ORIGINAL ARTICLE

Role of CCR2 in orthodontic tooth movement

Silvana Rodrigues de Albuquerque Taddei,a Ildeu Andrade, Jr,b Celso Martins Queiroz-Junior,c

Thiago Pompermaier Garlet,d Gustavo Pompermaier Garlet,e Fernando de Queiroz Cunha,f

Mauro Martins Teixeira,g and Tarc�ılia Aparecida da Silvah

Belo Horizonte, Minas Gerais, and Ribeir~ao Preto and Bauru, S~ao Paulo, Brazil

aPostgBiochFederbAssoUnivecPostgversiddPostRibeireAssoBaurufProfeUnivegProfeand ImGeraishAssosidadeThe aucts oSuppoBrazilselhoReprinof OdGaspaildeu_Subm0889-Copyrdoi:10

Introduction: Cytokines and chemokines regulate bone remodeling during orthodontic tooth movement. CCchemokine ligand 2 (CCL2) is involved in osteoclast recruitment and activity, and its expression is increasedin periodontal tissues undermechanical loading. In this study, we investigated whether theCC chemokine recep-tor 2 (CCR2)-CCL2 axis influences orthodontic tooth movement. Methods: A coil spring was placed in CCR2-deficient (CCR2�/�), wild-type, vehicle-treated, and P8A-treated (CCL2 analog) mice. In a histopathologicanalysis, the amounts of orthodontic tooth movement and numbers of osteoclasts were determined. Theexpression of mediators involved in bone remodeling was evaluated by real-time polymerase chain reaction.Results: Orthodontic tooth movement and the number of TRAP-positive cells were significantly decreasedin CCR2�/� and P8A-treated mice in relation to wild-type and vehicle-treated mice, respectively. Theexpressions of RANKL, RANK, and osteoblasts markers (COL-1 and OCN) were lower in CCR2�/� than inwild-type mice. No significant difference was found in osteoprotegerin levels between the groups.Conclusions: These data suggested a reduction of osteoclast and osteoblast activities in the absence ofCCR2. The CCR2-CCL2 axis is positively associated with osteoclast recruitment, bone resorption, andorthodontic tooth movement. Therefore, blockage of the CCR2-CCL2 axis might be used in the future formodulating the extent of orthodontic tooth movement. (Am J Orthod Dentofacial Orthop 2012;141:153-60)

Orthodontic tooth movement is achieved by re-modeling of the periodontal ligament and alveo-lar bone in response to mechanical stimulation.

raduate student, Laboratory of Immunopharmacology, Department ofemistry and Immunology, Instituto de Ciencias Biol�ogicas, Universidadeal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil.ciate professor, Department of Orthodontics, Faculty of Dentistry, Pontif�ıciarsidade Cat�olica de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil.raduate student, Department of Oral Pathology, Faculty of Dentistry, Uni-ade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil.graduate student, Department of Pharmacology, School of Medicine of~ao Preto, University of S~ao Paulo, Ribeir~ao Preto, S~ao Paulo, Brazil.ciate professor, Department of Biological Sciences, School of Dentistry of, S~ao Paulo University, Bauru, S~ao Paulo, Brazil.ssor, Department of Pharmacology, School of Medicine of Ribeir~ao Preto,rsity of S~ao Paulo, Ribeir~ao Preto, S~ao Paulo, Brazil.ssor, Laboratory of Immunopharmacology, Department of Biochemistrymunology, Instituto de Ciencias Biol�ogicas, Universidade Federal deMinas, Belo Horizonte, Minas Gerais, Brazil.ciate Professor, Department of Oral Pathology, Faculty of Dentistry, Univer-Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil.

uthors report no commercial, proprietary, or financial interest in the prod-r companies described in this article.rted by Fundac~ao de Amparo a Pesquisas do Estado de Minas Gerais,; Coordenac~ao de Aperfeicoamento de Pessoal de N�ıvel Superior; and Con-Nacional de Desenvolvimento Cient�ıfico e Tecnol�ogico of Brazil.t requests to: Ildeu Andrade, Jr, Departamento de Ortodontia, Faculdadeontologia, Pontif�ıcia Universidade Cat�olica de Minas Gerais, Av Dom Jos�er 500, CEP 30.535-901, Belo Horizonte, Minas Gerais, Brazil; e-mail,andrade@yahoo.com.br.itted, January 2011; revised and accepted, July 2011.5406/$36.00ight � 2012 by the American Association of Orthodontists..1016/j.ajodo.2011.07.019

