T., Buchholz, I., Drepper, T., Schobert, M., Wagner-Doebler, I., Tielen, P., Jahn, D., 2009. Genetic tools for the investigation of Roseobacter clade bacteria. BMC Microbiol. 9, 265-272. Priefer, U.B., Simon, R., Pühler, A., 1985. Extension of the host range of Escherichia coli vectors by incorporation of RSF1010 replication and mobilization functions. J. Bacteriol. 163, 324-329. Romanenko, L.A., Schumann, P., Rohde, M., Zhukova, N.V., Mikhailov, V.V., Stackebrandt, E., 2005. Marinobacter bryozoorum sp. nov. and Marinobacter sediminum sp. nov., novel bacteria from the marine environment. Int. J. Syst. Evol. Microbiol. 55, 143-148. Rontani, J.F., Mouzdahir, A., Michotey, V., Caumette, P., Bonin, P., 2003. Production of a polyunsaturated isoprenoid wax ester during aerobic metabolism of squalene by Marinobacter squalenivorans sp. nov. Appl. Environ. Microbiol. 69, 4167-4176. Sapp, M., Gerdts, G., Wellinger, M., Wichels, A., 2008. Consuming algal products: Trophic interactions of bacteria and a diatom species determined by RNA stable isotope probing. Helgol. Mar. Res. 62, 283-287. Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G., Pühler, A., 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69-73. Seong, K.J., Hoon Chang, J., Il Chung, S., Sun Yum, J., 1999. Molecular cloning and characterization of the Helicobacter pylori fliD gene, an essential factor in flagellar structure and motility. J. Bacteriol. 181, 6969-6976.

90

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Shapira, S.K., Chou, J., Richaud, F.V., Casadaban, M.J., 1983. New versatile plasmid vectors for expression of hybrid proteins coded by a cloned gene fused to lacA gene sequences encoding an enzymatically active carboxy-terminal portion of β-galactosidase. Gene 25, 71-82. Sher, D., Thompson, J.W., Kashtan, N., Croal, L., Chisholm, S.W., 2011. Response of Prochlorococcus ecotypes to co-culture with diverse marine bacteria. ISME J. Feb 17. [Epub ahead of print]. Singer, E., Webb, E.A., Nelson, W.C., Heidelberg, J.F., Ivanova, N., Pati, A., Edwards, K.J., 2011. Genomic potential of Marinobacter aquaeolei, a biogeochemical 'opportunitroph'. App. Environ. Microbiol. 77, 2763-2771. Slauch, J.M., Mahan, M.J., Mekalanos, J.J., 1994. In vivo expression technology for selection of bacterial genes specifically induced in host tissues. Meth. Enzymol. 235, 481-492. Staskawicz, B., Dahlbeck, D., Keen, N., Napoli, C., 1987. Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J. Bacteriol. 169, 5789-5794. Takai, K., Moyer, C.L., Miyazaki, M., Nogi, Y., Hirayama, H., Nealson, K.H., Horikoshi, K., 2005. Marinobacter alkaliphilus sp. nov., a novel alkaliphilic bacterium isolated from subseafloor alkaline serpentine mud from Ocean Drilling Program Site 1200 at South Chamorro Seamount, Mariana Forearc. Extremophiles 9, 17-27. Thoma, S., Schobert, M., 2009. An improved Escherichia coli donor strain for diparental mating. FEMS Microbiology Letters 294, 127-132. Thomas, D., Morgan, D.G., DeRosier, D.J., 2001. Structures of bacterial flagellar motors from two FliF-FliG gene fusion mutants. J. Bacteriol. 183, 6404. Wöhlbrand, L., Rabus, R., 2008. Development of a Genetic System for the Denitrifying Bacterium ‘Aromatoleum aromaticum’ Strain EbN1. J. Mol. Microbiol. Biotechnol. 17, 41-52 Worden, A.Z., Cuvelier, M.L., Bartlett, D.H., 2006. In-depth analyses of marine microbial community genomics. Trends Microbiol. 14, 331-336. Yakimov, M.M., Timmis, K.N., Golyshin, P.N., 2007. Obligate oil-degrading marine bacteria. Curr. Opin. Biotechnol. 18, 257-266

91

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Table 1. Bacterial strains and plasmids used in this study

92


93

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Table 2. Oligonucleotide primers used in this study. The underline marks the

restriction enzyme recognition sites.

94

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Table 3. Minimal inhibitory concentration for strain HP15 on 1.2 % MB agar and in

MB medium

Table 4. Conjugation efficiencies for plasmids pBBR1MCS and pSUP106 in

Marinobacter adhaerens HP15

95

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Figure 1. Fluorescence microscopy photographs of Marinobacter adhaerens HP15

harboring the reporter gene-carrying plasmid pBBR.EGFP (A) or the vector

pBBR1MCS as control (B) excited at 488 nm

Figure 2. Colony phenotypes of Marinobacter adhaerens HP15 carrying pITM2 (A)

and pITM1 (B) on MB agar supplemented with X-Gal.

96

DEVELOPMENT OF A GENETIC SYSTEM FOR MARINOBACTER ADHAERENS HP15 INVOLVED IN MARINE AGGREGATE FORMATION BY INTERACTING WITH DIATOM CELLS Figure 3. Phenotypic characterization of flagellum-deficient Marinobacter adhaerens

HP15 mutants by 0.3 % soft agar assay after 2 days of incubation: (A) HP15 wild type;

(B) HP15-∆fliC; and (C) HP15-fliG::Tn5.

Figure 4. Phenotypic characterization of flagellum-deficient Marinobacter adhaerens

HP15 mutants by transmission electron microscopy: (A) HP15 wild type showing a

full flagellum; (B) HP15-∆fliC carrying the flagellar hook only; and (C) HP15-

fliG::Tn5 lacking both, flagellar hook and flagellum.

97

Chapter 2

Attachment of Marinobacter adhaerens HP15 to Thalassiosira weissflogii is not essential for the induction of transparent exopolymeric particle formation

98

ATTACHMENT OF MARINOBACTER ADHAERENS HP15 TO THALASSIOSIRA WEISSFLOGII IS NOT ESSENTIAL FOR THE INDUCTION OF TRANSPARENT EXOPOLYMERIC PARTICLE FORMATION

3.1.4 Attachment of Marinobacter adhaerens HP15 to Thalassiosira weissflogii is not essential for the induction of transparent exopolymeric particle formation

The following manuscript is in preparation

99

ATTACHMENT OF MARINOBACTER ADHAERENS HP15 TO THALASSIOSIRA WEISSFLOGII IS NOT ESSENTIAL FOR THE INDUCTION OF TRANSPARENT EXOPOLYMERIC PARTICLE FORMATION

Attachment of Marinobacter adhaerens HP15 to

Thalassiosira weissflogii is not essential for the induction of

transparent exopolymeric particle formation

Shalin Seebah1, Uta Passow2 and Matthias S. Ullrich1*

1Molecular Life Science Research Center, Jacobs University Bremen, Bremen,

Germany

2 Marine Science Institute, University of California Santa Barbara, CA, USA

Running title: Bacterial attachment not essential for diatom TEP production




Campus Ring 6

28759 Bremen

Germany

Tel: +49 421 200 3245

Fax: +49 421 200 3249

[email protected]

Keywords: Flagella, MSHA Type-IV pili, TEP, diatom-bacteria interactions, ocean

carbon cycle

100

ATTACHMENT OF MARINOBACTER ADHAERENS HP15 TO THALASSIOSIRA WEISSFLOGII IS NOT ESSENTIAL FOR THE INDUCTION OF TRANSPARENT EXOPOLYMERIC PARTICLES FORMATION

ABSTRACT

Transparent exopolymeric particles (TEP) play a critical role in the formation of

marine aggregates. Although predominantly formed by the abiotic assembly of

TEP precursors, the interactions between phytoplankton and certain specific

bacterial species have been shown to directly impact the production of TEP and

the aggregation of phytoplankton. We hypothesized that motility-mediated

attachment of bacteria to phytoplankton cell surfaces impacts the production of

TEP. In this study, the role of the marine gammaproteobacterium, Marinobacter

adhaerens HP15, and its flagellum- or MSHA type IV pilus-deficient mutants

were investigated with respect to attachment to abiotic surface as well as to the

surface of the diatom Thalassiosira weissflogii. Our results demonstrated that a

fully-functional flagellum is a pre-requisite for the attachment of M. adhaerens

HP15 to both, abiotic and biotic surfaces. The MSHA type-IV pilus was also

found to be important for attachment, yet to a lesser extent. Although both

cellular appendages are crucial for bacterial attachment to diatom surfaces,

herein obtained results also showed that this attachment is not essential for

inducing diatom-borne TEP production. This suggested additional yet-to-be

determined mechanisms governing the induction of TEP formation following the

initial cell-to-cell contacts mediated by bacterial flagella and pili.

101


INTRODUCTION

Due to their gelatinous and sticky nature, transparent exopolymeric particles (TEP)

play a critical role in the formation of marine aggregates (Alldredge et al. 1993,

Passow and Alldredge 1994). These ubiquitously distributed and abundant particles

have been found in all marine aggregates investigated to date (Alldredge et al. 1993,

Passow and Alldredge 1994, Passow 2002). TEP are formed by a variety of pathways,

but in marine pelagic systems, they are predominantly formed by the abiotic assembly

of dissolved organic carbon (DOC) polymers which subsequently coagulate into

nano-, micro- and ultimately macrogels which can be up to several centimeters in size

(Chin et al. 1998, Verdugo et al. 2004, Verdugo 2012). DOC polymers which

ultimately coalesce to form TEP are released by a variety of organisms including

phytoplankton, bacteria, macroalgae, and e.g. the jellyfish Aurelia aurita.

(Stoderegger & Herndl 1999, Passow 2000, Ramaiah et al. 2001, Dicker 2011).

Phytoplankton exudates significantly contribute to the TEP pool, and exudation

depends on prevailing environmental conditions (Alldredge 1995, Gaerdes et al.

submitted) and on phytoplankton-associated bacterial interactions (Grossart 1999,

Gaerdes et al 2011).

Phytoplankton-bacterial associations have been investigated in different aquatic

systems (Bratbak and Thingstad 1985, Reche et al. 1997, Danger et al. 2007, Gaerdes

et al. 2011). The actual degree of bacterial colonization of algal cells may vary greatly

and seems to depend on the particular phytoplankton life stage (Vaque et al 1989,

Smith et al. 1995, Kaczmarska et al. 2005, Graff et al. 2011). It appears that

phytoplankton-associated bacteria are usually species-specific, benefit from the

interaction, and influence the secretion of extracellular polymeric substances (EPS)

(Grossart 1999, Bruckner et al. 2008, Bruckner et al. 2011, Gaerdes et al 2011).

Phytoplankton-associated bacteria have also been hypothesized to directly impact

bloom dynamics, community succession, primary productivity, the microbial loop and

ultimately the marine global carbon cycle (Azam and Malfatti 2007, Graff et al.

2011). However, the underlying mechanisms mediating phytoplankton-bacteria

interactions are not well understood.

102


In a recent study, Gaerdes et al. (2011) systematically tested 85 marine bacterial

isolates for their ability to attach to the diatom Thalassiosira weissflogii and for their

impact on TEP formation. From this pool, only four bacterial strains, belonging to the

gammaproteobacteria, flavobacteria, or firmicutes, were shown to directly enhance

TEP production and aggregation of diatom cells (Gaerdes et al. 2011). This led us to

speculate that specific interaction-relevant bacterial genes might be responsible for

inducing diatom-borne TEP production. In order to mechanistically investigate the

interaction at the molecular level, a bilateral model system consisting of the diatom,

T. weissflogii, and the genetically accessible marine gammaproteobacterium,

Marinobacter adhaerens HP15, has been established (Gaerdes et al. 2010, Gaerdes et

al. 2011, Sonnenschein et al. 2011, Kaeppel et al. 2012).

In the context of identifying diatom-bacteria interaction-relevant genes, it was

hypothesized that bacterial attachment to the diatom surfaces might be essential for

the interaction. Furthermore it was hypothesized that the attachment is (a) mediated

by bacterial motility determinants and (b) crucial for the induction of diatom-borne

TEP production. Bacterial attachment to biotic surfaces such as phytoplankton cells

and to abiotic surfaces such as marine snow particles might enable associated bacteria

to obtain nutrients and substrate, thereby providing a competitive advantage over free-

living bacteria. The adherence of bacteria to surfaces has been investigated in various

studies (Kogure et al. 1998, Morisaki et al. 1999, Dalisay et al. 2006, Wong et al.

2012), and the genetic basis of attachment and colonization of surfaces has often been

attributed to genes coding for the bacterial flagellum or different type IV pili (O'

Toole & Kolter 1998, Dalisay et al. 2006, Martinez et al. 2010).

In the marine environment, the symbiotic interaction of Vibrio fischeri with the squid

Euprymna scolopes has been shown to depend on the flagellum-mediated attachment

of the bacterium to its host cells, and bacteria deficient in flagellum are unable to

cause bioluminescence within the squid’s light organ, an important survival strategy

for this bacterial species (Nyvholm & McFall-Ngai 2004). The attachment of the

marine bacterium Pseudoalteromonas tunicata to both abiotic substrata and cellulose-

containing surfaces of the green alga Ulva australis has been shown to be mediated

by the type IV mannose-sensitive haemagglutinin (MSHA) pilus (Dalisay et al. 2006),

103


as has the colonization of plankton surface by V. cholerae (Hsiao et al. 2006).

Although there is ample evidence of bacterial interactions with biotic surfaces in the

environment, the impact of bacterial attachment on the mediation of TEP production

has been less scrutinized.

In this study, the attachment of flagellum- or MSHA type IV pilus-deficient M.

adhaerens HP15 mutants to abiotic and diatom surfaces have been investigated.

Furthermore, it was tested whether bacterial attachment to the diatom impacted TEP

production by quantifying the TEP amount produced in co-cultures of the diatom with

the wild type and its motility-impaired mutants.


Microbial strains, plasmids and culture conditions

Axenic cultures of the diatom Thalassiosira weissflogii (CCMP 1336) were

obtained from the Provasoli-Guillard National Center for Marine Algae and

Microbiota (Maine, USA). The cultures were grown at 16°C in f/2 medium (Guillard

& Ryther 1962, Guillard 1975), using a 12-hr light period at 115 mmol photons m-2 s-

1. F/2 medium was prepared with pre-filtered (0.2 µm pore size) and autoclaved

North-Sea water. Diatom cell abundance was monitored daily by counting cells in a

Sedgwick-Rafter Cell S50 (SPI Supplies, West Chester, PA, USA) using an inverted

Axiovert 200 microscope (Zeiss, Jena, Germany). The axenicity of the diatom culture

was regularly checked by plating on marine broth (MB) (Zobell 1941) plates and by

epifluorescence microscopy after staining with the dye 4′, 6-diamidino-2-phenylindol

(DAPI).

All bacterial strains and plasmids used in this study are listed in Table 1. Escherichia

coli strains were routinely grown in Luria-Bertani (LB) medium at 37°C with shaking

at 250 rpm and supplemented with 25 µg ml-1 chloramphenicol when needed. M.

adhaerens HP15, previously isolated from marine particles collected from the surface

waters of the German Bight (Grossart et al. 2004), was routinely grown in MB at

28°C with shaking at 250 rpm. HP15 flagellum-impaired mutants fliG::Tn5 and ∆fliC

had previously been created by transposon and gene-specific directed mutagenesis,

respectively (Sonnenschein et al. 2011). Mutant fliG::Tn5 is totally deficient in

104


synthesis of the flagellum. Mutant ∆fliC was created by the targeted knock-out of the

structural biosynthetic gene fliC coding for flagellin and is deficient in the flagellar

filament but still possesses an intact hook structure (Sonnenschein et al. 2011). The

M. adhaerens HP15 MSHA type IV pilus-deficient mutant, ∆mshB, was created in the

current study. All HP15 mutants were grown as described above in cultures

supplemented with 25 µg ml-1 chloramphenicol for mutants ∆fliC and ∆mshB and

with 500 µg ml-1 kanamycin for mutant fliG::Tn5.

