Richmond Review, July 23, 2014

Download Richmond Review, July 23, 2014

Post on 01-Apr-2016

223 views

Category:

Documents

6 download

DESCRIPTION

July 23, 2014 edition of the Richmond Review

TRANSCRIPT

  • SummerCleaning?

    recycle the green way!RegionalRecycling.caRegionalRecycling.ca

    Free EXPERT ADVICE from RICHMONDSREAL ESTATE PROFESSIONAL

    FREE No Obligation Home EvaluationAward Winning Service and Results

    Richmond Specialist

    Call Now! 604-649-0108 t www.tonyling.com

    TONY LINGReal Estate Services

    AWAR

    D WINNER

    2013

    RICHMONDBest of

    NEWS@RICHMONDREVIEW.COM OFFICE: 604-247-3700 DELIVERY: 604-247-3710 CLASSIFIED: 604-575-5555 NEWSROOM: 604-247-3730

    RICHMONDREVIEW.COM WEDNESDAY, JULY 23, 2014 20 PAGES

    REVIEW the richmond Summer Clarke and Team Caribbean win at Nations Cup 14

    Gateway Theatre hosts plays from Hong Kong 3 / City gets digging at Minoru 3

    Commercial property owners now fetching princely sums as prices soar

    by Martin van den HemelStaff Reporter

    Several sizable chunks of commercial real es-tate along No. 3 Road in the citys downtown core have recently been gobbled up by inves-tors or are about to be, The Richmond Review has learned.

    Much of the land is designated for future residential use in the City of Richmonds of-fi cial community plan, and prices have soared.

    The property at 8111 Ackroyd Rd., the for-mer home of Chapters bookstore, has a con-ditional contract for sale with a price tag of about $68 million, according to sources. This property, known as Richport Town Centre Shopping Mall, was sold in 2009 by Colliers, when it had an assessed value of $32.3 mil-lion, according to Vancouver Real Estate Blog (vancommercial.ca).

    Whats known as the Time Square property on No. 3 Road, a strip mall between Park and Cook roads, directly across the street from Richmond Centre shopping mall, sold for $20.2 million less than 18 months ago.

    Another 4.9 acre assembly of three ad-dresses, at 7960 Alderbridge Way, 5333 and 5411 No. 3 Roadboasting 742 feet of un-obstructed frontage along No. 3 Road, at the southwest corner of Alderbridgesold earlier this year for $69 million.

    The Acura dealership has an accepted off er of $17 million, but that deal wont close for a few months and this site is designated to re-main commercial, according to the citys OCP.

    And the home of The Richmond News, at 5731 No. 3 Rd., was sold by Glacier Media Group for $6 million in January. The buyer was a private investor (0986629 B.C. Ltd.) Another adjacent property is now on the market for $6.6 million.

    Bal Atwal, a principal with Avison Young Commercial Real Estate Inc., has been in-volved in the commercial real estate industry for more than a decade, the last seven with Avison Young.

    He sold the Alderbridge Way and No. 3 Road property, which includes 78,200 square feet of single-storey retail buildings, and is across the street from the Lansdowne Station of the Canada Line.

    The owners have seen the prices escalate to a point where they have hit new peaks and are starting to fl atten out, Atwal said. Owners are seeing this as a potential right time to sell.

    Also driving landowners to sell now is the knowledge that the next price escalation is probably another fi ve to 10 years away, he said.

    With property taxes based on land value, which has increased about 40 per cent in the last fi ve years, Atwal said his clients see this as an opportunity to sell their land assets and place their equity elsewhere.

    Atwal said hes been involved in about 90 per cent of the major deals along No. 3 Road over the last three or four years.

    While hes involved in the Chapters property sale, he said hes bound by a confi dentiality agreement and wouldnt confi rm the selling price or the identity of the prospective owners.

    While a signifi cant number of the buyers involved in the recent transactions along No. 3 Road are from overseas, he clarifi ed that foreign investors do not form the bulk of the buyers.

    A lot of the properties have been bought by local private investors, he said.

    Asked if any of his clients are on the verge of developing their newly acquired land, Atwal characterized the investors as being patient.

    Many are willing to hold the property at very low returns and wait for the next cycle to arrive, he said.

    See Page 3

    Branko Popazivanov photoA member of the Birds goes airborne against a cast of Monkeys at the 2014 Dolphin Basketball Classic held last weekend at Thompson Community Centre in Richmond. For more, see P. 14.

    Classic hoopInvestors eye prizes in downtown Richmond

    Owners are seeing this as a potential right time to sell.

    Bal Atwal

  • Page 2 Richmond Review Wednesday, July 23, 2014

  • Wednesday, July 23, 2014 Richmond Review Page 3

    Three productions from Hong Kong set for local stage

    by Matthew HoekstraStaff Repoter

    Three world-class theatre productions from Hong Kong will be presented at the fi rst-ever Gateway Pacifi c Theatre Festival Aug. 15 to 24.

    At a press conference to launch the festival on Tuesday, producer Esther Ho said she and Gateway artistic director Jovanni Sy travelled throughout China earlier this year to scout potential shows.

    We searched for the best shows for our community, she said.

    For this years inaugural festival, three shows from Hong Kong will be featured.

    The festival will present two plays in Canton-ese with English surtitles. A third is a non-ver-bal performance that mixes martial arts with clowning. All three plays will feature cast and crew from Hong Kong.

    The plays are:Tang Shu-wing Theatre Studios Detention is

    a physical comedy for all ages, running Aug. 15 to 17. Its non-verbal, so theres no surtitles. Set during an after-school detention session, three boys compete for the aff ections of their classmate. Its an example of classic Hong Kong humour thats enjoyed three separate runs in Hong Kong. Audiences will witness acrobatics, clowning, martial arts and percus-sion from the cast. The play was a hit at the

    Edinburgh Fringe Festival in 2012.The Isle, running Aug. 20 to 22, tells the

    story of one couples encounter on a remote island where their past and present overlap. They wrestle with the question of staying or leaving in a play described as a compassion-ate yet skeptical take on enduring love. It is written by Hong Kong playwright Paul Poon,

    The Fire of Desire runs Aug. 22 to 24. It is based on the classic 1900 play Reigen by Ar-thur Schnitzler (better known by its French title La Ronde), updating the setting to pres-ent-day Hong Kong. Five men and fi ve wom-enall played by the same two actorsex-plore their frustrations and perspectives on love, marriage and sex in 10 scenes, each tak-ing place in a room with a diff erent man and woman.

    Ho has big ambitions for the festival. Next years shows will be in Mandarin with English surtitles and Gateway plans for the festival to run annually for 15 years.

    Its really a celebration of Richmonds diversity and the large number of Chinese speakers (here), Sy said in an interview. Ive always loved international theatre and just being familiar with the theatre scene in Hong Kong, they do some outstanding work there, and it deserves to be seen in North America.

    Tickets to MainStage shows are $50 for adults and $25 for students; The Isle is $35 for adults and $20 for students. Call the Gateway Theatre Box Offi ce at 604-270-1812 or visit gatewaytheatre.com for tickets.

    with notes from Bhreandin Clugston

    Gateway to host international plays

    Bhreandin Clugston photo (above)Esther Ho announces the line-up to the inaugural Gateway Pacifi c Theatre Festival. The festival features three plays from Hong Kong, including Detention (left).

    Martin van den Hemel photoMondays ground-breaking ceremony launched construction of the $79.6 million multi-purpose complex on the site of what was Richmonds fi rst artifi cial turf fi eld. Richmond Mayor Malcolm was joined by coun-cillors, Richmond Aquatics Services Board chair Ian MacLeod, Minoru Seniors Society president Kathleen Holmes, and Richmond Sports Council chair Jim Lamond.

    Multi-purpose facility to open in 2017; will house aquatic centre and older adults facility

    by Martin van den HemelStaff Reporter

    Construction of a $79.6 million combined aquat-ics and seniors facility began Monday with a cer-emonial ground-breaking ceremony.