Bone is resorbed by osteoclasts on the pressure sites,and it is formed by osteoblasts on the tension sites.1,2

This process is regulated by an aseptic and transientinflammatory response that is characterized by thereleasing of several mediators, such as cytokines andchemokines.3-8

Chemokines, a large family of chemotactic cytokines,provide key signals for trafficking, differentiation, and ac-tivity of bone cells.9,10 The CC chemokine ligand 2 (CCL2,formerly known as monocyte chemotatic protein-1) hasbeen found to promote chemotaxis, differentiation, andactivation of osteoclasts.11-16 The cellular effects ofCCL2 are mediated by its engagement with the CCchemokine receptor 2 (CCR2),17 which is expressed by os-teoclast precursors.13-15 In addition, CCL2 expression isgreatly increased in periodontal tissues with orthodonticloading,3,4,6,7 as well as in other inflammatory conditionssuch as rheumatoid arthritis,18 bone cancer metastasis,19

periodontal disease,20,21 and periapical osteolysis.22

Studies in vitro and in vivo demonstrated thatthe blockage or absence of CCR2 significantly preventsbone resorption in experimental arthritis,23,24

osteoporosis,15 and bone fracture healing.25 Althoughthe expression of CCL2 has been shown in the periodon-tiumwith orthodontic force, the functional roles of CCL2and CCR2 in orthodontic tooth movement are notknown.3,4,6,7 In this study, we aimed to investigate the

153

154 Taddei et al

roles of CCR2 and CCL2 axis in osteoclast recruitmentand activity using a well-established mouse model oforthodontic tooth movement. We hypothesized thatthe CCR2-CCL2 axis would contribute significantly toosteoclast recruitment and, consequently, to orthodon-tic tooth movement.

Fig 1. Occlusal view of a nickel-titanium open-coil springplaced between themaxillary right first molar and incisors.

MATERIAL AND METHODS

Twenty-five wild-type mice (C57BL6/J) (10 weeksold), 25 CCR2-deficient mice (CCR2�/�) obtained fromthe Jackson Laboratory (Bar Harbor, Me), 5 vehicle-treated (PBS) mice, and 15 P8A-treated (a monomericvariant of the chemokine CCL2 able to inhibit CCR2-mediated leukocyte recruitment) mice were used in thisexperiment. CCR2 knockout mice have been previouslybred into the C57BL/6 background for 9 generations.In the genome of CCR2 knockout mice, the entire codingregion except the first 39 nucleotides and 50 untranslatedregion of the CCR2 gene in chromosome 9 were recom-bined with the neomycin-resistant gene (the codingregion and 30 untranslated region are replaced witha polII-neo cassette). No expression of CCR2 has beenobserved in this mouse. Absence of transcript was con-firmed by real-time polymerase chain reaction (PCR) byusing mRNA isolated from spleens and thioglycolate-elicited peritoneal exudate cells of homozygous mutantanimals. Overall, mice that are homozygous for the tar-geted mutation are viable, fertile, and normal in size,without any gross physical or behavioral abnormalities.26

All animals were treated under the ethical regulationsfor animal experiments, defined by the institutional ethicscommittee of Universidade Federal of Minas Gerais. Eachanimal’s weight was recorded throughout the experimen-tal period, and there was no significant loss of weight.