Table 1: Bacterial strains and plasmids used in this study

Strains and plasmids Characteristics Source or reference

Bacterial strains

M. adhaerens HP15 Wild type strain Grossart et al. 2004 Escherichia coli DH5α F'/endA1 hsdR17(rk

- mk +) relA1

supE44 thi-1 recA1 gyrA (NaIr) ∆(lacIZYA- argF) U169 deoR (Φ80dlac∆(lacZ)M15

Raleigh et al. 1989

∆ fliC fliC gene deletion mutant of HP15, CmR

Sonnenschein et al. 2011

fliG:: Tn5 Transposon insertion mutant of fliG of HP15, KmR

Sonnenschein et al. 2011

∆mshB mshB gene deletion mutant of HP15, CmR

This study

Plasmids pGEM®-T Easy colE1, lacZ, AmpR Promega GmbH,

Mannheim, Germany pMshB-up pGEM®-T Easy containing 1003 bp

upstream of the mshB gene, AmpR This study

pMshB-down pGEM®-T Easy containing 1001 bp downstream of the mshB gene, AmpR

This study

pFCM1 AmpR, CmR Choi and Schweizer 2005 pMshB-up-Cm pMshB-up containing the

chloramphenicol cassette from pFCM1, AmpR, CmR

This study

mshB mutagenic construct pMshB-up-Cm containing 1001 bp downstream of the mshB gene, AmpR, CmR

This study

105


In silico search for genes encoding MSHA Type IV pili

The complete M. adhaerens HP15 genome deposited at GenBank/EMBL/DDBJ

under accession number CP001978 (Gaerdes et al. 2010), was searched for genes

encoding for proteins annotated as MSHA family proteins using the BLAST search

algorithm (Altschul et al. 1990) available at the NCBI site

(http://www.ncbi.nlm.nih.gov/BLAST/). To determine sequence similarities of the

thereby predicted M. adhaerens HP15 MSHA type IV cluster, the deduced amino acid

sequences were compared to those of the well-characterized MSHA clusters of V.

cholerae O1 biovar El Tor strain N16961 and that of P. tunicata D2 (Heidelberg et al.

2000, Moran et al. 2006). For this, the MSHA type IV pilus clusters from

choromosome I of V. cholerae O1 biovar El Tor strain N16961 (Accession

NC_002505, Heidelberg et al. 2000) and that of P. tunicata D2 (Accession

NZ_AAOH01000003, Moran et al. 2006) were used. Furthermore, the putative major

MSHA pilin structural subunit was identified by searching for the presence of an N-

terminal signal peptide sequence and the consensus FTLIELVV pilin motif

characteristic for pilin encoded in the MSHA cluster of V. cholerae O1 biovar El Tor

strain N16961 (Heidelberg et al. 2000).

Gene-specific mutagenesis by homologous recombination

As candidate gene for the gene-specific mutagenesis of the MSHA type IV pilus, the

MSHA pilin-encoding gene mshB was selected from the predicted M. adhaerens

HP15 MSHA cluster (Fig. 1). The gene-specific mutagenesis by homologous

recombination was performed according to Hoang et al. (1998). The sequences of the

primers used in this study are listed in Table 2. A mutagenic construct containing a

chloramphenicol cassette bordered by upstream and downstream flanking regions of

the mshB gene was created as follows. A 1,003-bp upstream and a 1,001-bp

downstream region of the mshB gene were PCR amplified using the primers

MshBupF/MshBupR and MshBdownF/MshBdownR, respectively. Both fragments

were sub-cloned into the pGEM®-T Easy vector (Promega, Manheim, Germany)

resulting in plasmids pMshB-up and pMshB-down, respectively.

106


A 1,300-bp DNA fragment containing the chloramphenicol resistance cassette was

PCR amplified from plasmid pFCM1 using primers CmF/CmR. The fragment was

treated with NheI and sub-cloned into NheI-treated pMshB-up resulting in plasmid

pMshB-up-Cm. The latter plasmid was then treated with enzymes AvrII and Eco81I,

and the resulting fragment was ligated into AvrII- and Eco81I- treated plasmid

pMshB-down resulting in a plasmid containing the final 6,319-bp mshB mutagenic

construct. The mutagenic construct was electroporated into competent wild type M.

adhaerens HP15 cells according to Sonnenschein et al. (2011), and the resulting

mutants were selected on 25 µg ml-1 chloramphenicol containing MB agar plates. A

successful double cross-over event for the resulting ∆mshB mutant was confirmed by

PCR using a combination of primers listed in Table 2 resulting in the expected

fragments for the wild type and the mutated mshB gene, respectively.

Table 2: Oligonucleotide primers used in this study. Underlined are restriction recognition sites Primer name Sequence 5′′′′ – 3′′′′ Primers for the creation of the mshB mutagenic construct MshBupF ACCACACCCGCCAGGGAA MshBupR CCTNAGGCCTAGGGCTAGCCCTGTTTGCCAGCCGCTC MshBdownF GACCTAGGCCGTTCTTCCTGCTCCCG MshBdownR GACCTNAGGAACAGGGGCGGCTGACCT CmupF AGCTGGCTAGCGGATGTGCTGCAAGGCGA CmupR AGCTGGCTAGCGCCAAGCTTGCATGCCTG Primers for the confirmation of the ∆mshB mutant MshBF TATTGGTGACCACAGAGC MshBR TGATGCAGTACGACAGGA CmF AGCTCGAATTGGGGATCT CmR AAGATCCCCTGATTCCCT MshBupCmF GGCCACACTGATAATCAC MshBupCmR CGGTGGTATATCCAGTGA MshBdownCmF CGCAAGGCGACAAGGTGC MshBdownCmR CGTGCTGGGCGTTCTGTG

107


Figure 1: MSHA cluster in M. adhaerens HP15

Schematic representation of M. adhaerens HP15 MSHA type IV pilus cluster as compared to (A) P. tunicata D2 and (B) V. cholerae O1 biovar El Tor str. N16961. The entrire locus of M. adhaerens HP15 is 16.6 kb in length and consists of 16 continuous ORFs (mshI1I2JKLMNEGFBCDOPQ). The scale bar represents approximately 2 kb. The gray-scale codes depict the percentages of protein similarity with black shading representing > 70% similarity, dark grey > 60%, pale grey > 40% and white representing no similarity.

Phenotypic mutant characterization by swimming assay and by in vitro biofilm

assays

The swimming behavior of M. adhaerens HP15 and its mutants ∆fliC, fliG::Tn5 and

∆mshB was investigated by soft-agar assay as described by Sonnenschein et al.

(2012). In vitro biofilm assays were performed according to O’Toole (2011) with

minor modifications as follows. Bacterial cultures were grown overnight at 28 °C in

MB medium with shaking at 250 rpm. Subsequently, cultures were tenfold diluted

with MB and their optical densities (OD600) adjusted to ensure similar starting values.

600-µl aliquots of the diluted cultures were then incubated in 1.5 ml polypropylene

microtubes for 24 hrs at 37°C without shaking.

108


The tubes were subsequently thoroughly washed with distilled water, air-dried, and

the wall-attached cells were stained with 700 µl of 0.1% crystal violet for 20 mins.

After staining, tubes were thoroughly washed with distilled water and photographed.

Finally, attached and stained cells were washed off the walls with 95% ethanol for

spectrophotometric quantification at 600 nm.

Attachment assay with axenic T. weissflogii

To quantify the percentage of bacterial cells attached to the diatom T. weissflogii,

attachment assays were performed according to Gaerdes et al. (2011) with some

modifications. The axenic diatom cultures were grown in f/2 medium and harvested at

the stationary growth phase. Approximately 5,000 diatom cells ml-1 were incubated

with approximately 1x106 bacterial cells ml-1 for 24 and 48 hrs at room-temperature in

darkness. After incubation, the culture was gently mixed and passed through a 10-µm

pore size sieve (Sefar, Heiden, Switzerland) to separate diatom-attached bacteria from

the non-attached fraction. The enumeration of bacteria was performed by dilution

plating and counting of the colony-forming units (CFU ml-1) for both the attached and

non-attached bacteria. The experiment was conducted in three replicates in three

independent experiments.

Quantification of TEP production

TEP production was measured colorimetrically in triplicates by filtration of samples

onto 0.4-µm pore size polycarbonate filters (Sartorius, Goettingen, Germany) and

subsequent staining with Alcian blue following the procedure described by Passow

and Alldredge (1995). The staining solution was calibrated using Gum Xanthan, and

TEP was expressed as Gum Xanthan equivalents per liter (GXeq L-1). The Alcian

blue-stained filters were soaked in 80% sulphuric acid for 2 hrs and mixed every 30

minutes. The Alcian blue from the filters were spectrophotometrically measured at

787 nm.

109


RESULTS

The putative MSHA type IV pili biogenesis locus of M. adhaerens HP15

Analysis of the M. adhaerens HP15 genome revealed a putative MSHA type IV pilus

gene cluster which was found to be conserved with respect to the homology of the

predicted amino acid sequences and with respect to the similarity in the organization,

orientation and arrangement of its genes to those of the MSHA type IV pilus clusters

found in the genomes of V. cholerae O1 biovar El Tor strain N16961 and P. tunicata

D2 (Fig. 1). The genetic locus required for the assembly and secretion of M.

adhaerens HP15 MSHA type IV pilus was localized to a 16.6-kb region of the M.

adhaerens HP15 chromosome and contains 16 MSHA-related genes termed

mshI1I2JKLMNEGFBCDOPQ. With exception of the mshA gene, M. adhaerens

HP15 contains all MSHA-related genes present in the MSHA clusters of P. tunicata

D2 and V. cholerae O1 biovar El Tor strain N16961 (Fig. 1). A comparative analysis

of the M. adhaerens HP15 MSHA cluster with the genome of M. aquaeolei VT8

(Accession No. CP000514, Copeland et al. 2006) revealed that both Marinobacter

species possess highly homologous msh genes (data not shown).

Mutagenesis of mshB by homologous recombination

Electroporation of the mshB mutagenic construct into M. adhaerens HP15 cells

yielded three transformants on MB agar plates supplemented with chloramphenicol.

Transformants were checked with a combination of primer pairs (Table 2) to

distinguish transformants that had either undergone a single or a double cross-over

event. Mutant ∆mshB was created from a successful double cross-over event where

both the upstream and downstream flanking regions of the mshB gene have undergone

homologous recombination with the wild type chromosome and the mshB gene was

replaced by the chloramphenicol resistance cassette. The primer pair MshBF/MshBR

contained intragenic primers of mshB and as expected, no PCR product was obtained

with ∆mshB whereas mshB gene with an amplicon size of 510 bp was amplified in the

wild type.

110


In contrast, CmF/CmR amplifies the chloramphenicol cassette and as expected,

∆mshB yields a 1,052-bp product whereas the wild type of M. adhaerens HP15 did

not (data not shown). Two additional sets of primers, MshBupCmF/MshBupCmR and

MshBdownCmF/MshBdownCmR, were used to yield expected PCR product sizes

thus confirming the genotype of mutant ∆mshB (data not shown).

Mutant ∆mshB, the wild type of HP15, and the two previously generated mutants

∆fliC and fliG::Tn5 were subsequently incubated as diatom-free batch cultures in MB

broth as well as in f/2 medium revealing no significant growth differences among

each other in either of the media (data not shown).

Phenotypic mutant characterization by swimming assay and by in vitro biofilm

assays

Previously it had been demonstrated that HP15 mutants ∆fliC and fliG::Tn5 were

deficient in their swimming ability by soft-agar assays (Sonnenschein et al. 2011).

The phenotypes of both mutants could be confirmed. As expected, the swimming

ability of mutant ∆mshB, which carries a functional flagellum, was not affected and

resembled that of the wild type (data not shown).

In vitro biofilm assays conducted on polypropylene microtubes acting as abiotic

surfaces revealed that all three motility mutants were impaired in attachment and

biofilm formation (Fig. 2A). Interestingly, HP15 mutants ∆fliC and fliG::Tn5 were

found to be more severely impacted as compared to mutant ∆mshB when attachment

was quantified (Fig. 2B). Samples of the crystal-violet-stained M. adhaerens HP15

wild type displayed an average absorbance of 1.9 ± 0.08, which was approximately

three-fold higher than those of the crystal-violet-stained samples of mutants ∆fliC and

fliG::Tn5 and approximately two-fold higher than samples of the crystal-violet-

stained ∆mshB mutant (Fig. 2B) thus confirming the visual estimations and

suggesting a stronger role of the flagellum for attachment as compared to the MSHA

type IV pilus.

111


(A)

(B)

Figure 2. Biofilm formation of M. adhaerens HP15 and its motility deficient

mutants

Biofilm formation phenotype of M. adhaerens HP15 and its motility deficient mutants ∆fliC, fliG::Tn5 and ∆mshB. Bacterial strains were incubated on polypropylene surfaces for 24hrs at 37°C. (A) Visualization of attached bacterial cells stained with 0.1 % crystal violet (B) Quantification of crystal violet dissolved in 96% ethanol and absorbance measured spectrophotometrically at a wavelength of 600 nm. Data are from the average of 12 samples from 4 independent experiments. Bars represent standard errors. All the bacterial strains are significantly different from the MB only control with P < 0.01. Compared to the wild type HP15, all the mutants are significantly different with P < 0.01. ∆fliC and fliG::Tn5 values are not significantly different with P > 0.01. ∆mshB is significantly different from both ∆fliC and fliG::Tn5 mutants with P < 0.01.

112


Flagellum and MSHA Type IV pilus promote bacterial attachment to T.

weissflogii

In order to analyze a potential impact of the cellular appendages on the cell-to-cell

interaction of M. adhaerens HP15 and the diatom, T. weissflogii, attachment assays

were conducted. Bacterial abundances of HP15 wild type and its mutants expressed as

CFU ml-1 did not statistically differ at the start of the experiment (Table 3). After 24

hrs of co-incubation with the diatom cells, however, the total cell numbers (sum of

attached and free-living cells) for the ∆fliC and fliG::Tn5 mutants had significantly

increased, whereas those of the wild type and ∆mshB had not (Table 3). Interestingly,

the percentage of bacterial cells attached to the diatoms was significantly reduced for

the ∆fliC and fliG::Tn5 mutants as compared to those of the wild type and the mshB

mutant (Fig. 3). The percentage of attached ∆mshB mutant cells was also significantly

reduced with respect to the HP15 wild type, however to a lesser extent. After 24 hrs,

the fraction of bacterial cells attached to the diatom was 15.27 ± 2.21 % for the wild

type, only 1.85 ± 0.47 % and 1.65 ± 0.36 % for the ∆fliC and fliG::Tn5 mutants,

respectively, and 5.31 ± 0.9 % for mutant ∆mshB (Fig. 3A) thus confirming data of

the in vitro biofilm formation assay. Results of the experiment after 48 hrs of

incubation did not differ from those obtained after one day of incubation (Fig. 3B).

The finding that phenotypes did not differ between the two flagellum mutants

indicated that the flagellar hook structure is not sufficient to allow bacterial

attachment and that a fully functional flagellum is a pre-requisite for attachment of M.

adhaerens HP15 to abiotic and biotic surfaces.

Table 3: Bacterial cell dynamics for T. weissflogii attachment assay

Bacterial cell

abundance

( x 106 ) CFU ml-1

Avg ± SE

Wild type ∆ fliC fliG::Tn5 ∆mshB

t = 0, total 0.81 ± 0.23 1.35 ± 0.40 1.23 ± 0.32 0.87 ± 0.22

t = 24 hrs, total 0.54 ± 0.09 3.59 ± 0.48 * 3.16 ± 0.52 * 0.97 ± 0.08

t = 48 hrs, total 1.02 ± 0.21 4.00 ± 0.24 * 3.19 ± 0.48 * 1.11 ± 0.16

* P < 0.01

113


(A)

(B)

Figure 3. Percentage of bacterial cells attached to T. weissflogii

% of M. adhaerens HP15 wild type cells and the mutants ∆fliC, fliG::Tn5 and ∆mshB attached to stationary phase T. weissflogii diatoms after (A) 24hrs and (B) 48 hrs of incubation in f/2 medium. Data are from triplicates from 3 independent experiments.

114

ATTACHMENT OF MARINOBACTER ADHAERENS HP15 TO THALASSIOSIRA WEISSFLOGII IS NOT ESSENTIAL FOR THE INDUCTION OF TRANSPARENT EXOPOLYMERIC PARTICLES FORMATION Quantification of TEP production

To test whether cellular appendages-mediated bacterial attachment impacted algal

TEP formation, TEP concentrations of the diatom cultures incubated with either, the

wild type of M. adhaerens HP15, or its ∆fliC, fliG::Tn5 and ∆mshB mutants were

analyzed. The TEP concentrations of all treatments at the start of the experiment were

not statistically different from each other (Fig. 4). After 24 or 48 hrs of co-incubation

TEP concentrations increased approximately two- to three-fold in all treatments

without any statistically significant difference among treatments (P > 0.01). This

surprising result suggested that the observed differences in cellular attachment of the

different bacterial mutants did not impact TEP production at all.

Figure 4. TEP quantification of the different treatments TEP concentration in diatom cultures incubated with M. adhaerens HP15 and the motility-impaired mutants. The average TEP concentration at the start of the experiment did not significantly differ between the treatments (P > 0.01). Approximately 2-3 fold increase in TEP concentration was observed in all the treatments after both 24 hrs and 48 hrs of incubation (P < 0.01). TEP production between the samples however did not statistically differ after either of the incubation times (P > 0.01).

115


DISCUSSION

In this study, a MSHA type IV pilus gene locus comprised of the genes

mshI1I2JKLMNEGFBCDOPQ was identified in the genome of M. adhaerens HP15,

which showed a similar genetic organization and high protein sequence similarities to

homologous clusters of V. cholerae O1 biovar El Tor str. N16961 and P. tunicata D2

(Heidelberg et al. 2000, Moran et al. 2006). The genome of M. aquaeolei also seems

to contain similarily conserved MSHA type IV pili clusters. The MSHA type IV pilus

cluster was first described in marine Vibrio species (Marsh & Taylor 1999, Shime-

Hattori et al. 2006) and thereafter identified in Shewanella oneidensis MR-1

(Thormann et al. 2004) and in P. tunicata D2 (Dalisay et al. 2006). The lack of

significant sequence similarities of the herein detected cluster with that of S.

oneidensis MR-1 might reflect a further taxonomic divergence.