    But Ian MacLeod, chair of the Richmond Aquatics Services Board, thanked city staff and Richmond council for changing their plans for the site, opting to avoid closing the pool and instead relocate the placement of the facility.

    I think it would have been a disaster, MacLeod said about the initially-planned closure.

    Some 1,250 people use Minoru Pools facility ev-ery day, and forcing all those people to turn else-where for a couple of years during the construction period would have been unwise, he said.

    I thank council for having listened, he said.The new facility is scheduled to open in 2017.To fi nance the project, one of several known as

    the Minoru Civic Precinct projects, the city is using its own reserves and borrowing about $50 million to take advantage of low interest rates.

    The Minoru Civic Precinct projects also includes a new City Centre Community Centre, which is currently under construction at Minoru Boulevard and Firbridge Way and is slated to open in 2015, as well as the new No. 1 Fire Hall, which will be built immediately west of the multi-purpose complex.

    Construction of a new aquatic and older adults centre are top priorities for our council, Richmond Mayor Malcolm Brodie said. We need these new facilities to meet the existing and future needs of

    our growing and evolving community. This new multi-purpose complex will become a focal point for our community as it delivers a mix of outstand-ing services for a diverse group of users.

    Construction begins on new Minoru complex Plenty of sales along No. 3 RoadFrom Page 1

    While plenty of investors are interested in Richmond, the challenge to this point has been convincing land owners to sell.

    He said the sale of the IHOP site, at the corner of No. 3 Road and Park, for $3.4 mil-lion in 2011, set a benchmark for price that broke previous price barriers which had been fl at for a few years.

    Asked if the most recent sales will serve as a domino eff ect, Atwal said time will tell.

    But landowners risk their sites becoming orphaned, a well known local example be-ing the southeast corner of No. 3 Road and Westminster High-way. That property now has limited development options because of all the completed construction that hems it in on both sides.

    Other notable downtown Richmond sales by Atwal in-cluded 3411 and 3471 No. 3 Rd. for $8 million in May of 2012, 6700 No. 3 Rd. for $3.3 million in March of 2012, and 3711 No. 3 Rd. for $7.1 million earlier this year.

  • Page 4 Richmond Review Wednesday, July 23, 2014

    Registration for fall programs starts soonParks, Recreation and Culture

    Aquatics only: online 8:00 p.m., Tuesday, July 29

    All programs: online 10:00 p.m., Tuesday, July 29

    All programs: in person and Call Centre, Wednesday, July 30

    Starting Saturday, July 25, view the online paperless version of the Fall 2014 Guide at www.richmond.ca/guide. Paper copies are available for pick up from any City facility beginning July 25.

    3 easy ways to register: Internet:

    www.richmond.ca/register Registration Call Centre:

    Mon-Fri 8:30 a.m. - 5:30 p.m.604-276-4300

    In Person:During Facility Hours

    Summer Fun Nights are hereFree games, activities and music at King George Park

    The East Richmond Community Association invites you to come to

    King George Park West (No. 5 Road and Cambie Road) on Tuesday, July 29, Friday, August 8 and Tuesday, August 12 to play games, blow bubbles, get your face painted and more. Each day, from 5:30 to 7:30 p.m., there will be lots of activities for the whole family. Plus, starting at 6:30 p.m. on Friday, August 8, try karaoke led by the amazing DJ Derrick.

    This free event will occur weather permitting.

    For more information contact Cambie Community Centre at 604-233-8399.

    11th annual Richmond Maritime FestivalOne of the regions biggest, dont miss summer events

    Celebrate Stevestons waterfront heritage at the 11th Annual Richmond

    Maritime Festival, August 810, 2014, at the spectacular Britannia Shipyards National Historic Site.

    Learn local lore from a storytelling mermaid, wharf rat and statues brought to life. Enjoy live music, dancers, arts and crafts, and hands-on activities for all ages. Eat at locally renowned food trucks and on Friday evening, take in an outdoor concert featuring the zydeco, swamp pop and folk sounds of

    The Swamp Dogs from 5:00 to 7:00 p.m.

    But whatever you do, dont forget to visit the bounty of beautiful boats moored at the 190-metre (600-foot) dock.

    Free and fun for all ages, the Richmond Maritime Festival is one of Metro Vancouvers biggest, dont-miss summer events.

    August 810, 201410:00 a.m. to 6:00 p.m.Britannia Shipyards, 5180 Westwater DriveFree admission

    For more information, visit www.richmondmaritimefestival.ca

    Celebrate the of cial opening of the Garden City Bike Terrain ParkJuly 30, 6:30 8:00 p.m.

    Join us for the of cial opening of the Garden City Bike Terrain Park

    at the southwest corner of Garden City Park. The of cial opening will include speeches, daring bike demonstrations, Caps Krustys Bicycle Service Tent, and interactive displays by Vancouver Coastal Health. Bring your bike and safety gear to test Richmonds newest terrain professional bike instructors will be on hand to take riders of all skill levels through the bike park.

    City Centre Community Centres Concerts in the Park, featuring the local band Rivers Divide, follows at 7:00 p.m.

    Ponies in the ParkRichmond Nature Park

    Giddy up on over to the Nature Park for a pony ride through the woods.

    Suitable for children 4-12 years. Tickets are available on a rst come rst serve basis on event day only. Cash only. $10 per ride

    Date: Sunday, August 3 & Saturday, August 23

    Time: 11:00 a.m. - 4:00 p.m.

    Place: Richmond Nature Park,11851 Westminster Hwy

    Want to workout on BC Day, August 4?Community centres open BC Day

    The following community centres are open:

    Cambie 10:00 a.m. 3:00 p.m.

    Hamilton 10:00 a.m. 3:00 p.m.

    South Arm 10:00 a.m. 3:00 p.m.

    Steveston 10:00 a.m. 3:00 p.m.

    Thompson 10:00 a.m. 3:00 p.m.

    Total Fitness Pass holders can use their pass at any of these centres on the public holiday for no extra fee.

    Blueberry Sale and TeaSunday Aug 311:00 a.m. - 4:00 p.m.

    The blueberries are ripe and ready to enjoy! Savour the best blueberry

    pie in town or purchase fresh scrumptious berries and pies. Proceeds support the Richmond Nature Park Society.

    Date: Sunday Aug 03, 2014Time: 11:00 a.m. - 4:00 p.m.Place: Richmond Nature Park, 11851 Westminster HwyPrice: Blueberry prices TBA

    City Page

    City of Richmond | 6911 No. 3 Rd. Richmond BC V6Y 2C1 | Tel: 604-276-4000

    www.richmond.ca

    Community news covering July 23 to August 5, 2014

    City Hall is closed on August 4, BC Day.

    Public Works & Transportation CommitteeWednesday, July 23, 2014Anderson Room, City Hall4:00 p.m.

    Parks, Recreation & Cultural Services CommitteeTuesday, July 24, 2014Anderson Room, City Hall4:00 p.m.

    Regular Council MeetingMonday, July 28, 2014Council Chambers, City Hall7:00 p.m. (open meeting)

    Anderson Room, City Hall4:00 p.m. (closed meeting)

    24

    28

    23

  • Wednesday, July 23, 2014 Richmond Review Page 5

    SUMMER RUNWAY OPERATIONSAT YVRSOUTH RUNWAY MAINTENANCEJuly 4 August 1, 20149:00 p.m. 7:00 a.m.

    Starting July 4th, the south runway will be closed nightly at Vancouver International Airport (YVR) for annual runway maintenance and repairs. The north runway will be used for departures and arrivals during these closures. Up-to-date information about the closures will be available at www.yvr.ca/noise.

    We appreciate your support and thank you for your ongoing patience as we continue to maintain the highest safety standards at YVR.

    For more information email community_relations@yvr.ca or phone 604.207.7097.

    YVR.CA

    Asphalt paving advisoryJuly 15 to October 15, 2014The City of Richmond has contracted Columbia Bitulithic to grind and pave the following location in Richmond from July 15 to October 15, 2014:

    10000 block No. 3 Road 6000 block Blundell Road Hammersmith Way Hammersmith Gate 11 & 12000 block No. 5 Road 22000 block Old Westminster Highway Gilley Road and Westminster Highway Intersection

    Work hours will be 7:00 a.m. to 8:00 p.m. on weekdays, and 7:00 a.m. to 8:00 p.m. on weekends. Night time work hours will be from 7:00 p.m. to 5:00 a.m. (typically).

