role of sparc in drosophila melanogaster basal …...ii role of sparc in drosophila melanogaster...

Role of SPARC in Drosophila melanogaster basal lamina homeostasis

by

Bianca Scuric

A thesis submitted in conformity with the requirements for the degree of Masters of Science

Graduate Department of Cell and Systems Biology

University of Toronto

© Copyright by Bianca Scuric, 2016

ii

Role of SPARC in Drosophila melanogaster basal lamina homeostasis

Bianca Scuric

Masters of Science

Department of Cell and Systems Biology University of Toronto

2016

Abstract SPARC is a multifunctional, evolutionarily conserved, collagen- and growth factor-binding glycoprotein that is required in Drosophila melanogaster for proper larval development and maintenance of fat body homoeostasis. I have engineered a SPARC RNAi knockdown in the larval fat body, with an emphasis on ultrastructural adipocyte morphology and basal lamina integrity, resulting in adipocyte remodeling characterized by cell rounding and accumulation of fibrous matrix material. SPARC deficient larva show increased deposition of collagen IV and other basal lamina components. How collagen IV assembles into an organized network in basal lamina remains unclear. In seeking to elucidate the potential intra- and extracellular functions of SPARC in this context, I generated five mCherry tagged SPARC constructs which failed to rescue SPARC-null mutants. Together, the data compiled by myself and others in the lab indicate that SPARC is required to maintain adipocyte morphology and basal lamina homeostasis during larval development.

iii

Acknowledgments This thesis is dedicated to my beloved mother, Anne-Marie, who has supported me throughout my entire academic career. Her unconditional love and encouragement to always pursue my goals (usually extemporaneous in nature) drove me to find and realize my potential. Thank you for learning and growing with me, and always being so positive - I am forever grateful. I would like to thank my supervisor, and friend Dr. Maurice Ringuette, for the opportunity to engage in research, and truly learn what it means to be a scientist – “in many cases, no results or negative results challenge the current knowledge base, and these push us to uncover novel ideas and methods of attack”. There are people in everyone’s lives who make success both possible and rewarding. To my sisters, Michelle and Dakota, thank you for always being there to inspire me and spending countless nights staying up with me to do work. To my Dad and second mother, Fran, without you I would never have even made it through the front door of this renowned institution – thank you for pushing me to always to surpass expectations. My partner Donald Sheldon Rogers IV, his beautiful daughters, Ava and Brooklin, whom I will always cherish as my own, Donald Senior and Sue Rogers, and the rest of the Rogers family, thank you for graciously accepting me and showing me such support and encouragement. Thanks to Dorothea Godt, Tony Harris, and Ashley Bruce for your amenability, guidance, insightful advice and for opening up your lab resources to me. Lastly I’d like to thank twinkle toes (Alexa) and notrescued (Brian) for making every day in the lab most enjoyable, you two truly mean the world to me and I could never express the gratitude I have for your friendships – “I get by with a little help from my friend” – John Lennon. I’m movin’ on...

iv

Table of Contents Abstract ....................................................................................................................................................... ii

Acknowledgments .................................................................................................................................iii

List of Tables ............................................................................................................................................ vi

List of Figures ........................................................................................................................................ vii

1. Introduction ......................................................................................................................................... 1

1.1 Extracellular Matrix .............................................................................................................. 1

1.2 Basal laminae .......................................................................................................................... 2

1.3 Major basal lamina components ...................................................................................... 3

a. Type IV Collagen .................................................................................................................... 6

b. SPARC .................................................................................................................................... 8

1.4 Basal lamina secretion and assembly ......................................................................... 12

1.5 Fat body development and remodeling ..................................................................... 13

Objectives and Summary .............................................................................................................. 16

2. Materials and Methods .................................................................................................................. 17

Chapter 1: Ultrastructural analysis of knockdown of SPARC in larval adipocytes 17

2.1.1 Drosophila Genetics ......................................................................................................... 17

2.1.2 SPARC RNAi Cross Summary ...................................................................................... 19

2.1.3 Preparation of larval tissues ....................................................................................... 19

2.1.4 Scanning Electron Microscopy (SEM) ..................................................................... 19

2.1.5 Transmission Electron Microscopy (TEM) ............................................................ 20

2.1.6 Imaging acquisition, processing and statistical analysis.................................. 21

Chapter 2: Generation of UAS-SPARC mutant fusion constructs ................................... 22

2.2.1 Synthesis of full-length and mutated Drosophila SPARC constructs, tagged with mCherry ............................................................................................................................... 22

2.2.2 Generation of a human SPARC construct ............................................................... 22

2.2.3 Preparation of pENTR 2B entry vector and ppWG mCherry destination vector for Gateway cloning ..................................................................................................... 23

2.2.4 Generation of entry clones containing Drosophila and human SPARC sequences ...................................................................................................................................... 24

2.2.5 Injection of Drosophila and Human UAS-SPARC::mCherry clones ................. 26

2.2.6 Rescue cross summary .................................................................................................. 26

2.2.7 Assay for SPARC-null rescue ........................................................................................ 28

2.2.8 Immunohistochemistry ................................................................................................. 28

2.2.9 Western Blot analysis .................................................................................................... 29

v

3. Results ................................................................................................................................................. 31

Chapter 1: Ultrastructural analysis of knockdown of SPARC in the Drosophila larval fat body ................................................................................................................................... 31

Introduction ................................................................................................................................. 31

3.1.1 Knockdown of SPARC causes pitting of greater recess on the surface of larval adipocytes ......................................................................................................................... 32

3.1.2 Knockdown of SPARC leads to increased basal lamina thickness ................ 35

3.1.3 Knockdown of SPARC results in altered cytoplasmic content compared to wild-type adipocytes ................................................................................................................. 38

3.1.4 Fibrous extracellular material accumulates extracellularly within the lymph space and reticular system surrounding adipocytes and between adjacent cells ................................................................................................................................ 41

Chapter 2: in vivo structure function analysis of SPARC .................................................. 44

Introduction ................................................................................................................................. 44

3.2.1 Generation of UAS-SPARC mutant fusion constructs ......................................... 45

3.2.2 Characterization of the expression of UAS-SPARC::mCherry transgenes ... 58

3.2.3 Df(3R)136nm H2AvD::GFP SPARC-deficient mutants are not rescued by UAS-SPARC::mCherry transgenes .......................................................................................... 65

4. Discussion .......................................................................................................................................... 70

4.1 Knockdown of SPARC in the larval fat body causes fat body defects characterized by accumulation of fibrous extracellular material, a thickening of the basal lamina and modification of intracellular contents .......................................... 70

4.2 UAS-SPARC::mCherry transgenes do not localize to the basal lamina surrounding fat body adipocytes nor do they rescue SPARC-null associated lethality ............................................................................................................................................... 72

4.3 Future Directions ..................................................................................................................... 76

References .............................................................................................................................................. 80

Appendix ................................................................................................................................................. 87

Appendix A. Primer Sequences .................................................................................................. 87

Appendix B. Sequencing Results ............................................................................................... 87

vi

List of Tables Table 1. Fly Strains .............................................................................................................................. 17

Table 2. List of Antibodies and Stains .......................................................................................... 29

vii

List of Figures Figure 1. Basal laminae are specialized extracellular matrix networks ............................ 5

Figure 2. Structural organization of SPARC ............................................................................... 10

Figure 3. Knockdown of SPARC causes the formation of extensive deep-seated pits

on the surface of larval adipocytes ............................................................................................... 34

Figure 4. Knockdown of SPARC causes thickening of the basal lamina surrounding

adipocytes ............................................................................................................................................... 37

Figure 5. Knockdown of SPARC leads to vast accumulation of fibrous material

between adjacent adipocytes and within the reticular system ......................................... 40

Figure 6. Knockdown of SPARC modifies adipocyte intracellular content .................... 43

Figure 7. Schematic representation of recombinant Drosophila and human SPARC

constructs................................................................................................................................................ 48

Figure 8. Human SPARC vector and human SPARC cDNA synthesis ............................... 50

Figure 9. Map of pENTR 2B entry vector and ppWG mCherry destination vector and

entry vector multiple cloning sites ............................................................................................... 54

Figure 10. Digested entry clones.................................................................................................... 57

Figure 11. PCR confirmation of insertion of transgenes ....................................................... 61

Figure 12. Gross analysis reveals expression of UAS-SPARC::mCherry transgenes

within the lymph gland and pericardial cells ............................................................................ 63

Figure 13. Confocal analysis reveals UAS-SPARC::mCherry localizes to intracellular

puncta and not within the basal lamina surrounding adipocytes .................................... 64

Figure 14. Functional expression of UAS-SPARC::mCherry protein is compromised by

cleavage of the C-terminal mCherry tag ...................................................................................... 69

1

1. Introduction

1.1 Extracellular Matrix The extracellular matrix (ECM) is an indispensable feature of all multicellular

organisms. Dynamic and complex in nature, the ECM is a highly charged,

proteinaceous and sugar rich network composed of four types of biochemically and

structurally diverse macromolecules: (1) collagens, (2) glycoproteins, (3)

proteoglycans and (4) non-collagenous structural proteins. In vertebrates, these

molecules associate into defined complexes that are divided into two classes:

interstitial matrices and basal laminae.

Initial studies lead investigators to perceive ECM molecules as having only

structural and adhesive functions (Hay, 1981; reviewed in Hay, 1991). In large part,

this was due to the unique structural and functional properties of the most

abundant of ECM molecules, the collagens. For example, the fibril-forming collagens,

such as the prototypic Type I Collagen, are secreted as soluble precursors that are

rapidly self-assembled into extensively cross-linked fibrils that laterally aggregate

to form fibers with tensile strength greater than that of steel per unit mass

(reviewed in Hay, 1981). While a major function of collagen is to impart tensile

strength to tissues and organs, molecular and functional studies have shown that

collagens and ECM molecules have diverse, pleiotropic regulatory functions in

metazoans. The biological activities of growth factors and cognate receptors are

modulated by ECM molecules (reviewed in Yurchenco et al., 2004; Hay 1991).

2

Through ECM signaling, a reciprocal dialogue is established between the ECM and

the cells thus maintaining a continuum between the extracellular and intracellular

environments.

While invertebrates can form interstitial matrices composed of collagens,

elastomeric proteins, and proteoglycans, the major type of ECM contributing to

Drosophila development is the basal lamina (Hutter et al., 2000; Hynes and Zhao,

2000).

1.2 Basal laminae Some of the most evolutionarily conserved ECM molecules are those that comprise

basal laminae (Hutter et al., 2000). While our understanding of the molecular

organization and function of basal laminae is largely derived from vertebrates,

studies of invertebrate basal lamina indicate a high degree of structural and

functional conservation between vertebrates and invertebrates (Hutter et al., 2000;

Aouacheria et al. 2004). Basal laminae were originally referred to as “basement

membranes” based on low resolution light microscopic images of tissue sections

stained with hematological dyes. More sophisticated higher resolution transmission

electron microscopy (TEM) studies revealed that what was originally referred to as

basement membranes, included interstitial matrix as well as what is now defined as

basal laminae. A basal lamina is a 50-100 nm zone visible as an electron dense

domain (lamina densa) sandwiched between two almost electron transparent zones

(lamina lucida) (Hay, 1991). Despite this many researchers continue to use the

3

terms interchangeably. Throughout this thesis, the term basal lamina will be used

exclusively.

Basal laminae are multifunctional, ECM sheets that underlie epithelial and

endothelial cells and surrounding muscle fibers, nerves, and adipose tissue. In

addition to tissue compartmentalization, basal laminae have diverse

morphoregulatory activities such as acting as substrates for cell migration, axon

guidance, growth factor localization and activation, maintenance of epithelial cell

polarity, and differentiation, growth and apoptosis (Erickson and Couchman, 2000).

In some tissues, like the kidney, the basal lamina has been modified to play a key

role in filtration (Bouturd et al., 2000; reviewed in Miner and Yurchenco, 2004).

1.3 Major basal lamina components Studies have shown that Laminin, Type IV Collagen, Perlecan, and Nidogen are

major components of invertebrate basal lamina (Figure 1.). The Drosophila genome

contains four Laminin genes, which encode two α, one β, one γ subunits, two Type

IV Collagen genes, which encode the α1(IV) and α2(IV) subunits, one Nidogen and

one Perlecan gene (Hutter et al., 2000; Hynes and Zhao, 2000).

Molecular and genetics studies in Drosophila have shown that mutations that

prevent the assembly of Laminin-1 (α3,5, β1, γ1) molecules lead to the disruption or

absence of basal laminae during embryogenesis resulting in embryonic lethality

(Fessler et al., 1987; Henchcliffe et al., 1993; Martin et al., 1999). Furthermore,

mutations in Perlecan (Park et al., 2003) and Nidogen do not affect the assembly and

5

Figure 1. Basal laminae are specialized extracellular matrix networks

Basal laminae play a dynamic and indispensable role in the development of

multicellular organisms. They are thin specialized extracellular matrix sheets that

are essential for maintaining tissue homeostasis by defining tissue boundaries,

providing an adhesive substratum for cell anchoring and migration and regulating

cell shape and polarity. Basal laminae also regulate cell signaling by binding to a

variety of transmembrane receptors and growth factors that transduce intracellular

signals. The major components of invertebrate basal lamina are Laminin, Type IV

Collagen, Perlecan, and Nidogen. The Drosophila genome contains four Laminin

genes, which encode two α, one β, one γ subunits, two Type IV Collagen genes, which

encode the α1(IV) and α2(IV) subunits, one Nidogen and one Perlecan gene (Hutter

et al., 2000; Hynes and Zhao, 2000).

6

stability of basal laminae during embryogenesis, raising the possibility that other

components contribute to the assembly and stability of basal laminae.

a. Type IV Collagen

Type IV Collagen, the only member of the collagen superfamily whose distribution is

restricted to basal laminae, forms a covalently linked polygonal network intimately

associated with the Laminin network (Timpl et al., 1981; Yurchenco and Furthmayr,

1984). Mammalian genomes code for six genetically distinct type IV collagen α

chains (Boutaud et al., 2000). Each α chain is approximately 1400 amino acid

residues with collagenous Gly-X-Y repeats, interrupted by approximately 20 short

repeats at the globular C-terminus (NC terminal domain 1) (Hay, 1991; Khoshnoodi

et al., 2008). The most broadly distributed Type IV Collagen isoform is a hetrotrimer

composed of two α1(IV) and one α2(IV) chains, designated at [α1(IV)2α2(IV)]

(Timpl, 1989; Hudson et al., 1993). Assembly of Collagen IV into a network begins

with the dimerization and crosslinking of NC1 domains followed by lateral

association between the alpha chains. Dimers assemble into anti-parallel tetramers

by interactions between four N-terminal domains, which are stabilized by disulfide

bonds.