Vibrio mutants defective in the formation of the MSHA pili have been shown to be

defective in adherence to zooplankton and crustaceans (Chiavelli et al. 2001).

Transposon mutagenesis of P. tunicata D2 confirmed that mutants defective in the

biosynthesis of the MSHA type IV pilus exhibited severe impairment of the bacterial

attachment to the algae Ulva australis (Dalisay et al. 2006). These previous

observations suggested that the MSHA type IV pilus might play a significant role for

attachment of the investigated microbes to biotic surfaces. Likewise, MSHA type IV

pilus-mediated attachment to abiotic surfaces was demonstrated for S. oneidensis MR-

1 (Thormann et al. 2004). Our data are in line with either of these findings since the

M. adhaerens HP15 ∆mshB mutant showed significant reduction in attachment to

both the abiotic and the diatom surface. It was observed that the impact of the

flagellum in attachment is more pronounced than that of the MSHA type IV pilus. By

testing the attachment of two individual M. adhaerens HP15 flagellum mutants, ∆fliC

and fliG::Tn5, it was shown that the bacterial hook structure is not sufficient for the

bacteria to attach to surfaces and that a fully-functional flagellum is imperative for

this attachment. These results are in line with observations previously made by

O'Toole and Kolter (1998) who had demonstrated the importance of flagellar motility

by comparing attachment of motile and non-motile P. aeruginosa strains to plastic

surfaces under static biofilm culture conditions.

116


The current study showed that the interaction of M. adhaerens HP15 to both abiotic

and T. weissflogii surfaces initially depended on the attachment of the bacteria

through its flagellum. It is tempting to speculate that sustained attachment might

thereafter be mediated by i.e. the MSHA type IV pilus. To substantiate this idea,

future studies will focus on estimating the differential expression of msh genes

throughout the course of the interaction.

Not easy to interpret is the puzzling finding that – despite significant lower number of

attached cells – the total cell numbers of the flagellum-deficient mutants at the end of

the diatom attachment assays were higher than those of the wild type. Since all

mutants showed a growth pattern indistinguishable from that of the wild type in

diatom-free batch cultures, at least two possible scenarios may be envisioned: a) non-

attaching cells are replicating faster than attached cells; or b) there are technical

difficulties separating attached cells from the diatom surfaces or from each other thus

yielding lower CFU ml-1 numbers. Should the later scenario hold true, the actual

number of attached wild type cells were higher than determined. Therefore, future

studies will emphasize on direct three-dimensional microscopic investigations using

confocal laser scanning microscopy and fluorescently labeled bacterial cells.

Algal carbon exudation in form of TEP has been shown to increase in presence of

specific bacteria (Grossart et al. 1999, Gaerdes et al. 2011). Herein, it was

hypothesized that the induction of diatom-borne TEP depended on the attachment of

M. adhaerens HP15 to T. weissflogii. Results of our study, however, did not support

this hypothesis since neither, disruption of the flagellum and the MSHA type IV pilus,

nor decreased attachment of the respective mutants led to significant differences in

TEP formation as compared to that induced by the wild type. Although it cannot be

ruled out that attachment of M. adhaerens HP15 to the diatom may induce a different

type(s) of carbon exudates not detectable with the currently applied method, it may be

additionally speculated that other yet-to-be-determined genetic traits are responsible

for the induction of TEP formation in the investigated interaction.

117


In conclusion, results of this study hint at a potentially high complexity of the marine

diatom-bacteria interactions and prompt further investigations on the nature of carbon

exudates produced as well on additional bacterial genes required for its induction.

Consequently, our future attempts will focus on identifying M. adhaerens HP15 gene

products specifically expressed during the interaction using in vivo expression

technology (Darwin 2005) and on the development of additional carbon exudate

detection methods using i.e. differential lectin staining approaches (Wigglesworth-

Cooksey and Cooksey 2005).

ACKNOWLEDGEMENTS

The authors thank Caitlin Fairfield for valuable technical help and suggestions. This

work was funded by the Helmholtz Graduate School for Polar and Marine Research

and the Marine Science Institute, University of California Santa Barbara.

118


REFERENCES

Alldredge AL, Passow U, Logan BE. (1993). The abundance and significance of a class of large, transparent organic particles in the ocean. Deep-Sea Res. I. 40:1131-1140 Alldredge AL. (1995). The potential role of particulate diatom exudates in forming nuisance mucilaginous scums. Ann Ist Super Sanita 35 (3): 397 - 400 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990). Basic local alignment search tool. J. Mol. Biol. 215: 403-410 Azam F. and Malfatti F. (2007). Microbial structuring of marine ecosystems. Nature Reviews 5:782-791 Bratbak G. and Thingstad TF. (1985). Phytoplankton-bacteria interactions: an apparent paradox? Analysis of a model system with both competition and commensalisms. Mar. Ecol. Prog. Ser. 25: 23:30 Bruckner CG, Bahulikar R, Rahalkar M, Schink B, Kroth PG (2008). Bacteria associated with benthic diatoms from Lake Constance: phylogeny and influences on diatom growth and EPS secretion. Appl. Environ. Microbiol. 47(24): 7740-7749 Bruckner CG, Rehm C, Grossart HP, Kroth PG (2011). Growth and release of extracellular organic compounds by benthic diatoms depend on interactions with bacteria. Environ. Microbiol. 13(4): 1052-1063 Chiavelli DA, Marsh JW, Taylor RK. (2001). The mannose-sensitive hemagglutinin of Vibrio cholerae promotes adherence to zooplankton. Appl. Environ. Microbiol. 67 (7): 3220-3225 Chin WC, Orellana MV, Verdugo P. (1988). Spontaneous assembly of marine dissolved organic matter into polymer gels. Nature 391: 568-572 Copeland A, Lucas S, Lapidus A, Barry K, Detter JC, Glavina del Rio T, Hammon N, Israni S, Dalin E, Tice H, Pitluck S, Kiss H, Brettin T, Bruce D, Han C, Tapia R, Gilna P, Schmutz J, Larimer F, Land M, Hauser L, Kyrpides N, Kim E, Edwards K, Richardson P. (2006). Complete sequence of chromosome 1 of Marinobacter aquaeolei VT8. Submitted (DEC-2006) to the EMBL/GenBank/DDBJ databases. Dalisay DS, Webb JS, Scheffel A, Svenson C, James S, Holmstrom C, Egan S, Kjelleberg S. (2006). A mannose-sensitive haemagglutinin (MSHA)-like pilus promotes attachment of Pseudoalteromonas tunicata cells to the surface of the green alga Ulva australis. (2006). Microbiology 152: 2875-2883

119


Danger M, Leflaive J, Oumarou C, Ten-Hage L, Lacroix G. (2007). Control of phytoplankton-bacteria interactions by stoichiometric constraints. Oikos 116 (7): 1079-1086 Darwin AJ (2005) Genome-wide screens to identify genes of human pathogenic Yersinia species that are expressed during host infection. Curr Issues Mol Biol 7: 135-150. Dicker RA. (2011). Release of extracellular polymeric substances (EPS) by Aurelia aurita and mucus blob flux. MS dissertation. University of Massachusetts Boston. Gaerdes A, Kaeppel EC, Shehzad A, Seebah S, Teeling H, Yarza P, Glöckner FO, Grossart HP, Ullrich MS. (2010). Complete genome sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine microorganism. Stand. Genomic Sci. 3: 97-107 Gaerdes A, Iversen MH, Grossart HP, Passow U, Ullrich MS (2011). Diatom-associated bacteria are required for aggregation of Thalassiosira weissflogii. ISME J. 5:436-454 Gaerdes A, Ramaye Y, Grossart HP, Passow U, Ullrich MS. (submitted). Effects of Marinobacter adhaerens HP15 on polymer exudation by Thalassiosira weissflogii at different N:P ratios. Graff JR, Rines JEB, Donaghay PL (2011). Bacterial attachment to phytoplankton in the pelagic marine environment. Mar. Ecol. Prog. Ser. 441:15-24 Grossart HP (1999). Interactions between marine bacteria and axenic diatoms (Cylindrotheca fusiformis, Nitzschia laevis, and Thalassiosira weissflogii) incubated under various conditions in the lab. Aquat Microb Ecol. 19: 1-11. Grossart HP, Schlingloff A, Bernhard M, Simon M, Brinkhoff T (2004). Antagonistic activity of bacteria isolated from organic aggregates of the German Wadden Sea. FEMS Microbiol. Ecol. 47:387-396 Guillard, R.R.L. and Ryther, J.H. (1962). Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt and Detonula confervacea Cleve. Can. J. Microbiol. 8:229-239. Guillard, R.R.L. (1975). Culture of phytoplankton for feeding marine invertebrates. pp 26-60. In Smith W.L. and Chanley M.H (Eds.) Culture of Marine Invertebrate Animals. Plenum Press, New York, USA.

120


Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dosdon RJ, Haft DH, Hickey EK, Peterson JD, Umayam L, Gill SR, Nelson KE, Read TD, Tettelin H, Richardson D, Ermolaeva MD, Vamathevan J, Bass S et al. (2000). DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406 (6795): 477 - 483 Hoang TT, Karkhoff-Schweizer RAR, Kutchma AJ, Schweizer HP. (1998). A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: 77-86 Hsiao A, Liu Z, Joelsson A, Zhu J. (2006). Vibrio cholerae virulence regulator-coordinated evasion of host immunity. PNAS 103 (39): 14542 - 14547 Kaeppel EC, Gaerdes A, Seebah S, Grossart HP, Ullrich MS. (2012). Marinobacter adhaerens sp. nov., isolated from marine aggregates formed with the diatom Thalassiosira weissflogii. Int. J. Syst. Evol. Microbiol. 62: 124-128 Kaczmarska I, Ehrman JM, Bates SS, Green DH, Léger C, Harris J. (2005). Diversity and distribution of epibiotic bacteria on Pseudo-nitzchia multiseries (Bacillariophyceae) in culture, and comparison with those diatoms in native seawater. Harmful algae 4: 725-741 Kogure K, Ikemoto E,Morisaki H (1998). Attachment of Vibrio alginolyticus to glass surfaces is dependent on swimming speed. J. Bacteriol 180: 932-937 Marsh JW and Taylor RK. (1999). Genetic and transcriptional analyses of the Vibrio cholerae mannose-sensitive hemagglutinin type 4 pilus gene locus. J. Bacteriol. 181: 1110-1117 Martinez RM, Jude BA, Kirn TJ, Skorupski K, Taylor RK. (2010). Role of FlgT in anchoring the flagellum Vibrio cholerae. J. Bacteriol. 192 (8): 2085-2092 Moran MA, KjellebergS, Egan S, Saunders N, Thomas T, Ferriera S, Johnson J, Kravitz S, Halpern A, Remington K, Beeson K, Tran B, Rogers YH, Friedman R., Venter JC. (2006). The Pseudoalteromonas tunicata D2 whole genome shot-gun project. Submitted (FEB-2006) to the EMBL/GenBank/DDBJ databases. Morisaki H, Nagai S, Ohshima H, Ikemoto E, Kogure K. (1999). The effect of motility and cell-surface polymers on bacterial attachment. Microbiology 145:2797-2802 Nyholm SV, McFall-Ngai MJ. (2004). The Winnowing: Establishing the Squid–Vibrio Symbiosis. Nat. Rev. Microbiol., 2 (8): 632-42.

121


O'Toole, G. A., and R. Kolter. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304. O'Toole, G. A. Microtiter Dish Biofilm Formation Assay. J. Vis. Exp. (47), e2437, DOI: 10.3791/2437 (2011) Passow U and Alldredge AL. (1994). Distribution, size, and bacterial colonization of transparent exopolymer particles (TEP) in the ocean. MEPS 113:185-198 Passow U. and Alldredge AL. (1995). A dye-binding assay for the spectrophotometric measurement of transparent exopolymer particles (TEP). Limnol. and Oceanogr. 40 (7): 1326-1335 Passow U. (2000). Formation of transparent exopolymer particles, TEP, from dissolved precursor material. Mar. Ecol. Prog. Ser. 192:1-11 Passow U. (2002). Transparent exopolymer particles (TEP) in aquatic environments. Prog. Oceanogr. 55: 287-333 Ramaiah N., Yoshikawa T. and Furuya K. (2001). Temporal variations in transparent exopolymeric particles (TEP) associated with a diatom spring bloom in a subarctic ria in Japan. Mar. Ecol. Prog. Ser. 212:79-88 Reche I, Carillo P, Cruz-Pizarro. (1997). Influence of metazooplankton on interactions between bacteria and phytoplankton in an oligotrophic lake. J. Plankt. Res.19 (5): 631-646 Shime-Hattori A, Iida T, Arita M, Park KS, Kodama T, Honda T. (2006). Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation. FEMS Microbiol. Lett. 264: 89-97. Smith DC, Steward GF, Long RA, Azam F. (1995). Bacterial mediation of carbon fluxes during a diatom bloom in a mesocosm. Deep-Sea Res. II 42: 75-97 Sonnenschein E.C., Gärdes A., Seebah S., Torres-Monroy I., Grossart H.P. and Ullrich M.S. (2011). Development of a genetic system for Marinobacter adhaerens HP15 involved in marine aggregate formation by interacting with diatom cells. J. Microbiol. Methods. 87 (2): 176-183 Stoderegger KE., Herndl G.J. (1999). Production of exopolymer particles by marine bacterioplankton under contrasting turbulence conditions. Mar. Ecol. Prog. Ser. 189:9-16 Thormann KM, Saville RM, Shukla Soni, Pelletier DA, Spormann AM. (2004). Initial phases of biofilm formation in Shewanella oneidensis MR-1. J. Bacteriol. 186 (23) 8096-8104.

122


Vaqué D, Duarte CM, Marassé C. (1989). Phytoplankton colonization by bacteria: encounter probability as a limiting factor. Mar. Ecol. Prog. Ser. 54:137-140. Verdugo P., Alldredge AL., Azam F., Kirchman D., Passow U., Santschi P. (2004). The oceanic gel phase: a bridge in the DOM-POM continuum. Mar. Chem. 92: 67-85 Verdugo P. (2012). Marine microgels. Annu. Rev. Mar. Sci. 4: 375-400 Wong E, Vaaje-Kolstad G, Ghosh A, Hurtado-Guerrero R, Konarev PV et al. (2012). The Vibrio cholerae Colonization Factor GbpA Possesses a Modular Structure that Governs Binding to Different Host Surfaces. PLoS Pathog 8(1): e1002373. doi:10.1371/journal.ppat.1002373 Wigglesworth-Cooksey B, Cooksey KE (2005) Use of fluorophore-conjugated lectins to study cell-cell interactions in model marine biofilms. Appl Env Microbiol 71:428-435 Zobell CE. (1941). Studies on marine bacteria. I. The cultural requirements of heterotrophic aerobes. J Mar Res 4: 42-75

123

Chapter 3

Combined effects of lowered pH and elevated temperature on diatom-bacteria interactions

124

COMBINED EFFECTS OF LOWERED pH AND ELEVATED TEMPERATURE ON DIATOM-BACTERIA INTERACTIONS

3.1.5 Combined effects of lowered pH and elevated temperature on diatom-bacteria interactions

The following manuscript is in preparation

125


Combined effects of lowered pH and elevated temperature

on diatom-bacteria interactions

Shalin Seebah1, Cai t l in Fai r f ie ld2, Matthias S. Ullrich1 and Uta Passow2*

1Molecular Life Science Research Center, Jacobs University Bremen, Bremen,

Germany

2 Marine Science Institute, University of California Santa Barbara, CA, USA


Marine Science Institure

University of California Santa Barbara

CA 93106

USA

Tel: +49 421 200 3245

[email protected]

Keywords: ocean acidification, temperature, TEP, marine aggregates, climate change,

diatom, Thalassiosira weissflogii, Marinobacter adhaerens HP15

126


ABSTRACT

As atmospheric carbon dioxide concentrations continue to rise, the question of

how marine pelagic ecosystems and biogeochemical cycling of elements will react

to increasing ocean acidification and elevated temperatures has become a subject

of intense investigations. In this study, the combined effects of a lowered pH and

elevated temperature on transparent exopolymeric particle and marine

aggregate formation were studied in roller tank experiments. Aggregates were

formed either from axenic cultures of the diatom Thalassiosira weissflogii or with

the diatom cultures co-inoculated with the marine bacterium M. adhaerens

HP15. The carbonate system was manipulated to reflect present-day conditions

with a pH range of 8.0 – 8.2 and two different future ocean scenarios with a pH

range of 7.6 – 7.8 and 7.4 – 7.6 respectively. The experiments were conducted at

15 °°°°C or 20 °°°°C.