Tooth movement was induced as previously de-scribed.7 Briefly, the mice were anesthetized intraperito-neally with 0.2 mL of a solution containing xylazine(0.02 mg/mL) and ketamine (50 mg/mL). An orthodonticappliance consisting of a nickel-titanium 0.25 3 0.76-mm coil spring (Lancer Orthodontics, San Marcos, Calif)was bonded by light-cured resin (Transbond; 3M Unitek,Monrovia, Calif) between the maxillary right first molarand the incisors (Fig 1). The magnitude of force was cali-brated by a tension gauge (Shimpo Instruments, Itasca, Ill)to exert a force of 35 g in the mesial direction. There wasno reactivation during the experimental period. This studywas divided in 2 parts. In thefirst, named general, 2 groupswere compared: wild-type and CCR2�/� mice. In thesecond part, named specific, 4 groups were evaluated:vehicle-treated mice and 3 P8A-injected groups eachgiven a different dose (subcutaneous administration of0.5, 1.5, or 3.0 mg/kg/day). For the histomorphometric

February 2012 � Vol 141 � Issue 2 American

analysis, the left side without the maxillary appliancewas used as the control. Two subgroups were used formolecular analysis: control (mice without appliances)and experimental (mice with activated coil springs). Forthe histopathologic analysis, the wild-type and CCR2�/�

mice were killed with an overdose of anesthetic after 6and 12 days of mechanical loading (Appendix Table I).For the molecular examination, these groups were killedat 0, 12, and 72 hours (Appendix Table II). The vehicle-and P8A-treated groups (at the 3 different doses) werekilled after 12 days of orthodontic force for histomorpho-metric analysis (Appendix Table I). For every set ofexperiments, 5 animals were used at each time.

In the histopathologic analysis, the right and leftmaxillae halves, including the first, second, and thirdmolars, were dissected and fixed in 10% buffered forma-lin (pH 7.4). After fixation, each hemi-maxilla was decal-cified in 14% ethylenediaminetetraacetic acid (pH 7.4)for 20 days and embedded in paraffin. Samples werecut into sagittal sections of 5-mm thickness. The sectionswere stained with tartrate resistant acid phosphatase(TRAP; Sigma-Aldrich, St Louis, Mo), counterstainedwith hematoxylin, and used for histologic examination.The first molar’s distobuccal root, on its coronal two-thirds of the mesial periodontal site, was used for the os-teoclast counts, on 5 sections per animal. Osteoclastswere identified as TRAP-positive, multinucleated cellssited on the bone surface. The slides were counted by

Journal of Orthodontics and Dentofacial Orthopedics

Fig 2. A, Time course of changes in the amounts of tooth movement between the wild-type andCCR2�/�mice; B, number of TRAP-positive osteoclasts.C-G, Histologic changes related to orthodon-tic tooth movement in the wild-type and CCR2�/� mice, with sections of the periodontium around thedistobuccal root of the first molar stained with TRAP: C, control group (without mechanical loading);D, wild-type and E, CCR2�/� experimental groups (12 days after mechanical loading); F andG, higherviews of the identified areas in D and E. WT, Wild type; small arrows indicate TRAP-positive osteo-clasts; MB, mesial alveolar bone; DB, distal alveolar bone; PL, periodontal ligament; R, root; H, hyali-nized area; large arrows indicate the direction of tooth movement. Data are expressed as the mean 6

SEM. *P\0.05 comparing the control group with the respective experimental group. #P\0.05 compar-ing the wild-type and the CCR2�/� experimental groups (1-way ANOVA and Newman-Keuls multiplecomparison test). Bar 5 100 mm.

Taddei et al 155

American Journal of Orthodontics and Dentofacial Orthopedics February 2012 � Vol 141 � Issue 2

Table. Time course of changes in the amount of or-thodontic tooth movement between the wild-typeand CCR2�/� mice

Wild type(mean 6 SEM)

CCR2�/�

(mean 6 SEM) P value6 days 62.5 6 12.5 75 6 11.9 .0.0512 days 115 6 15.5 62.5 6 4.7 \0.05

156 Taddei et al

2 examiners (S.T. and C.Q.), and the intraclass correlationcoefficient showed average measures of 0.977, validat-ing the measurement.

Image J software (National Institutes of Health, Be-thesda, Md) was used to quantify the amount of toothmovement, as previously described.7 Tooth movementwas obtained as the difference between the distance ofthe cementoenamel junctions of the first molar andthe second molar of the experimental side (right hemi-maxilla) in relation to the control side (left hemi-maxilla) of the same animal. Five vertical sections peranimal were evaluated under a microscope (Axioskop40; Carl Zeiss, G€ottingen, Germany) adapted to a digitalcamera (PowerShot A620; Canon, Tokyo, Japan). Threemeasurements were made for each evaluation; the vari-ability was below 5%.