The Drosophila genome codes for only two Collagen IV chains, α1 chain encoded by

the Dcg1/Cg25C gene (Lunstrum et al., 1988) and α2 chain encoded by the Viking

gene (Yasothornsrikul et al., 1997). Drosophila Collagen IV protein is maternally

supplied (Knibiehler et al., 1990) and forms a basal lamina in the early embryo

following cellularization (Wang, 2008). Embryonic expression of Collagen IV begins

7

at stage 13 and is restricted to mesodermal derivatives (Mirre et al., 1988). Between

stage 13 and 15, Collagen IV is expressed by migrating hemocytes which deposit

basal lamina components around all major organs including the ventral nerve cord

until it reaches a maximal level at stage 15 (Mirre et al., 1992; Olofsson et al., 2005).

At stage 15, the fat body begins to express high levels of Collagen IV and acts as the

dominant source of all basal lamina components during larval development (Fessler

et al., 1989; Hoshizaki et al., 1994).

Loss of Collagen IV leads to lethality during late embryogenesis in Drosophila. Wang

et al., (2008) showed that collagen IV binds to Decapentaplegic (Dpp) and is

required for the establishment of a Dpp gradient decreasing in a dorsal to ventral

direction during early embryonic development. Collagen IV augments Dpp signaling

to promote dorsal ventral patterning (Wang, 2008). Collagen IV also promotes BMP

signaling in tubule forming cells during renal tubule morphogenesis in mammals

(Bunt et al., 2010). During late embryogenesis, Collagen IV is required for ventral

nerve cord (VNC) condensation, failure of which leads to lethality (Olofsson et al.,

2005). During larval development, disruption of Collagen IV function causes a

decrease in locomotive activity due to a failure to form functional myotendnous

junctions (Borchiellini et al., 1996). Recent studies in our lab have demonstrated

that the dysregulation in the assembly and maturation of collagen IV leads to larval

lethality, associated with remodeling of the fat body (Shahab et al., 2015).

8

b. SPARC SPARC (Secreted Protein Acidic Rich in Cysteine) is a 33-35 kDa multifunctional,

counter-adhesive, calcium- and collagen- binding matricellular glycoprotein.

SPARC was originally called osteonectin because it was first identified as an

abundant non-collagenous component of mineralized tissues (Termine et al., 1981).

However, it was shortly thereafter shown to be expressed in a broad spectrum of

tissues, particularly in tissues undergoing morphogenesis, remodeling, repair and

neoplastic transformation (Mendis and Brown, 1994; Tuzelmann et al. 1998;

Brekken and Sage 2000). SPARC was also given the acronym BM-40 since it is

enriched within basement membrane/basal laminae (Mann et al., 1987).

Based on its primary amino acid sequence, mature SPARC can be subdivided into

three distinct structural domains (Figure 2.). In invertebrates, the N-terminal

domain I is rich in acidic amino acids and can bind up to eight Ca2+ ions with low

affinity (Kd = 10-3-10-5 M), making SPARC sensitive to changes in ECM Ca2+ levels

(Maurer et al., 1992). This domain is the most divergent among SPARC proteins and

contains the epitopes recognized by most SPARC antibodies. Domain II contains a

follistatin-like module with ten conserved cysteine residues, two Cu2+-binding sites,

and a single N-linked glycosylation site. Connective tissue derived SPARC (i.e. bone)

has high-mannose oligosaccharide attachment whereas platelet-derived growth

factor contains complex oligosaccharide N-glycosylation. The C-terminal domain III

is an alpha-helical rich region containing a pair of EF-hands motifs, which bind two

Ca2+ ions with high affinity (Kd = 10-7 M) (Hohenester et al., 1997). EF-hand motifs

are present in a broad variety of intracellular proteins that mediate calcium-

10

Figure 2. Structural organization of SPARC

SPARC is a collagen binding glycoprotein, composed of three domains: a glutamic

acid-rich n terminal domain, with low Ca2+-binding affinity, a follastatin-like module

and a C-terminal alpha helical rich region containing two evolutionary conserved,

collagen binding epitopes.

11

dependent functions (reviewed in Meinman, 1991). Canonical EF-hand motifs

consist of two alpha helices (E and F) that are linked by a Ca2+-binding loop. Both

EF-hands of SPARC are atypical; EF-hand1 contains an amino acid insertion within

the Ca2+-coordinating loop whereas EF-hand2 has a canonical pattern of Ca2+-

binding residues but is stabilized by a disulfide bridge between flanking helices.

This domain has been designated the Extracellular Calcium-binding (EC) domain to

distinguish it from the classical intracellular EF-hand motifs (Sasaki et al., 1998).

The high affinity Ca2+-binding EF-hands is meditated by cooperative interactions

between EF-hands as well as the follistatin-like cassette (Burch et al., 2000). The

coupling of the EC domain and the follistatin-like domain II is the hallmark feature

of the SPARC family (Vannahme et al., 2002). Mutations in the EF-hands that abolish

the Ca2+-binding inhibit SPARC secretion, suggesting that Ca2+-binding is required

for the proper folding in the ER and secretion (Busch et al., 2000).

During Drosophila melanogaster embryogenesis, SPARC transcripts are detected at

the onset of cellularization and show enrichment in the invaginating mesoderm and

endoderm (Martinek et al., 2008). At stage 11, SPARC expression was observed in

the anterior and posterior midgut primordia and continued to be expressed in

mesodermal derivatives throughout embryogenesis. SPARC expression was

observed in migrating hemocytes from stage 12 onwards and found to be deposited

into basal laminae surrounding all major organs such as the gut, VNC, and salivary

glands. By stage 15, SPARC is expressed in the channel glia of the developing VNC

and fat body. Strong SPARC immunostaining was also observed in the garland cells

where SPARC protein localized to large puncta (Martinek et al., 2002).

12

Previously, our lab generated the SPARC mutation line, Df(3R)136nm H2AvD::GFP,

by an imprecise excision of a downstream histone variant, which rendered SPRC

non-functional (Martinek et al., 2008). The SPARC mutant phenotype results in

lethality at various larval stages and leads to growth, feeding, ecdysis and fat body

defects (Shahab, 2011). In addition, loss of SPARC has been shown to cause aberrant

morphological changes in the fat body, characterized by a cell-autonomous

accumulation of Collagen IV, Laminin and Perlecan at the basal lamina surrounding

mutant adipocytes (Baratta, 2012). Similar effects were seen in larvae expressing

SPARC RNAi with cg-Gal4 in the fat body and hemocytes. Together, these data

suggest that SPARC plays a role in the regulation and assembly of basal lamina.

1.4 Basal lamina secretion and assembly There are two major sources of basal laminae components in Drosophila: the

hemocytes and the fat body (Fessler et al., 1989; Le Parco, et al., 1986; Fogerty et al.,

1994; Kusche‐Gullberg et al., 1992; Martinek et al., 2002; Martinek et al., 2008;

Pastor‐Pareja et al., 2011). With the exception of the hemocytes, all Drosophila

tissues are associated with a basal lamina (Tepass et al., 1994; Brac, 1983).

Biochemical and genetic studies conducted have provided the following model of

basal lamina assembly. Laminin is the first component of the basal lamina to be

secreted and assembled into a network and in its absence no basal lamina formation

occurs (Smyth et al., 1999). Secreted Laminin binds to the ECM cell surface

receptors β1-integrin and α-dystroglycan via its C-terminal LG domain. Binding to

13

cell surface receptors facilitates its polymerization through the N-terminal short

arms (Li et al., 2003; Lohikangas et al., 2001). Following Laminin polymerization

into a network, Collagen IV is secreted and polymerized into a network that is

tethered to the Laminin network. Linkage of the Collagen IV network to the Laminin

network is believed to be mediated through the small ECM glycoprotein Nidogen

that can bind to both Type IV Collagen and Laminin (Yurchenco and O’rear, 1994).

Perlecan does not polymerize like Collagen IV and Laminin but can bind to both of

these network forming molecules and Nidogen (Knox et al., 2006; Yurchenco and

O’rear, 1994).

1.5 Fat body development and remodeling The Drosophila fat body is the functional equivalent of the vertebrate liver and

adipose tissue with metabolic and immune response regulatory functions (Tong et

al., 2000; Wellen et al., 2003). The Drosophila larval fat body is a uniform tissue

which consists mainly of adipocytes or fat cells (Divoux et al., 2011). The fat body is

a major source of basal laminae components (Fessler et al., 1989), growth factors

(Kawamura et al., 1999; Okamoto et al., 2009), lipid-binding proteins and proteins

involved in the immune response (Britton et al., 1998). The fat body also serves as

the principal energy reservoir and functions to synthesize and store protein, lipid

and carbohydrates that it releases during metamorphosis or under starvation

conditions to sustain the organism (Britton et al., 1998; Delanoue et al., 2010).

Development of the Drosophila fat body begins at stage 11 when progenitor fat cells

arise from 9 bilateral clusters of cells in the inner mesodermal layer (known as the

14

splanchnopleura) spanning parasegments 4 through 12 (Hoshizaki et al., 1994). By

stage 15, the embryonic fat body is composed of two ribbon-like single-cell layers

located bilaterally between the body wall and visceral muscles. Internal organs

protrude through the fat body giving it a perforated sheet-like appearance. The bulk

of the fat body extends from the gonad to the thoracic region of the embryo.

Terminal fat cell differentiation occurs at stage 15 and is marked by expression of

the genes alcohol dehydrogenease (adh) and Collagen IV α1 (DCg1/Cg25C)

(Hoshizaki et al., 1994). Development of the embryonic fat body requires expression

of the GATA transcription factor Serpent (Srp), without which fat body progenitors

undergo apoptosis (Sam et al., 1996).

By the end of embryogenesis, the fat body consists of approximately 2200 cells

(Hoshizaki, 2005). The number of fat body cells (adipocytes), remains constant

throughout larval development. However, the adipocytes undergo several rounds of

endoreplication and continue to increase in volume until the wandering stage at the

end of 3rd instar (Britton et al., 1998). Larval fat cells have a flat polygonal shape and

appear tightly associated with one another. The width of the fat body is variable and

ranges from roughly 10 cells in the widest regions/lobes to single cells in the

interconnecting strands (Butterworth et al., 1965).

During the 3rd instar larval stage, the volume of fat body cells increases five-fold

while the nucleus shows a two-fold increase in size. By the middle of the 3rd instar,

approximately 30% of the cytoplasm of the fat cells is composed of lipid droplets

15

and 8% of glycogen deposits. At this stage, fat body cells begin to accumulate

proteinaceous globules representing autolysosomes that continue to increase in size

and number until they make up 23% of fat cell cytoplasm before pupation

(Butterworth et al., 1965). Fat body cells reach their maximum size 110 hours After

Egg Laying (AEL) after which larvae begin wandering and fat cells start to decrease

in size with the onset of pupation.

During pre-pupal stages, the larval fat body begins to undergo several changes in

shape, size and function in a process termed “fat body remodelling” (Bond et al.,

2011). Fat body cells begin to lose their polygonal shape and become spherical

approximately 6 hours after pupariation formation (APF). Between 6 and 12 hours

APF, fat body cells continue to round up, reducing their contacts with each other,

and eventually completely disassociate in a wave that progresses from anterior to

posterior by 14 hours APF (Nelliot et al., 2006). Individual fat body cells undergo

autophagy and release nutrients to support growth in the developing adult. The

number of fat body cells slowly declines throughout pupation, with a few cells

persisting for up to two days in the adult, after which they undergo programmed cell

death and are replaced by the adult fat body (Aguila et al., 2007).

16

Objectives and Summary Previous studies in the laboratory demonstrated that knockdown of SPARC in the fat

body caused abnormal changes to adipocytes and the fat body basal lamina,

resulting in larval lethality (Baratta, 2012). The first objective of my studies was to

further characterize morphological defects imparted by the dysregulation of basal

lamina components due to SPARC knockdown in the larval fat body adipocytes. My

second objective was to investigate the structure and function of the SPARC protein

in regulating basal lamina homeostasis. The precise role(s) of SPARC in mediating

the regulation of collagen IV secretion for proper basal lamina assembly and

stability still remain elusive. Thus my second objective was to gain an

understanding of the functional relationship between SPARC and collagen IV during

larval development by in vivo structure function analysis of SPARC, with an

emphasis on the evolutionarily conserved critical residues of the SPARC protein.

17

2. Materials and Methods

Chapter 1: Ultrastructural analysis of knockdown of SPARC in larval adipocytes

2.1.1 Drosophila Genetics Fly Strains Flies were raised on standard yeast medium. All crosses were performed at 25°C or

29°C. Embryos and larva were reared on apple or grape juice agar plates. The

strains used in this study are listed in the table below.

Table 1. Fly Strains

Strain Genotype Description Source Wild type Oregon R (+/+) Wild type strain Bloomington Dicer‐2; SPARC RNAi v16678

UAS-SPARC RNAi line enhanced with Dicer on 2nd chromosome

Dickson et al. 2007, VDRC

Df(3R)136nm H2AvD::GFP

w1118; ΔHis2AvD, Df(3R)nm136 H2AvD::GFP

SPARC-null deficiency line

Martinek et al. 2008, Shahab et al. 2015

UAS‐SPARC‐16 UAS-SPARC transgene at attp16

Baratta 2012

cg-Gal4; Df(3R)136nm H2AvD::GFP/ TM6B

Fat body and hemocyte specific collagen IV driver homozygous on the 2nd

chromosome, combined with SPARC-null deficiency balanced over TM6B on the 3rd chromosome

18

UAS::mCherry‐40/CyO UAS::mCherry transgene inserted at attp40

Tepass (Milena)

UAS-dSPARC::mCherry y1 M{vas-int.Dm}ZH-2A w*; P{CaryP}attP40

UAS-Drosophila SPARC::mCherry transgene inserted at attp40

This thesis

UAS-hSPARC::mCherry y1 M{vas-int.Dm}ZH-2A w*; P{CaryP}attP40

UAS-human SPARC::mCherry transgene inserted at attp40

This thesis

UAS-Δsp::mCherry y1 M{vas-int.Dm}ZH-2A w*; P{CaryP}attP40

UAS-Drosophila SPARC (lacking signal peptide)::mCherry transgene inserted at attp40

This thesis

UAS-ΔdiS::mCherry y1 M{vas-int.Dm}ZH-2A w*; P{CaryP} attP40

UAS-Drosophila SPARC (with mutated disulfide bridge in EC domain)::mCherry transgene inserted at attp40

This thesis

UAS-mCBD::mCherry y1 M{vas-int.Dm}ZH-2A w*; P{CaryP}attP40

UAS-(with mutated Collagen binding epitopes in EC domain)::mCherry transgene inserted at attp40

This thesis

cg-Gal4 w1118; P{w[+mC]=Cg-GAL4.A}2

Collagen IV driver line, Gal4 expression in hemocytes and fat body

Asha et al. 2003

lsp2-Gal4 y1 w1118; P{w[+mC]=Lsp2-GAL4.H}3

Larval serum protein driver line, Gal4 expression in larval fat body

Hassan 2001

bl/CyO; TM2/TM6B Double balanced line

if/CyO; MKRS/TM6B Double balanced line

Tepass (Jordan)

http://flybase.org/cgi-bin/fbidq.html?FBst0006357



19

2.1.2 SPARC RNAi Cross Summary Expression of SPARC RNAi was achieved using the Gal4-UAS system (Brand et al.,

1993). In order to generate animals expressing UAS-SPARC::mCherry transgenes,

wild type w1118 virgin female flies carrying the cg-Gal4 transgene were crossed to

male flies carrying UAS-SPARC RNAi enhanced with Dicer on the 2nd chromosome.