Our results show that the growth of the diatom T. weissflogii is not significantly

impacted by the tested levels of ocean acidification, but that its growth is favored

under elevated temperatures. Furthermore, it was shown that synergistic effects

of ocean acidification and temperature may have a pronounced impact on TEP

production in axenic cultures of the diatoms, but not in presence of bacteria. We

further show that the combined effects of decreasing pH and elevated

temperatures substantially reduce marine aggregate formation and the sinking

velocities of aggregates. We conclude that the vertical export of particulate

organic matter through marine aggregates may be severely impacted in a future

ocean, depending on the magnitude and on the vertical depth penetration of

warming in the ocean.

127


INTRODUCTION

The majority of particulate organic carbon (POC) sinks out of the marine euphotic

zone in the form of marine snow (Fowler and Knauer 1986). Marine snow can either

be produced de novo by marine plankton or by the physical coagulation of smaller

particles (Alldredge and Silver 1988). The coagulation of particles to form larger

marine aggregates is enhanced by the presence and abundance of transparent

exopolymeric particles (TEP) and specific bacteria (Alldredge et al. 1993, Passow and

Alldredge 1994, Gaerdes et al. 2011). These ubiquitously distributed and abundant

particles have been found in all marine aggregates investigated to date (Alldredge et

al. 1993, Passow and Alldredge 1994, Passow 2002). TEP are formed by a variety of

pathways, but in marine pelagic systems, they are predominantly formed by the

abiotic assembly of dissolved organic carbon (DOC) polymers which subsequently

coagulate into nano-, micro- and ultimately macrogels which can be up to several

centimeters in size (Chin et al. 1998, Verdugo et al. 2004, Verdugo 2012).

Since the age of the industrial revolution, CO2 emissions from the burning of fossil

fuels and changes in land use have increased atmospheric CO2 concentrations from

pre-industrial values of 280 ppm to currently 390 ppm

(http://www.esrl.noaa.gov/gmd/ccgg/trends, data by Tans and Keeling,

NOAA/ESRL). Values are expected to rise to 750 ppm (IPCC scenario IS92a, IPCC

2007) or even beyond 1,000 ppm by the end of this century (Raupach et al. 2007). As

atmospheric CO2 concentrations continue to rise, the question of how the marine

pelagic ecosystems and biogeochemical cycling of elements will react to increasing

ocean acidification has become a subject of intense investigations. Ocean acidification

results from an increase of dissolved inorganic carbon (DIC) and a concomitant

decrease in pH (Zeebe and Wolf-Gladrow 2001). The increasing atmospheric CO2

concentrations do not solely result in ocean acidification but are coupled to intensified

radiative forcing which results in higher sea-surface temperatures (Houghton et al.

1995).

128


Studies addressing the impact of elevated atmospheric CO2 on TEP production have

revealed very different results with partially contradicting conclusions. In their

mesocosm studies, for example, Engel et al. (2004) showed that the net production of

TEP in the presence of the phytoplankton Emiliana huxleyi increased with an

increased pCO2 level of 710 µatm. In contrast, Egge et al. (2009) showed no

significant change in net TEP production with increasing pCO2. Furthermore, Wetz et

al. (2009) reported opposing trends in a long-term monitoring of TEP distributions in

an estuary. They observed that TEP concentrations showed clear seasonal and spatial

patterns, and that TEP distributions were positively correlated with pH but negatively

correlated with temperature.

Further studies in this discipline have largely focused on microbial community

dynamics in mesocosms (Riebesell 2008) and on specific investigations looking at the

impact of calcification on calcifying organisms such as coccolithophores (Biermann

and Engel 2010). It had been argued that the expected changes in pH will have little

impact on non-calcifying marine microbes (Berge et al. 2010, Joint et al. 2010)

although this assumption was been disputed (Liu et al. 2010). Despite the striking

differences in the above studies, it became clear that TEP concentrations in the

environment are not in steady state but vary with changes in environmental conditions

depending on the group of organisms being studied. Although there is a lot of studies

in this field, investigations on the combined impact of ocean acidification and

temperature increases remained scarce. To our knowledge, no investigations have yet

been conducted on the impact of future ocean scenarios on microbial interactions,

especially on diatom-bacteria interactions.

Certain specific bacterial strains have been shown to directly induce diatom-borne

TEP production and aggregate formation of the diatom Thalassiosira weissflogii

(Gaerdes et al. 2011). This observation has led to the establishment of a genetically

accessible bilateral model system consisting of that diatom and the marine

gammaproteobacterium Marinobacter adhaerens HP15 (Gaerdes et al., 2010, Gaerdes

et al. 2011, Sonnenschein et al. 2011, Kaeppel et al. 2012).

129


In the current study, the combined effects of changing the carbonate chemistry and

temperature on this established bilateral model system was investigated. Thus, we

present results on the impact of future ocean scenarios on TEP production and

aggregate formation in an in vitro established diatom-bacteria model system.


Experimental design

Six experimental set-ups were conducted to investigate the combined effects of

changing marine carbonate chemistry and temperature on TEP production and marine

aggregate formation. The experiments focused on the established bilateral model

system consisting of the diatom T. weissflogii and the marine bacterium M. adhaerens

HP15. Axenic diatom cultures were included as controls to investigate the effects of

the presence of bacteria on diatom aggregation and TEP formation. Three different

carbonate chemistry regimes were selected to reflect: (i) the present-day conditions,

with the partial pressure of CO2 (pCO2) ranging between 300-350 µatm (termed

ambient) and (ii) two future ocean scenarios with pCO2 ranging from 750-850 µatm

(designated future 1) and 1000-1250 µatm (referred to as future 2). For each

carbonate chemistry regime, two temperatures were chosen, 15 °C and 20 °C,

respectively. (Table 1).

Prior to conducting the experiments, the diatom and bacterial cultures were

acclimatized to the different temperature and carbonate chemistry regimes for more

than 8 generations (for details see below). After acclimatization, experiments were

conducted in duplicates in roller tanks at 15 °C and 20 °C, respectively, in darkness.

Roller tanks were 1.15-L plexiglass cylinders with a diameter of 14 cm and a depth of

7.47 cm rotated on a roller table with three rotations per minute (rpm), which assured

that growing aggregates remained suspended at all times.

The carbonate chemistry of the experimental media was perturbed by manipulating

pH and dissolved inorganic carbon (DIC) concentrations. Total alkalinity (TA), pH

and DIC were monitored during both the acclimatization and experimental phases.

TEP concentrations were quantified at the onset of the experiments. The experiments

were terminated after 96 hrs of incubation and the number and size classes of the

130


formed aggregates determined in each tank. The aggregates were then removed, their

sinking velocities determined and the aggregates mixed in a known volume of sterile

seawater. The aggregate fraction will henceforth be called aggregated slurry. The

volume of the aggregated slurry was the difference between the known volume of

sterile seawater and the new volume once all the aggregates were added and shaken

thoroughly to produce a homogeneous suspension for further sampling. After removal

of aggregates, the remaining seawater will henceforth be termed as surrounding

seawater (SSW). TEP concentrations from both the aggreggated slurry and the SSW

were quantified with four replicates each. The carbonate system was determined in

SSW.

Experiment # Carbonate chemistry Temperature Treatments

1 ambient 15 °C Tw only, Tw + HP15

2 future 1 15 °C Tw only, Tw + HP15


4 ambient 20 °C Tw only, Tw + HP15



Table 1. Experimental design showing the different combinations of carbonate

chemistry, temperature and microbial combinations in the respective experiments.

Tw: T. weissflogii and HP15: M. adhaerens HP15

Experimental media

In the course of preliminary tests, it was observed that filtration of natural seawater

through 0.2 µm pore-sized filters (Millipore, MA, USA) did not satisfactorily remove

any bacterial contaminants such as nanobacterial cells passing through the filters and

forming colonies on test agar plates (data not shown). Since the carbonate chemistry

is severely impacted by de-gassing, sterilization of natural seawater by autoclaving

was not an option (Riebesell et al. 2010, pers. observations). Consequently, artificial

131


seawater (ASW) was prepared according to Kester et al. (1967) with modifications to

control the carbonate system. Preparation of the base media was done as follows: Per

kg of ASW, two separate solutions of salts were prepared. The first solution

comprised of the anhydrous salts NaCl, Na2SO4, KCl, KBr and H3BO3 while the

second solution contained the hydrous salts MgCl2.6H20, CaCl2.2H20 and SrCl2. Salt

concentrations were according to Kester et al. (1967). Both solutions were prepared

with MilliQ water and autoclaved separately. When cooled, both solutions were

mixed and 0.172 g of NaHCO3 was added per kg of ASW to yield DIC concentrations

for ambient seawater at 2,050 µmol kg-1. The base experimental medium was

thereafter supplemented with vitamins and trace metal solutions as in F/2 medium

(Guillard & Ryther 1962, Guillard 1975), and macronutrients had final concentrations

of 59 µM nitrate, 3.6 µM phosphate, and 53.5 µM silicic acid.

Carbonate chemistry perturbations

Increasing atmospheric CO2 concentrations alter pCO2, pH and DIC but not the TA of

the surface ocean. These changes can be experimentally mimicked either by bubbling

seawater with pCO2-adjusted air or by chemically altering the seawater using the

closed system approach (Rost et al. 2008). Since TEP production has been shown to

be impacted by bubbling (Mopper et al. 1995, Schuster and Herndl 1995, Zhou et al.

1998), the carbonate system was chemically perturbed. To mimic future ocean

conditions, appropriate amounts of 0.1 M HCl (mL kg-1), 0.1 M NaHCO3 (mL kg-1)

and 0.001 M Na2CO3 (mL kg-1) were added. The respective volumes needed for

additions were calculated using CO2Sys (Lewis and Wallace 1998) with detailed steps

as described in Passow (2011). Measurements of pH and TA confirmed that our

perturbations changed the system as expected and that changes reflected those

anticipated in the future ocean.

Microbial cultures and their acclimatization

Axenic cultures of Thalassiosira weissflogii (CCMP 1336) were obtained from the

Provasoli-Guillard National Center for Marine Algae and Microbiota (Maine, USA).

132


The cultures were acclimatized by incubation for more than 8 generations at 15 °C or

20 °C, respectively, in the manipulated media to reflect the ambient or two different

future treatments. Diatoms were kept in the exponential phase of growth, and regular

dilutions of the cultures were performed to keep the cell density below 60, 000 cells

mL-1. Cell concentrations, pH and TA of the cultures were regularly monitored to

ensure that the carbonate chemistry did not change significantly during pre-cultures.

The cultures were maintained at 50 µE s-1 with a 12-hr light period in 2-L Fernbach

flasks with narrow openings to minimise carbonate system changes due to air

exchange. Diatom cell abundance was monitored daily by counting cells in a

Sedgwick-Rafter Cell S50 (SPI Supplies, West Chester, PA, USA) using an inverted

Axiovert 200 microscope (Zeiss, Jena, Germany). The axenicity of the diatom culture

was intermittently checked by epifluorescence microscopy after staining with the dye

4′, 6-diamidino-2-phenylindol (Porter and Feig 1980).

M. adhaerens HP15 previously isolated from marine particles collected from the

surface waters of the German Bight (Grossart et al. 2004) was acclimatized by

growing cells overnight in marine broth prepared with ASW, which had been

adjusted to reflect the different pCO2 treatments, either at 15 ºC or 20 ºC in sterile

culture flasks with aeration of approximately 250 rpm.

After the acclimatization phase, roller tank experiments were set-up with diatom cells

in a final concentration of approximately 3 x 103 cells ml-1 and bacterial cells, where

present, at a final concentration of approximately 3 x 105 cells ml-1. The microbial

cultures were added to the media prepared as described above and the roller tanks

filled, bubble-free under sterile conditions. Prior to inoculation with the diatom

culture, the bacterial cells were washed twice in sterile seawater to minimize carry-

over of nutrients or bacterial growth-derived matter into the diatom cultures.

Carbonate chemistry analysis

The carbonate system of the experiments was monitored by measuring pH, TA and

DIC. Samples for pH were collected bubble-free in 20-mL scintillation vials and the

pH (total scale) was measured with a spectrophotometer using the indicator dye m-

cresol purple (Sigma-Aldrich) within 1-2 hours of sampling.

133


The measurement temperature was held at 25 ºC and the absorbance measured at 730

nm, 578 nm and 434 nm before and after dye addition (Clayton and Byrne 1993,

Fangue et al. 2010). pH was calculated following the standard of operating procedure

(SOP) 7 ″Determination of the pH of seawater using the indicator dye m-cresol

purple″ (Dickson and Goyet 1994). Samples for TA and DIC measurements were

taken following SOP1 ″Water sampling for the parameters of the oceanic carbon

dioxide system″ (Dickson and Goyet 1994). Samples were poisoned with 0.02%

saturated HgCl2 by volume and sent for analysis to the Dickson Laboratory at the

Scripps Institution of Oceanography, UCSD.

The program CO2Sys (Lewis and Wallace 1998) was used to calculate the carbon

system from TA and pH. The dissociation constants K1 and K2 from Roy et al.

(1993) were used since it has been described as the most appropriate for ASW (Zeebe

and Wolf-Gladrow 2001) and KHSO4 according to Dickson. Any two of the main

carbonate parameters (pH, TA, DIC, pCO2) describe the carbonate system sufficiently

and the other parameters can be calculated from the measured ones. In 50 different

samples, we measured three carbonate parameters (pH, TA and DIC) to over-

determine the carbonate system.

Sinking velocity

The sinking velocity of aggregates was measured by gently transferring individual

aggregates from the roller tanks using a wide bore pipette to a high cylinder

containing sterile experimental media. Prior to measuring sinking velocity of

aggregates, the analysis medium was incubated overnight at either 15 °C or 20 °C to

ensure that aggregates experience no change in environmental conditions during the

subsequent sinking velocity determinations. The time taken for each aggregate to sink

a defined distance was recorded. The dimensions of the aggregate axes (x, y, and z

direction) were measured under a dissecting microscope, using a grid paper and ruler,

and the aggregated volume was calculated by assuming an ellipsoid shape. The

equivalent spherical diameter (ESD) was calculated. The sinking velocity was

determined for approximately 10 aggregates per tank, and the sizes of all visible

aggregates measured. The aggregates were classified into two size classes: large

134


aggregates of size ≥ 5 mm ESD and smaller aggregates of size < 5mm ESD.

Quantification of TEP

TEP concentrations were measured colorimetrically by filtration of samples onto 0.4-

µm pore size polycarbonate filters (Millipore, MA, USA) and subsequent staining

with Alcian blue following the procedure described by Passow and Alldredge (1995).

The staining solution was calibrated using Gum Xanthan, and TEP was expressed as

Gum Xanthan equivalents per liter (GXeq L-1). The Alcian blue-stained filters were

soaked in 80% sulphuric acid for 2 hrs and mixed every 30 minutes. The Alcian blue

from the filters was spectrophotometrically measured at 787 nm. TEP was measured

in four replicates per tank at the start of the experiment and after 96 hrs from both, the

aggregate slurry and the SSW fractions of all treatments.

RESULTS

Over-determination of the carbonate chemistry

The carbonate system was over-determined by simultaneously measuring the pH, DIC

and TA in 50 independent samples. The pCO2 concentrations were then calculated

using all three possible combinations: TA and DIC, pH and DIC as well as pH and

TA. Fig. 1 shows the pCO2 based on pH and TA fitted with that calculated from DIC

and TA. DIC and pH- based calculations gave slightly different pCO2 values and the

correlation coefficient with those calculated from TA and either pH or DIC,

respectively, was slightly lower.

Acclimatization phase

T. weissflogii cultures were acclimatized in media manipulated to reflect the ambient

and two future scenarios, at two different temperatures. Diatom growth rates and pH

measurements during the acclimatization phases are shown in Table 2. The

maintenance of the low cell density ensured that the pH was maintained within the

limits targeted for all the treatments. Throughout the acclimatization phase, the

average TA was 2351 ± 7 µmol kg-1 and did not significantly vary between any of the

135

treatments (p > 0.01), thereby demonstrating that the carbonate system during the

acclimatization phase remained within the targeted parameters.


Fig. 1. Results of the over-determination of the carbonate system. pCO2

concentrations calculated from pH and TA were identical to values calculated from

TA and DIC (y = 1.000x – 4.3123, r2 = 1.0000), whereas those calculated from pH

and DIC differed slightly from those derived from pH and TA (y = 0.9838x –

42.1785, r2 = 0.9890).

Treatment µ (d -1) pH No. of days acclimatized

15 °C ambient 0.51 7.93 – 8.21 11

future 1 0.52 7.57 – 7.76 11

future 2 0.49 7.45 – 7.66 11 20 °C ambient 0.86 8.04 - 8.23 8

future 1 0.86 7.61 - 7.84 8

future 2 0.82 7.46 – 7.67 8

Table 2: Diatom growth rates and adjusted pH range during the acclimatization phase

136


Experimental phase

Carbonate system

During the experimental phase, the carbonate system was determined at the onset and

after 96 hrs of incubation in the roller tanks. pCO2 and pH data are shown in Figs. 2-

3. The results show a clear distinction between the starting conditions of the ambient

and two future scenarios. In all the treatments and irrespective of bacterial presence,

the pCO2 increased after 96 hrs. Although similar trends were observed for both

temperatures, the change in pCO2 (Fig. 2A-B) was largest in the two future treatments

at 20 ºC, reflecting higher respiration at the higher temperature and a weaker

buffering system under future carbonate chemistry conditions.