With a stereomicroscope, the periodontal ligament andthe surrounding alveolar bone samples were extractedfrom the maxillary first molars. Gingival tissue, oralmucosa, and toothwere discarded. These tissueswere sub-jected to RNA extraction and real-time PCR to evaluate theexpression of molecules known to regulate osteoclastfunction (receptor activator of nuclear factor kappa-B[RANK], receptor activator of nuclear factor kappa-B li-gand [RANKL], and osteoprotegerin [OPG]) and osteoblastmarkers (osteocalcin [OCN] and collagen-1 [COL-1]). RNAwas extracted by using TRIZOL reagent (Invitrogen, Carls-bad, Calif). Complementary DNA was synthesized by using2 mg of RNA through a reverse transcription reaction(Superscript II, Invitrogen). Real-time PCR analysis wasperformed in MiniOpticon (BioRad, Hercules, Calif) by us-ing the SYBR-green fluorescence quantification system(Applied Biosystems, Foster City, Calif). Standard PCRconditions were 95�C (10 minutes) and then 40 cycles of94�C (1 minute), 58�C (1 minute), and 72�C (2 minutes),followed by the standard denaturation curve. The primersequences are described in Appendix Table III.

The mean cycle threshold (Ct) values from duplicatemeasurements were used to calculate expression of thetarget gene, with normalization to an internal control(b-actin) by using the 2�DDCt formula.

Statistical analysis

The results in each group were expressed as the mean6 SEM. Because the data sets had normal distributions,differences among the groups were analyzed by 1-wayanalysis of variance (ANOVA) followed by theNewman-Keuls multiple comparison test. P\0.05 wasconsidered statistically significant.

RESULTS

The histomorphometric results showed that theamount of tooth movement (Fig 2, A, and Table) and

February 2012 � Vol 141 � Issue 2 American

the numbers of TRAP-positives osteoclasts (Fig 2, B)were increased after 6 and 12 days of mechanical load-ing in the wild-type mice (P\0.05). On the other hand,diminished tooth movement (Fig 2, A, and Table) andfewer TRAP-positive cells (Fig 2, B) were observed inthe CCR2�/� mice after 12 days (P \0.05). There wasno significant difference between the groups after 6days of mechanical loading. Moreover, microscopicanalysis showed that, in the control side, TRAP activitywas on the distal side of the alveolar bone surface, andno activity was observed in the mesial region of the pe-riodontium (Fig 2, C). After 6 days of orthodontic load-ing, there appeared to be an increase in TRAP activity onthe mesial periodontium of the distobuccal root (thepressure side) and a reduction on the distal side of thisroot (the tension side). On day 12, TRAP activity ap-peared to increase more extensively in the wild-typemice (Fig 2, D and F), which had greater alveolar boneresorption areas than did the CCR2�/� mice (Fig 2, Eand G). In contrast, a wide hyalinized area on the mesialside was observed in the CCR2�/� mice (Fig 2, F and G).

To investigate the importance of the CCR2 in thismodel, we further analyzed whether P8A, a CCL2 mono-meric variant that is able to inhibit CCR2-mediated leuko-cyte recruitment, would also change the amount of toothmovement and osteoclast recruitment. Tooth movement(Fig 3, A) and the numbers of TRAP-positive osteoclasts(Fig 3, B) were reduced in the P8A-treated mice ina dose-dependent way (Fig 3) when compared with themice treated with the vehicle (P\0.05).

To understand the mechanisms involved in thealtered bone remodeling of CCR2�/� mice during or-thodontic tooth movement, we also evaluated the ex-pression of osteoclast regulators (RANK, RANKL, andOPG) and osteoblast markers (OCN and COL-1).RANK and RANKL mRNA levels were significantly in-creased after mechanical loading (P \0.05) but weresmaller in the CCR2�/� mice than in the wild-typemice (P\0.05) (Fig 4, A and B). The mechanical stressup-regulated the OPG levels, but the increases weresimilar in the wild-type and the CCR2�/� mice (Fig4, C). Expressions of OCN and COL-1 were significantlyincreased after mechanical loading (P\0.05), but they

Journal of Orthodontics and Dentofacial Orthopedics

Fig 3. A, Effect of different doses of P8A on the amounts of tooth movement; B, number of TRAP-positive osteoclasts. Data are expressed as mean 6 SEM. *P \0.05 comparing the control groupwith the respective experimental group. #P \0.05 comparing the vehicle and P8A experimentalgroups. 1P \0.05 comparing the P8A dose of 0.5 mg/kg/day with the 2 other P8A-treated groups(1.5 and 3.0 mg/kg/day) (1-way ANOVA and Newman-Keuls multiple comparison test).