2.1.3 Preparation of larval tissues For collection of wandering 3rd instar larvae, walls of vials were cleared and

returned to a 25°C incubator for 1 hour. One hour later, animals found to be actively

wandering up the sides of vials were rinsed in 1 X Phosphate Buffered Saline (PBS)

and dissected. Dissections were performed in 1 X PBS by pulling apart animal cuticle

from either side of the lateral midgut using forceps. Organs were extracted by

holding the caudal, then rostral end of the animal with forceps, followed by gently

squeezing the cuticle toward the torn opening to extract internal organs.

2.1.4 Scanning Electron Microscopy (SEM) Larvae were dissected in PBS and fixed for 24 hours in 3% glutaraldehyde in 0.1 M

Sorensen’s Phosphate Buffer at 4°C. Animals were washed in 0.1 M phosphate buffer

three times for 10 minutes at room temperature to remove primary fixative.

Carcasses were post-fixed in fresh 1% osmium tetroxide in 0.1 M phosphate buffer

for 1.5 hours and washed three times for ten minutes in 0.1 M phosphate buffer.

Carcasses were dehydrated through an ascending ethanol series by incubating in

30-100% ethanol. Tissues were then infiltrated with a hexamethyldisilizane (HMDS)

20

and an ethanol series at ratios of 3:1, 1:1, and 1:3 ethanol to HMDS. Each infiltration

was conducted for 30 minutes followed by infiltration with 100% HMDS three times

for 30 minutes. Post-fixation, dehydration and infiltrations were performed on a

nutator at room temperature. Following infiltration with 100% HMDS, tissues were

left overnight in a depressed dish in 100% HMDS and HMDS was allowed to volatize.

The fat body was carefully dissected from dried tissue and mounted on specimen

stubs on double sided carbon tape. Samples were sputter coated with platinum

using the BalTec SCD050 and examined with a Hitachi S2500 scanning electron

microscope at 10kV.

2.1.5 Transmission Electron Microscopy (TEM) Larvae were dissected in PBS and fixed for 24 hours in 3% glutaraldehyde in 0.1 M

Sorensen’s Phosphate Buffer at 4°C. Animals were washed in 0.1 M phosphate buffer

3 times for 10 minutes at room temperature to remove primary fixative. Carcasses

were post-fixed in fresh 1% osmium tetroxide in 0.1 M phosphate buffer for 1.5

hours and washed three times for ten minutes in 0.1 M phosphate buffer. Carcasses

were dehydrated through an ascending ethanol series by incubating in 30-100%

ethanol. Tissue was then infiltrated in ethanol and Spurr’s Resin at ratios of 3:1, 1:1,

and 1:3 for one hour each at room temperature on a nutator, and then in 100%

Spurr’s resin overnight. Tissues were then infiltrated for several hours in fresh

100% Spurr’s resin and embedded overnight at 65°C. Blocks were fine sectioned

and stained.

21

2.1.6 Imaging acquisition, processing and statistical analysis Measurements of thickness of the basal laminae were taken from thirty random

positions along fat body surfaces using Image J. The basal lamina of wild-type

adipocytes has an average thickness of 30.4±1.1 nm. Expression of UAS-SPARC RNAi

with cg‐Gal4 in the fat body and hemocytes caused a statistically significant increase

in the thickness of the basal lamina. The average thickness of the fat body basal

lamina was found to be 62.3±2.3 nm. Results were found to be statistically

significant using an unpaired two-tailed t‐test with P<0.0001. n=50. Averages are

Mean±SEM. Asterisk indicates statistical significance.

Images in this study are of single confocal, SEM or TEM sessions, and were

processed using Adobe Illustrator® CC 2014 and Adobe Illustrator® CS5.

22

Chapter 2: Generation of UAS-SPARC mutant fusion constructs

2.2.1 Synthesis of full-length and mutated Drosophila SPARC constructs, tagged with mCherry

GeneArt Strings™ technology offered by ThermoFisher Scientific, was used to

generate the following Drosophilia SPARC transgenes: 1) full-length Drosophila

SPARC (dsparc), 2) Drosophila SPARC without signal peptide (Δsp-dsparc), 3)

Drosophila SPARC with mutated collagen binding residues (mCBD-dsparc) and 4)

Drosophila SPARC without disulfide bond in EF-hand II (ΔdiS-dsparc). SPARC

sequences were flanked with Sal I and Not I restriction enzyme sites, full sequences

and primer designs are presented in Appendix A. The sequence of the signal peptide

was detected using SignalP 4.1.

2.2.2 Generation of a human SPARC construct To amplify the human SPARC sequence, Polymerase Chain Reaction (PCR) was

conducted using the i-pfu High Fidelity DNA polymerase kit (ThermoFisher

Scientific Catalog # F-553S). The template for the human SPARC sequence was the

V65969 construct, containing chloramphenicol resistance. The SPARC sequence was

also flanked with Sal I and Not I restriction enzyme sites. Full sequences and primer

designs are presented in Appendix A. PCR conditions were as follows, initial

denaturation (94 °C for 2 minutes), and denaturation (30 cycles at 94 °C for 20

seconds each), annealing (60 °C for 10 seconds), and extension (68 °C for 1 minute).

The final extension was for 5 minutes at 72 °C. SPARC cDNA was purified using the

PureLink® PCR purification kit (ThermoFisher Scientific Catalog # K3100-01).

23

Amplification of human SPARC cDNA was confirmed by gel electrophoresis (0.8 %

agarose gels run for 30 minutes at 100 Volts) and Sanger Sequencing (all sequencing

services performed by Clinic Genomics Centre, Mount Sinai Hospital).

2.2.3 Preparation of pENTR 2B entry vector and ppWG mCherry destination vector for Gateway cloning

a. Transformation of entry and destination vectors Entry vector (pENTR 2B) (ThermoFisher Scientific Catalog # A10463) and

destination vector (ppWG mCherry) (modified from Drosophila Genomic Resource

Center Stock # 1078) from were generously supplied by Professor Tony Harris

(University of Toronto). Vectors were used to transform specialized competent cells

(strain C757U) that are resistant to ccdB genes in the vectors. pUC19 plasmid was

used as a negative control and plasmids with known antibiotic resistance were used

as positive controls. Each vector was added to 50 µl of competent cells and was

incubated in ice for 30 minutes. These cells were then heat shocked at 42 °C for 30

seconds, then incubated on ice for 2 minutes to recover. SOC (Super Optimal Broth)

medium was added and cells were incubated for 1 hour at 225 RPM at 37 °C. Cells

were spread onto LB plates with kanamycin (for entry vector) or ampicillin (for

destination vector), then incubated overnight at 37°C. The colonies picked for large

scale DNA preparation were prepared using Sigma Plasmid Maxiprep Kit (NA 0310).

Samples were visualized using 0.8 % agarose gels run for 30 minutes at 100 Volts.

24

b. Restriction enzyme digestion of pENTR 2B and ppWG mCherry

Entry vector (pENTR) was digested using two restriction enzymes, Sal I (5’-

GTCGAC-3’) and Not I (5’-GCGGCCGC-3’) Fast Digest enzymes from Thermo

Scientific. pENTR vector, 10 x Fast Digest buffer, and each enzyme were added

together and were incubated at 37 °C for 2 hours. Enzymes were inactivated by

incubating at 65°C for 20 minutes. The digested plasmid was ran on a 0.8% agarose

gel to confirm complete digestion and purified using Quick Gel Extraction kit

(ThermoFisher Scientific Catalog # K2100-12). All samples were stored at -20°C for

future experiments.

2.2.4 Generation of entry clones containing Drosophila and human SPARC sequences

a. Ligation and Transformation Ligation reactions were carried out at 3:1 insert to vector ratio at 4°C overnight or

25°C for 2 hours. Ligation product was added to chemically competent DH5 α cells.

After incubation on ice for 30 minutes, the mixture was heat shocked for 20 seconds

at 42°C and recovered on ice for 2 minutes. Cells were suspended in SOC medium

and shaken for 1 hour at 37°C, then incubated overnight at 37 °C on Kanamycin

plates. Selected colonies were grown in LB at 37°C overnight. This sample was

subsequently used to prepare ligated plasmids (entry clones) using the Plasmid

Miniprep kit (ThermoFisher Scientific Catalog # K2100-11).

25

b. LR Recombination

LR recombination mixture was made by adding entry clone (150 ng), destination

vector (150 ng), TE buffer (pH 8.0), and LR Clonase II enzyme mix. Reactions were

incubated at 25°C overnight. Proteinase K solution was added to terminate the

reaction and incubated at 37°C for 10 minutes. LR reaction was used to transform

into Top10 competent cells (ThermoFisher Scientific Catalog # C4040-10).

c. Antibiotic Stocks Chloramphenicol

Chloramphenicol stock was prepared by dissolving chloramphenicol in 100 %

ethanol. The solution was filtered through a 0.22 µm filter. Stock solutions were

stored in foil wrapped microcentrifuge tubes at -20°C.

Kanamycin 50 mg/ml kanamycin stock solution was made by dissolving kanamycin disulfate

salt in deionized water. Solutions were filtered and stored as mentioned above.

Ampicillin

100 mg/ml ampicillin stock solution was made by dissolving ampicillin in sodium

chloride and deionized water. Solutions were filtered and stored as mentioned

above.

26

2.2.5 Injection of Drosophila and Human UAS-SPARC::mCherry clones Generation of transgenic lines carrying the UAS-SPARC::mCherry full-length and

mutant fusion constructs shown in Figure 9 were outsourced to BestGene Inc.

Constructs were inserted at integration site attp40 (Markstein et al., 2008) on the

second chromosome and genomic integration was confirmed by PCR of adult flies.

PCR conditions were as follows, initial denaturation (94 °C for 2 minutes), and

denaturation (30 cycles at 94 °C for 20 seconds each), annealing (60 °C for 10

seconds), and extension (68 °C for 1 minute). The final extension was for 5 minutes

at 72 °C.

2.2.6 Rescue cross summary Expression of SPARC transgenes was achieved using the Gal4-UAS system (Brand et

al., 1993). In order to generate animals expressing UAS-SPARC::mCherry transgenes,

in a SPARC-null background, the following crosses were performed using each of the

five transgenic lines generated in this study:

27

Balancing transgenic lines: (Chromosome affected)

(1) (2) (3) (1) (2) (3) w- ; UAS-SPARC::mCherry wm; + X w- ; if ; MKRS Y + + w- Cyo TM6B

w- ; UAS-SPARC::mCherry wm ; + X w- ; UAS-SPARC::mcherry wm ; + l Y Cyo TM6B w- Cyo MKRS

w- ; UAS-SPARC::mCherry wm ; MKRS w-/Y UAS-SPARC::mCherry wm TM6B

Rescue of SPARC-null mutant.

(Chromosome affected) (1) (2) (3) (1) (2) (3)

w- ; UAS-SPARC::mCherry wm ; MKRS X w-; bl; Df(3Rnm)136nm H2AvD::GFP

Y Cyo TM6B w- Cyo TM6B

w- ; UAS-SPARC::mCherry wm ; Df(3R136 nm H2AvD::GFP X w- ; cg-Gal4 ; Df(3R)136nm H2AvD::GFP w- Cyo TM6B Y cg-Gal4 TM6B

w- ; UAS-SPARC::mCherry wm ; Df(3R)136nm H2AvD::GFP Y/w- cg-Gal4 Df(3R)136nm H2AvD::GFP

28

2.2.7 Assay for SPARC-null rescue Larvae were screened for expression of mCherry using a fluorescent stereoscope

(Zeiss ApoLumar V12). One hundred mCherry positive 1st instar larvae of the were

reared on yeasted apple or grape agar plates at 25°C until all surviving larvae

reached pupation, with five such plates being examined per genotype. Larvae were

screened for Tubby (TM6B) phenotypes, allowed to hatch then screened for curly

wings (Cyo).

2.2.8 Immunohistochemistry

a. Fixation and immunostaining of embryos and larval fat bodies Larvae were reared at 25°C on apple or grape agar plates or in standard media vials.