    Traffic will be reduced to single-lane and there may be temporary lane closures. Delays may occur. The use of an alternate route is strongly encouraged.

    This work is weather dependent and dates are subject to change without notice.

    Questions may be directed to Wasim Memon, Supervisor, Engineering Inspections, at 604-276-4189, or visit the Citys paving program webpage at www.richmond.ca (City Services > Roads, Dykes, Water & Sewers > Construction Projects > 2014 Paving).

    City Board

    City of Richmond | 6911 No. 3 Rd. Richmond BC V6Y 2C1 | Tel: 604-276-4000

    www.richmond.ca

    5441 NO. 3 ROAD ACROSS FROM LANSDOWNE CENTRE

    TO

    STORE CLOSINGFINAL WEEK

    EVERYTHING MUST BE SOLD!

    ALL MENS

    NOW

    *EXCLUDES $15 DEX

    Details of horrific January 2013 shootings at banquet hall contained in court ruling

    by Martin van den HemelStaff Reporter

    New details about the horrifi c Jan. 16, 2013 shoot-ing at the Riverside Banquet Hall, showing how two of the victims are lucky to be alive and how the shooter was asked to come to the party, emerged in the written judgement released this week by Rich-mond provincial court Judge Patrick Chen.

    In the judgement, Sukhdeep Singh Sandhu was found not criminally responsible by reason of a men-tal disorder on seven criminal charges including at-tempted murder, three counts of aggravated assault, and three fi rearms-related charges.

    According to the ruling, a crowd of more than 100 people were in attendance at the party on River Road, which was a celebration of the induction of a number of new members into the longshoremens union.

    This was an auspicious occasion and cause for cel-ebration as members generally have to work 10 to 12 years as casual labour before being allowed to enter the union, Judge Chen wrote.

    Sandhu was asked to be the designated driver for his cousin Davinder Sandhu, a longshoremen, who was attending the party, wanted to drink, and knew his cousin didnt drink alcohol.

    The accused initially said he did not wish to go, but ultimately agreed to do his cousin the favour, Chen wrote. Prior to driving to his cousins house, the ac-cused put on a bullet-proof vest and loaded his gun, a Heckler and Koch 9mm semi-automatic handgun with serial numbers obliterated.

    As Sandhus fi rst victim was walking to the bar inside the banquet hall, east of No. 6 Road, he saw Sandhu coming towards him, but thought Sandhu would pass him by.

    Instead, the unexpected happened.Sandhu drew his gun, pointed it at the victims head

    and shot him from close range.The shot proved not to be fatal, but only by bare

    centimetres.The bullet entered the left side of (the victims)

    nose, shattered his right cheekbone and exited through his right ear, the ruling states.

    Sandhu then stood over the victim, pointing the barrel at the right side of the victims head from about a foot away, and appeared to try to fi re three more shots.

    But the gun misfi red or jammed, and the victim and a witness could hear it click at least three times. At this point, a witness tried to intervene by wrestling Sandhu to the ground and holding him around the

    neck, while trying to take the gun away, only to fl ee when the accused threatened to shoot him.

    The fi rst victim was struck with a second bullet as he tried to crawl for cover, the bullet entering his left side, tearing through his stomach and intestines, and exiting through the back of his right leg.

    He was also struck a third time, this bullet striking his left thigh where it still remains today, as doctors have determined that more damage would result by trying to remove it than by leaving it there.

    The witness who tried to intervene was also target-ed, a bullet slicing through both of his thighs.

    Another bullet struck another victim, entering his neck right under his jaw bone, and fracturing two of his vertebrae, only to come to a rest while protruding out of the back of his neck.

    Another bullet struck another male victim in the left leg, but he appears to have made a full recovery, the judge noted.

    Sandhus fi rst victim, who was most seriously in-jured, spent three weeks in hospital during which he was fed intravenously. He wasnt able to eat solid foods for many months. He had a plate placed over his right cheek, held in place by four screws. Pieces were cut out of his large and small intestine.

    A large scar stretching from his stomach to his waist remains as a reminder of the shooting, which also saw him lose some of his vision in his right eye.

    But he has since returned to work, some 13 months after the shooting, where he is currently assigned light duties. He now works as a crane operator.

    The man who was shot in the neck spent three days in hospital, and wore a neck brace for three months. Three pieces of shrapnel from the shooting remain lodged in his neck, he still cant feel the left side of his throat, and he is plagued by a tingling sensation running from the left side of his head down to his left shoulder and chest. He continues to go to physio and massage therapies.

    See www.richmondreview.com for the full judgement on this case.

    First shooting victim lucky to be alive

    Martin van den Hemel photoPolice on the scene of the Jan. 16, 2013 shootings.

    A predicted massive run of Fraser River sockeye has yet to show up in force, so no commercial salmon fi sh-ing has been approved so far.

    Fishery managers with the Pacifi c Salmon Commission said Friday fewer sockeye are coming in so far than expect-ed, although that could change swiftly.

    The commissions Fraser River panel has not yet issued an estimate of the

    run size and said planned openings for seine boat fi sheries have been pushed back to at least July 23.

    The pre-season forecastbased on the fact this years return is the spawn of the unusually large 2010 runpro-jected 23 million sockeye would likely come back to the Fraser this summer, and it might run as high as 72 million.

    Jeff Nagel

    Sockeye mega-run so far slow to show up

  • Page 6 Richmond Review Wednesday, July 23, 2014

    www.richmond.ca

    Please help us reduce our environmental footprint and view the guide online.

    REGISTERFOR FALL 2014 PROGRAMS

    AQUATICS: online 8:00pm | July 29ALL PROGRAMS: online 10:00pm | July 29ALL PROGRAMS: in person / Call Centre | July 30

    Help us reduce our environmental footprint. Visit the

    guide online at richmond.ca/guide

    PARKS, RECREATION AND CULTURE GUIDEFall 2014 | September December

    Starting July 26, view the guide online at richmond.ca/guide or pick up a paper copy from any community facility.

    Start times and datesAquatics only:online 8:00 p.m. Tuesday, July 29

    All programs:online 10:00 p.m. Tuesday, July 29

    All programs:in person and Call Centre Wednesday, July 30

    richmond.ca/register

    Letstrimourwaste!

    LETS RECYCLE MORE THIS SUMMER!Green Carts make it easy to recycle food scraps and yard trimmings.

    www.richmond.ca/greencart

    Environmental Programs Information Line: 604-276-4010

    Clean, odour-free carts:t8SBQGPPETDSBQTJOOFXTQBQFSVTFEQBQFSUPXFMTPSQJ[[BEFMJWFSZCPYFTCFGPSFBEEJOHUIFNUPZPVSLJUDIFODPOUBJOFSPS(SFFO$BSUt$POTJEFSQVUUJOHTNFMMZNBUFSJBMTJOUIFGSFF[FSVOUJMDPMMFDUJPOEBZt4QSJOLMFCBLJOHTPEBJOTJEFUIFDBSUt-JOFUIFDBSUXJUIOFXTQBQFSPSQBQFSZBSEXBTUFCBHTt3JOTFDBSUSFHVMBSMZXJUIFOWJSPONFOUBMMZGSJFOEMZEFUFSHFOUT

    Convenient options for curbside collection of extra yard trimmings:t-BCFMFE(SFFO$BOTGPSFYDFTTGPPETDSBQTBOEZBSEUSJNNJOHTt1BQFSZBSEXBTUFCBHTGPSFYUSBZBSEUSJNNJOHTPOMZt5JFECVOEMFTPGZBSEUSJNNJOHTYJOTJ[FCSBODIFTNVTUCFMFTTUIBOwJOEJBNFUFS

    t%SPQPGGZBSEUSJNNJOHTBUUIF3JDINPOE3FDZDMJOH%FQPUPS&DP8BTUF

    3FNJOEFS5IFNBYJNVNXFJHIUGPS(SFFO$BOTBOEQBQFSZBSEXBTUFCBHTJTLHMCT

    Look for theseflyers in

    REVIEW the richmond

    Canadian Tire*Home Depot*Lowes*M&M Meatshops*

    Marketplace IGA*PriceSmart FoodsSafeway*Save-On-Foods

    Sears*The Brick*Visions Electronics

    *Limited distribution 2012 - 2013

    City of Richmond photoMermaids and other sea creatures will welcome crowds to the Richmond Maritime Festival at Britannia Shipyards National Historic Site from Aug. 8 to 10. B.C.s oldest shipyard will be transformed with festive, maritime-themed dcor, spontaneous performances and ingenious exhibits in the annual festival. This years festival will run three full days from 11 a.m. to 6 p.m. from Friday, Aug. 8 to Sunday, Aug. 10.