Fig 4. mRNA expression of osteoclast differentiation and activity markers: A, RANKL; B, RANK; andC,OPG in wild-type and CCR2�/� periodontium after 12 and 72 hours of mechanical loading. Data areexpressed as mean6 SEM. *P\0.05 comparing the control with the respective experimental groups.#P\0.05 comparing the wild-type and CCR2�/� experimental groups (1-way ANOVA and Newman-Keuls multiple comparison test). WT, Wild type.

Taddei et al 157

were lower in the CCR2�/� mice than in the wild-typemice (P \0.05) (Fig 5).

DISCUSSION

We have previously observed increased CCL2 expres-sion during orthodontic tooth movement.4,7 In thisstudy, the functional roles of CCL2 and CCR2 wereevaluated. Our major findings were reduced numbersof osteoclasts and diminished tooth movement whenCCL2 interactions were absent (CCR2�/� mice) orantagonized (P8A-treated mice). CCR2 deficiency wasassociated with lower expressions of RANKL, RANK,and osteoblasts markers (COL-1 and OCN), reinforcing

American Journal of Orthodontics and Dentofacial Orthoped

the role of CCL2-CCR2 interactions in driving boneremodeling during orthodontic tooth movement.

Several studies have shown increased CCL2 expressionduring orthodontic tooth movement,3,4,6,7 as well asin other sites of bone remodeling, such as rheumatoidarthritis,18 periodontal disease,20,21 and bone meta-stasis,19 in which osteoclastogenesis is highly stimulated.Since the cellular effects of CCL2 might be mediated byCCR2,17 its absence might interfere with osteoclast dif-ferentiation and, consequently, with bone remodeling.15

Our results suggest that not only CCL2 is expressed butalso the CCL2-CCR2 axis plays a significant role in oste-oclast recruitment and bone resorption in orthodontictooth movement. Although previous studies have shown

ics February 2012 � Vol 141 � Issue 2

Fig 5. mRNA expression of osteoblastic markers: A, OCN and B, COL-1 in wild-type and CCR2�/�

periodontium after 12 and 72 hours of mechanical loading. Data are expressed as mean 6 SEM.*P\0.05 comparing the control group with the respective experimental group. #P\0.05 comparingthe wild-type and the CCR2�/� experimental groups (1-way ANOVA and Newman-Keuls multiple com-parison test). WT, Wild type.

158 Taddei et al

increased bone mineral density in CCR2�/� mice, whichmakes these animals more resistant to compressive load-ings, this does not seem to fully explain their decreasedorthodontic tooth movement.15 Similar results were ob-served after treatment with a CCL2 inhibitor in wild-typemice, arguing that an innate effect in bone physiologycould not explain the results observed. In contrast, thediminished CCL2-CCR2–mediated osteoclast recruit-ment and differentiation could account for our observa-tions, an effect also seen in an osteoporosis modelin vivo.15

The results obtained in animals treated with P8A,a monomeric variant of CCL2 that inhibits CCR2-dependent cell migration in vivo, suggested that CCL2is the most important CCR2 ligand in this model.27 Theresults reported less tooth movement and fewer TRAP-positive osteoclasts in P8A-treated mice after mechani-cal loading. In accordance, P8A reduced bone lesionsin rats with arthritis.28 Moreover, CCL2�/� mice havebeen shown to have a high bone mass phenotype be-cause of fewer osteoclasts.15 Taken altogether, thesedata confirm that the CCL2-CCR2 axis is involved inthe recruitment of osteoclast precursors and, conse-quently, in orthodontic tooth movement. Therefore,this effect does not seem to result from the differencesin the bone density observed in the CCR2�/� mice, butfrom the reduction of osteoclast recruitment from thelack of CCR2, since wild-type mice treated with P8Aand CCR2�/� mice showed similar results.