Aggregate characteristics and total aggregated volume

Between 33 and 52 aggregates per tank were generated in both treatments of

experiments 1-3 at 15 °C and in the axenic cultures of the diatoms treatment of

experiment 4, at 20 °C (Fig. 4A-B). In contrast at 20 °C, both treatments of the future

experiments 5 and 6 as well as the ambient experiment 4 with bacteria-containing

treatment generated less than 20 aggregates per tank (Fig. 4B). The highest number of

aggregates was formed at 15 °C under ambient conditions and in the presence of

bacteria. Although more aggregates were produced under this condition, the presence

of bacteria seemed to lead to a higher proportion of smaller aggregates (> 5mm).

Under future scenarios at 15 °C however, an opposite trend was found. The

comparison of axenic versus xenic cultures showed an increase in the formation of

large aggregates in presence of bacteria. Despite slight differences in the number and

size distributions of aggregates formed in the different treatments at 15 °C, the overall

trend was that the total number of aggregates or the sizes of the aggregates did not

drastically differ between the treatments. However, when the same treatments were

compared with those incubated at the elevated temperature of 20 °C, striking

differences were observed. With exception of the axenic diatom cultures incubated

under ambient conditions, a drastic reduction in both the number and size of

137

aggregates was observed at 20 °C (Fig. 4B).

138


(A)

(B)

Fig. 2. Determination of pCO2 concentrations at the initial measurement and after 96

hrs of incubation. (A) pCO2 at 15 °C (B) pCO2 at 20 °C. The values for t = 96 hrs are

averages from duplicate tanks and standard deviations are depicted by error bars.

139


(A)

(B)

Fig. 3. Determination of pH values at the initial measurement and after 96 hrs of

incubation. (A) pH at 15 °C (B) pH at 20 °C. The values for t = 96 hrs are averages

from duplicate tanks and standard deviations are depicted by error bars.

140


(A)

(B)

Fig. 4. Numbers and size distribution of aggregates formed after 96 hrs in roller tanks

at (A) 15 °C and (B) 20 °C. Aggregate sizes were expressed as equivalent spherical

diameters (ESD) in mm.

141


When expressed in terms of total aggregated volumes, we observed no appreciable

change among any of the treatments conducted at 15 °C, with the exception of axenic

cultures incubated under the future 2 scenario (Fig. 5). This observation suggested

that there is no significant impact of a changed carbonate chemistry on total

aggregated volumes. The impact of the presence of bacteria on the total aggregated

volumes also appeared small, with no appreciable change observed in any of the six

experiments containing bacteria. In striking contrast however, was the finding that in

both future treatments at 20°C, a drastic reduction in the total aggregated volume was

observed (Fig. 5), suggesting a interactive effect of elevated temperature with a

changed carbonate chemistry.

Fig. 5. Total aggregated volume in the different treatments after 96 hrs in roller tanks.

Sinking velocity

Sinking velocities were determined for aggregates at the end of the roller tank

experiments. Sinking velocities did not seem to be impacted by pCO2 but aggregate

size and temperature had an effect: At 15°C, sinking velocity generally increased with

increasing sizes, reaching approximately 50 m d-1 for aggregates with an ESD of

approximately 5 mm, and 100 m d-1 for aggregates with an ESD of approximately 13

mm (y = 22.607x + 70.33 , n = 68, r2 = 0.7997) (Fig. 6A).

142


Since fewer aggregates were formed in the roller tanks at 20 °C, fewer sinking

velocity determinations were conducted. Although fewer larger-sized aggregates were

formed at 20 °C, the tendency of increased velocity with increasing sizes hold true (y

= 2.404x + 16.08, n = 45, r2 = 0.5902). However, the overall sinking velocity at 20°C

was lower for the same ESD compared to those formed at 15°C. For example, an

aggregate with an ESD of approximately 7 mm at 15°C had a sinking velocity of

approximately 60 m d-1. The same sized aggregate from 20 °C treatments sank with

approximately 30 m d-1. Furthermore, the slope of the size versus sinking velocity

relationship was much smaller, by almost a factor of 10, for aggregates formed at 20

°C compared to those at 15°C. As an example, two aggregates with ESD of

approximately 7 mm and 14 mm, respectively, had very similar sinking velocities of

approximately 30 m d-1 (Fig. 6B).

(A)

143


(B)

Fig. 6. Determination of sinking velocities of aggregates from (A) 15 °C (y = 22.607x

+ 70.33 , n = 68, r2 = 0.7997) and (B) 20 °C (y = 2.404x + 16.08, n = 45, r2 = 0.5902)

TEP concentration dynamics

With p-values > 0.01, the initial TEP concentrations did not significantly differ

between the treatments of the six experiments (Fig. 7., Table 3.). In all the

experiments incubated at 15 °C, TEP concentrations increased approximately 3-fold

after 96 hrs of incubation in the roller tanks and approximately 3-4 fold at 20 °C (Fig.

7.). The total TEP concentration expressed as µg Xeq. tank -1 was the sum of TEP in

the aggregate fraction and in the surrounding seawater. The increases in total TEP

concentration after 96 hrs were not statistically different between the axenic and xenic

cultures of all the 6 experiments (Table 3). A statistically significant increase (P <

0.05) in total TEP production was however observed when the axenic treatments were

144


Compared in terms of the two temperatures (Table 3.). This comparison of the two

temperature settings revealed that the total TEP concentrations significantly increased

(P < 0.05), in both future scenarios at 20 °C when diatoms were incubated axenically

(Table 3.). Thus, neither pCO2, nor the presence of bacteria, nor temperature had a

clear impact on net TEP production during the 96 hrs experiments, but the

combination of increased temperature and ocean acidification conditions appeared to

result in higher TEP concentrations of the axenic cultures.

When separating the total TEP concentrations for the aggregate slurry and the SSW,

respectively, it was observed that 20-45 % of all TEP were found in the aggregate

slurry (Table 4.). At both temperatures the highest fraction of TEP assignable to the

aggregates was detected in axenic diatom cultures incubated under ambient conditions

and amounted to 28 % at 15 °C and 45 % at 20 °C, respectively. There also seemed to

be a tendency of decreasing proportions of TEP occuring in the aggregate slurry under

both future scenarios and at both temperatures, and irrespective of the presence of

bacteria (Table 4).

We further analyzed whether total TEP concentrations correlated with to the total

aggregated volumes. However, results given in Fig. 8, show no such obvious

correlation between the abundance of TEP produced and the total aggregated volume.

145


(A)

(B)

Fig. 7. TEP concentration dynamics at the start of the experiment and after 96 hours

in roller tanks.

146


Table 3. Results of statistical tests (ANOVA) comparing total TEP concentrations

between experiments and between treatments

Experiment # Treatment Difference

Initial t = 0 hr

1 Tw ambient vs Tw + HP15 ambient Not. sig. diff.

2 Tw future 1 vs Tw + HP15 future 1 Not. sig. diff.





Total TEP t = 96 hrs at 15 °°°°C




1 vs 2 Tw ambient vs Tw future 1 Not. sig. diff.


1 vs 2 Tw + HP15 ambient vs Tw + HP15 future 1 Not. sig. diff.


Total TEP t = 96 hrs at 20 °°°°C




4 vs 5 Tw ambient vs Tw future 1 P < 0.05




Total TEP t = 96 hrs 15 °°°°C versus 20 °°°°C

1 vs 4 Tw ambient Not. sig. diff.

1 vs 4 Tw + HP15 ambient Not. sig. diff.

2 vs 5 Tw future 1 P < 0.05

2 vs 5 Tw+ HP15 future 1 Not. sig. diff.

3 vs 6 Tw future 2 P < 0.05

3 vs 6 Tw + HP15 future 2 Not. sig. diff.

147


Table 4. Total TEP concentrations in the different treatments and the % partitioned

into the aggregate slurry.

Sample Total TEP concentrations µµµµg Xeq. Tank-1 (Avg ±±±± SE)

15 °°°°C 20 °°°°C

Total TEP % in Agg slurry Total TEP % in Agg slurry

Tw amb 1286 ± 141 28 1361 ± 66 45

Tw fut 1 1439 ± 2 24 1697 ± 6 30

Tw fut 2 1160 ± 55 22 1584 ± 47 28

Tw+HP15 amb 1383 ± 195 24 1360 ± 125 34

Tw+HP15 fut 1 1321 ± 109 20 1639 ± 271 26

Tw+HP15 fut 2 1272 ± 189 21 1627 ± 123 21

Fig. 8. Total TEP concentrations in the tank as a function of total aggregated volume

148


DISCUSSION

Perturbation of the carbonate system

Ocean acidification experiments rely on the accurate perturbation of the carbonate

system. Although, any two of the main carbonate parameters (pH, TA, DIC, and

pCO2) can describe the carbonate system sufficiently, each of the measured

parameters is associated with uncertainties in their estimations (Hoppe et al. 2012).

Due to these uncertainties, discrepancies in calculated pCO2 values can vary between

10 and 30 % (Riebesell et al. 2010, Hoppe et al. 2012). Over-determinination of the

carbonate system of the herein tested samples showed that overall our carbonate

chemistry was solid and consistent.

Acclimatization

As phytoplankton photosynthesize and cell culture densities increase correspondingly,

CO2 is removed from the medium leading to an increase in pH. By frequent dilutions

of the diatom cultures before the cell density reached 60 000 cells ml-1, it was possible

to maintain the pH of the carbonate system within a narrow range during the

acclimatization phase. Since the TA was nearly constant during this phase, it coule be

confirmed that the carbonate system was satisfactorily controlled throughout the

acclimatization phase. Diatom cultures were acclimatized for a period of over 8

generations lasting between 8 and 11 days. Under the herein tested carbonate

chemistry regimes, diatom growth rates were not significanlty impacted. These results

are in line with studies conducted on other Thalassiosira species (Chen and Durbin

1994) and various other phytoplankton species (Berge et al. 2010). Both previous

studies had shown that algal growth rates were statistically similar at a pH ranging

from 7.0 to 8.5. The elevated temperature of 20 °C significantly favored diatom

growth. This positive correlation between microbial growth rate and temperature is a

commonly observed phenomenon and reflects enhanced metabolic activities with

increasing temperature.

149


Marine aggregate formation in a future ocean

Noticeably more aggregates were formed in the 15 °C roller tank experiments.

Despite weak differences in the number and size distribution among aggregates

formed in the different treatments at this temperature, the general trend was that the

total number of aggregates or the aggregate sizes did not drastically differ. These

results suggested that in future ocean scenarios, ocean acidification may not

significanlty impact the formation of marine aggregates if water temperatures stayed

low. However, as soon as the temperature was increased a drastic reduction in both

the number and sizes of aggregates was observed in all treatments except those

containing axenic diatom cultures at ambient conditions. Generally, these results

suggested that the presence of bacteria might not significantly impact aggregate

formation in a future ocean. Additionally, it could be speculated that synergistic

effects of elevated temperature and ocean acidification may drastically reduced the

formation of marine aggregates per se as well as the total aggregated volumes.

Furthermore, results of the sinking velocity determination showed that there is

generally a higher sinking velocity for larger aggregates. However, this might only

hold true if temperatures did not increase since the absolute sinking velocity of

aggregates formed under future ocean scenarios at 20 °C was nearly half of that of

similarly sized aggregates formed at 15 °C. These results suggested that the vertical

transport of particulate organic matter via marine aggregates may become severely

impacted in a future ocean and will depend on the magnitude and on the vertical depth

penetration of warming in the ocean.

Synergistic effects of changes of temperature and carbonate chemistry enhance

TEP production of axenic diatom cultures

TEP production by diatoms in all experiments conducted at 15 °C was not

significantly impacted suggesting that ocean acidification only may not become

relevant for this process regardless whether bacteria are present or not. However and

interestingly, both future scenarios conducted at elevated temperature exhibited a

significant increase in TEP production when diatoms were incubated axenically.

150


This result might indicate that potential consumption of TEP by bacteria at elevated

temperatures resulted in less TEP in the acidified ocean. However, the actual high

diversity of microbial interactions in the sea makes such a scenario rather unlikely.

For diatom-bacteria interactions, it is very cautiously suggested that they might not

impact total TEP production in a future ocean.

Lack of correlation between TEP production and marine aggregate formation

Although TEP production as well as marine aggregate formation dynamics were

found to be affected at variable intensity by the tested future ocean scenarios, no

direct correlation between TEP production and aggregate formation was observed.

This finding is in line with studies conducted by Bhaskar et al. (2005), in which no

correlation between macroaggregate size and TEP abundance had been detected for

the interaction of the diatom Skeletonema costatum and Marinobacter sp.. In contrast,

our own previous data obtained from studies on the interaction of T. weissflogii and

M. adhaerens HP15 (Gaerdes et al. 2011) indicated a positive linear correlation

between TEP concentrations and aggregate formation. Although this hard-to-

interprete discrepancy might reflect the high level of complexity of diatom-bacteria

interactions and unknown processes that govern the transformation of dissolved

organic matter into particulate organic matter, it should cautiously be noted that a

number of parameters such as light exposure and preparation of the seawater medium

were different in both of our studies.

Conclusions

Our results showed that growth of the diatom T. weissflogii is not significantly

impacted by the projected level of ocean acidification, but that its growth is likely to

be favored under elevated seawater temperatures. Furthermore, it was demonstrated

that synergistic effects of ocean acidification and a temperature increase might lead to

a more pronounced impact on TEP production, irrespective of the presence of

bacteria. In line with our findings, Engel (2004) showed that the net production of

TEP by the phytoplankton Emiliana huxleyi increased with an increased pCO2 level

of 710 µatm. This elevation was close to the herein predicted future 1 scenario

151


(750-850 µatm). In contrast, other ocean acidification studies showed no significant

impact in net TEP production with increasing pCO2 (Egge et al. 2009). These

conflicting results support the assumption that yet-unknown additional processes

might significanlty contribute to the transformation of DOM into POM. Results of the

current study indicate that potential detrimental effects of ocean acidification and

elevated seawater temperature might affect the formation of aggregates in the first

place. It is therefore concluded that the vertical export of POM via marine aggregates

may become severely impacted in a future ocean and might highly depend on the

magnitude and the vertical depth penetration of warming in the ocean.

ACKNOWLEDGEMENTS

The authors would like to thank Eva Sonnenschein and the Bio workshop personnel

of UCSB for technical assistance. This work was financially supported by the

Helmholtz Graduate School for Polar and Marine Research, the Marine Science

Institute, University of California Santa Barbara and Jacobs University Bremen

REFERENCES

Alldredge AL. and Silver MW. (1988). Characteristics, dynamics and significance of marine snow. Progress in Oceanography 20: 41-82 Alldredge AL, Passow U, Logan BE. (1993). The abundance and significance of a class of large, transparent organic particles in the ocean. Deep-Sea Res. I. 40:1131-1140 Berge T, Daugbjerg N, Balling Anderson B, Hansen P. (2010). Effect of lowered pH on marine phytoplankton growth rates. Mar. Ecol. Prog. Ser. 416: 79-91 Bhaskar PV and Bhosle NB. (2005). Microbial extracellular polymeric substances in marine biogeochemical processes. Current Science 88: 45-53 Biermann A. and Engel A. (2010). Effect of CO2 on the properties and sinking velocity of aggregates of the coccolithophore Emiliana huxleyi. Biogeosciences 7: 1017-1029

152


Buesseler KO. (1998). The decoupling of production and particulate export in the surface ocean. Glob. Biogechem. Cycles. 12: 297-310 Chin WC., Orellana MV. and Verdugo P. (1998). Spontaneous assembly of marine dissolved organic matter into polymer gels. Nature 391: 568-572 Chen CY and Durbin EG. (1994). Effects of pH on the growth and carbon uptake of marine phytoplankton. Mar. Ecol. Prog. Ser. 109: 83-94 Clayton TD. and Byrne RH. (1993). Spectrophotometric seawater pH measurements: total hydrogen ion concentration scale calibration of m-cresol purple and at sea results. Deep-Sea Res. I 40: 2115-2129 De La Rocha and Passow U. (2007). Factors influencing the sinking of POC and the efficiency of the biological carbon pump. Deep Sea Res. II 54: 639-658 Dickson AG and Goyet C. (Eds) (1994). Handbook of methods for the analysis of the various parameters of the carbon dioxide system in seawater. Version 2. ORNL/CDIAC-74 Egge JK., Thingstad TF., Larsen A., Engel A., Wohlers J., Bellerby RGJ. and Riebesell U. (2009). Primary production during nutrient-induced blooms at elevated CO2 concentrations. Biogeosciences 6: 877-885 Engel A., Delille B., Jacquet S., Riebesse U., Rochelle-Newall E., Terbrueggen A. and Zondervan I. (2004). Transparent exopolymer particles and dissolved organic carbon production by Emiliana huxleyi exposed to different CO2 concentrations: a mesocosm experiment. Aquat. Microb. Ecol. 34: 93-104 Fangue N., O’Donnell M., Sewell M. Matson P., MacPherson A. and Hoffmann G. (2010). A laboratory-based experimental system for the study of ocean acidification effects on marine invertebrate larvae. Limnol. and Oceanogr. Methods 8: 441-452 Fowler SW. and Knauer GA. (1986). Role of large particles in the trasnsport of elements and organic compounds through the water column. Prog. Oceanagr. 16: 147-194 Gaerdes A., Kaeppel EC., Shehzad A., Seebah S., Teeling H., Yarza P., Glöckner FO. Grossart HP. and Ullrich MS. (2010). Complete genome sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine microorganism. Stand. Genomic Sci. 3: 97-107 Gaerdes A, Iversen MH, Grossart HP, Passow U, Ullrich MS. (2011). Diatom-associated bacteria are required for aggregation of Thalassiosira weissflogii. ISME J. 5:436-454

153


Grossart HP., Schlingloff A., Bernhard M., Simon M., and Brinkhoff T. (2004). Antagonistic activity of bacteria isolated from organic aggregates of the German Wadden Sea. FEMS Microbiology Ecology 47: 387-396

Guillard RRL and Ryther JH. (1962). Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt and Detonula confervacea Cleve. Can. J. Microbiol. 8:229-239. Guillard RRL. (1975). Culture of phytoplankton for feeding marine invertebrates. pp 26-60. In Smith W.L. and Chanley M.H (Eds.) Culture of Marine Invertebrate Animals. Plenum Press, New York, USA.