    Maritime Festival sails into town next month

  • Wednesday, July 23, 2014 Richmond Review Page 7

    Its a wonderful worldFilm, media arts and spectacle in unique

    locations. Your Kontinent Film and Media Arts Festival brings the world to Richmond.

    July 1726www.richmonddaysofsummer.ca

    COMMUNITY PARTNER PRODUCED BY

    PRESENTED BY

    MEDIA PARTNERS

    2 for 1 admission at West Richmond Pitch & Putt Golf Course

    July 19 August 1

    www.richmond.ca

    Two golfers can play for the price of one! Days and times for this special offer are:July 19August 1Monday to Friday, 9 a.m.5 p.m.Saturday and Sunday, 9 a.m.noonWest Richmond 9-hole Pitch & Putt Golf Courset/PBEWBODFECPPLJOHKVTUESPQJOt0QFOEBZTBXFFLXFBUIFSQFSNJUUJOHt"GGPSEBCMFSBUFT

    PLAY TODAY!www.richmond.ca/pitchandputt$BMMGPSNPSFEFUBJMT0QFOEBJMZBNUPEVTL1FOEMFUPO3PBE)VHI#PZE$PNNVOJUZ1BSLCannot be combined with any other offer or promotion.

    Asphalt paving advisoryJune 15 to August 15, 2014The City of Richmond has contracted Columbia Bitulithic to grind and pave the following location in Richmond from June 15 to August 15, 2014:

    7000 block Garden City Road 9000 block Granville Avenue 8000 block Ackroyd Road 8000 block Alexandra Road 6000 block Westminster Highway

    Work hours will be 7:00 a.m. to 8:00 p.m. on weekdays, and 7:00 a.m. to 8:00 p.m. on weekends. Night time work hours will be from 7:00 p.m. to 5:00 a.m. (typically).

    Traffic will be reduced to single-lane and there may be temporary lane closures. Delays may occur. The use of an alternate route is strongly encouraged.

    This work is weather dependent and dates are subject to change without notice.

    Questions may be directed to Wasim Memon, Supervisor, Engineering Inspections, at 604-276-4189, or visit the Citys paving program webpage at www.richmond.ca(City Services > Roads, Dykes, Water & Sewers > Construction Projects > 2014 Paving).

    City Board

    City of Richmond | 6911 No. 3 Rd. Richmond BC V6Y 2C1 | Tel: 604-276-4000

    www.richmond.ca

    A Couple of Hooligans will take over the Tank Deck at the Gulf of Georgia Cannery Friday, July 25 as part of the Music at the Cannery summer concert series.

    Featuring Dave Hoerl and Dave Webb, A Couple of Hooligans will present an evening of the blues.

    The Music at the Cannery series is sponsored by G&F Financial Group, Cannery Brewing Co. and Canada

    Berries, and is presented in collabo-ration with The Beat Merchant.

    Upcoming: Gabriel Mark Hassel-back on Aug. 1; Irish Wakers on Aug. 8; Robert Hubele on Aug. 15; Boce-phus King on Aug. 22; and Harpdog Brown on Aug. 29.

    All shows start at 6:30 p.m.; arrive early (12138 Fourth Ave.) to ensure a seat. Concerts are rain or shine; admission is by donation.

    Trudy Morse photoThe Legendary Lego Build at Lansdowne Centre on Saturday attracted a large number of enthusiastic young people who were busy experimenting with Lego and observing Robin Sather at work constructing castles. Sather is the only Lego certifi ed professional in Canada and is based in Abbotsford. A new castle-themed sculp-ture is built each Saturday in July and will remain on display until July 30.

    Music at the Cannery series continues Friday

    Castles made of Lego

    Improve your travel experience with tech tools

    Older adults can learn how technology can improve their travel ex-perience at Richmond Public Librarys free program Tech Gear for Travel.

    This program takes place Monday, July 28 from 10:30 a.m. to noon at the Brighouse branch (7700 Minoru Gate).

    To register, visit any branch of Richmond Public Library, call 604-231-6413 or register online at www.yourli-brary.ca/events.

    Guest speaker Jenni-fer Cairns is the founder of eGurus Technology Tutors.

  • Page 8 Richmond Review Wednesday, July 23, 2014

    #1 - 3671 VIKING WAY, RICHMOND, B.C. V6V 2J5 604-247-3700 FAX:

    604-247-3739 RICHMONDREVIEW.COM

    ASSISTANT ADVERTISING MANAGERELANA GOLD, 604-247-3704

    admanager@richmondreview.comADVERTISING

    LESLEY SMITH, 604-247-3705lesley@richmondreview.com

    COLLIN NEAL, 604-247-3719collinn@richmondreview.com

    MARSHALL MACKINDER, 604-247-3714marshall@richmondreview.com

    KIMBERLEY LIM, 604-247-3709 kimberley@richmondreview.com

    JANE ILOTT, 604-247-3707jane@richmondreview.com

    CIRCULATION MANAGER/AD CONTROLKRISTENE MURRAY, 604-247-3711

    circulation@richmondreview.comCIRCULATION

    LITO TUAZON, ROYA SARWARY 604-247-3710

    circulation@richmondreview.com

    The Richmond Review is a member of the B.C. Press Council, a self-regulatory body governing the provinces newspaper industry. The council considers complaints

    from the public about the conduct of member newspa-pers. Directors oversee the mediation of complaints, with

    input from both the newspaper and the complaint holder. If talking with the editor or publisher does not resolve your

    complaint about coverage or story treatment, you may contact the council. Write (include documentation) within 45 days to B.C. Press Council, PO Box 1356, Ladysmith, V9G

    1A9. For information, phone 888-687-2213 or go to www.bcpresscouncil.org

    REVIEW the richmond

    PUBLISHERMARY KEMMIS, 604-247-3702

    publisher@richmondreview.com

    EDITORBHREANDIN CLUGSTON, 604-247-3730

    editor@richmondreview.comSTAFF REPORTERS

    MATTHEW HOEKSTRA, 604-247-3732mhoekstra@richmondreview.comMARTIN VAN DEN HEMEL, 604-247-3733martin@richmondreview.com

    DON FENNELL, 604-247-3731sports@richmondreview.com

    Published every Wednesday and Friday by Black Press Ltd.

    CREATIVE SERVICES MANAGERJAANA BJRK, 604-247-3716

    jaana@richmondreview.comCREATIVE SERVICES

    GABE MUNDSTOCK, 604-247-3718gabe@richmondreview.comPETER PALMER, 604-247-3706

    peter@richmondreview.comJAMES MARSHALL, 604-247-3701james@richmondreview.com

    opinion

    When the au-dited public accounts confirmed a $353 million surplus for the last fiscal year, B.C. Liberal political staff were quick to remind reporters of the NDPs main theme from last years election cam-paign.

    Pages of election quotes from almost every NDP MLA were waiting to be distributed. It was a bogus budget, one of the more polite tags applied to the governments pre-election fi scal plan.

    It underestimates the costs in a whole bunch of ministries and were going to have to review that because all of the decisions that we propose in our platform will have to be implemented, said then-leader Adrian Dix, describ-ing the NDPs plans to tax and spend more.