Osteoclastogenesis and bone resorption activity areup-regulated by RANKL, produced by osteoblast/stroma

February 2012 � Vol 141 � Issue 2 American

cells, through their binding to their receptor RANKexpressed in osteoclast progenitor cells.29 This processcan be inhibited by the decoy receptor OPG,which preventsRANK-RANKL engagement.29,30 To understand themolecular basis of the impaired osteoclast differentiationand activity in the absence of CCR2, these osteoclastregulators were analyzed. The expression of both RANKLand RANK was decreased in the CCR2�/� mice whencompared with the wild-type mice, although there wasno significant difference in the OPG levels between thosegroups. In accordance, previous studies showed thatCCR2 deficiency decreases RANK expression by preosteo-clasts15 and reduces osteoclastic bone resorption in vitroand in vivo.15,25 Moreover, treatment with P8A reducedRANKL levels and bone erosion in rats with arthritis.28

Taken together, our results suggest that the observedreduction in the number of osteoclasts led to less boneresorption and, consequently, to less orthodontic toothmovement in the CCR2�/� mice; this might be related todown-regulation of RANKL/RANK gene expression.

Considering that osteoblasts might interact with os-teoclasts and regulate bone remodeling, we also evalu-ated the expression of osteoblast markers.29,30 Inagreement with other studies, our results demonstratedsignificant increases of COL-1 and OCN mRNA expres-sion in the periodontal tissues of the wild-type mice afterorthodontic tooth movement.5-7 Nevertheless, COL-1and OCN expressions were lower in the CCR2�/� micethan in the wild-type mice, suggesting that osteoblastdifferentiation and activity were decreased in the ab-sence of CCR2. This reduced osteoblast activity might

Journal of Orthodontics and Dentofacial Orthopedics

Taddei et al 159

be linked to a decrease of osteoclast stimulatory signals(as RANKL), resulting in diminished bone resorption inthe CCR2�/�mice. On the other hand, in an osteoporosismodel, both bone formation and OCN levels in serumwere not changed in the CCR2�/� mice when comparedwith the wild-type mice.15 Further research is required toconfirm the role of CCR2 in the differentiation andactivity of osteoblasts.

CONCLUSIONS

1. The absence of CCR2 decreased osteoclast chemoat-traction and decreased osteoclast and osteoblast ac-tivities, leading to reduced tooth movement. Thiswas the first demonstration that CCR2 plays an im-portant role in bone remodeling during orthodontictooth movement.

2. CCL2 is the primary CCR2 ligand and plays a centralrole in osteoclast recruitment and, consequently, inorthodontic tooth movement.

3. The blockade of the CCR2-CCL2 axis might be usedfor future therapeutic interventions, limiting in-flammatory bone loss diseases, such as osteoporosisand rheumatoid arthritis, or modulating the extentof orthodontic tooth movement.

REFERENCES

1. Krishnan V, Davidovitch Z. Cellular, molecular, and tissue-level re-actions to orthodontic force. Am J Orthod Dentofacial Orthop2006;129:469.e1-32.

2. Wise GE, King GJ. Mechanisms of tooth eruption and orthodontictooth movement. J Dent Res 2008;87:414-34.

3. Alhashimi N, Frithiof L, Brudvik P, Bakhiet M. Chemokines areupregulated during orthodontic tooth movement. J InterferonCytokine Res 1999;19:1047-52.

4. Andrade I Jr, Silva TA, Silva GA, Teixeira AL, Teixeira MM. The roleof tumor necrosis factor receptor type 1 in orthodontic toothmovement. J Dent Res 2007;86:1089-94.

5. Garlet TP, Coelho U, Silva JS, Garlet GP. Cytokine expression pat-tern in compression and tension sides of the periodontal ligamentduring orthodontic tooth movement in humans. Eur J Oral Sci2007;115:355-62.

6. Garlet TP, Coelho U, Repeke CE, Silva JS, Cunha FQ, Garlet GP. Dif-ferential expression of osteoblast and osteoclast chemmoatrac-tants in compression and tension sides during orthodonticmovement. Cytokine 2008;42:330-5.