Hoppe CJM, Langer G, Rokitta SD, Wolf-Gladrow DA, Rost B. (2012). Implications of observed inconsistencies in carbonate chemistry measurements for ocean acidification studies. Biogeosciences Discuss. 9: 1781-1792. Houghton JT, Meira Filho LG, Bruce J, Hoesung L, Callander BA, Haites E, Harris N, Maskell K. (Eds) (1995). Climate change: Radiative forcing of climate change and an evaluation of the IPCC IS92 emission scenarios. Cambridge University Press. IPCC: Climate change (2007): Synthesis report. Contribution of working groups I, II, III to the fourth assessment report of the intergovernmental panel on climate change, edited by: core writing team Pachauri RK and Reisinger A. IPCC, Geneva, Switzerland. Joint I, Doney SC, Karl DM. (2010). Will ocean acidification affect marine microbes? ISME J. 1-7. Kaeppel EC, Gaerdes A, Seebah S, Grossart HP and Ullrich MS. (2012). Marinobacter adhaerens sp. nov., isolated from marine aggregates formed with the diatom Thalassiosira weissflogii. Int. J. Syst. Evol. Microbiol. 62: 124-128 Kester DR, Duedall IW, Connors DN and Pytkowicz RM. (1967). Preparation of artificial seawater. Limnol. and Oceanogr. 12: 176-179 Lewis E. and Wallace DWR. (1998). Program developed for CO2 system calculations. ORNL/CDIAC-105 Carbon dioxide informations Analysis Center, Oak Ridge National Laboratory, Department of Energy, US. Liu JW, Weinbauer MG, Maier C, Dai MH, Gattuso JP. (2010). Effect of ocean acidification on microbial diversity and on microbe-driven biogeochemistry and eco-system functioning. Aquat. Microb. Ecol. 61: 291-305 Mopper K, Zhou J, Ramana KS, Passow U, Dam HG, Drapeau DT. (1995) The role of surface-active carbonhydrates in the flocculation of a diatom bloom in a mesocosm. Deep-Sea Res. II 42: 47-73

154


Passow U and Alldredge AL. (1995). A dye-binding assay for the spectrophotometric measurement of transparent exopolymer particles (TEP). Limnol. Oceangr. 40: 1326-1335 Passow U. (2002). Transparent exopolymer particles (TEP) in aquatic environments. Progress in Oceanography 55:287-333 Passow U. (2011). The abiotic formation of TEP under different ocean acidification scenarios. Mar. Chem. doi:10.1016/j.marchem.2011.10.004

Porter KG and Feig YS. (1980). The use of DAPI for identifying and counting aquatic microflora. Limnol. and Oceanogr. 25: 943-948 Raupach MR, Marland G, Ciais P, Le Quere C, Canadell JG, Klepper G, Field CB. (2007). Global and regional drivers of accelerating CO2 emissions. PNAS USA, 104: 10288-10293 Riebesell U, Fabry VJ, Hansson L, Gattuso JP. (Eds) (2010). Guide to best practices for ocean acidification research and data reporting. Vol. Bruessel. Rost B, Zondervan I, Wolf-Gladrow A. (2008). Sensitivity of phytoplankton to future changes in ocean carbonate chemistry: current knowledge, contradictions and research direction. Mar. Ecol. Prog. Ser. 373: 227-237 Schuster S and Herndl GJ. (1995). Formation and significance of transparent exopolymeric particles in the northern Adriatic Sea. Mar. Ecol. Prog. Ser. 124: 227-237 Sonnenschein EC., Gaerdes A., Seebah S., Torres-Monroy I., Grossart HP., Ullrich MS. (2011). Development of a genetic system for Marinobacter adhaerens HP15 involved in marine aggregate formation by interacting with diatom cells. J. Microbiol. Methods 87 (2): 176-183 Verdugo P., Alldredge AL., Azam F., Kirchman D., Passow U., Santschi P. (2004). The oceanic gel phase: a bridge in the DOM-POM continuum. Mar. Chem. 92: 67-85 Verdugo P., (2012). Marine Microgels. Annu. Rev. Mar. Sci. 4:375-400

Wetz MS., Robbins M. and Paerl HW. (2009). Transparent exopolymer particles (TEP) in a river-dominated estuary: spatial-temporal distributions and controls upon TEP formation. Estuaries and Coasts 32: 447-455

Zeebe RE. and Wolf-Gladrow A, (2001). CO2 in seawater: Equilibrium, kinetics and isotopes, Vol 65, Elservier, Amsterdam Zhou J, Mopper K, Passow U. (1998). The role of surface-active carbonhydrates in

155

the formation of transparent exopolymer particles by bubble adsorption of seawater. Limnol. Oceanogr. 43: 1860-1871

156

Discussion

Using a polyphasic approach consisting of a combination of genomic and phenotypic

analyses, in the first part of this study, M. adhaerens HP15 was described as a novel

member of the Marinobacter genus [Kaeppel et al. 2012]. Genomic information was

gathered from the analysis of bacterial 16S rRNA sequences, whole genome DNA-

DNA relatedness and G+C contents of strain HP15 and its phylogenetic relatives. 16S

rRNA gene sequences are routinely used molecular markers for phylogenetic analyses

[Stackebrandt et al. 1985, Ludwig and Schleifer 1994, Rossello-Mora and Amann

2001]. The 16S rRNA gene sequence of HP15T (GenBank Accession no. AY241552)

was analysed using the ARB software package [Ludwig et al. 2004] and the reference

alignment was provided by the Living Tree Project database [Yarza et al. 2008].

Results of the analysis distinctly showed that M. adhaerens HP15 clusters with other

Marinobacter species and that M. adhaerens HP15 is most closely related to the type

strains of M. flavimaris (99 %), M. salsuginis (98 %), M. lipolyticus (98 %) and M.

algicola (98 %) [Antunes et al. 2007, Green et al. 2006, Martin et al. 2003, Yoon et

al. 2004]. The recommended boundary for demarcating species based on 16S rRNA

sequence is 97 % [Stackebrandt and Goebel 1994]. However, it has come to light that

in certain cases – also observed for the above tested Marinobacter strains – 16S

rRNA lacks resolving power at the species level [Rossello-Mora and Amann 2001].

Therefore, aside from 16S rRNA analyses, whole genome DNA-DNA relatedness and

G+C content analyses were performed.

Once denaturated, complementary DNA strands can re-associate to form native

duplex structures under stringent experimental conditions. This characteristic property

of DNA forms the basis of the whole genome DNA-DNA relatedness technique

[Rosselo-Mora and Amann 2001]. In a mixture of two different DNAs for example,

the amount of re-association depends on the degree of identity between the DNAs.

Based on numerous studies with well-defined prokaryotic species, it has been

suggested that values of 70 % or above are reasonable borders for species

differentiation [Wayne et al. 1987]. The genomic DNA of HP15T showed similarities

of 63.6 (68.7), 40.0 (38.0), 28.9 (26.0), and 28.2 (24.5) % to those of M. flavimaris,

M. salsuginis, M. lipolyticus and M. algicola, respectively [Kaeppel et al. 2012].

157

These similarities were below the accepted boundary for species differentiation and

thus proved that M. adhaerens represents a novel species.

Among prokaryotes, G+C contents vary between 20 and 80 mol% [Tamaoka 1994].

The greater the difference between two organisms, the less closely related they are.

Empirical data showed that organisms that differ by more than 10 mol% do not

belong to the same genus and that 5 mol% is the common range found within species

[Rosselo-Mora and Amann 2001]. This observation also held true for the

Marinobacter genus and with 56.9 mol%, the G+C content of M. adhaerens HP15

falls well within the accepted range of variation in G+C contents of six other tested

Marinobacter species with G+C contents ranging from 52.7 and 58.0 mol% [Kaeppel

et al. 2012] thus confirming that strain HP15 represents a novel Marinobacter species.

For taxonomic purposes, a combined genomic and phenotypic description is essential

for the delineation of new species in prokaryotes [Wayne et al. 1987]. Although M.

flavimaris was most closely related to M. adhaerens HP15 in our genomic analyses,

the phenotypic characterization clearly demarcated the two species [Kaeppel et al.

2012]. The two strains differed in their pigmentation, with M. adhaerens HP15

exhibiting a brownish pigmentation while M. flavimaris colonies were cream-colored.

Furthermore, the two strains differed significantly in their utilization of glycerol, D-

fructose, DL-lactic acid, D-gluconate, L-alanine, phenylacetate, and L-glutamate as

well as in their ability to reduce nitrate to nitrite [Kaeppel et al. 2012].

On the basis of our detailed polyphasic approach, the bacterial partner of the selected

bilateral model system, strain HP15T (=DSM 23420T = CIP 110141T), was confirmed

to represent a novel species and was named as Marinobacter adhaerens [ad.hae'rens.

L. part. adj. adhaerens: hanging on, sticking to] [Kaeppel et al. 2012].

The genus Marinobacter was established with the species M. hydrocarbonoclasticus

in 1992 [Gauthier et al. 1992]. A total of 31 further species have been described until

today. In addition to our research interest on its potential to induce TEP production

and aggregate formation, Marinobacter have attracted increasing interest in the field

of petroleum microbiology and hydrocarbon degradation. Together with the genera

Alcanivorax, Thallassolituus, Cycloclasticus and Oleispira, certain representatives of

the genus Marinobacter form the obligate hydrocarbonoclastic group of bacteria

recognized to play a significant role in the biological removal of petroleum

hydrocarbons from polluted marine waters [Gauthier et al. in 1992, Yakimov et al.

2007]. Marinobacter are tolerant to various conditions and have been isolated from a

158

variety of marine environments ranging from oil-contaminated environments to

sediments, surface and deep sea waters as well as in polar regions [Huu et al. 1999,

Gorshkova et al. 2003, Yoon et al. 2004, Grossart et al. 2004, Takai et al. 2005,

Montes et al. 2008, Roh et al. 2008]. Furthermore, representatives of this genus have

been identified based on their interactions with other organisms: M. algicola was

originally obtained from dinoflagellate cultures, M. bryozoorum was found associated

with bryozoa and M. xestospongiae was isolated from a marine sponge [Romanenko

et al. 2005, Green et al. 2006, Lee et al. 2011].

The abundance of representatives of the Marinobacter genus varies between 2-9 % in

the Adriatic Sea [Grossart HP, personal communication] and was found to represent

up to 16% of proteobacterial signals in fluorescent in situ hybridization experiments

conducted with samples from Helgoland Roads (Fuchs B, personal communication).

Considering the great diversity of marine microbes in the ocean, these amounts are

significant, and further strengthen the potential ecological importance of this genus in

certain areas of the ocean.

As previously shown for other environmentally important bacterial species

[Bakersmans et al. 2009, Piekarski et al. 2009, Wöhlbrand and Rabus 2008],

establishment of the genetic accessibility of individual strains represents the pivotal

base for detailed and accelerated research on these organisms. Therefore, we focused

on the establishment of a genetic system to allow for the precise molecular

manipulation of M. adhaerens HP15. Herein, (i) the genome of M. adhaerens HP15

was sequenced and annotated [Gaerdes et al. 2010] and (ii) protocols for the

manipulation of M. adhaerens HP15 at the molecular level were identified and

optimized [Sonnenschein et al. 2011].

The M. adhaerens HP15 genome was sequenced using the 454 FLX Ti platform of

454 Life Sciences (Branford, CT, USA) and the annotated genome sequence was

deposited in GenBank under the accession number CP001978 for the chromosome

and CP001979 and CP001980 for the two indigenous circular plasmids pHP-42 and

pHP-187, respectively [Gaerdes et al. 2010]. M. adhaerens HP15 possesses three

replicons: (i) a ~4.4 Mb chromosome encoding for 4,180 protein-coding genes, 51

tRNAs and three rRNA operons; (ii) pHP-42, a 42-kb plasmid encoding for 52

protein-coding genes; and (iii) pHP-187, a 187-kb plasmid encoding for 178 protein-

coding genes [Gaerdes et al. 2010]. From the genome and plasmid sequences, the

design of precise PCR primers needed for experiments such as gene-specific

159

mutagenesis and microarray analysis can be accomplished. Beyond the identification

of genes and design of PCR primers, the complete genome sequence represents a

powerful basis to allow for functional as well as comparative genomic studies [Fraser

et al. 2002]. So far, the genome sequences of M. algicola DG893 [Green et al. 2007],

M. aquaeolei VT8 [Copeland et al. 2006] and M. adhaerens HP15 [Gaerdes et al.

2010] are publicly available. A potential comparative genomic study could be based

on the genomic comparison of M. algicola DG893 – isolated from dinoflagellate

cultures – to that of M. adhaerens HP15. Since both Marinobacter strains have been

shown to interact with phytoplankton, this study could potentially provide biological

insights and reveal functional genes that are important in the mediation of

phytoplankton-bacteria interactions. Furthermore, ecological experiments testing the

specificity of the Marinobacter genus in inducing TEP production and aggregate

formation could be conducted with other diatom species. In this respect, it will be

interesting to conduct experiments with diatom species whose genome sequences are

publicly available. Two candidates that could potentially serve this purpose are the

ubiquitously found organisms, T. pseudonana and Phaeodactylum tricornutum. Dual

transcriptomics studies with those diatoms and M. adhaerens could further provide

interesting biological insights on diatom-bacteria interactions.

Genetic methods that allow for the manipulation of M. adhaerens HP15 at the

molecular level were identified and optimized [Sonnenschein et al. 2011]. Protocols

for the efficient transformation of two replicable plasmids, pBBR1MCS [Kovach et

al. 1994] and pSUP106 [Priefer et al. 1985], were established both for conjugal

transfer and electroporation [Sonnenschein et al. 2011]. The antibiotic susceptibility

spectrum was determined. Additionally, two reporter genes encoding for green

fluorescent protein and ß-galactosidase, respectively, were introduced and

successfully expressed in M. adhaerens HP15 thus yielding in powerful tools for gene

expression analyses. In combination with the genome sequence, these tools offered

the possibility to investigate the roles of specific genes during the diatom-bacteria

interaction.

In the second part of this work, the established genetically accessible model system

was employed to test the hypothesis that M. adhaerens HP15 motility appendages

were crucial for its attachment to the diatom T. weissflogii. M. adhaerens HP15

flagellum- and MSHA type IV pilus-deficient mutants were generated by transposon

insertion as well as by gene-specific mutagenesis using homologous recombination

160

[Sonnenschein et al. 2011, Seebah et al. manuscript in preparation]. By conducting in

vitro biofilm assays and attachment assays with diatom cells, our results clearly

demonstrated that a fully-functional flagellum was a pre-requisite for the attachment

of M. adhaerens HP15 to both abiotic and to the diatom surfaces. The MSHA type-IV

pilus was also found to be important for attachment, albeit to a lesser extent. These

results are in line with observations previously made by O' Toole and Kolter [1998]

who had demonstrated the importance of flagellar motility by comparing attachment

of motile and non-motile P. aeruginosa strains to plastic surfaces under static biofilm

culture conditions. Our data are also in line with studies where mutants defective in

the biosynthesis of the MSHA type IV pilus exhibited severe impairment of P.

tunicata attachment to the algae Ulva australis [Dalisay et al. 2006]. Likewise,

MSHA type IV pilus-mediated attachment to abiotic surfaces was demonstrated for S.

oneidensis MR-1 [Thormann et al. 2004].