    Skeena MLA Robin Austin targeted health care in the budget debate: Bearing in mind that our population is actually increasing, bearing in mind that our popula-tion is aging, I think its very unrealistic to think we can actually limit health care ex-penditures to 2.7 per cent.

    As it turned out, health care spending grew by just over two per cent. It still went up by $360 million from the previous year, but after annual increases of six or seven per cent had

    become the norm, this is quite an achievement. New agreements remain to be negotiated with doctors and nurses, so were unlikely to see the same cost control results for the current year.

    Ottawas health care transfer payment formula has changed, and increases are to be capped at three per cent a year by 2016, so this is the kind of spending restraint all provinces are expected to produce.

    Education was the only other ministry to receive signifi cant extra funding last year, up $299 million despite continuing enrol-ment decline. Like health, the education budget goes up every year, and these increases, along with strong student performance results, expose the rhetoric of the B.C. Teachers Federa-tion about a cash-starved system for what it is.

    But the biggest fabrica-tion of last years election was the debt free B.C. slogan emblazoned on the side of Premier Christy Clarks campaign bus.

    The public accounts confi rm that the provinces total debt rose to just over $60 billion, the latest of a series of increases since 2008. The much-touted balanced budget is on the operating side, while the province continues to pile up debt to pay for the Port Mann mega-project, hospi-tals, schools and other big infrastructure.

    Finance Minister Mike de Jong emphasized the diff er-ence between capital and operating expenditures.

    Were borrowing to build as opposed to paying for the groceries, he said.

    Debt free B.C. was not an outright misrepresentation, merely one of the most

    far-fetched promises ever delivered in the history of B.C. politics. The legislature is to convene in October so the B.C. Liberals can pass a taxation framework for the nascent liquefi ed natural gas industry, which the government hopes will generate the revenues to ultimately pay off the prov-inces $60-billion mortgage.

    Meanwhile there is more capital debt ahead. The cabinet is expected to

    green-light the Site C dam on the Peace River this fall, a decade-long project esti-mated to cost $8 billion.

    Along with the public accounts, the fi nance ministry released a list of surplus land sales. The sale of 50-odd properties, some of them closed schools, net-ted the provincial treasury about $310 million, which accounts for most of the surplus.

    Was this selling off the family silverware to try and balance the books, as now-NDP leader John Horgan termed it before the election? Its certainly not a revenue source to be matched next year.

    Tom Fletcher is leg-islature reporter and columnist for Black Press. Twitter: @tomfletcherbc Email: tfletcher@blackpress.ca

    B.C. ViewsTom Fletcher

    B.C. back in black, deep in debt

    If the Fraser River ever were to breach its dikes in a major flood, the re-sult would be a catastrophe of historical proportions.

    Up to 300,000 residents and $50 billion in development could be gravely impacted.

    So concludes the Fraser Basin Council, as it puts together a coalition of local and senior gov-ernments and other interests all

    focused on developing a strategy to protect the region from a devas-tating fl ood.

    Its a laudable and entirely neces-sary initiative, but one which begs the question: What took so long?

    In 2007, the Fraser threatened to overwhelm the existing dikes in parts of the Fraser Valley, which were frantically raised in some spots.

    Seven years later, authorities identify the need for a multi-

    billion-dollar regional fl ood protection planone that would coordinate eff orts between com-munities so that the surging Fraser isnt simply pushed from one vul-nerable spot to the next along its route.

    Climate change and altered weather patterns didnt begin seven years ago. Arbitrary grant applications for dike work and varied maintenance eff orts from one community to the next are

    nothing new either.In the meantime little consensus

    has been reached on dredging parts of the river, which still seems to be anathema to senior govern-ment agencies.

    Make no mistake, a cohesive Fra-ser River fl ood protection strategy is vital.

    It just best not take another seven years to expedite some actual action.

    Black Press

    EDITORIAL: Flood strategy is long overdue

    Tom Fletcher/Black PressFinance Minister Mike de Jong presents the audited public accounts at the B.C. legislature ealier this month, showing the province is back in the black as promised in the 2013 election.

    The biggest fabri-cation of last years

    election was the debt free B.C.

    slogan emblazoned on the side of Pre-

    mier Christy Clarks campaign bus.

  • Wednesday, July 23, 2014 Richmond Review Page 9

    SPACES AVAILABLE!Richmond Summer Camps

    Feature camps:KINDERCAMPMake new friends, go on eld trip adventures and enjoy in-house play in this fun and comforting introduction to summer camp that is perfect for children going into or just nishing Kindergarten.

    City CentreGeneral Currie School 56yrsAug 58 TuF 9:30am3:30pm $130.50/4 sess 570309

    612 YEARS CAMPVisit Science World, explore Garden City Park with City Centre campers and create, create, create on Cardboard City and Loony Lego theme days.

    Sea Island Community Centre 612yrsAug 1115 MF 9:30am3:30pm $130.50/5 sess 540058

    612 YEARS CAMPEXPLORING RICHMONDOffered at a lower cost, this high-quality camp includes a visit to one of Richmonds beautiful parks and outdoors spaces each day along with an environmental component activity.

    Cambie Community Centre 612yrsAug 57 Tu/Th 10:00am2:30pm $31.95/2 sess 564221Aug 68 W/F 10:00am2:30pm $31.95/2 sess 564220

    MEDIA LABANIMATIONLEVEL 1Create short animated lms using a variety of animation techniques under the guidance of professional lmmakers and animators. Offered in partnership with Cinevolution Media Arts.

    Media Lab 812yrsAug 1115 MF 1:002:30pm $101.50/5 sess 731858

    1012 YEARS CAMPSwim at Langleys Willoughby Park, spend the day at Kits Beach and take in some of the Richmond Maritime Festival for a fun camp experience!

    Steveston Community Centre 1012yrsAug 58 TuF 9:00am4:00pm $121.80/4 sess 561859

    3 ways to register!t.POo'SJBNoQN tXXXSJDINPOEDBSFHJTUFS t*OQFSTPOEVSJOHGBDJMJUZIPVST

    for ages 318 | single day or full week | exciting out trips sports, arts, nature, heritage, general, adventure and other specialty camps!

    Download the 16-page yer at www.richmond.ca/camps

    www.richmond.ca

    BEST VALUE LUNCH

    In Town

    LATE NIGHTSPECIALS(9:30pm onwards)

    All You Can Eat!LUNCH

    Adult $10.95Child $7.95

    DINNER STARTING ATAdult $22.95Child $10.95

    LATE NIGHT(9:30 onwards)Adult $14.95Child $8.95

    FEATURING: DINNER UP TO AND

    OVER 100 ITEMS LATE NIGHT OVER 60 ITEMS

    (Sashimi Available) TAKE OUT MENU 20% OFF

    A LA CARTE MENU AVAILABLE

    50% OFF WITH THE AYCE

    LUNCH/LATE NIGHT

    Burning Kiss Roll

    Carribean Pearl Roll

    Green Garden Roll

    TemptationRoll

    LUNCHSashimi Options

    Lunch Bento Boxes Unagi Fried Rice

    Avocado & Dynamite Rolls

    DINNER Prawn TempuraSpicy Salmon &

    Tuna SashimiKorean Salmon Sashimi

    Fresh BBQ Meats

    LATE NIGHTSalmon & Tuna

    SashimiHokkigai SushiMassago Sushi

    Fresh BBQ Meats

    MENU HIGHLIGHTS

    These Deluxe Rolls are included in the AYCE Dinner Menu

    BESTAll-You-Can-Eat

    In Town

    205-4231 HAZELBRIDGE WAY (AT CENTRAL SQUARE), RICHMOND 604-279-9077 OPEN: MON-SUN 11:30-3PM, 5PM-12AM

    Suite 201-1128 West Broadway, Vancouver 604 677 0434

    ADD $1.00 TO PRICES ON WEEKENDS AND HOLIDAYS.

    Remembering the Battle of Lundys Lane

    letters

    Smart letter about the ovalEditor:

    Re: Tony Crowleys letter about the attributes of the Richmond Olympic Oval, July 18.