For collection of 3rd instar wandering larvae (approximately 110 hours after AEL),

walls of vials were cleared and returned to 25°C for 1 hour. Animals found to be

actively wandering up the sides of vials were rinsed in 1 X Phosphate Buffered

Saline (PBS) and dissected. Dissections were performed as described above in

section 1.3. Dissected animals were fixed for 30 minutes in 4% formaldehyde in 1 X

PBS at room temperature on a nutator. Fixed animals were rinsed in Triton X‐

100/PBS (PBT) and subsequently washed 3 times for 20 minutes in PBT. Following

washes, tissues were blocked in 5% Donkey serum in PBT at room temperature for

1 hour. Tissues were then incubated with primary antibody in 5% Donkey serum in

PBT at 4°C overnight on nutator. Tissues were rinsed 3 times and washed 3 times

for 20 minutes in PBT. Dissected animals were blocked in 5% Donkey serum in PBT

at room temperature for 1 hour. Subsequently, tissues were incubated in the dark

29

with fluorescently‐conjugated secondary antibodies for 2 hours at room

temperature in 5% Donkey serum in PBT. Secondary antibody solution was

removed and samples were rinsed and washed 3 times for 20 minutes at room

temperature in PBT. Fat body was dissected from larval cuticle in PBS and mounted

in Vectashield (Vector Laboratories,Catalog #H‐1000).

b. Antibodies used in this study Table 2. List of Antibodies and Stains

Antibody Host Species Dilution Source Anti Drosophila SPARC

Rabbit 1:250 N. Martinek et al., 2002

Anti Drosophila Collagen IV‐Cg25C

Guinea Pig 1:500 Shahab, et al., 2015

Anti mCherry Rabbit Abcam Anti mCherry Mouse Abcam Anti mouse Alexa Fluor®

Donkey 1:500 ThermoFisher Scientific

Anti rabbit Alexa Fluor® 488


Anti guinea pig Alexa Fluor® 647


Rhodamine Phalloidin

1:20 Life Technologies

Alexa Fluor® 488 1:20 Life Technologies Anti-Rabbit HRP Donkey 1:5000 Jackson Immuno

Research Anti-Mouse HRP Donkey 1:5000 Jackson Immuno

Research Anti-Guinea Pig HRP

Donkey 1:5000 Jackson Immuno Research

2.2.9 Western Blot analysis Tissues were homogenized with a fitted pestle in a microcentrifuge tube in protein

extraction buffer (100 nM Tris pH6.8 and 4% SDS). Concentrations were quantified

30

using Pierce BCA Protein Assay Kit (Catalog # 23227) according to the

manufacturer’s instruction. Equal amounts of protein were diluted in 2X Lammeli

buffer (100 mM Tris pH 6.8, 200 mM DTT, 20% glycerol, 0.01% bromophenol blue

and 4% SDS), boiled for 5 minutes and subjected to electrophoresis in a 10-15% SDS

polyacrylamide gel (Bio-Rad Catalog # 4561033) for 1.5 hours at 150 Volts. Protein

was transferred onto a PVDF membrane (Bio-Rad Catalog # 1620177) for 50

minutes at 100V. Membranes were blocked in 5% skim milk powder in TBST (Tris-

buffered saline, 0.05% Tween-20) for 1 hour at room temperature and incubated

with appropriate antibodies listed in Table 2 at 4°C overnight. Membranes were

washed with TBST and incubated with Donkey horseradish peroxidase secondary

antibodies (Jackson Immuno Research) at a dilution of 1:5000 for 1 hour at room

temperature. Membranes were then washed three times for 20 minutes with TBST.

For chemiluminescent protein detection Western Blotting Luminol reagent was

used (Santa Cruz Catalog # SC-2048). Membranes were visualized using BioRad

Molecular Imager Gel Doc™ XR+ Imaging System.

31

3. Results

Chapter 1: Ultrastructural analysis of knockdown of SPARC in the Drosophila larval fat body Data collected in this chapter were published in: Shahab J., Baratta C., Scuric B., Godt

D., Venken J.T. and Ringuette M.J. (2015) Loss of SPARC dysregulates basal lamina

assembly to disrupt larval fat body homeostasis in Drosophila melanogaster. Dev

Dyn. 244(4):540-52.

The analysis of morphological changes in adipocyte structure imparted by the

knockdown of SPARC during larval development was initiated by Baratta (2012). I

performed additional knockdown experiments to confirm the findings and further

characterize the effects of loss of SPARC by SEM and TEM analysis (Figure 8 A (inset

only), C (inset only), D-F). In addition, I assisted in editing of the main text with M.J.

Ringuette and J. Shahab, and organized and rendered all images for submission of

the paper.

Introduction The fat body has been shown to be a major source of basal lamina components

during Drosophila larval development, including Collagen IV binding glycoprotein,

SPARC (Pastor-Pareja et al., 2011; Sasaki et al., 1998). Previous reports have

demonstrated that knockdown of SPARC leads to an aberrant accumulation of ECM

proteins including Collagen IV, Laminin and Perlecan. Here, I further investigated

32

the effects of knockdown of SPARC in Drosophila larvae, with a focus on

ultrastructural morphology of the fat body.

3.1.1 Knockdown of SPARC causes pitting of greater recess on the surface of larval adipocytes Expression of UAS-SPARC RNAi, dsRNA targeting domain III of SPARC, in the larval

fat body has been demonstrated to cause defects in fat body morphology (Baratta,

2012). Thus I sought to perform ultrastructural analyses of adipocytes in a SPARC

RNAi background. I examined second instar wild-type adipocytes and compared the

pits on their surface with those found on the surface of cg-Gal4; UAS SPARC RNAi

adipocytes. Wild-type fat body adipocytes are covered with several small

depressions of varying sizes that are visible on the surfaces apposite the basal

lamina (Figure 3 A,B). Knockdown of SPARC caused adipocyte pits to appear greater

in diameter and have a different morphology (Figure 3 D,E). While there were

varying degrees of pit size and depth, in most cases the edges of the pits extended

outwards and contained ruffled material within them, in contrast to wild-type pits,

which appeared empty (Figure 3 A, B compared to D,E). Further analysis by TEM,

revealed that lipid droplets appear at the outer edges of the fat body, protruding

from an intact basal lamina (Figure 3 F), compared to wild-type which does not

contain protruding lipid droplets at all (Figure 3 C).

34

Figure 3. Knockdown of SPARC causes the formation of extensive deep-seated pits on the surface of larval adipocytes

(A,B) The surface of wild-type adipocytes have small, shallow pits of varying sizes

that are visible adjacent to the basal lamina. Fat bodies dissected from animals

expressing SPARC RNAi in the fat body have extensive, deep-seated pits with edges

that extend outwards, and ruffled material is visible within them (D,E). Pits on the

surface of wild-type adipocytes do not protrude from the tissue surface and appear

to be empty (A,B). In contrast to wild-type fat body cells (C) droplets at the outer fat

body edge protrude from the fat body surface and are cradled by a continuous basal

lamina after SPARC knockdown (F - indicated by red arrow). Scale bar (A, C, D)=5

µm. Scale bar (B)=2.31 µm. Scale bar=2.5 µm. Magnification (A)=6.0K. Magnification

(B)=13K. Magnification (C)=57.0K. Magnification (D)=20.0K. Magnification

(E)=12.0K.

35

3.1.2 Knockdown of SPARC leads to increased basal lamina thickness The basal lamina surrounding adipocytes in SPARC knockdown cells appeared

thicker than that of wild-type adipocytes (Figure 4 C,D compared to A,B). I analysed

ten TEM images taken at 80,000X magnification from five wild type and five cg-

Gal4;UAS-SPARC RNAi larvae. Quantification of basal lamina thickness using

measurements taken with ImageJ software indicate that knockdown of SPARC

significantly increases the thickness of the basal lamina but does not affect the

presence of a basal lamina (Figure 4 E). The average thickness of the wild-type basal

lamina was found to be 30.4±1.1 nm, while loss of SPARC expression resulted in an

average basal lamina thickness of 62.3±2.3 nm. These results were found to be

significant using a two‐tailed t‐test with P<0.0001. These results are consistent with

previous findings in our lab and further confirm the effects of loss of SPARC on basal

lamina homeostasis.

36

Figure 4.

37

Figure 4. Knockdown of SPARC causes thickening of the basal lamina surrounding adipocytes

Electron micrographs of fat bodies dissected from wild type larvae reveal that

knockdown of SPARC causes a significant increase in the thickness of basal lamina.

Additionally, the presence of a basal lamina is not affected. Measurements of

thickness of the basal lamina were taken from random positions along the fat body

surface using ImageJ. The average thickness of the wild-type basal lamina was found

to be 30.4±1.1 nm, while loss of SPARC expression resulted in an average basal

lamina thickness of 62.3±2.3 nm. Results were found to be significant using a two-

tailed t-test with P<0.001. n=50. Averages are Mean±SEM. Asterisk indicate

statistical significance. Scale bars=2.0 µm. Magnification (A, B)=2500x, (C, D,

F)=20000x.

38

3.1.3 Knockdown of SPARC results in altered cytoplasmic content compared to wild-type adipocytes Comparison of electron micrographs of fat bodies dissected from wild type larvae

and from larvae expressing SPARC RNAi in the fat body revealed several

morphological differences in adipocytes. Wild type adipocytes contain a

combination of both lipid and glycogen stores (Figure 5 A,B – labeled by L and blue

arrows, respectively). Knockdown of SPARC in the fat body caused a reduction in

cytoplasmic glycogen and the appearance of large ‘vacuole-like’ stores (Figure 5 C,D

- large ‘vacuole-like’ stores indicated by V). Additionally, knockdown of SPARC

caused an increase in the cytoplasmic content of rough endoplasmic reticulum

(RER) (Figure 5 C – RER indicated by white arrows) such that the cytoplasm of the

adipocytes appeared much darker than that of wild type cells. RER bodies appeared

large and distended, a feature normally observed during pupariation (Kerkut et al.,

1985).

39

L

L

V V

V

V

40

Figure 5. Knockdown of SPARC modifies adipocyte intracellular content

Analysis of larval fat bodies dissected from wild type and cg-Gal4; UAS-SPARC RNAi

(A,B compared to C,D) revealed morphological differences in cytoplasmic content.

Knockdown of SPARC causes an increase in RER and the formation of large

“vacuole-like” stores (C,D), compared to wild type cells that contain a combination

of both lipid and glycogen stores (A,B). Blue arrows indicate glycogen stores, white

arrows indicate RER, L indicates lipid droplets, V indicates “vacuole-like” stores.

Scale bar (A,C)=2.0 µm. Scale bar (B,D)=20 µm. Magnification (A,C)=3.6K.

Magnification (B,D)=36.0K.

41

3.1.4 Fibrous extracellular material accumulates extracellularly within the lymph space and reticular system surrounding adipocytes and between adjacent cells Closer evaluation of SPARC RNAi adipocytes unveiled a vast accumulation of fibrous

material between the intact basal lamina and the adipocyte surface that can be

likened to ECM material (Figure 6 B) which is absent from wild type cells (Figure 6

A). This material can also be visualized in the lymph spaces (indicated by white

arrow) formed by the plasma membrane reticular system (PMRS) as well as in

adipocyte intercellular spaces (indicated by asterix). This accumulation is absent

from these spaces in wild-type fat bodies. This analysis suggests that the aberrant

increase of various basal lamina proteins at the surface of the fat body upon loss of

SPARC observed by Shahab, 2011 and Baratta, 2012, likely corresponds to this

fibrous material.

42

*

* *

*

*

*

L L

L

L

43

Figure 6. Knockdown of SPARC leads to vast accumulation of fibrous material between adjacent adipocytes and within the reticular system

Transmission electron micrographs of wild type (A) and UAS-SPARC RNAi (B)

expressing adipocytes from 3rd instar wandering larvae. Knockdown of SPARC

causes accumulation of fibrous material in the lymph spaces formed by the PMRS

(indicated by white arrow), as well as in between adjacent adipocytes (indicated by

asterisk) that is absent from wild type fat bodies. Large lipid droplets also

accumulate within the recticular spaces (indicated by L). Scale bar (A,B)= 5µm.

Magnification (C,B)=8.5K.

44

Chapter 2: in vivo structure function analysis of SPARC

Introduction The deficiency line, Df(3R)136nm H2AvD::GFP, was previously generated by an

imprecise excision of an downstream histone variant, which rendered SPARC non-

functional (Martinek et al., 2008). Larvae homozygous for this mutation were found

to exhibit lethality at the first larval instar (Shahab et al., 2015). In addition, loss of

SPARC has been shown to cause aberrant morphological changes in the fat body,

characterized by a cell-autonomous accumulation of Collagen IV, Laminin and

Perlecan at the basal lamina surrounding mutant adipocytes (Shahab et al., 2015).

Similar effects are seen in larvae expressing SPARC RNAi with cg-Gal4 in the fat

body and hemocytes. Together, these data suggest that SPARC plays an intimate role

in the regulation and assembly of basal lamina components. Thus I sought to

perform an in vivo structure function analysis of SPARC in the fat body of Drosophila

melanogaster with the objective of elucidating the roles of the different critical

features of SPARC domains during larval development. My focus was to characterize

potential intra- and extra-cellular functions of SPARC on basal lamina homeostasis,

with an emphasis on Collagen IV assembly and maturation. Five transgenic lines

carrying mutant and fusion SPARC constructs were generated for expression under

the UAS-Gal4 system.

45

3.2.1 Generation of UAS-SPARC mutant fusion constructs

a. Synthesis of recombinant Drosophila and human SPARC Conserved residues and domains of SPARC have been associated with various

cellular functions in vitro (Brekken et al., 2001). Studies by Sasaki et al., 1998 have

shown that residues arginine (R)-182 and glutamic acid (E)-254 are critical for

collagen binding. Substitution of these residues with leucine and alanine,

respectively, completely abolishes collagen binding. These critical collagen binding

residues are conserved in Drosophila SPARC (Martinek et al., 2007). In addition,

crystallography studies on human SPARC have shown that calcium and collagen

binding properties of SPARC are dependent on interaction between EF hands found

in domains two and three (Maurer et al., 1995). This interaction is dependent on

disulfide bridging between EF hands.

To analyze the function of these key residues and the potential intra- and extra-

cellular roles of SPARC, the following constructs were synthesized using GeneArt

Strings™ technology: 1) full-length Drosophila SPARC (dSPARC), 2) full-length

Drosophila SPARC carrying leucine and alanine substitutions for amino acids

arginine-182 and glutamic acid-254, respectively (mCBD-dSPARC), 3) full-length

Drosophila SPARC with substitutions of two cysteine residues with alanine residues

in both EF hands of EC domain III (ΔdiS-dSPARC), and 4) full-length Drosophila

SPARC lacking the signal peptide sequence (Δsp-dSPARC) (Figure 7). In order to be

able to incorporate these into an expression clone, all sequences were flanked by a 6

46

nucleotide overhang and sites for restriction enzymes Sal I (5’-GTCGAC-3’) and Not I

(5’-GCGGCCGC-3’) (Appendix A).

To explore the functional conservation of SPARC, I generated a full-length human

SPARC construct using PCR amplification. Using a plasmid with human SPARC cDNA

as the template (Figure 8A), PCR was conducted to amplify and to flank SPARC

sequence with the aforementioned restriction enzyme sites. For primer sequences

please refer to Appendix A. After PCR, the sample was run on agarose gel, which

showed an intense band near 1000 bp (Figure 8B). This band corresponds to the

size of human SPARC flanked with restriction enzyme sites at approximately 940 bp.

The digested PCR amplified fragment (lane 3) is slightly smaller in size (921bp) but

it is not discernable from lane 2 because the size difference is too small. Lane 4 is the

negative control for PCR in which no template was added. Lane 5 shows purified

digested entry vector. The samples in lanes 3 and 5 were ligated together to create

an entry clone.

47

Figure 7

48

Figure 7. Schematic representation of recombinant Drosophila and human SPARC constructs

Schematic of UAS-SPARC::mCherry fusion constructs. SPARC or SPARC mutant

sequences are followed by an mCherry tag. Arrows indicate location of forward and

reverse primers used to verify insertion by PCR on whole fly extracts. Primer

locations for the mCherry tag are not indicated but correspond to either side of the

mCherry (red) region.