7. Andrade I Jr, Taddei SRA, Garlet GP, Garlet TP, Teixeira AL,Silva TA, et al. CCR5 down-regulates osteoclast function in ortho-dontic tooth movement. J Dent Res 2009;88:1037-41.

8. Teixeira CC, Khoo E, Tran J, Chartres I, Liu Y, Thant LM, et al.Cytokine expression and accelerated tooth movement. J DentRes 2010;89:1135-41.

9. Yu X, Huang Y, Collin-Osdoby P, Osdoby P. CCR1 chemokinespromote the chemotactic recruitment, RANKL development, andmotility of osteoclasts and are induced by inflammatory cytokinesin osteoblasts. J Bone Miner Res 2004;19:2065-77.

American Journal of Orthodontics and Dentofacial Orthoped

10. Yano S, Mentaverri R, Kanuparthi D, Bandyopadhyay S, Rivera A,Brown EM, et al. Functional expression of beta-chemokine recep-tors in osteoblasts: role of regulated upon activation, normal T cellexpressed and secreted (RANTES) in osteoblasts and regulation ofits secretion by osteoblasts and osteoclasts. Endocrinology 2005;146:2324-35.

11. Kim MS, Day CJ, Morrison NA. MCP-1 is induced by receptoractivator of nuclear factor-{kappa}B ligand, promotes humanosteoclast fusion, and rescues granulocyte macrophagecolony-stimulating factor suppression of osteoclast formation.J Biol Chem 2005;280:16163-9.

12. Kim MS, Day CJ, Selinger CI, Magno CL, Stephens SRJ,Morrison NA. MCP-1-induced human osteoclast-like cells aretartrate-resistant acid phosphatase, NFATc1, and calcitoninreceptor-positive but require receptor activator of NF kappaBligand for bone resorption. J Biol Chem 2006;281:1274-85.

13. Kim MS, Magno CL, Day CJ, Morrison NA. Induction of chemo-kines and chemokine receptors CCR2b and CCR4 in authentic hu-man osteoclasts differentiated with RANKL and osteoclast like cellsdifferentiated by MCP-1 and RANTES. J Cell Biochem 2006;97:512-8.

14. Silva TA, Garlet GP, Fukada SY, Silva JS, Cunha FQ. Chemokines inoral inflammatory diseases: apical periodontitis and periodontaldisease. J Dent Res 2007;86:306-19.

15. Binder NB, Niederreiter B, Hoffmann O, Stange R, Pap T,Stulnig TM, et al. Estrogen-dependent and C-C chemokinereceptor-2-dependent pathways determine osteoclast behavior inosteoporosis. Nat Med 2009;15:417-24.

16. Miyamoto K, Ninomiya K, Sonoda K, Miyauchi Y, Hoshi H,Iwasaki R, et al. MCP-1 expressed by osteoclasts stimulates osteo-clastogenesis in an autocrine/paracrine manner. Biochem BiophysRes Commun 2009;383:373-7.

17. Yadav A, Saini V, Arora S. MCP-1: chemoattractant with a role be-yond immunity: a review. Clin Chim Acta 2010;411:1570-9.

18. IwamotoT Okamoto H, Toyama Y, Momohara S. Molecular aspectsof rheumatoid arthritis: chemokines in the joints of patients. FEBSJ 2008;275:4448-55.

19. Lu X, Kang Y. Chemokine (C-C motif) ligand 2 engages CCR21stromal cells of monocytic origin to promote breast cancermetastasis to lung and bone. J Biol Chem 2009;284:29087-96.

20. Kurtis B, T€uter G, Serdar M, Akdemir P, Uygur C, Firatli E, et al.Gingival crevicular fluid levels of monocyte chemoattractantprotein-1 and tumor necrosis factor-alpha in patients withchronic and aggressive periodontitis. J Periodontol 2005;76:1849-55.

21. Pradeep RA, Daisy H, Hadge P. Serum levels of monocyte chemo-attractant protein-1 in periodontal health and disease. Cytokine2009;47:77-81.

22. Garlet TP, Fukada SY, Saconato IF, Avila-Campos MJ, Silva TA,Garlet GP, et al. CCR2 deficiency results in increased osteolysisin experimental periapical lesions in mice. J Endod 2010;36:244-50.