    All I can say is fi nally a person with a brain.Run for city councilI would vote for a person

    like you.Brian Barnes

    Steveston

    Editor:Long live Canada, the

    True North Strong and Free.

    This Friday, July 25, will mark the 200th anni-versary of the Battle of Lundys Lane, a battle that saved Canada, our home and native land.

    This is the battle that gave us the country that we have today, the sov-ereignty that we so love and should never take for granted, and it was one of the bloodiest battles of the warand one of the deadliest battles ever fought onCanadiansoil.

    The British and Canadi-ans mustered a total of 3,500 and eight guns (in-cluding reinforcements) facing an American invasion force of 2,500 troops and nine guns. The Americans knew that this battle could make or break their campaign for supremacy. The British knew that if they lost this battle, Upper Canada would fall and maybe soon after, Lower Canada as well.

    And so over the hal-lowed ground of Lundys Lane Cemetery they faced each other and on that day began the crucial events that set in motion the country that we call Canada. Twice before the Americans had tried to invade Canada and both times they had been soundly repelled back to their own country. The British even repel-ling them as far south as Washington and while attacking the city, burned the White House.

    But while the British held Lundys Lane in strength, when they heard of the advancing Americans, they began to pull back their forces. But orders of a retreat were immediately counter-manded and the troops stayed where they were. And so began a battle that saw both sides ad-vancing and then falling back and when midnight came the battlefi eld was in disarray.

    In the early hours of the next day, the Americans, numbering some 1,200 in strength, tried to take even more of the

    battlefi eld, but found that the British numbered some 2200, men and so were forced to retreat to Fort Erie, having to abandon or destroy much equipment and supplies to make room for the wounded on any avail-able wagons.

    In the end, the British had won the battle and retained the battlefi eld and although both sides would continue to fi ght for another six months, the balance of combat power on the Niagara Peninsula had swung from the Americans to the British and Canadians, and Upper and Lower Canada were still there.

    It is to these soldiers and those who fought at the Battle of Chryslers Farm, the Battle of Queenston Heights and all the other battles of the war on both land and sea, that we owe our sovereignty and the birth of our country.

    We also owe a debt of thanks to one such lady who felt that these soldiers should be memo-rialized and that lady was Ruth Redmond, a local teacher, who in the 1950s, began using her meager savings to purchase properties adjacent the battlefi eld, preserving heritage buildings and sites, to help preserve the memory of the brave Brit-ish and Canadians. She, like the soldiers in the bat-tle and the war in general, is in my view a Canadian above and beyond the call of loyalty.

    The future of Canada was won and preserved this day by men of bravery, courage and the will to staunchly defend their country and sovereignty with their very lives. Therefore we must never forget their sacrifi ce to our country, And as well be ever vigilant to maintain and defend our sovereignty, both economic as well a geographic, where ever it may be under threat, from the arctic to the forty-ninth parallel and from the Atlantic to the pacifi c, to preserve this country that we all love.

    Gordon KibbleRichmond

    China knows how to find usEditor:

    Re: Airport-based economy key to future, July 18.One can appreciate that Mr. Au wants a photo op as

    we head into the silly season of civic elections. How-ever, anyone with a passing knowledge of Richmond and its history knows that we already have an airport-based economy.

    For decades, YVR has been one of the largest genera-tors of economic activity and jobs. Indeed, my family is here in Richmond thanks to an airline job servicing planes destined to and from Hong Kong in 1957.

    To suggest we are not already an international trade and business hub is to ignore the constant roar of air-craft, the steady growth of immigration, the saturation of cheap import products, and the fl ow of literature arriving at my doorstep in Cantonese and Mandarin. It appears to me that China knows well how to fi nd us.

    With the fl oodgates of immigration and trade al-ready well open, lets hope that Mr. Au and council will focus their energy and travels on pursuits that improve the lives of those already here.

    Roy Oostergo, Richmond

  • Page 10 Richmond Review Wednesday, July 23, 2014

    $99*PROGRAMSPECIAL

    for 1 month of classes(appox 8) and a t-shirt

    Valid for the months of July & August 2014

    *Plus Tax

    DENTURESTHAT FIT

    YOUR LIFESTYLE Complete and Partial Dentures Same-day Relines

    and Repairs Dentures over Implants

    PHONE TODAY FOR YOURFREE CONSULTATION!

    BPS CERTIFIEDSONIA RAEISI, RDTEL: 604 273 4221

    6860 NO. 3 ROAD, RICHMOND

    Sonia RaeisiSonia Raeisi

    formerly known as Stewart Denture Clinic

    Want to get your message to a bigger market?Every small business has a story to tell and The Richmond Review is pleased to offer the Richmond Review Business Pro les as a proven vehicle for you to advertise your business.

    This powerful marketing opportunity combines editorial content, a consistent advertising program, and full colour to maximize your results.

    Contact us at 604.247.3700#1-3671 Viking Way, Richmond, BC admanager@richmondreview.com

    Give yourself peace of mind with the right coverage for your home.

    Were insurance experts. So, well make sure you get the right coverage for you and your home. Call us today and fi nd out how you can save money on your home insurance premiumswith discounts of up to 30%.

    The Co-operators is the leading Canadian-owned multi-product insurance company.

    Home Autoplan Life Investments Group Business Farm Travel

    Daniel Wang Agencies Inc.Daniel Wang Financial Advisor

    105-8033 Saba Road Richmond, B.C. V6Y 4M8

    604-270-4233 daniel_wang@cooperators.caC&C

    business | PROFILE

    A Kees instructor connecting with some young pupils

    Perm Roof 1 Ltd. specializes in all your roofing needs

    Dr. Harry Dhanju at his Richmond Centre Dental office

  • Wednesday, July 23, 2014 Richmond Review Page 11

    New Patients Always WelcomeINVISALIGN, ORTHODONTICS, IMPLANTS, Restorative, Family,

    Cosmetic and Laser DentistryDR. J. DHANJU INC.

    TO BOOK APPOINTMENTS PLEASE CALL

    604-276-2442WWW.DRDHANJU.COM

    OPEN LATE EVENINGS & WEEKENDS

    Dr. Dhanju andAssociates Proudly

    Welcome to our Staff

    DR. BIN XIE

    Richmond Centre Dental Clinic

    CONVENIENTLY LOCATEDIN THE RICHMOND CENTRE MALL

    PERM ROOF 1 LTD.

    Cedar Shakes Fiberglass Shingles 2-ply Torch-On Roof Repair Roof Restoration Roofi ng Re-roofi ng

    FREE Estimates Fully Insured and WCBTel: 604-946-8112 | Fax: 604-946-8115CALL PIERRE: 604-817-0511

    permroof@permroof.compermroof.com

    Why wait until your roof is discolored, we can clean & prevent further mossing & discoloration.

    SERVING THE LOWER MAINLAND OVER 36 YEARS

    Before After

    @ Radisson Hotel Vancouver AirportFor reservations call us at 604-279-8303

    or email fresh@radissonvancouver.com or book online at www.opentable.com

    8181 Cambie Road, Richmond www.freshrestaurant.ca

    WINE BY BOTTLESAVE $10 AND $5.5 PINT Fridays & Saturdayswith any Entre order

    Fridays and Saturdays.

    Starting from $19.95.

    Prime Rib includes

    our unlimited Chefs salad table.

    @For

    RESTAURANT & LOUNGE

    JOIN US FOR PRIME RIB WEEKEND SPECIALS

    Have an idea to make Richmond more connected and engaged? Apply for a grant of up to $1,000.

    Deadline is August 15, 2014.

    vancouverfdn #vfnsg

    Learn more at vancouverfoundation.ca/nsg

    business | PROFILE

    Sonia Raeisi at Richmond Denture Clinic on No. 3 Road

    Radisson Executive Chef Gregory Walsh, dicing some Kale.