TEP are both ubiquitous and abundant in the ocean and have been found in all

aggregates investigated to date [Alldredge et al. 1993; Passow and Alldredge 1994;

Passow 2002]. However, the underlying molecular mechanisms that govern TEP

production remained unknown. We predicted that the attachment of bacteria to diatom

surfaces could potentially influence diatom-borne TEP production. In order to test

this, M. adhaerens HP15 and its flagellum- or MSHA type IV pilus-defective mutants

were co-incubated with axenic cultures of T. weissflogii. Thereafter, the amount of

TEP produced by the diatom cells was quantified. With TEP concentrations occurring

in similar amounts in all co-cultures, our findings showed that although bacterial

motility appendages are crucial for bacterial attachment to diatom surfaces, this

attachment is not essential for inducing diatom-borne TEP production. Additional yet-

to-be determined mechanisms appear to govern the induction of TEP formation

following the initial cell-to-cell contacts mediated by bacterial flagella and pili

[Seebah et al. manuscript in preparation].

From the molecular perspective, the bacterial determinants responsible for inducing

diatom-borne TEP production still remain unknown. Consequently, future attempts

will focus on identifying M. adhaerens HP15 gene products specifically expressed

during the interaction using in vivo expression technology (IVET) [Mahan et al.

1993]. This technique offers the possibility of identifying gene products specifically

expressed during the interaction. The identified genes expressed in vivo could then be

mutagenized and their impact on inducing diatom-borne TEP production assessed.

161

TEP production and diatom aggregation play pivotal roles in the oceanic carbon

cycle. In order to evaluate potential feedback mechanisms of marine biogeochemical

cycles in response to climate change, it is essential to investigate the effects of

projected changes in ocean temperature and acidification on TEP and marine

aggregate formation dynamics. The final part of this thesis therefore focused on

ecological experiments where TEP and aggregate formation dynamics were tested in

conditions mimicking future ocean scenarios.

Prior to conducting the respective experiments, we observed that the routinely used

technique of filtering natural seawater through 0.2 µm sieves did not satisfactorily

remove all bacterial contaminants such as nanobacterial cells passing through the

filters and forming colonies on agar plates (data not shown). Since sterilization of

natural seawater by autoclaving severely impacts the carbonate system [Riebesell et

al. 2010, pers. observation], we established a new protocol for the preparation of

experimental media, which is appropriate for the manipulation of the carbonate

system [Seebah et al. manuscript in preparation]. By investigating the impact of TEP

production and aggregate formation under future ocean carbonate chemistry and

temperature regimes, the results of our study cautiously suggested that the combined

effect of ocean acidification and increased temperature leads to a pronounced

reduction of marine aggregate formation. Furthermore, we show that aggregates

formed under these conditions had slower sinking velocities than aggregates formed

under present-day conditions. We therefore suggested that the vertical export of

particulate organic matter through marine aggregates may be severely impacted in a

future ocean, depending on the magnitude, and on the vertical depth penetration of

warming in the ocean.

The results of our study further showed that TEP production was not significantly

impacted under the tested ocean acidification conditions. However, the synergistic

effect of an elevated temperature and ocean acidification favored TEP production in

axenic cultures of the diatom T. weissflogii. The results of our study, suggest that

bacteria do not significantly impact diatom-borne TEP production. In cultures

containing both diatoms and bacteria, no significant differences were observed in TEP

production. These results are contradictory to the previous finding where M.

adhaerens HP15 was shown to directly enhance TEP production in axenic cultures of

T. weissflogii [Gaerdes et al. 2011]. This observation highlights the complexity of

162

TEP production by phytoplankton and suggests that other unknown factors govern the

transformation of dissolved organic matter into particulate organic matter.

One possible factor that could be tested in future studies is the effect of light on TEP

production. The rolling tank experiments conducted in this study were carried out in

un-interrupted darkness. In contrast, Gaerdes et al. (2011) had used rolling tanks

subjected to two hours of light daily. It is possible that this short-term light exposure

contributed to a higher exudation of the diatom-borne photosynthesis products and

hence more TEP was produced.

The integration of results obtained in this work revealed that a set of genetic tools and

a workflow for the precise manipulation of M. adhaerens HP15 was successfully

established. The developed techniques are easily transposable and offer the possibility

of manipulating other Marinobacter species at the molecular level and can be used to

investigate hypothesis-driven questions. We investigated the role of M. adhaerens

HP15 motility during its interaction with the diatom T. weissflogii and concluded that

although the bacterial cell appendages were crucial to mediate the attachment to the

diatom, this attachment was not crucial for inducing TEP production. The interesting

finding that marine aggregation was severely impacted under conditions mimicking

future ocean scenarios, confirmed numerous predictions of the detrimental effects of

an increased level of anthropogenic CO2 emissions. In conclusion, this work shed

light on diatom-bacteria interactions, TEP production and aggregate formation both,

from a molecular and ecological perspective.

Not covered by experiments reported in this thesis, but nevertheless an interesting

observation was made from scanning electron micrographs [Figure 17] of T.

weissflogii and M. adhaerens HP15. In this micrograph, it would appear that M.

adhaerens HP15 is entangled in the surrounding network of fibrils around the diatom

T. weissflogii. This observation suggests that M. adhaerens HP15 might i.e. attach to

the spines of the diatom. The spines of T. weissflogii are made up of β-chitin fibrils

(Durkin et al. 2009). Whether M. adhaerens HP15 interacts with the diatom to use

TEP as a carbon source or possesses chitinases to breakdown β-chitin fibrils for use as

a carbon source, or both, remains at this stage an intriguing question. A preliminary

scan of the M. adhaerens HP15 sequenced genome did not reveal the presence of

chitinases encoding genes (data not shown). However, due to the inherently diverse

nature of chitinase genes (LeCleir and Hollibaugh 2006), we cannot exclude the

163

possibility that the bacterium might in effect possess chitinases encoding genes. A

thorough bioinformatics analysis will be in the future needed. M. flavimaris str. SW-

145 - the closest relative of M. adhaerens HP15 – has been reported to possess

chitinolytic activity (LeCleir and Hollibaugh 2006), which further suggests the

possibility that M. adhaerens HP15 could also possess chitinolytic activity. In order to

substantiate or exclude this possibility, it would be an interesting future project to test

the chitinolytic activity of the bacterium. By growing M. adhaerens HP15 on media

with β-chitin as the sole carbon source, and thereafter analysing whether chitinases

appear in the protein profiles by matrix-assisted laser desorption/ionization time-of-

flight mass spectrometry, this project could potentially offer new insights of the

interaction. In addition, if found, the mutagenesis of putative chitinases could be

achieved with the established genetic tools. Testing these mutants by attachment

assays and by microscopy could potentially confirm whether the bacterium

preferentially attaches to and takes advantage of the β-chitin fibrils of the diatom.

Figure 17

Scanning electron micrograph depicting M. adhaerens HP15 entangled in the spines of the diatom T. weissflogii [Micrograph courtesy of Astrid Gaerdes and Yannic Ramaye, Ullrich Laboratory, Jacobs University Bremen].

164

Bibliography

Albert M.J. and Bhuiyan N.A. (1997). Phenotypic and genotypic changes in Vibrio cholerae O139 Bengal. J. Clin. Microbiol. 35(10): 2588-2592. Alldredge AL. and Silver MW. (1988). Characteristics, dynamics and significance of marine snow. Progress in Oceanography 20: 41-82 Alldredge AL, Passow U, Logan BE. (1993). The abundance and significance of a class of large, transparent organic particles in the ocean. Deep-Sea Res. I. 40:1131-1140 Amin SA., Greenb D.H et al. (2009). Photolysis of iron–siderophore chelates promotes bacterial–algal mutualism. Proc. Natl. Acad. Sci. 106(40): 17071-17076 Antunes A., Franca L., Rainey FA., Huber R., Nobre MF., Edwards KJ. And Da Costa MS. (2007). Marinobacter salsuginis sp. nov., isolated from the brine-seawater interface of the Shaban Deep, Red Sea. Int. J. Syst. Evol. Microbiol. 57: 1035-1040 Armbrust EV. (1999). Identification of a new gene family expressed during the onset of sexual reproduction in the centric diatom Thalassiosira weissflogii. Appl. Environ. Microbiol. 65: 3121-3128 Armbrust EV. et al. (2004). The genome of the diatom Thalassiosira pseudonana: ecology, evolution and metabolism. Science 306: 79-86 Azam F., Fenchel T., Field JG., Gray JS., Meyer-Reil LA., Thingstad F. (1983). The ecological role of water-column microbes in the sea. Mar. Ecol. Prog. Ser. 10: 257-263 Azam F. and Ammerman JW. (1984). Cycling of organic matter by bacterioplankton in pelagic marine ecosystems: microenvironmental considerations. Flows of Energy and Materials in Marine Ecosystems. Plenum, New York, pp 345-360 Azam F. and Malfatti F. (2007). Microbial structuring of marine ecosystems. Nat. Rev. Microbiol. 5: 782-791 Bakermans C., Sloup RE., Zarka DG., Tiedje JM., Thomashow MF., (2009). Development and use of genetic system to identify genes required for efficient low-temperature growth of Psychrobacter arcticus 273-4. Extremophiles 13, 21-30. Barbara GM.and Mitchell JG. (2003a). Bacterial tracking of motile algae. FEMS Microbiol. Ecol. 44: 79-87 Bhaskar PV., Grossart HP., Bhosle NB and Simon M. (2005). Production of macroaggregates from dissolved exopolymeric substances (EPS) of bacterial and diatom origin. FEMS Microbiol. Ecol. 53: 255-264

165

Bell W. and Mitchell R. (1972). Chemotactic and growth responses of marine bacteria to algal extracellular products. The Biological Bulletin 143: 265 Biddanda B. and Brenner R. (1997). Carbon, nitrogen and carbohydrate fluxes during the production of particulate and dissolved organic matter by marine phytoplankton. Limnol. and Oceanogr. 42(3): 506-518 Blackburn N., Fenchel T. and Mitchell J. (1998). Microscale nutrient patches in planktonic habitats shown by chemotactic bacteria. Science 282: 2254-2256 Buesseler KO. (1998). The decoupling of production and particulate export in the surface ocean. Glob. Biogechem. Cycles. 12: 297-310 Caldeira K. and Wickett ME. (2003). Anthropogenic carbon and ocean pH. Nature 425: 365 Carlson CA., Bates NR., Hansell DA and Steinberg DK. (2001). Nutrient Cycling: The Carbon Cycle. Encyclopedia of Ocean Science. Steele J., Thorpe S., and Turekian K. (Eds.) Academic Press, London. 390-400 Casotti R., Mazza S., Brunet C., Vantrepotte V., Ianora A. and Miralto A. (2005). Growth inhibition and toxicity of the diatom aldehyde 2-trans, 4-trans-decadienal on Thalassiosira weissflogii (Bacillariophyceae) J. Phycol. 41: 7-20 Ceballos S. and Ianora A. (2003). Different diatoms induce contrasting effects on the reproductive success of the copepod Temora stylifera. J. Exp. Mar. Biol. Ecol. 294: 189-202 Chin WC., Orellana MV. And Verdugo P. (1998). Spontaneous assembly of marine dissolved organic matter into polymer gels. Nature 391: 568-572 Cole JJ. (1982). Interactions between bacteria and algae in aquatic ecosystems. Annual Review of Ecology and Systematics 13: 291-314 Cole JR., Chai B., Marsh TL., Farris RJ., Wang Q., Kulam SA. et al. (2003) The Ribosomal Database Project (RDP-II): previewing a new autoligner that allows regular updates and the new prokaryotic taxonomy. Nucleic. Acids. Res. 31: 442-443 Copeland A, Lucas S, Lapidus A, Barry K, Detter JC, Glavina del Rio T, Hammon N, Israni S, Dalin E, Tice H, Pitluck S, Kiss H, Brettin T, Bruce D, Han C, Tapia R, Gilna P, Schmutz J, Larimer F, Land M, Hauser L, Kyrpides N, Kim E, Edwards K, Richardson P. (2006). Complete sequence of chromosome 1 of Marinobacter aquaeolei VT8. Submitted (DEC-2006) to the EMBL/GenBank/DDBJ databases. Dalisay DS, Webb JS, Scheffel A, Svenson C, James S, Holmstrom C, Egan S, Kjelleberg S. (2006). A mannose-sensitive haemagglutinin (MSHA)-like pilus promotes attachment of Pseudoalteromonas tunicata cells to the surface of the green alga Ulva australis. Microbiology 152: 2875-2883

166

De La Rocha and Passow U. (2007). Factors influencing the sinking of POC and the efficiency of the biological carbon pump. Deep Sea Res. II 54: 639-658 Dicker RA. Release of extracellular polymeric substances (EPS) by Aurelia aurita and mucus blob flux. (2011). MS dissertation. University of Massachusetts Boston Durkin CA., Mock T. and Armbrust EV. (2009). Chitin in diatoms and its association with the cell wall. Eukaryotic Cell 8 (7): 1038 - 1050 Falkowski PG. and Raven JA. (2007). Aquatic photosynthesis. 2nd Edition, Princeton University Press, Princeton Fenchel T. (2002). Microbial behavior in a heterogeneous world. Science 296: 1068-1071 Field CB., Behrenfeld MJ., Randerson JT and Falkowski P. (1998). Primary production of the biosphere: Integrating terrestrial and oceanic components. Science 281(5374): 237-240 Fowler SW. and Knauer GA. (1986). Role of large particles in the trasnsport of elements and organic compounds through the water column. Prog. Oceanagr. 16: 147-194 Fraser CM., Eisen JA., Nelson KE., Paulsen IT and Salzberg SL. (2002). The value of complete microbial genome sequencing (You get what you pay for). J. Bacteriol. 184 (23): 6403-6405 Friedlingstein P., Houghton R.A, Marland G., Hackler J., Boden T.A., Conway T.J., Canadell J.G., Raupach M.R., Ciais P. and Le Quere C. (2010) Nature Geoscience 3: 811–812 Fryxell GA. and Hasle GR. (1977). The genus Thalassiosira: species with a modified ring of central strutted processes. In R. Simonsen (Ed). Proceedings from the fourth symposium on recent and fossil marine diatoms. Oslo. Beihefte zur Nova Hedwigia 54: 67-98 Fryxell GA., Doucette GJ. and Hubbard GF. (1981). The genus Thalassiosira: the bipolar diatom T. Antarctica Comber. Botanica Marina 24: 321-335 Fryxell GA., Gould RW. Jr. and Watkins TP. (1984). Gelatinous colonies of the diatom Thalassiosira in Gulf stream warm core rings including T. fragilis sp. nov. Br. Phycol. J. 19: 141-156 Gaerdes A., Kaeppel EC., Shehzad A., Seebah S., Teeling H., Yarza P., Glöckner FO. Grossart HP. and Ullrich MS. (2010). Complete genome sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine microorganism. Stand. Genomic Sci. 3: 97-107.

Gaerdes A, Iversen MH, Grossart HP, Passow U, Ullrich MS (2011). Diatom-associated bacteria are required for aggregation of Thalassiosira weissflogii. ISME J.