50

Figure 8. Human SPARC vector and human SPARC cDNA synthesis

Plasmid that contains human SPARC sequence (A). This plasmid was used as the

template for PCR (B). Amplification of human SPARC sequence. Lane 1 shows a 1 kB

DNA ladder. Lane 2 shows the PCR amplified sample. The size of the band

corresponds to the expected size of human SPARC sequence flanked with restriction

enzyme sites (940 bp). Lane 3 is PCR amplified human SPARC after digestion using

Sal I and Not I. The fragment is slightly smaller in size (921bp) but it is not

discernable from lane 2 because the size difference is too small. Lane 4 is a negative

control for PCR in which no template was added. Lane 5 shows digested entry

vector. The samples in lane 3 and 5 were ligated together to create an entry clone.

51

b. Perpetuation of entry and destination vectors To generate SPARC-tagged expression clones, the Gateway cloning system was used.

This system uses the ability of attL sites to recombine with attR sites to swap the

sequence between two attL sites with the sequence between two attR sites. The

entry clone, which contains the sequence of interest or in this case, SPARC, between

attL sites, is recombined with destination vector that has a ccdB gene between attR

sites. The destination vector used in this study contains a C-terminal mCherry

fluorescent tag, such that upon recombination, an expression clone is generated

where the SPARC gene is followed by an mCherry tag. Selectivity is conferred

through differential antibiotic resistance properties between the entry clone and the

destination vector. The same is true for the expression clone and the donor vector.

In addition, upon recombination, the donor vector will contain the ccdB gene, which

is lethal. This allows for double selection. Another advantage of the Gateway cloning

system is that one can target specific genomic sites to integrate an expression clone,

which inherently contains an attb site. The Drosophila genome has many attp sites

onto which the expression clone can be integrated. In order to generate mutant

fusion constructs using the Gateway cloning system I generated entry clones

containing, one of the five SPARC mutant fragments.

The entry vector and the destination vector were generously supplied by the Harris

lab (U of T). Figure 9 shows the map of the entry vector (pENTR 2B) (A) and

destination vector (ppWG mCherry) (B) used in this study. Each vector was used to

transform specialized competent cells that were resistant to ccdB gene caused

52

lethality. Vector concentration was increased using the Maxiprep kit. After spinning

down the starter cell culture during Maxiprep procedure, transformed cells

appeared pink in colour. This confirmed the presence of the mCherry tags and

antibiotic resistance, which led to translation of the vector and generated this red

fluorescent protein. Nanodrop concentrations of entry and destination vectors were

9.1 ng/ µl and 51.1 ng/ µl, respectively. To avoid having to use large volumes of

these vector samples, sodium acetate and ethanol were used to concentrate these

vectors. The total volume of each sample was decreased by 6-fold. The resulting

concentrations, as measured by Nanodrop, were 45.5 ng/ul and 225.2 ng/ul for

entry vector and destination vector, respectively. This is approximately a 5-fold

increase for both which correlated to the observed increase in band intensity when

visualized on an agarose gel (data not shown).

54

Figure 9. Map of pENTR 2B entry vector and ppWG mCherry destination vector and entry vector multiple cloning sites

Entry vector (pENTR 2B) (A) and destination vector (ppWG mCherry) (B) used in

this study. Important features of the entry vector include ccdB (lethal gene),

kanamycin resistance and two attL sites required for recombination. The

destination vector contains a UASp promoter, ampicillin resistance, two attR sites

followed by mCherry sequence. (C) Multiple cloning site of entry vector, pENTR 2B.

Sal I and Not I restriction enzymes, located upstream and downstream of the ccdB

gene respectively, were chosen to remove the ccdB gene because they did not

internally cut the SPARC gene. The PCR-amplified SPARC sequence was also cut

using these enzymes. Images adapted from ThermoFisher Scientific Catalog #

A10463 User Manual.

55

c. Generation of SPARC entry clones

To create entry clones from the entry vector, the ccdB gene from the entry vector

needed to be replaced by synthesized Drosophila and human SPARC sequences.

Conveniently, the entry vector comes with multiple cloning sites equipped with

several restriction enzyme sites upstream and downstream of ccdB. In order to

remove ccdB, the vector was digested with Sal I, which cuts upstream of ccdB, and

with Not I, whose recognition site is located downstream of the ccdB gene (data not

shown). These two enzymes were specifically chosen because they did not

internally cut human or Drosophila SPARC sequence. This was confirmed by

analyzing published human and Drosophila SPARC sequence using the NEB cutter

program (Vincze, T. et al., 2003). This allowed for one way ligation into the entry

vector to create an entry clone. After ligation of SPARC mutant sequences into the

entry vector, these samples were re-digested with Sal I and Not I and were ran on an

agarose gel (Figure 10). The results were as expected, with the top band

corresponding to the size of the entry vector and the bottom band corresponding to

the size of SPARC in all samples. Digested dSPARC clone (lane 2), mCBD-dSPARC

(lane 4), and ΔdiS-dSPARC all ran at the same size, while Δsp-dSPARC (lane 3) was

slightly smaller. Similar results were obtained upon digestion of hSPARC entry clone

(data not shown). After verification on agarose gel, all entry clones were verified

through sequencing (Appendix A).

57

Figure 10. Digested entry clones

Digestion of Drosophila SPARC entry clones. Entry clones, generated by ligating

entry vector with SPARC sequence, were digested with Sal I and Not I. Lane 1 shows

a 1 kB DNA ladder. Lane 2 shows a digested clone that contains full-length

Drosophila SPARC. Lane 3 shows the one that contains Drosophila SPARC without

the signal peptide. Due to the lack of signal peptide sequence, the lower band, which

corresponds to SPARC, travelled farther than other samples as the size of the

sequence is smaller. Lanes 4 and 5 show entry clones that contain SPARC with

mutated collagen binding residues and SPARC without disulfide bond in EF-hand II,

respectively. After verification on an agarose gel, all entry clones were verified

through sequencing.

58

d. LR recombination The protocol for LR recombination calls for 1 hour reaction but notes that overnight

incubation increases the yield. The recombination reactions were held overnight to

increase the yield. When LR reaction mixtures were used to transform E.coli Top10

cells, which has higher transformation efficiency than commonly used DH5α cells,

each reaction generated about 5-6 colonies, compared to 4 colonies for positive

controls. The expression clone prepared from these colonies was sent for

sequencing and the results showed 100% identity with the desired SPARC mutant

sequence using BLAST (Actschul, S.F. et al., 1990). All expression clones were

verified by gel electrophoresis (data not shown) and verified through Sanger

Sequencing (Appendix A).

3.2.2 Characterization of the expression of UAS-SPARC::mCherry transgenes

a. All UAS-SPARC::mCherry transgenes were integrated at attp40

Genomic integration of UAS-SPARC::mCherry transgenes was confirmed by PCR

analysis of whole fly extracts (Figure 11 A,B) and Sanger Sequencing (data not

shown). PCR of regions spanning UAS-SPARC::mCherry inserts (Figure 11A), as well

as the mCherry region alone (Figure 11B), performed on each of the five transgenic

UAS-SPARC::mCherry fly lines, produced the expected band sizes. Lane 2 containing

a negative control wild-type cDNA corresponded to a lack of insertion, lanes 3-7

containing each of the five mutant fusion lines in the following order:

dSPARC::mCherry, hSPARC::mCherry, ΔspdSPARC::mCherry, ΔdiSdSPARC and

59

mCBDdSPARC::mCherry, revealed expected bands at approximately 1800 bp and

lane 7 containing cDNA from UAS-mCherry alone, a secondary negative control (a

gracious gift from the Tepass lab) also corresponded to a lack of insertion. PCR of

cDNA, using mCherry specific primers revealed all five UAS-SPARC::mCherry lines,

and positive control UAS::mCherry alone, contain the mCherry sequence with a band

correlating to ~700bp.

b. UAS-SPARC::mCherry localizes to larval lymph glands and within pericardial cells but not to the fat body

Under the control of the low level, fat body-specific driver Lsp2-Gal4, UAS-

SPARC::mCherry red-fluorescence was observed within each set of pericardial cells

(PCs), located bilaterally along the heart tube, and within ventrally located lymph

glands of 1st, 2nd and 3rd instar larvae as well as pupae (Figure 12 A-E) and adults.

The same localization pattern was observed in animals of all stages when

expression was driven by the fat body and hemocyte specific driver cg-Gal4,

compared to animals expressing UAS-mCherry alone (Figure 12 F), which exhibit

both PC and lymph expression, as well as within the fat body.

61

Figure 11. PCR confirmation of insertion of transgenes

PCR of the entire SPARC::mCherry insert from each of the five generated transgenic

fly lines, and two control lines (A). Lane 1 shows a 20 kB DNA ladder. Lane 2

contains wild-type cDNA showing the lack of insertion, lanes 3-7 represent the

correlating SPARC constructs in the following order: dSPARC::mCherry,

hSPARC::mCherry, ΔspdSPARC::mCherry, ΔdiSdSPARC and mCBDdSPARC::mCherry, ,

each which revealed an expected band at ~1800 bp, and in lane 8 cDNA from a line

containing a UAS-mCherry alone at attp40 was used as a template (negative

control). PCR for SPARC::mCherry constructs did not include the UAS sequence. PCR

of cDNA using primers spanning the mCherry region (B). Wild-type flies lack

mCherry sequence (lane 2), and all five transgenic lines represented in lanes 3-7 in

the following order: dSPARC::mCherry, hSPARC::mCherry, ΔspdSPARC::mCherry,

ΔdiSdSPARC and mCBDdSPARC::mCherry; as well as the UAS::mCherry line, contain

the mCherry sequence with a band corresponding to ~ 700 bp.

62

A C B

D E F

63

Figure 12. Gross analysis reveals presence of SPARC::mCherry proteins within the lymph gland and pericardial cells

Stereoscopic fluorescent imaging revealed concentrated presence of

SPARC::mCherry dorsally, along the heart tube, within pericardial cells, and ventrally

within the lymph gland (indicated by white arrows) in all five transgenic lines (A-E).

Very little to no fat body expression was observed (A-E). In contrast, mCherry is

visible not only in pericardial cells and the lymph gland of a fly line expressing UAS-

mCherry, but also within the fat body (highlighted by bracketed area) and other

regions of the pupa. Images were taken on a Leica Stereoscope, 32.5X zoom, 520

resolution, 1388x1040 exposure.

64

c. Confocal analysis reveals mCherry expression is restricted to the cytoplasm of adipocytes Immunostaining of UAS-SPARC::mCherry expressing fat bodies with antibodies

against F-Actin (to show cell boundaries), SPARC and mCherry demonstrated that

SPARC is detected at normal levels within the basal lamina surrounding individual

adipocytes, compared to wild type (Figure 13). mCherry protein was detected at

very low levels within intracellular puncta although not within the basal lamina. In

contrast, expression of a UAS::mCherry transgene alone resulted in high levels of

intracellular mCherry staining. Given that mCherry was observed in pericardial cells

and lymph glands of live Drosophila larvae, combined with the observed lack of

mCherry detection by immunostaining, the data indicate that SPARC::mCherry fusion

proteins are likely broken down upon induced expression.

d. SPARC::mCherry proteins are cleaved in larval adipocytes

Western blot analysis was conducted on protein extracts from fat bodies dissected

from wandering 3rd instar larva expressing UAS-SPARC::mCherry transgenes under

the control of cg-Gal4. Fat body blots probed for mCherry showed the presence of

cleaved mCherry at its expected protein size of approximately 28 kDa (Figure 17),

compared to a wild-type control, in which no protein was detected. Full length

SPARC fused with mCherry is approximately 63 kDa and was not detected in any of

the five transgenic lines. Analysis of SPARC expression did not reveal any SPARC

protein larger than that of 35 kDa wild-type SPARC, with the exception of ΔdiS-

dSPARC which detected a secondary band at 45 kDa, too small to be representative

of an intact protein. These data indicate that mCherry protein is produced by

65

adipocytes of transgenic animals expressing UAS-SPARC::mCherry constructs;

however, they are cleaved after translation.

3.2.3 Df(3R)136nm H2AvD::GFP SPARC-deficient mutants are not rescued by UAS-SPARC::mCherry transgenes Expression of UAS-SPARC::mCherry in a cg-Gal4; Df(3R)136nm H2AvD::GFP/

Df(3R)136nm H2AvD::GFP mutant background did not rescue larval lethality at 18°C

or 25°C consistent with an absence of UAS-SPARC::mCherry staining within the basal

lamina surrounding larval adipocytes. In comparison, UAS-SPARC16, an untagged

SPARC transgene integrated at attp16 (Baratta, 2012), does rescue larval lethality. It

is likely that stability of the SPARC protein is comprised by the addition of a C-

terminal tag.

66

A B

E G

K

D

J

H F

I

C

M

A

O

L

P

Q R S

V U

T

W X

N

67

Figure 13. Confocal analysis reveals SPARC::mCherry localizes to intracellular puncta and not within the basal lamina surrounding adipocytes

Confocal analysis of fat bodies dissected from wandering 3rd instar larva from each

of the transgenic lines expressing UAS-SPARC::mCherry or UAS::mCherry under

control of the driver cg-Gal4. Tissues were stained with Rhodamine Phalloidin (to

mark cell boundaries), and probed for SPARC and mCherry. Fat bodies from all five

transgenic lines (E-T) appear to stain similar to wild type (A-D) for SPARC and F-

Actin. mCherry staining is increased mildly from the low level of auto-fluorescence

visible in wild type. However compared to SPARC and F-Actin staining, mCherry

does not appear to localize to the basal lamina surrounding adipocytes, and small

mCherry puncta are within fat body adipocytes. Expression of mCherry in

UAS::mCherry fat body was very strong intracellular, consistent with gross analysis

of larvae and pupae of this genotype. Scale bars=30µm.

69

Figure 14. Functional expression of UAS-SPARC::mCherry protein is compromised by cleavage of the C-terminal mCherry tag

Western blot analysis of 3rd instar larval fat bodies blotted for mCherry (A) detected

mCherry protein at ~28 kDa, representative of a cleaved product, as 28 kDa is the

expected size of mCherry by itself. Lane 1=wild-type, lane 2=lsp2-Gal4, lane

3=dSPARC-ΔdiS::mCherry, lane 4=dSPARC::mCherry, lane 5=hSPARC::mCherry, lane

6= dSPARC-mCBD::mCherry, lane 7=dSPARC-Δsp::mCherry, lane 8=empty and lane 9=

UAS::mCherry. Blot probed for SPARC protein (B) detected SPARC at 35 kDa. Full-

length SPARC::mCherry fusion protein was not detected at the expected size of 63

kDa in either blot. Lane 1=wild-type, lane 2=lsp2-Gal4, lane 3=dSPARC-

ΔdiS::mCherry, lane 4=dSPARC::mCherry, lane 5=hSPARC::mCherry, lane 6= dSPARC-

mCBD::mCherry, lane 7= empty, lane 8=dSPARC-Δsp::mCherry and lane 9=

UAS::mCherry.