    Daniel Wang of The Co-operators, Richmond

  • Page 12 Richmond Review Wednesday, July 23, 2014

    OPEN DAILY 10AM TO 5PM

    12138 Fourth Ave. Steveston Phone: 604.664.9009 gulfofgeorgiacannery.com

    ExploreExplore thethe Cannery!Cannery!Explorez la conserverie!

    604-328-9269 or 604-781-3795Open 7 days 8am-8pm INCLUDING HOLIDAYS

    bcstrawberries.com birakfarms.com

    Bridgeport Road

    Cambie RoadKnigh

    t Stre

    et

    No. 6

    Road

    FRESH LOCAL BLUEBERRIESARE READY NOW!

    DELIVERING FRESHNESSDELIVERING FRESHNESS

    1 4200 No. 6 Road (near Cambie)

    Strawberry & Blackberry U-Pick Available $2/lb.

    2 3600 No. 6 Road*$1.49/lb U-Pick at this location Blueberry U-Pick Available3 9111 No. 6 Road

    4 6311 No. 5 Road 5 11351 Blundell Road6 11411 Granville Ave.

    (near No. 5 Road)7 No. 4 Road & Francis 8 2720 56th St.

    Ladner/Tsawwassen9 22835 16th Avenue

    Langley

    U-PICK

    99/lb*

    10 lb Box Blueberries ...... $5005 lb Box Blueberries ........ $200

    OFF

    OFF

    Valid until July 30, 2014. Coupon must be presented at time of purchase.

    Burn survivors camp kicks off in Richmond

    by Martin van den HemelStaff Reporter

    The Richmond Firefi ght-ers Society presented a $25,000 cheque to the B.C. Professional Fire Fighters Burn Fund last weekend, during the kick-off of the 2014 Young Burn Survivors Camp.

    The Burn Fund hosts young burn survivors for a week-long camp every July at Camp La-tona on Gambier Island.

    The kickoff to the camp was held at South Arm Community Centre on Sunday.

    Today was a fabu-lous day at South Arm Community Centre, Jeremy Duncan, of the Richmond Fire Fighters Association IAFF Local 1286, said on Sunday.

    Since 1994, more than 1,000 kids between six and 18 from across the province have partici-pated. While the camp is free for young burn survivors, the cost to the Burn Fund is about $2,900 for each camper.

    But thanks to the support of donors and sponsors, the fund cov-ers the campers travel costs, as well as the cost of accommodation, co-ordinating and operat-ing the camp. Doctors, nurses, medical thera-pists, adult burn survi-vors and professional fi re fi ghters donate their time as counselors.

    Campers and their counsellors participate in activities includ-ing swimming, hiking, kayaking, rafting and waterskiing.

    For more information about the burn fund, visit burnfund.org

    community

    Dale Truscott photoOff to Camp Latona on Gambier Island is this bus full of campers taking part in the 2014 Young Burn Survivors Camp, which launched at South Arm Community Cen-tre on Sunday.

    Jeremy Duncan photoJen McElgunn, her husband Jason, their daughter Hannah, Erin and Richmond Firefi ghters Society president Cory Parker presented a $25,000 cheque to the B.C. Professional Fire Fighters Burn Fund an event at South Arm on Sunday.

  • Wednesday, July 23, 2014 Richmond Review Page 13

    The Fair at the PNE is back...

    ...to win gate and ride passes go to our websiteand click on CONTESTS

    ride passes go to our website

    with all your fair favourites and, new for this year only, Game of

    Thrones: The Exhibition, Internet Cat Video Festival, 360 degree

    travel experience, ToonCity kids zone featuring an animation exhibit,

    plus over 30 Nightly concerts on two stagesall FREE with admission.

    August 16-September 1(closed Aug 18 & 25)

    to win gate and ride passes

    ENTER TO

    WINt i t d id

    RREEEEEEEEEEENNNNNNNNNNNTTTTTTTTTEEEEEEEEEERRRRRRRRRR TTTTTTTTTTOOOOOOOOOENTER TO

    WINwww.richmondreview.com

    4266

    Where: Garden City Road, between Cambie Road and Alderbridge Way (Southbound Lane) Start: Early July Anticipated Completion: Early September Working Hours: 7:00 a.m. 8:00 p.m. Monday to Friday 7:00 a.m. 8:00 p.m. Saturday

    PLEASE BE ADVISED OF TRAFFIC DISRUPTIONS IN YOUR AREA:

    To meet the demand for electricity and improved reliability, BC Hydro will be constructing a new, 800 metre underground duct bank in your area.

    In accordance with a work schedule that has been reviewed and approved by the City of Richmond, crews will typically be on site from 7:00 a.m. to 8:00 p.m., Monday to Friday and Saturday from 7:00 a.m. to 8:00 p.m.

    In addition, due to the location of this project, some work will need to be completed at night in order to avoid significant traffic impacts.

    BC Hydro recognizes that construction projects may be an inconvenience and we will do our best to mitigate the impacts. We appreciate your patience and understanding while we complete this important system improvement project.

    For more information please contact: BC Hydro Stakeholder Engagement Phone: 604 623 4472 Toll free: 1 866 647 3334 Email: stakeholderengagement@bchydro.com

    GARDEN CITY DUCT BANK PROJECT

    Patio season keeps getting better!3711 Bayview St. Richmond, BC V7E 3B6

    P: 604-275-5188www.tapenade.ca

    WINNERWWWWWWWWWWWWWIIIIIIINNNNNNNNNNNNNEEEEEEERRRRRRR

    2014

    RICHMONDBest of

    BREAKFAST SPECIALfrom $5.95

    LUNCH SPECIALfrom $6.95

    #104-10151 No. 3 Road, Richmond604-272-3238

    No. 3 Road

    Gilbert Rd

    Francis Rd.

    Williams Rd.

    Steveston Hwy

    +

    At Banners You Can Afford to Dine Out 3 Times a Day!

    Best all day Grill in Richmond.Open everyday 7:30am-9pm

    50%OFF

    with couponbuy one menu item at regular

    price + 2 beverages and receive a second menu item

    50% off.Not valid with senior discount, stamp

    cards and daily specials. Not valid with any other discount offers.

    Valid July 23-August 6, 2014

    sportsPeewee provincials

    The Juan de Fuca Whalers handed the Coquitlam Adanacs a 7-2 loss in the Peewee A1 gold medal match at the annual B.C. Lacrosse championships held in Richmond last weekend.

    The A2 title went to the Surrey Rebels with an 11-9 victory over Se-miahmoo Rock, while Juan de Fuca edged Sur-rey 6-4 for the Peewee B gold. And in the Peewee C fi nal, Port Coquitlam Saints outlasted Saanich Tigers 7-4 .

    Pam Mason of the host committee was award-ed the BCLA volunteer award.

    Whalers lead list of winners

    Richmond Lacrosse was represented by three teams at the provincial Peewee Division championships it hosted last weekend at Minoru Arenas.

  • Page 14 Richmond Review Wednesday, July 23, 2014

    Avoid hiring this guy from un ltered job pos ng websites.Find a much better solution!

    Call a Recruitment Specialist

    1.855.678.7833

    sports

    Irish eyes are smiling in Richmond

    by Don FennellSports Editor

    Call it the luck of the Irish if you will, but it was indeed a glorious weekend for the Eire.

    First, Northern Ireland golf pro Rory McIlroy scored the British Open in Liverpool, completing a wire-to-wire lead to capture the third leg of the career grand slam Sunday morning. Then to cap the day, at Richmonds Hugh Boyd Park, major underdog Ire-land got a late goal from Tiarnan King to stun a crowd of more than 3,000 and defending champion India 1-0 to win the Geoff Penniston Nations Cup.

    Prior to kickoff of the mens Open Division fi nal, there was some chat-ter that perhaps the Irish might have already emptied the tank. After all, theyd just earned an exhaustive 1-0 decision over Canada to secure their place in the title match against India, which itself needed extra time to slip

    past Croatia 2-1 in the other semifi nal.Additionally, Ireland had been re-

    quired to go to penalties to advance from the group stage, defeating Ger-many 1-0.

    But no one was able to measure the Irishs resolve.