167

5:436-454 Gauthier MJ., Lafay B., Christen R., Fernandez L., Acquaviva M., Bonin P. and Bertrand JC. (1992). Marinobacter hydrocarbonoclasticus gen. nov. sp. nov., a new, extremely halotolerant hydrocarbon-degrading marine bacterium. Int. J. Syst. Evol. Microbiol. 42: 568-576 Gorshkova NM., Ivanova EP., Sergeev AF., Zhukova NV., Alexeeva Y., Wright JP., Nicolau DV., Mikhailov VV., and Christen R. (2003). Marinobacter excellens sp. nov., isolated from sediments of the Sea of Japan. Int. J. Syst. Evol. Microbiol. 53: 2073-2078 Goudie A.S and Cuff D.J (Eds) (2002). Encyclopedia of global change: Environmental change and human society. Volume 2. Oxford University Press. 2002. Green DH., Bowman JP., Smith EA., Gutierrez T. and Bolch CJS. (2006). Marinobacter algicola sp. nov., isolated from laboratory cultures of paralytic shellfish toxin-producing dinoflagellates. Int. J. Syst. Evol. Microbiol. 56: 523-527 Green D., Ferriera S., Johnson J., Kravitz S., Beeson K., Sutton G., Rogers YH., Friedman R., Frazier M. and Venter JC. (2007). The Marinobacter algicola DG893 whole genome shotgun (WGS) project. Submitted (JUN-2007) to the EMBL/GenBank/DDBJ databases. Grossart HP., Riemann L. and Azam F. (2001). Bacterial motility in the sea and its ecological implications. Aquat. Microb. Ecol. 25: 247-258 Grossart HP., Schlingloff A., Bernhard M., Simon M., and Brinkhoff T. (2004). Antagonistic activity of bacteria isolated from organic aggregates of the German Wadden Sea. FEMS Microbiology Ecology 47: 387-396 Grossart HP., Levold F., Allgaier M., Simon M. and Brinkhoff T. (2005). Marine diatom species harbour distinct bacterial communities. Environ. Microbiol. 7: 860-873 Hallegraeff GM and Bolch CJ. (1992). Transport of diatom and dinoflagellate resting spores in ship’s ballast water: implications for plankton biogeography and aquaculture. J. Plankton Res. 14: 1067-1084 Hansen JLS., Kiorboe T. and Alldredge AL. (1996). Marine snow derived from abandoned larvacean houses: sinking rates, particle content and mechanisms of aggregate formation. Mar. Ecol. Prog. Ser. 141: 205-215 Hansell DA. and Carlson CA. (2001). Marine dissolved organic matter and the carbon cycle. Oceanography Special Issue JGOFS 14(4): 41-49 Hasegawa Y., Martin JL., Giewat MW., Rooney-Varga JN. (2007) Microbial community diversity in the phycosphere of natural populations of the toxic alga, Alexandrium fundyense. Environ. Microbiol. 9: 3108–3121

168

Hong Y., Smith WO. and White AM. (1997). Studies on transparent exopolymer particles (TEP) produced in the Ross Sea (Antarctica) Houghton JT. et al. (Eds) (1995). Climate change 1994. Radiative forcing and an evaluation of the IPCC IS92 emission scenarios. Cambridge University Press Houghton RA. (2007). Balancing the global carbon budget. Annual Review of Earth and Planetary Sciences 35: 313-347 Huu NB., Denner EBM., Ha Dang TC., Wanner G., and Stan-Lotter H. (1999). Marinobacter aquaeolei sp. nov., a halophilic bacterium isolated from a Vietnamese oil-producing well. Int. J. Syst. Evol. Microbiol. 49: 367-375 Jarrell K. (2009). Pili and flagella: Current Research and Future Trends. Caister Academic Press. Jiao N., Herndl GJ., Hansell DA., Benner R., Kattner G., Wilhelm SW., Kirchman DL., Weinbauer MG., Luo T., Chen F. and Azam F. (2010). Microbial production of recalcitrant dissolved organic matter: long-term carbon storage in the global ocean. Nat. Rev. Microbiol. 8: 593-599 Joos F., Plattner GK., Stocker TF., Marchal O., Schmittner A. (1999). Global warming and marine carbon cycle feedbacks on future atmospheric CO2 Science, (284/5413) 464-467 Joos F. and Prentice I.C. (2004). A paleo perspective on the future of atmospheric CO2 and climate. In: Field C.B. and Raupach M.R. (Eds). The global carbon cycle: Integrating humans, climate and the natural world. Scope 62, Island Press, Washington DC pp165-186. Kaeppel EC, Gaerdes A, Seebah S, Grossart HP and Ullrich MS. (2012). Marinobacter adhaerens sp. nov., isolated from marine aggregates formed with the diatom Thalassiosira weissflogii. Int. J. Syst. Evol. Microbiol. 62: 124-128 Kepkay PE., Niven SEH. and Milligan TG. (1993). Low molecular weight and colloidal DOC production during a phytoplankton bloom. Mar. Ecol. Prog. Ser. 100: 233-244 Khatiwala S., Primeau F. and Hall T. (2009).Reconstruction of the history of anthropogenic CO2 concentrations in the ocean. Nature. 462: 346-349 Kiorboe T., Andersen KP. And Dam HG. (1990). Coagulation efficiency and aggregate formation in marine phytoplankton. Mar. Biol. 107: 235-245 Kiorboe T. (2001). Formation and fate of marine snow: small-scale processes with large-scale implications. Scientia Marina 65 (S2) Koski M., Wichard T., Jonasdottir SH. (2008) Good and bad diatoms: development, growth and juvenile mortality of the copepod Temora longicornis on diatom diets. Mar Biol 154: 719–734

169

Kovach ME., Phillips RW., Elzer PH., Roop RM., Peterson KM. (1994). pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16: 800-802. Lampert W. (1978). Release of dissolved organic carbon by grazing zooplankton. Limnol. Oceanogr. 23: 831-834 LeCleir GR. and Hollibaugh JT. (2006). Chitinolytic bacteria from alkaline hypersaline Mono Lake, California, USA. Aquat. Microb. Ecol. 42: 255-264 Lee OO., Lai PY., Wu H., Zhou X., Miao L., Wang H. and Qian PY. (2011). Marinobacter xestospongiae sp. nov., a novel bacterium isolated from the marine sponge Xestospongia testudinaria collected from the Red Sea, Saudi Arabia. doi: 10.1099/ijs.0.028811-0 Li YH., Takahashi T. and Broecker WS. (1969). Degree of saturation of CaCO3 in the oceans. Journal of Geophysical Research 74: 5507-5525 Liu R. and Ochman H., (2007). Stepwise formation of the bacterial flagellar system. Proc. Natl. Acad. Sci. USA. 104(17): 7116-7121 Liss PS. and Slater PG. (1974). Flux of gases across the air-sea interface. Nature 247: 181-238 Lombard F. and Kiorboe T. (2010). Marine snow originating from appendicularian houses: age-changes in settling characteristics. Deep Sea Res. I 57: 1304-1313 Ludwig W. and Schleifer KH. (1994). Bacterial phylogeny based on 16S and 23S rRNA sequence analysis. FEMS Microbiol. Rev. 15: 155-173 Ludwig W., Strunk O., Westram R., Richter L., and Meier H. (2004). ARB: a software environment for sequence data. Nucleic Acids Res. 32: 1363 Lutz M., Dunbar R., and Caldeira K. (2002). Regional variability in the vertical flux of particulate organic carbon in the ocean interior. Global Biogeochem. Cycles. 16(3): 1037 Mahan MJ., Slauch JM. and Mekalanos JJ. (1993). Selection of bacterial virulence genes that are specifically induced in host tissues. Science. 259: 686-688 Malmcrona-Friberg K., Goodman A. and Kjelleberg S. (1990). Chemotactic responses of marine Vibrio sp. Strain S14 (CCUG 15956) to low-molecular weight substances under starvation and recovery conditions. Appl. Environ. Microbiol. 56: 3699-3704 Martin S., Marquez MC., Sanchez-Porro C., Mellado E., Arahal DR., and Ventosa A. (2003). Marinobacter lipolyticus sp. nov., a novel moderate halophile with lipolytic activity. Int. J. Syst. Evol. Microbiol. 53: 1383-1387 Middleboe M. and Lyck PG. (2002). Regeneration of dissolved organic matter by viral lysis in marine microbial communities. Aquat. Microb. Ecol. 27: 187-194

170

Mitchell JG., Pearson L., Dillon S. and Kantalis K. (1995). Natural assemblages of marine bacteria exhibiting high-speed motility and large accelerations. Appl. Environ. Microbiol. 61: 4436-4440 Molino PJ. and Wetherbee R. (2008). The biology of biofouling diatoms and their role in the development of microbial slimes. Biofouling: The Journal of Bioadhesion and Biofilm Research 24: 365-379

Montenegro A., Brovkin V., Eby M., Archer D. and Weaver AJ. (2007). Long term fate of anthropogenic carbon, Geophys. Res. Lett. 34 L19707 Montes MJ., Bozal N. and Mercade E. (2008). Marinobacter guineae sp. nov., a novel moderately halophilic bacterium from an Antarctic environment. Int. J. Syst. Evol. Microbiol. 58: 1346 Mopper K, Zhou J, Ramana KS, Passow U, Dam HG, Drapeau DT. (1995) The role of surface-active carbonhydrates in the flocculation of a diatom bloom in a mesocosm. Deep-Sea Res. II 42: 47-73 Nyholm SV, McFall-Ngai MJ. (2004). The Winnowing: Establishing the Squid–Vibrio Symbiosis. Nat. Rev. Microbiol. 2 (8): 632-42 OCTET workshop report (2000). Biological pump working group summary. http://www.msrc.sunysb.edu/octet/biological pump.html O'Toole GA., and Kolter R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304 Passow U, Alldredge AL, Logan BE (1994). The role of particulate carbohydrate exudates in the flocculation of diatom blooms. Deep-Sea Res 41:335–357 Passow U. (2000). Formation of transparent exopolymer particles, TEP, from dissolved precursor material. Mar Ecol Prog Ser 192:1-11 Passow U. (2000 a). Production of transparent exopolymer particles (TEP) by phyto- and bacterioplankton. Mar. Ecol. Prog. Ser. 236: 1-12 Passow U. (2002b). Transparent exopolymer particles (TEP) in aquatic environments. Progress in Oceanography 55:287-333 Paul C. and Pohnert G. (2011). Interactions of the algicidal bacterium Kordia algicida with diatoms: regulated protease excretion for specific algal lysis. PLos One. 6(6):e21021 Piekarski T., Buchholz I., Drepper T., Schobert M., Wagner-Doebler I., Tielen P., Jahn D. (2009). Genetic tools for the investigation of Roseobacter clade bacteria. BMC Microbiol. 9: 265-272.

171

Pommier J., Michel C., Grosselin M. (2008). Particulate organic carbon export in the upper twilight zone of the Northwest Atlantic Ocean during the decline of a spring bloom. Mar. Ecol. Prog. Ser. 356: 81-92 Priefer UB., Simon R., Pühler A. (1985). Extension of the host range of Escherichia coli vectors by incorporation of RSF1010 replication and mobilization functions. J. Bacteriol. 163: 324-329. Ramaiah N., Yoshikawa T. and Furuya K. (2001). Temporal variations in transparent exopolymeric particles (TEP) associated with a diatom spring bloom in a subarctic ria in Japan. Mar. Ecol. Prog. Ser. 212:79-88 Rhee GY. (1972). Competition between an alga and an aquatic bacterium for phosphate. Limnol. Oceanogr. 17: 505-514 Riebesell U, Fabry VJ, Hansson L, Gattuso JP. (Eds) (2010). Guide to best practices for ocean acidification research and data reporting. Vol. Bruessel. Roh SW., Quan ZX., Nam YD., Change HW., Kim KH., Rhee SK., Oh HM., Jean CO., Yoon JH. et al. (2008). Marinobacter goseongensis sp. nov. from seawater. Int. J. Syst. Evol. Microbiol. 58: 2866 Romanenko LA., Schumann P., Rohde M., Zhukova NV., Mikhailov VV. and Stackebrandt E. (2005). Marinobacter bryozoorum sp. nov. and Marinobacter sediminum sp. nov., novel bacteria from the marine environment. Int. J. Syst. Evol. Microbiol. 55: 143-148 Rosselló-Mora R. and Amann R. (2001). The species concept for prokaryotes. FEMS Microbiology Reviews 25: 39-67

Round FE., Crawford RM., Mann DG. (1990) The Diatoms: Biology and Morphology of the Genera. Cambridge University Press, London

Sabine CL. Et al. (2004) in The Global Carbon Cycle: Integrating Humans, Climate, and the Natural World. SCOPE 62. Field CB. and Raupach MR. (Eds.) Island Press, Washington, DC, pp. 17–4 Sarmiento JL. and Orr JC. (1991). Three-dimensional simulations of the impact of Southern Ocean nutrient depletion on atmospheric CO2 and ocean chemistry. Limnol. Oceanogr. 36(8): 1928-1950 Sarmiento JL., Dunne J., Gnanadesikan RM., Key RM., Matsumoto K. and Slater R. (2002). A new estimate of the CaCO3 to organic carbon export ratio. Global biogeochemical cycles 16(4): 1107 doi:10.1029/2002GB001919 Sarmiento JL., Gloor M., Gruber N., Beaulieu C., Jacobson AR., Mikaloff Fletcher SE., Pacala S. and Rodgers K. (2010). Trends and regional distributions of land and ocean carbon sinks. Biogeosciences 7: 2351-2367

172

Schuster S. and Herndl G.J., (1995). Formation and significance of transparent exopolymeric particles in the northern Adriatic Sea. Mar Ecol Prog Ser 124:227-236 Seymour J.R., Ahmed T., Durham W.M., Stocker R. (2010). Chemotactic response of marine bacteria to the extracellular products of Synechococcus and Prochlorococcus. Aquat. Microb. Ecol. 59:161-168 Shime-Hattori A, Iida T, Arita M, Park KS, Kodama T, Honda T. (2006). Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation. FEMS Microbiol. Lett. 264: 89-97. Silva PC. and Hasle GR. (1994). Proposal to conserve Thalassiosiraceae against Lauderiaceae and Planktoniellaceae (Algae). Taxon 43: 298-289 Smayda TJ. (1971). Normal and accelerated sinking of phytoplankton in the sea. Marine Geology 11: 105-122 Sonnenschein EC., Gaerdes A., Seebah S., Torres-Monroy I., Grossart HP., Ullrich MS. (2011). Development of a genetic system for Marinobacter adhaerens HP15 involved in marine aggregate formation by interacting with diatom cells. J. Microbiol. Methods 87 (2): 176-183 Stackebrandt E., Ludwig W. and Fox GE. (1985). 16S ribosomal RNA oligonucleotide cataloguing. Methods Microbiol. 18: 75-107 Stackebrandt E. and Goebel BM. (1994). Taxonomic Note: A place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int. J. Syst. Bacteriol. 44: 846-849 Stoderegger KE., Herndl G.J. (1999). Production of exopolymer particles by marine bacterioplankton under contrasting turbulence conditions. Mar. Ecol. Prog. Ser. 189:9-16 Sundquist ET. and Visser K. (2004). The Geologic History of the Carbon Cycle. In: Treatise on Geochemistry. Holland, H.D. and Turekian, K.K. (Eds) Elsevier, Amsterdam. 8: 425-472. Takai K., Moyer CL., Miyazaki M., Nogi Y., Hirayama H., Nealson KH. and Horikoshi K. (2005). Marinobacter alkaliphilus sp. nov., a novel alkaliphilic bacterium isolated from subseafloor alkaline serpentine mud from Ocean Drilling Program Site 1200 at South Chamorro Seamount, Mariana Forearc. Extremophiles 9: 17-27 Tamaoka J. (1994). Determination of DNA base composition. In Chemical Method Prokaryotic Systematics, pp. 463-470. Edited by Goodfellow M. and O’Donnell AG. Chichester, Wiley Thormann KM, Saville RM, Shukla Soni, Pelletier DA, Spormann AM. (2004). Initial phases of biofilm formation in Shewanella oneidensis MR-1. J. Bacteriol. 186 (23) 8096-8104

173

Turner J.T., (2002). Zooplankton fecal pellets, marine snow and sinking phytoplankton blooms. Aquat. Microb. Ecol. 27:57-102 Verdugo P., Alldredge AL., Azam F., Kirchman D., Passow U., Santschi P. (2004). The oceanic gel phase: a bridge in the DOM-POM continuum. Mar. Chem. 92: 67-85 Verdugo P., (2012). Marine Microgels. Annu. Rev. Mar. Sci. 4:375-400 Volk T. and Hoffert MI. (1985). Ocean carbon pumps: Analysis of relative strengths and efficiencies in ocean-driven atmospheric CO2 changes. In The Carbon Cycle and Atmospheric CO2: Natural Variations Archean to Present. Geophys. Monogr. Ser 32: pp 99-110. Sunquist ET. and Broecker WS. (Eds), AGU, Washington DC. Wayne LG. et al. (1987). Report of the ad-hoc committee on reconciliation of approaches to bacterial systematics. Int. J. Syst. Evol. Microbiol. 37: 463-464 Windust A.J., Quilliam M.A., Wright J.L., McLachlan J.L., (1997). Comparative toxicity of the diarrhetic shellfish poisons, okadaic acid, okadaic acid diol-ester and dinophysistoxin-4, to the diatom Thalassiosira weissflogii. Toxicon. 35(11): 1591-603. Wöhlbrand L. and Rabus R. (2008). Development of a Genetic System for the Denitrifying Bacterium ‘Aromatoleum aromaticum’ Strain EbN1. J. Mol. Microbiol. Biotechnol. 17: 41-52 Yakimov MM., Timmis KN., Golyshin PN. (2007). Obligate oil-degrading marine bacteria. Current Opinion in Biotechnology. 18 (3): 257-266 Yarza P., Richter M., Peplies J., Euzeby J., Amann R., Schleifer KH., Ludwig W., Gloeckner FO. and Rosselló-Mora R. (2008). The All-Species Living Tree project: a 16S rRNA-based phylogenetic tree of all sequenced type strains. Syst. Appl. Microbiol. 31: 241-250 Yoon JH., Yeo SH., Kim IG. and Oh TK. (2004). Marinobacter flavimaris sp. nov and Marinobacter daepoensis sp. nov. slightly halophilic organisms isolated from seawater of the Yellow Sea Korea. Int. J. Syst. Evol. Microbiol. 54: 1799-1803 Zeebe RE. and Wolf-Gladrow A. (2001). CO2 in seawater: Equilibrium, kinetics and isotopes, Vol 65, Elservier, Amsterdam Zhou J, Mopper K, Passow U. (1998). The role of surface-active carbohydrates in the formation of transparent exopolymer particles by bubble adsorption of seawater. Limnol. Oceanogr. 43:1860–71

174

Declaration I hereby declare that this thesis is my own work and effort and that it has not been submitted to another university for the conferral of a degree. Where other sources of information have been used, they have been acknowledged. Date, Signature

seebah phd thesis final submission[1]

Documents