70

4. Discussion

4.1 Knockdown of SPARC in the larval fat body causes fat body defects characterized by accumulation of fibrous extracellular material, a thickening of the basal lamina and modification of intracellular contents The fat body is the principle source of ECM components during larval development

and has been demonstrated to be the major source of basal lamina components

surrounding prospective adult organs (Pastor-Pareja et al., 2011). To gain a better

understanding of SPARC’s role in regulating basal laminae homeostasis I sought to

further characterize the effects of knockdown of SPARC in the larval fat body.

I investigated two distinct phenotypic features of SPARC knockdown in the larval fat

body: 1) topographical changes of adipocytes defined by the formation of deep-

seated surface pits and a thickening of basal lamina surrounding the fat body; and 2)

accumulation of fibrous extracellular material within the lymph, reticular spaces

and between adjacent adipocytes. While depletion of SPARC led to the dramatic

accumulation of fibrous ECM at cell boundaries (likely the aggregation of Collagen

IV), the overall presence of a basal lamina was not affected. Larvae expressing UAS-

SPARC RNAi presented with many extensive, hole-like pits, the majority of which

exhibited raised circumferential edges accompanied by ruffled protrusions within.

TEM analysis revealed large lipid droplets of varying sizes cradled beneath the basal

lamina of adipocytes at the outer most edge of the fat body. Likely, these lipid

droplets are representative of the pits observed on the fat body surface by SEM. The

function of the pit structures remains unclear.

71

Larvae expressing UAS-SPARC RNAi in the fat body are much smaller and relatively

transparent in comparison to wild-type larva. It is possible that the appearance of

extensive adipocyte pitting is coincident with depletion of energy stores, as animals

knocked down for SPARC resemble nutritionally compromised animals (Shahab, et

al., 2015). Knockdown of SPARC in adipocytes also showed enlarged and distended

RER, which is a hallmark response of insect fat body cells to hormone signaling

during moulting and pupariation (Kerkut et al., 1985). Distention of the RER may be

due to accumulation of the observed fibrosis ECM.

A study regarding the biogenesis of Collagen IV briefly described the effects of

knockdown of SPARC in the Drosophila larval fat body (Pastor-Pareja et al., 2011).

Knockdown of SPARC using UAS-SPARC RNAi was demonstrated to cause

extracellular accumulation of Collagen IV in thick fibers in a manner characteristic

of fibrosis. It was hypothesized that SPARC is critical for the extracellular solubility

of Collagen IV. Consistent with this study, my results and other recently published

data from our lab (Shahab et al., 2015) show that loss of SPARC causes Collagen IV

to accumulate extracellularly at the surface adjacent to the basal lamina

surrounding the fat body in a cell-autonomous manner. Since Collagen IV is

produced by the fat body, it must remain soluble in order to diffuse through the

basal lamina and reach distal target sites. Our model suggests that SPARC functions

to maintain the solubility of Collagen IV within the extracellular space, preventing it

from pre-mature polymerization. In this respect, the absence of SPARC leads to the

72

rapid polymerization of Collagen IV into a dense, fibrous meshwork. In contrast,

recent studies on the regulation of basal lamina protein levels in follicle cells of the

Drosophila egg chamber by Isabella and Horne-Badovinac (2015) suggest that

SPARC down-regulation is required for an increase in basal lamina Collagen IV

during egg chamber elongation. Interestingly, unlike the fat body, the authors

observed no effect on intra- or extracellular Collagen IV upon the knockdown of

SPARC. Thus it is likely that SPARC behaves differently to regulate the secretion and

deposition of Collagen IV within the basal lamina of different tissues.

4.2 UAS-SPARC::mCherry transgenes do not localize to the basal lamina surrounding fat body adipocytes nor do they rescue SPARC-null associated lethality Previous studies reported that expression of transgenic lines carrying a full length

SPARC fusion construct tagged with N-terminal 3XFLAG-HA tag were unable to

rescue the SPARC mutant phenotype (Shahab, 2011). Thus I have generated five

new SPARC transgenic lines, imparting expression of SPARC tagged with mCherry

fluorescent protein at the C-terminus, under control of the UAS-Gal4 system.

I expected the full length UAS-dSPARC::mCherry construct to rescue SPARC-null,

Df(3R)136nm H2AvD::GFP homozygous larvae as it was identical to wild-type

SPARC. The purpose of the human SPARC construct was to see if SPARC was

evolutionarily conserved in its function. SPARC has changed very little during

evolution and human SPARC is expected to rescue Drosophila SPARC-null lethality.

In contrast, Drosophila SPARC without signal peptide sequence was generated to

73

reveal potential intracellular functions as the lack of a signal peptide should blocked

SPARC from entering the secretory pathway. Intracellular function of SPARC is not

well understood but its intracellular association with microtubules in cilia has been

reported in Xenopus (Huynh et al., 2000). In addition, data from our lab suggest

intracellular association between SPARC and collagen IV, such that SPARC co-

localizes with misfolded collagen IV in intracellular vesicles. This study further

demonstrated that SPARC deficiency did not increase intracellular collagen IV and

proposed that SPARC may interact intracellularly with collagen IV, shuttled together

to extracellular space, to regulate collagen IV polymerization extracellularly.

The Drosophila SPARC construct that lacks collagen-binding residues, was generated

to investigate the direct association between SPARC and Collagen IV because the

mutations in this construct were to abolish SPARC Collagen IV binding. Recent

studies in humans identified two homozygous SPARC variants in patients presenting

with osteogenesis imperfecta (OI) type IV, a severe bone fragility disorder often

caused by mutations in genes that encode Type I Collagen α1 and α2 chains

(Mendoza-Londono et al., 2015). Defects in genes that play a role in the processing

of Type I Collagen have also been identified that lead it OI. It was demonstrated that

conserved residues Arg166 and Glu263 of the EC domain were mutated to His166

and Lys263, respectively. Both individuals were homozygous for one of the two

mutations in SPARC. Consistent with our model, the authors hypothesize that

SPARC, which binds to Type I collagen in the extracellular space, may play a role as

an intracellular chaperone of Collagen I.

74

The Drosophila SPARC construct without a disulfide bond in EF-hand II was

expected not to rescue the SPARC-null phenotype, since it is a requirement for the

SPARC-Collagen IV interaction. The formation of the disulfide bond in EF hand II is

unique to SPARC and has been conserved throughout evolution (Koehler et al,

2009). Hence, it is likely that this disulfide bond may play a critical role in the

function of SPARC as a chaperone.

The results I expected from the in vivo analysis of the critical features of SPARC were

not demonstrated by the rescue experiments. Failure of all five transgenic lines to

even partially rescue SPARC-null larval lethality suggests that the functional stability

of mCherry tagged SPARC proteins were compromised. Further analysis by Western

blot revealed that SPARC::mCherry was not expressed as a full-length protein (as

shown by fluorescent stereoscopy and confocal). I hypothesize that mCherry tagged

SPARC is cleaved upon translation. Protein instability could be caused by

disruptions in mRNA processings or improper folding of translated proteins, leading

to degradation.

Lysosomal degradation of proteins, known as the process of autophagy, is one of the

mechanisms cells use to degrade soluble components of the cytosol and organelles

that are no longer required for cell function (Hansen and Johnansen, 2011). In this

system cytoplasmic components become enclosed in a double membrane to form a

compartment known as the autophagosome and are delivered to the lysosome for

75

degradation. This process serves as a quality control to protect the cell from the

consequences of aggregated proteins, damaged organelles and toxic stress. I

hypothesize that the localization of UAS-SPARC::mCherry transgenes within

pericardial cells and the lymph glands, was due to increase in autophagy imparted

by an accumulation of cleaved mCherry proteins.

Pericardial cells (PCs) or pericardial nephrocytes are accessory cells of the

Drosophila heart that function to remove damaging macromolecules from the

hemolymph and their absence has been linked to decreases in longevity (Das et al.,

2008). These cells are surrounded by groups of hemocytes that lie adjacent to the

heart tube. Perhaps PCs are functioning to remove the mCherry tagged SPARC from

the hemolymph upon expression by adipocytes and floating hemocytes. Studies by

Das and colleagues (2008) indicate that post-embryonic PCs are required to

overcome toxic stress in Drosophila. In addition, studies investigating the expression

of various proteins tagged with GFP or RFP (Zhang et al., 2013) revealed that

secreted RFP and GFP proteins accumulate within pericardial nephrocytes,

independent of the tissue they were expressed in. This is consistent with the

localization patterns observed of transgenically expressed SPARC.

76

4.3 Future Directions A number of issues should be addressed in order to effectively continue studies on

the functions of SPARC in Collagen IV assembly and maturation during Drosophila

development.

The generation of the SPARC mutant, Df(3R)136nm H2AvD::GFP by Martinek (2008),

later modified by Shahab (2011), has thus far demonstrated to be a suitable

background in which to study Collagen IV regulation. In spite of the ability of

Df(3R)136nm H2AvD::GFP line to exhibit the hypothesized phenotype associated

with lack of SPARC, my rescue experiments performed using this mutant line as a

SPARC-null background were unsuccessful. Although there is a high possibility that

insertion of a C-terminal mCherry tag interferes with transgenic SPARC protein

stability, it cannot be ruled out that the modifications made to rectify the secondary

site mutation in the neutralized gene of Df(3R)136nm H2AvD::GFP mutants, affect the

rescue. The developmental arrest of homozygous Df(3R)136nm H2AvD::GFP larva at

the1st larval instar raises the possibility that additional mutations are present in the

recombined line. In the transheterozygotes, this mutation would be complemented

by the presence of a normal allele. However, the fat body phenotype and lethality at

the 2nd instar still ensued because of the homozygous disruption of SPARC. A great

benefit to the studies of this lab would be to generate a clean SPARC deficiency-line,

targeting only the SPARC locus without perturbing secondary sites. This could be

achieved through the use of CRISPR-Cas9 technology. This line will enable us to

confirm the phenotype obtained with our Df(3R)136nm H2AvD::GFP line. A true

77

SPARC mutant line will also allow us to more precisely define the lethality

associated with loss of SPARC. In addition, this new SPARC-null line could be used as

a background to generate GFP‐tagged SPARC mutants on the 2nd chromosome.

These CRISPR experiments have already been initiated in our laboratory. Currently

all target sequences have been selected and vectors for single guide RNAs are being

designed.

In light of the fact that CRISPR is a relatively new technology which will take time to

learn in order to generate a clean SPARC-null line, I propose that recombination of

the existing Df(3R)136nm H2AvD::GFP line with recently released Fios-BM-40-

SPARC::sGFP line (Sarov et al., 2015), could be performed. Since both strains

affected SPARC on the 3rd chromosome, the recombination would allow us to

determine if the loss of SPARC phenotypes imparted by Df(3R)136nm H2AvD::GFP

are affected by any possible additional site mutations. First, assessment of

chromosomal location of the SPARC GFP insert in Fios-BM-40-SPARC::sGFP flies,

should be compared with that of the SPARC insertion in Df(3R)136nm H2AvD::GFP in

order to determine if recombination experiments are feasible.

78

Assuming recombination is a feasible and likely event between the two lines the

following crosses could be performed:

Recombinants can be screened using H2AvD::GFP of the SPARC 136 deficiency line,

which expresses GFP in cell nuclei and using the enhanced GFP marker (sGFP) in

Fios line, which expresses GFP whenever SPARC is expressed. Balanced recombined

lines expressing both the SPARC-null allele and SPARC sGFP can be crossed to

themselves, to assay for SPARC rescue. Any surviving animals homozygous for

SPARC-null allele and SPARC-GFP (screened by the lack of TM6B), would indicate

two major findings: 1) Fios-BM-40-SPARC::sGFP is a functionally sufficient

fluorescently tagged SPARC transgenic which will allow us to follow SPARC in real

time, and 2) further confirmation that larval lethality caused by homozygous

79

expression of Df(3R)136nm H2AvD::GFP is due to loss of SPARC, and not any

secondary sites mutations.

Finally, studies on the regulation of Collagen IV secretion and maturation in vivo

could be complimented by in vitro biochemical studies in Drosophila Schneider 2

cells (S2 cells). These cells (derived from a hemocyte-like lineage) express SPARC.

Collagen fibrillogenesis assays indicate that SPARC increases the lag phase of human

Collagen I polymerization in vitro, with no impact on fibrillogenesis during the

growth phase, suggesting that SPARC may regulate the nucleation of Collagen

assembly. In contrast to fibril-forming Collagens, the prodomains of Collagen IV

protomers are not cleaved prior to polymerization. Indeed, both the N- and C-

terminal domains play key roles in the formation of Collagen IV protomers into

networks.

RNAi knockdown of SPARC experiments in S2 cells could be used to investigate the

impact on Collagen IV polymerization. In addition, exogenous SPARC can be used to

determine if SPARC is able to prevent polymerization or if co-secretion of SPARC

and Collagen IV is necessary. These studies would provide novel mechanistic insight

into the morphoregulatory contributions of SPARC to fat body basal lamina

assembly and function. Given the evolutionary conservation of SPARC across all

animal phyla, the mechanism(s) deciphered could be translatable to the activity of

SPARC in higher organisms.

80

References Aouacheria, A., Cluzel, C., Lethias, C., Gouy, M., Garrone, R., Exposito, J. Y. (2004). Invertebrate data predict an early emergence of vertebrate fibrillar collagen clades and an anti-incest model. J. Biol. Chem. 279, 47711-47719. Aguila, J. R., Suszko, J., Gibbs, A. G., & Hoshizaki, D. K. (2007). The role of larval fat cells in adult Drosophila melanogaster. Journal of Experimental Biology 210, 956‐63. Baratta, C. (2012). SPARC is Required in the Drosophila melanogaster fat body for ECM homeostasis during larval development. (M.Sc. thesis) Retrieved from University of Toronto Research Repository. Boutaud, A., Borza, D. B., Bondar, O., Gunwar, S., Netzer, K. O., Singh, N., Ninomiya, Y., Sado, Y., Noelken, M. E., and Hudson, B. G. (2000). Type IV collagen of the glomerular basement membrane. Evidence that the chain specificity of network assembly is encoded by the noncollagenous NC1 domains. J. Biol. Chem. 275, 30716-30724. Borchiellini, C., Coulon, J., and Le Parco Y. (1996). The function of type IV collagen during Drosophila muscle development. Mech. Dev. 58, 179-191. Bond, N. D., Nelliot, A., Bernardo, M. K., Ayerh, M. A., Gorski, K. A., Hoshizaki, D. K., & Woodard, C. T. (2011). ßFTZ‐F1 and Matrix metalloproteinase 2 are required for fat‐body remodeling in Drosophila. Developmental Biology 360, 286‐96. Brac, T. (1983). Charged sieving by the basal lamina and the distribution of anionic sites on the external surfaces of fat body cells. Tissue and Cell 15, 489‐98. Brand, A. H., & Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401‐15. Brekken, R. A., and Sage, E. H. (2000). SPARC, a matricellular protein: at the crossroads of cell-matrix. Matrix Biol. 19, 569-580. Britton, J. S., & Edgar, B. A. (1998). Environmental control of the cell cycle in Drosophila: nutrition activates mitotic and endoreplicative cells by distinct mechanisms. Development 125, 2149‐58. Bunt, S., Hooley, C., Hu N., Scahill, C., Weavers, H., and Skaer, H. (2010). Hemocyte-secreted type IV collagen enhances BMP signalling to guide renal tubule morphogenesis in Drosophila. Dev. Cell 19, 296-306.