23. Br€uhl H, Cihak J, Schneider MA, Plach�y J, Rupp T, Wenzel I, et al.Dual role of CCR2 during initiation and progression ofcollagen-induced arthritis: evidence for regulatory activity ofCCR21 T cells. J Immunol 2004;172:890-8.

24. Brodmerkel CM, Huber R, Covington M, Diamond S, Hall L,Collins R, et al. Discovery and pharmacological characterizationof a novel rodent-active CCR2 antagonist, INCB3344. J Immunol2005;175:5370-8.

25. Xing Z, Lu C, Hu D, Yu Y, Wang X, Colnot C, et al. Multiple roles forCCR2 during fracture healing. Dis Model Mech 2010;3:451-8.

ics February 2012 � Vol 141 � Issue 2

160 Taddei et al

26. Boring L, Gosling J, Chensue SW, Kunkel SL, Farese RV Jr,Broxmeyer HE, et al. Impaired monocyte migration and reducedtype 1 (Th1) cytokine responses in C-C chemokine receptor 2knockout mice. J Clin Invest 1997;100:2552-61.

27. Handel TM, Johnson Z, Rodrigues DH, Dos Santos AC, Cirillo R,Muzio V, et al. An engineered monomer of CCL2 hasanti-inflammatory properties emphasizing the importance of olig-omerization for chemokine activity in vivo. J Leukoc Biol 2008;84:1101-8.

February 2012 � Vol 141 � Issue 2 American

28. Shahrara S, Proudfoot AE, Park CC, VolinMV,HainesGK,Woods JM,et al. Inhibition ofmonocyte chemoattractant protein-1 amelioratesrat adjuvant-induced arthritis. J Immunol 2008;180:3447-56.

29. Boyce BF, Xing L. Bruton and Tec: new links in osteoimmunology.Cell Metab 2008;7:283-5.

30. Aoki S, Honma M, Kariya Y, Nakamichi Y, Ninomiya T,Takahashi N, et al. Function of OPG as a traffic regulator forRANKL is crucial for controlled osteoclastogenesis. J Bone MinerRes 2010;25:1907-21.

Journal of Orthodontics and Dentofacial Orthopedics

Appendix Table I. Number of mice in each group for histopathologic analysis

Wild type CCR2�/� VehicleP8A

0.5 mg/kgP8A

1.5 mg/kgP8A

3.0 mg/kg6 days 5 5 - - - -12 days 5 5 5 5 5 5

Appendix Table II. Number of mice in each group for molecular analysis

Real time PCR

Wild type CCR2�/�

0 hour 5 512 hours 5 572 hours 5 5

Appendix Table III. Primer sequences and reaction properties

Target/GI Forward and reverse sequences At (�C) Mt (�C) BpRANKGI: 110350008

(F) 50-CAAACCTTGGACCAACTGCAC-30

(R) 50-GCAGACCACATCTGATTCCGT-3060 84 76

OPGGI: 2072182

(F) 50-GGAACCCCAGAGCGAAATACA-30

(R) 50-CCTGAAGAATGCCTCCTCACA-3057 77 225

RANKLGI: 114842414

(F) 50-CAGAAGATGGCACTCACTGCA-30

(R) 50-CACCATCGCTTTCTCTGCTCT-3065 73 203

OCNGI: 508299

(F) 50-AAGCCTTCATGTCCAAGCAGG-30

(R) 50-TTTGTAGGCGGTCTTCAAGCC-3060 78 170

COL-1GI: 118131144

(F) 50–AATCACCTGCGTACAGAACGG�30

(R) 50–CAGATCACGTCATCGCACAAC�3062 84 114

ß-actinGI: 145966868

(F) 50–ATGTTTGAGACCTTCAACA�30

(R) 50-CACGTCAGACTTCATGATGG-3056 75 495

At, Annealing temperature; Mt, melting temperature; Bp, base pairs of amplicon size; GI, GenInfo Identifier; F, forward; R, reverse.

Taddei et al 160.e1

American Journal of Orthodontics and Dentofacial Orthopedics February 2012 � Vol 141 � Issue 2