81

Butterworth, F. M., Bodenstein, D., & King, R. C. (1965). Adipose tissue of Drosophila melanogaster.I. An experimental study of larval fat body. Journal of Experimental Zoology 158, 141‐53. Busch, E., Hohenester, E., Timpl, R., Paulsson, M., and Maurer, P. (2000). Calcium affinity, cooperativity, and domain interactions of extracellular EF-hands present in BM-40. J. Biol. Chem. 275, 25508-25515. Das, D., Aradhya, R., Ashoka, D. and Inamdar, M. (2008). Post-embryonic pericardial cells of Drosophila are required for overcoming toxic stress but not for cardiac function or adult development. Cell Tissue Res 331, 565-570. Delanoue, R., Slaidina, M., & Léopold, P. (2010). The steroid hormone ecdysone controls systemic growth by repressing dMyc function in Drosophila fat cells. Developmental Cell 18, 1012‐21. Dickson, B., Dietzl, G., Keleman, K., & members, V. p. (2007). [RNAi construct and insertion data submitted by the Vienna Drosophila RNAi Center]. Divoux, A., and Clement, K. (2011). Architecture and the extracellular matrix: the still unappreciated components of the adipose tissue. Obes. Rev. 12, e494-503. Erickson, A. C., and Couchman, J. R. (2000). Still more complexity in mammalian basement membranes. J. Histochem. Cytochem. 48, 1291-1306. Fessler, L. I., Campbell, A. G., Duncan, K. G., Fessler, J. H. (1987). Drosophila laminin: characterization and localization. J. Cell Biol. 105, 2383-2391. Fessler, J. H., and Fessler, L. I. (1989). Drosophila extracellular matrix. Annu. Rev. Cell Biol. 5, 309-339. Fogerty, F. J., Fessler, L. I., Bunch, T. A., Yaron, Y., Parker, C. G., Nelson, R. E., et al. (1994). Tiggrin, a novel Drosophila extracellular matrix protein that functions as a ligand for Drosophila alpha PS2 beta PS integrins. Development 120, 1747‐58. Hansen T. E. and Johansen T. (2011) Following autophagy step by step. BMC Biol 9, 39. Zhang, F., Zhao, Y., and Han, Z. (2013). An in vivo functional analysis for renal gene discovery in Drosophila pericardial nephrocytes. J Am Soc Nephrol 24, 191-197. Hay, E. D. (1981). Extracellular matrix. J. Cell Biol. 91, 205s-223s.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hansen%20TE%5BAuthor%5D&cauthor=true&cauthor_uid=21635796

http://www.ncbi.nlm.nih.gov/pubmed/?term=Johansen%20T%5BAuthor%5D&cauthor=true&cauthor_uid=21635796

82

Hay, E. D. (1991). Cell Biology of Extracellular Matrix: 2nd Ed. Springer Science & Business Media. Dec 31. Henchcliffe, C., Garcia-Alonso, L., Tang, J., and Goodman, C. S. (1993). Genetic analysis of laminin A reveals diverse functions during morphogenesis in Drosophila. Development 118, 325-337. Hoshizaki, D. K., Blackburn, T., Price, C., Ghosh, M., Miles, K., Ragucci, M., and Sweis, R. (1994). Embryonic fat-cell lineage in Drosophila melangaster. Development 120, 2489-2499. Hohenester, E., Maurer, P., and Timpl, R. (1997). Crystal structure of a pain of follistatin-like and EF-hand calcium-binding domains in BM-40. EMBO J. 16, 3778-3786. Hoshizaki, D. K., Blackburn, T., Price, C., Ghosh, M., Miles, K., Ragucci, M., & Sweis, R. (1994). Embryonic fat‐cell lineage in Drosophila melanogaster. Development 120, 2489‐99.

Hoshizaki, D. K. (2005). Fat‐Cell Development (Vol. 2). Berlin: Elsevier

Hudson, B. G., Tryggvason, K., Sundaramoorthy, M. Neilson, E. G. (2003). Alport’s syndrome, Goodpasture’s syndrome, and type IV collagen. N. Engl. J. Med. 348, 2543-2556. Hutter, H., Vogel, B. E., Plenefisch, J. D., Norris, C. R., Proenca, R. B., Spieth, J., Guo, C., Mastwal, S., Zhu, X., Scheel, J., Hedgecock, E. M. (2000). Conservation and novelty in the evolution of cell adhesion and extracellular matrix genes. Science 287, 989-994. Hynes, R. O., and Zhao, Q. (2000). The evolution of cell adhesion. J. Cell Biol. 150, F89-96. Hyunh, M., Hong, H., Delovitch, S., Desser, S., and Ringuette, M. (2000). Association of SPARC (osteonectin, BM-40) with extracellular and intracellular components of the ciliated surface ectoderm of Xenopus embryos. Cell Motil Cytoskeleton 47, 154-162. Isabella, A. J., Horne-Badovinac, S. (2015). Dynamic regulation of basement membrane protein levels promotes egg chamber elongation in Drosophila. Dev Bio 406, 212-221. Kawamura, K., Shibata, T., Saget, O., Peel, D., and Bryant, P. J. (1999). A new family of growth factors produced by the fat body and active on Drosophila imaginal disc cells. Development 126, 211-219. Kerkut, G. A., & Gilbert, L. I. (1985). Comprehensive insect physiology, biochemistry, and pharmacology (1sted.). Oxford ; New York: Pergamon Press.

83

Khoshnoodi, J., Pedchenko, V., Hudson, B. G. (2008). Mammalian collagen IV. Microsc. Res. Tech. 71, 357-370. Knibiehler, B., Mirre, C., Le Parco, Y. (1990). Collagen type IV of Drosophila is stockpiled in the growing oocyte and differentially located during early stages of embryogenesis. Cell Differ. Dev. 30, 147-157. Knox, S., & Whitelock, J. (2006). Perlecan: How does one molecule do so many

things? Cellular and Molecular Life Sciences, 63, 2435-2445.

Koehler, A., Desser, S., Chang, B., MacDonald, J., Tepass, U., and Ringuette, M. (2009). Molecular evolution of SPARC: absence of the acidic module and expression in the endoderm of the starlet sea anemone, Nematostella vectensis. Dev Genes Evol 219, 509-521. Kusche‐Gullberg, M., Garrison, K., MacKrell, A., Fessler, L. I., & Fessler, J. H. (1992). Laminin A chain: expression during Drosophila development and genomic sequence. EMBO J 11, 4519‐27. Le Parco, Y., Knibiehler, B., Cecchini, J. P., & Mirre, C. (1986). Stage and tissue‐specific expression of a collagen gene during Drosophila melanogaster development. Exp Cell Res 163, 405‐12. Li, S., Edgar, D., Fassler, R., Wadsworth, W., and Yurchenco, P. D. (2003). The role of laminin in embryonic cell polarization and tissue organization. Dev. Cell 4, 613-624. Lohikangas, L., Gullberg, D., and Johansson, S. (2001). Assembly of laminin polymers is dependent on beta1-integrins. Exp. Cell Res. 265, 135-144. Lunstrum, G. P., Bachinger, H. P., Fessler, L. I., Duncan, K. G., Nelson, R. E., and Fessler, J. H. (1988). Drosophila basement membrane procollagen IV. I. Protein characterization and distribution. J. Biol. Chem. 263, 18318-18327. Mann, K., Deutzmann, R., Paulsson, M., and Timpl, R. (1987). Solubilization of protein BM-40 from a basement membrane tumor with chelating agents and evidence for its identity with osteronectin and SPARC. FEBS Lett. 218, 167-172. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., & Perrimon, N. (2008). Exploiting position effects and the gypsyretrovirus insulator to engineer precisely expressed transgenes. Nature Genetics 40, 476-483. Martin, D., Zusman, S., Li, X., Williams, E. L., Khare, N., DaRocha, S., Chiquet-Ehrismann, R., and Baumgartner, S. (1999). wing blister, a new Drosophila laminin

84

alpha chain required for cell adhesion and migration during embryonic and imaginal development. J. Cell Biol. 145, 191-201. Martinek, N., Zou R., Berg M., Sodek J., and Ringuette, M. (2002). Evolutionary

conservation and association of SPARC with the basal lamina in Drosophila. Dev

Genes Evol 212, 124-133.

Martinek, N., Shahab, J., Saathoff, M., and Ringuette, M. (2008). Haemocyte-derived SPARC is required for collagen-IV-dependent stability of basal laminae in Drosophila embryos. J. Cell Sci. 121, 1671-1680. Maurer, P., Mayer, U., Bruch, M., Jeno, P., Mann, K., Landwehr, R., Engel, J., and Timpl, R. (1992). High-affinity and low-affinity calcium binding and stability of the multidomain extracellular 40-kDa basement membrane glycoprotein (BM-40/SPARC/osteonectin). Eur. J. Biochem. 205, 233-240. Mendis, D. B., and Brown, I. R. (1994). Expression of the gene encoding the extracellular matrix glycoprotein SPARC in the developing and adult mouse brain. Brain Res. Mol. Brain Res. 24, 11-19. Mendoza-Londono R., Fahiminiya S., Majewski J., Tétreault M., Nadaf J., Kannu P., Sochett E., Howard A., Stimec J., et al. (2015). Recessive osteogenesis imperfecta caused by missense mutations in SPARC. Am J Hum Genet. 96, 979-85. Miner, J. H., and Yurchenco, P. D. (2004). Laminin functions in tissue morphogenesis. Annu. Rev. Cell Dev. Biol. 20, 255-284. Mirre, C., Cecchini, J. P., Le Parco, Y., and Knibiehler, B. (1988). De novo expression of a type IV collagen gene in Drosophila embryos is restricted to mesodermal derivatives and occurs at germ band shortening. Development 102, 369-376. Mirre, C., Le Parco, Y., and Knibiehler, B. (1992). Collagen IV is present in the developing CNS during Drosophila neurogenesis. J. Neurosci. Res. 31, 146-155. Nelliot, A., Bond, N., & Hoshizaki, D. K. (2006). Fat‐body remodeling in Drosophila melanogaster genesis 44, 396‐400. Okamoto, N., Yamanaka, N., Yagi, Y., Nishida, Y., Kataoka, H., O’Connor, M. B., Mizoguchi, A. (2009). A fat body-derived IGF-like peptide regulates postfeeding growth in Drosophila. Dev. Cell 17, 885-891. Olofsson, B., and Page, D. T. (2005). Condensation of the central nervous system in embryonic Drosophila is inhibited by blocking hemocyte migration or neural activity. Dev. Biol. 279, 233-243.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mendoza-Londono%20R%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=Fahiminiya%20S%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=Majewski%20J%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=T%C3%A9treault%20M%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=Nadaf%20J%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kannu%20P%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sochett%20E%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=Howard%20A%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/?term=Stimec%20J%5BAuthor%5D&cauthor=true&cauthor_uid=26027498

http://www.ncbi.nlm.nih.gov/pubmed/26027498

85

Park, Y., Rangel, C., Reynold, M. M., Caldwell, M. C., Johns, M., Nayak, M., Welsh, C. J., McDermott, S., and Datta, S. (2003). Drosophila perlecan modulates FGF and hedgehog signals to activate neural stem cell division. Dev. Biol. 253, 247-257. Pastor-Pareja, J., and Xu, T. (2011). Shaping cells and organs in Drosophila by opposing roles of fat-body secreted collagen IV and perlecan. Developmental Cell 21, 245-256. Rempel, S. A., Golembieski, W. A., Ge, S., Lemke, N., Elisevich, K., Mikkelsen, T.,

Gutiérrez, J.A. (1998). SPARC: a signal of astrocytic neoplastic transformation and

reactive response in human primary and xenograft gliomas. J Neuropathol Exp

Neurol. 57, 1112-21.

Sam, S., Leise, W. and Hoshizaki, D. (1996). The serpent gene is necessary for progression through the early stages of fat-body development. Mech. Dev. 60, 197–205. Sarov, M., Barz, C., Jambor, H., Hein, M., Schmied, C., Suchold, D., Stender, B., Janosch, S., et al.(2015). A genome-wide resource for the analysis of protein localisation in Drosophila. doi: http://dx.doi.org/10.1101/028308 Sasaki, T., Hohenester, E., Gohring, W., and Timpl, R. (1998). Crystal structure and mapping by site-directed mutagenesis of the collagen-binding epitope of an activated form of BM-40/SPARC/osteonectin. The EMBO Journal 17, 1625-1634. Shahab, J. (2011). SPARC is required for larval development and regulation of fat body dynamics in Drosophila melanogaster. (Ph.D thesis). Retrieved from University of Toronto Research Repository. Shahab, J., Baratta, C., Scuric, B., Godt, D., Venken, K. J., and Ringuette, M. (2015). Loss of SPARC dysregulates basal lamina assembly to disrupt larval fat body homeostasis in Drosophila melanogaster. Dev. Dyn. 244, 540-552. Smyth, N., Vatansever, H. S., Murray, P., Meyer, M., Frie, C., Paulsson, M., and Edgar, D. (1999). Absence of basement membranes after targeting the LAMC1 gene results in embryonic lethality due to failure of endoderm differentiation. J. Cell Biol. 144, 151-160. Tepass, U., Fessler, L. I., Aziz, A., & Hartenstein, V. (1994). Embryonic origin of hemocytes and their relationship to cell death in Drosophila. Development 120, 1829‐37.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rempel%20SA%5BAuthor%5D&cauthor=true&cauthor_uid=9862633

http://www.ncbi.nlm.nih.gov/pubmed/?term=Golembieski%20WA%5BAuthor%5D&cauthor=true&cauthor_uid=9862633

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ge%20S%5BAuthor%5D&cauthor=true&cauthor_uid=9862633

http://www.ncbi.nlm.nih.gov/pubmed/?term=Lemke%20N%5BAuthor%5D&cauthor=true&cauthor_uid=9862633

http://www.ncbi.nlm.nih.gov/pubmed/?term=Elisevich%20K%5BAuthor%5D&cauthor=true&cauthor_uid=9862633

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mikkelsen%20T%5BAuthor%5D&cauthor=true&cauthor_uid=9862633

http://www.ncbi.nlm.nih.gov/pubmed/?term=Guti%C3%A9rrez%20JA%5BAuthor%5D&cauthor=true&cauthor_uid=9862633



86

Termine, J. D., Kleinman, H. K., Whitson, S. W., Conn, K. M., McGarvey, M. L., and Martin, G. R. (1981). Osteonectin, a bone-specific protein linking mineral to collagen. Cell. 26, 99-105. Timpl, R., Wiedemann, H., van Delden, V., Furthmayr, H., and Kuhn, K. (1981). A network model for the organization of type IV collagen molecules in basement membranes. Eur. J. Biochem. 120, 203-211. Tong, G. L., Lin, Z. X., and Jiang, J. C. (2000). The heterozygous effect of X-ray or ENU-induced null-mutant Adh alleles on alcohol tolerance of Drosophila melanogaster. Yi Chuan Xue Bao, 27, 691-700. Vannahme, C., Smyth, N., Miosge, N., Gosling, S., Frie, C., Paulsson, M., Maurer, P., and Hartmann, U. (2002). Characterization of SMOC-1, a novel modular calcium-binding protein in basement membranes. J. Biol. Chem. 277, 37977-37986. Wang, X., Harris, R. E., Bayston, L. J., and Ashe, H. L. (2008). Type IV collagens regulate BMP signalling in Drosophila. Nature 455, 72-77. Wellen, K. E., and Hotamisliqil, G. S. (2003). Obesity-induced inflammatory changes in adipose tissue. J. Clin. Invest. 112, 1785-1788. Yasothornsrikul, S., Davis, W. J., Cramer, G., Kimbrell, D. A., and Dearolf, C. R. (1997). viking: identification and characterization of a second type IV collagen in Drosophila. Gene 198, 17-25. Yurchenco, P. D., and Furthmayr, H. (1984). Self-assembly of basement membrane collagen. Biochemistry 23, 1839-1850. Yurchenco, P. D., & O'Rear, J. J. (1994). Basal lamina assembly. Current Opinion in

Cell Biology 6, 674-681.

Yurchenco, P. D., Amenta, P. S., and Patton, B. L. (2004). Basement membrane assembly, stability and activities observed through a developmental lens. Matrix Biol. 22, 521-538.

87

Appendix The restriction enzyme recognition sites are coloured in blue and start codons of either SPARC or mCherry protein are coloured in red. The mutated residues of SPARC mutant sequences are coloured in green.

Appendix A. Primer Sequences Human SPARC Forward Primer (for PCR and sequencing) 5’-CCAATTCAGTCGACCACCATGAGGGCCTGGATCT-3’ Human SPARC Reverse Primer (for PCR and sequencing) 5’-TATGATGCGGCCGCACTACGATCACAAGATCCTTGTCGATATCC-3’ Drosophila SPARC Forward Primer (for sequencing) 5’-ACCAATCCGGACAACGCGCA-3’ Drosophila SPARC Reverse Primer (for sequencing) 5’-GATGTGCATGTGCGCGTTGT-3’ Human SPARC Middle Sequence Primer (for sequencing) 5’-GAGAGGGATGAGGACAACA-3’ mCherry Forward Primer (for PCR and sequencing) 5’-AAGGGCGAGGAGGATAACATGG -3’ mCherry Reverse Primer (for PCR and sequencing) 5’-ACTTGTACAGCTCGTCCATGCC -3’

Appendix B. Sequencing Results Human SPARC ATGAGGGCCTGGATCTTCTTTCTCCTTTGCCTGGCCGGGAGGGCCTTGGCAGCCCCTCAGCAAGAAGCCCTGCCTGATGAGACAGAGGTGGTGGAAGAAACTGTGGCAGAGGTGACTGAGGTATCTGTGGGAGCTAATCCTGTCCAGGTGGAAGTAGGAGAATTTGATGATGGTGCAGAGGAAACCGAAGAGGAGGTGGTGGCGGAAAATCCCTGCCAGAACCACCACTGCAAACACGGCAAGGTGTGCGAGCTGGATGAGAACAACACCCCCATGTGCGTGTGCCAGGACCCCACCAGCTGCCCAGCCCCCATTGGCGAGTTTGAGAAGGTGTGCAGCAATGACAACAAGACCTTCGACTCTTCCTGCCACTTCTTTGCCACAAAGTGCACCCTGGAGGGCACCAAGAAGGGCCACAAGCTCCACCTGGACTACATCGGGCCTTGCAAATACATCCCCCCTTGCCTGGACTCTGAGCTGACCGAATTCCCCCTGCGCATGCGGGACTGGCTCAAGAACGTCCTGGTCACCCTGTATGAGAGGGATGAGGACAACAACCTTCTGACTGAGAAGCAGAAGCTGCGGGTGAAGAAGATCCATGAGAATGAGAAGCGCCTGGAGGCAGGAGACCACCCCGTGGAGCTGCTGGCCCGGGACTTCGAGAAGAACTATAACATGTACATCTTCCCTGTACACTGGCAGTTCGGCCAGCTGGA

88

CCAGCACCCCATTGACGGGTACCTCTCCCACACCGAGCTGGCTCCACTGCGTGCTCCCCTCATCCCCATGGAGCATTGCACCACCCGCTTTTTCGAGACCTGTGACCTGGACAATGACAAGTACATCGCCCTGGATGAGTGGGCCGGCTGCTTCGGCATCAAGCAGAAGGATATCGACAAGGATCTTGTGATCGTAGTGCGGCCGCACTCGAGATATCTAGACCCAGCTTTCTTGTACAAAGTGGTGAGATCTATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACG Drosophila SPARC ATGCGCTCCCTTTGGCTGCTGCTCGGCTTGGGCCTGCTGGCTGTGAGCCACGTCCAGGCCTCTACGGAGTTTTCCGAAGATCTGCTGGATGAGGACCTCGACCTGTCCGACATCGATGAGAACGAAGAGGAGTTCCTGCGCCTGCTGGAGGAGAAGAACAAGATCAAGGATATTGAGCGCGAGAATGAGATTGCCACCAAGCTGGCCGAAGTGCAGCACAATCTACTCAATCCCGTTGTCGAGGTGGATCTGTGCGAAACGATGAGCTGCGGAGCCGGTCGCATCTGCCAGATGCACGACGAGAAGCCCAAATGCGTGTGCATTCCGGAGTGCCCGGAGGAGGTGGACACTCGCCGCCTGGTCTGCACCAATACCAACGAGACCTGGCCGTCGGACTGCTCTGTGTATCAGCAGCGCTGCTGGTGCGACAGCGGCGAGCCCGGCTGCACCAATCCGGACAACGCGCACATGCACATCGACTACTACGGCGCTTGCCACGAGCCCAGGAGCTGCGAGGGCGAGGACCTGAAGGACTTCCCCAGGCGCATGCGCGACTGGCTGTTCAACGTGATGCGCGACCTGGCCGAGCGCGACGAGCTGACCGAGCACTACATGCAGATGGAGCTGGAGGCGGAGACCAACAACTCGCGTCGCTGGTCGAACGCCGCCGTGTGGAAGTGGTGCGACCTGGACGGCGATACCGATCGCTCCGTCTCGCGCCACGAGCTCTTCCCCATCCGTGCTCCGCTGGTCAGTCTCGAGCACTGCATCGCACCCTTCCTCGAGTCCTGCGACTCCAACAAGGACCATCGCATCACCCTGGTGGAGTGGGGCGCCTGCCTGGAGCTGGATCCCGAGGACCTCAAGGAGCGTTGCGACGACGTCCAGCGGGCTCAGCCCCATCTTCTGGGTGCGGCGCGGCCGCACTCGAGATATCTAGACCCAGCTTTCTTGTACAAAGTGGTGAGATCTATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACG Drosophila SPARC without signal peptide ATGGCCTCTACGGAGTTTTCCGAAGATCTGCTGGATGAGGACCTCGACCTGTCCGACATCGATGAGAACGAAGAGGAGTTCCTGCGCCTGCTGGAGGAGAAGAACAAGATCAAGGATATTGAGCGCGAGAATGAGATTGCCACCAAGCTGGCCGAAGTGCAGCACAATCTACTCAATCCCGTTGTCGAGGTGGATCTGTGCGAAACGATGAGCTGCGGAGCCGGTCGCATCTGCCAGATGCACGACGAGAAGCCCAAATGCGTGTGCATTCCGGAGTGCCCGGAGGAGGTGGACACTCGCCGCCTGGTCTGCACCAATACCAACGAGACCTGGCCGTCGGACTGCTCTGTGTATCAGCAGCGCTGCTGGTGCGACAGCGGCGAGCCCGGCTGCACCAATCCGGACAACGCGCACATGCACATCGACTACTACGGCGCTTGCCACGAGCCCAGGAGCTGCGAGGGCGAGGACCTGAAGGACTTCCCCAGGCGCATGCGCGACTGGCTGTTCAACGTGATGCGCGACCTGGCCGAGCGCGACGAGCTGACCGAGCACTACATGCAGATGGAGCTGGAGGCGGAGACCAACAACTCGCGTCGCTGGTCGAACGCCGCCGTGTGGAAGTGGTGCGACCTGGACGGCGATACCGATCGCTCCGTCTCGCGCCACGAGCTCTTCCCCATCCGTGCTCCGCTGGTCAGTCTCGAGCACTGCATCGCACCCTTCCTCGAGTCCTGCGACTCCAACAAGGACCATCGCATCACCCTGGTGGAGTGGGGCGCCTGCCTGGAGCTGGATCCCGAGGACCTCAAGGAGCGTTGCGACGACGTCCAGCGGGCTCAGCCCCATCTTCTGGGTGCGGCGCGGCCGCACTCGAGATATCTAGACCCAGCTTTCTTGTACAAAGTGGTGAGATCTATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTG

89

Drosophila SPARC with mutated collagen binding residues ATGCGCTCCCTTTGGCTGCTGCTCGGCTTGGGCCTGCTGGCTGTGAGCCACGTCCAGGCCTCTACGGAGTTTTCCGAAGATCTGCTGGATGAGGACCTCGACCTGTCCGACATCGATGAGAACGAAGAGGAGTTCCTGCGCCTGCTGGAGGAGAAGAACAAGATCAAGGATATTGAGCGCGAGAATGAGATTGCCACCAAGCTGGCCGAAGTGCAGCACAATCTACTCAATCCCGTTGTCGAGGTGGATCTGTGCGAAACGATGAGCTGCGGAGCCGGTCGCATCTGCCAGATGCACGACGAGAAGCCCAAATGCGTGTGCATTCCGGAGTGCCCGGAGGAGGTGGACACTCGCCGCCTGGTCTGCACCAATACCAACGAGACCTGGCCGTCGGACTGCTCTGTGTATCAGCAGCGCTGCTGGTGCGACAGCGGCGAGCCCGGCTGCACCAATCCGGACAACGCGCACATGCACATCGACTACTACGGCGCTTGCCACGAGCCCAGGAGCTGCGAGGGCGAGGACCTGAAGGACTTCCCCAGGCGC(CTC)ATGCGCGACTGGCTGTTCAACGTGATGCGCGACCTGGCCGAGCGCGACGAGCTGACCGAGCACTACATGCAGATGGAGCTGGAGGCGGAGACCAACAACTCGCGTCGCTGGTCGAACGCCGCCGTGTGGAAGTGGTGCGACCTGGACGGCGATACCGATCGCTCCGTCTCGCGCCACGAGCTCTTCCCCATCCGTGCTCCGCTGGTCAGTCTCGAG(GCG)CACTGCATCGCACCCTTCCTCGAGTCCTGCGACTCCAACAAGGACCATCGCATCACCCTGGTGGAGTGGGGCGCCTGCCTGGAGCTGGATCCCGAGGACCTCAAGGAGCGTTGCGACGACGTCCAGCGGGCTCAGCCCCATCTTCTGGGTGCGGCGCGGCCGCACTCGAGATATCTAGACCCAGCTTTCTTGTACAAAGTGGTGAGATCTATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTG Drosophila SPARC without disulfide bond in EF hand II ATGCGCTCCCTTTGGCTGCTGCTCGGCTTGGGCCTGCTGGCTGTGAGCCACGTCCAGGCCTCTACGGAGTTTTCCGAAGATCTGCTGGATGAGGACCTCGACCTGTCCGACATCGATGAGAACGAAGAGGAGTTCCTGCGCCTGCTGGAGGAGAAGAACAAGATCAAGGATATTGAGCGCGAGAATGAGATTGCCACCAAGCTGGCCGAAGTGCAGCACAATCTACTCAATCCCGTTGTCGAGGTGGATCTGTGCGAAACGATGAGCTGCGGAGCCGGTCGCATCTGCCAGATGCACGACGAGAAGCCCAAATGCGTGTGCATTCCGGAGTGCCCGGAGGAGGTGGACACTCGCCGCCTGGTCTGCACCAATACCAACGAGACCTGGCCGTCGGACTGCTCTGTGTATCAGCAGCGCTGCTGGTGCGACAGCGGCGAGCCCGGCTGCACCAATCCGGACAACGCGCACATGCACATCGACTACTACGGCGCTTGCCACGAGCCCAGGAGCTGCGAGGGCGAGGACCTGAAGGACTTCCCCAGGCGCATGCGCGACTGGCTGTTCAACGTGATGCGCGACCTGGCCGAGCGCGACGAGCTGACCGAGCACTACATGCAGATGGAGCTGGAGGCGGAGACCAACAACTCGCGTCGCTGGTCGAACGCCGCCGTGTGGAAGTGGTGCGACCTGGACGGCGATACCGATCGCTCCGTCTCGCGCCACGAGCTCTTCCCCATCCGTGCTCCGCTGGTCAGTCTCGAGCACTGCATCGCACCCTTCCTCGAGTCCTGC(GCC)GACTCCAACAAGGACCATCGCATCACCCTGGTGGAGTGGGGCGCCTGC(GCC)CTGGAGCTGGATCCCGAGGACCTCAAGGAGCGTTGCGACGACGTCCAGCGGGCTCAGCCCCATCTTCTGGGTGCGGCGCGGCCGCACTCGAGATATCTAGACCCAGCTTTCTTGTACAAAGTGGTGAGATCTATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTG

role of sparc in drosophila melanogaster basal …...ii role of sparc in drosophila melanogaster...

Documents