    Backstopped by often-spectacular goalkeeping of Luke OShea, who won The Richmond Review Trophy as the tournaments most outstand-ing player without allowing a goal against, and a never-say-die attitude, Ireland secured their second mens Open Division in four years with their win over India. They did so in 2014 with a young team that was consid-ered by most pundits to be rebuild-ing.

    Its pretty sweet, admitted OShea, who defl ected much of the credit to his teammates.

    I felt like I played pretty well, not conceding a goal in fi ve games, but all the boys in front of me played well too and we had some key tackles every gameall of which could have gone either way. But we were able to get the W and fi nally win it all.

    A Richmond resident, the lanky six-foot-two OSheawho in 2012 helped to lift University of B.C. to Ca-nadian Inter-university mens soccer

    championshipsaid, like most peo-ple at Hugh Boyd Park Sunday, he an-ticipated the fi nal match was headed for at least extra time. But against con-stant pressure from India for much of the second half, he was able to hold the fort until King was able to convert a late break into the games only goal.

    It was defi nitely tough and a lot of

    the boys were really tired for the fi nal, OShea said. A lot of the younger boys had to step up, and played such great tournaments.

    In other mens division play, Por-tugal needed extra timeand a late goal to avoid penalty kicksto slip past Italy in the over-30 fi nal; India blanked Fiji 2-0 in the over-38 fi nal;

    Fiji outscored Ireland 2-0 in the over-45 fi nal; and Scotland scored a 3-0 win over China in the over-52 fi nal.

    Desmond Tachie of Africa won the A. Turner Sales Ltd. Trophy as the tour-naments top goal scorer, while the John Craven Award was presented to Stu Walters of Ireland as the most outstanding defender.

    by Don FennellSports Editor

    The last match Richmond Red Hot Selects played in the summer of 2012 they won, capping their youth soccer journey with a 2-1 victory over Kam-loops Blaze in the Provincial A Cup under-18 girls fi nal.

    Two years later, six members of that team reunited to form the nucleus of Team Caribbean at the 35th annual Nations Cup in Richmond. And true to form they again emerged victori-ous, topping Team Italy 3-1 in the womens fi nal Sunday afternoon at Hugh Boyd Park.

    It was so much fun playing with my old teammates again, said Summer Clarke, whose breakaway speed was

    instrumental in the Caribbean ending a title reign which had been shared between Ireland and Canada since the womens division was introduced a decade ago.

    Clarke, the 18-year-old Richmond resident who is widely regarded as one of the best sophomore players in college soccer at Louisiana State University, said playing in the Na-tions Cup, which featured some older, more experienced players, may have actually been more challenging than university soccer.

    One of the six former Selects, Bren-da Murillos headerthe fi rst of her soccer careercompleted the scor-ing against Italy.

    Being able to play with everyone again was the best feeling ever. Its indescribable, said a smiling Murillo after the game.

    Summers dad, Clive Clarke, coached the Caribbean side. He said as a for-mer player in the Nations Cup, it was his dream to see a womens division created. To guide this team, many of

    whom he coached in youth soccer, to victory was awesome.

    Our strategy was to play tight de-fensively and attack with our speed, said Clive. Alyssa Graemea deserv-ing recipient of tournament MVP honourswas sensational in the midfi eld and the goal she scored to open the scoring against India (which helped lift Caribbean into the fi nal) was fantastic.

    Graeme, who is anxious to resume her college career at Langara in Sep-tember, was surprised and honored by her selection as tournament MVP.

    It was unexpected to hear the compliments for my consistent play-ing, but I have high expectations for myself, she said. I thought I played well enough, but of course everyone thinks they can always play better.

    Graeme was equally modest in de-scribing her spectacular goal in a 2-1 win by Caribbean over India Sunday morning.

    I just found myself in the right place at the right time, when Brenda

    (Murillo) happened to look up and see me. I just went for it (kicking a booming shot into the corner of the upper half of the net). It worked out, she said.

    Clive also praised the play of recent R.A. McMath Secondary School grad Emma Partridge, who helped to an-

    chor the outside of a strong back line.In the midst of their celebration, the

    former Red Hot Selects on the Carib-bean team experienced a particularly solemn moment dedicating their vic-tory to Ashley Chen. The former Se-lect passed away from a rare form of cancer in February.

    Luke OSheas tournament clean sheet earns him nod as MVP at Nations Cup

    Caribbean queensat Nations CupNucleus of former Richmond Selects, led by MVP Alyssa Graeme, top womens division

    Don Fennell photoTournament MVP, goalkeeper Luke OShea holds the fort as Ireland blanks India 1-0 in the mens Open Division fi nal at the Nations Cup Soccer Tournament Sunday in Richmond.

    Don Fennell photoSummer Clarke of Team Caribbean tries to squeeze between a pair of Team Italy defenders to get to a loose ball during the Womens Division fi nal at the Nations Cup Soccer Tournament Sunday at Hugh Boyd Park. Caribbean won 3-1.

  • Wednesday, July 23, 2014 Richmond Review Page 15

    NAME: PHONE:

    AUGUST 8-9-10

    DROP OFF AT: The Richmond Review

    1-3671 Viking Way, Richmondby 5:00 pm on Friday, August 1

    GATES OPEN: FRI. 4:30 PM; SAT. & SUN. 9:00 AM

    www.abbotsfordairshow.com Tell us why you want to go to the Airshow . . .

    mon1

    nd

    NEW NEW Friday NightTWILIGHT SHOW!

    WIN TICKETS!FFTWTSHSH

    ABBOTSFORD INTERNATIONALABBOTSFORD INTERNATIONAL

    AAAAAGATGGATGATGATGATESSESESESES OPEOPEOPEOPEOPEENNNNN

    AAAAAA

    (MJHPTZY\JJPQ^^JWXAND SAVE!

    Register on-line at www.raidersfootball.ca

    In person registration at Minoru Tuesday and Thursdays from 6:00pm-9:00pm

    Practices starts in JulySeason starts Sept. to Nov.

    Flag Football 6-7 year old 8-9 year old(only $100 includes your jersey)

    Atom Tackle Football 8-9 year oldPeewee Football 10-11 year oldJunior Bantam Football 12-13 year oldBantam Football 14-15 year oldMidget Football 16-18 year old

    FALL FOOTBALLREGISTRATION OPEN

    RICHMONDRICHMONDMINOR FOOTBALLMINOR FOOTBALL

    Main Stage Entertainment (continuous) Fireworks Torchlight Parade Kids Zone Market Place Vancouver Aquarium Aqua Van Sandcastle by Craig Mutch Salmon Barbeque by Semiahmoo First Nation AND SO MUCH MORE!

    MARINE DRIVE, WHITE ROCKEast Beach West Beach White Rock Pier

    AUGUST 1, 2 & 3 FEATURING

    65th 65th Anniversary!Anniversary!

    Saturday August 2 8:00 pm

    ++ MAIN STAGE ++Headline Entertainment

    FRIENDS OF THE FESTIVAL

    Dale & WendyMumford

    Brian & Alicia

    Hagerman

    MEDIA SPONSORS

    MAIN STAGE

    SEMIAHMOO LEVEL

    COMMUNITY SPONSORS

    For more info visit us at www.whiterockseafestival.ca or contact us at email@whiterockseafestival.ca

    PROTECTYOUR HOME or BUSINESS

    Phone: 604-251-2121Email: okaban@telus.net

    4FDVSJUZ4ZTUFNTt%73T$$57$BNFSBTt*OWFTUJHBUJPOT$POTVMUJOHt%FCVHHJOH

    BEST BUY Correction NoticeIn the July 18 flyer, page 5, the Bose QuietComfort 15 Acoustic Noise-Cancelling Headphones (WebCode: 10173935) were advertised with an incorrect price. Please be advised that these headphones are $296.99 NOT $269.99, as previously advertised. Also we would like to clarify the Asus TF701T Transformer Pad (WebCode: 10275831) advertised on page POP 3. Please be advised that this tablet DOES NOT come with a keyboard, as previously advertised. We sincerely apologize for any inconvenience this may have caused our valued customers.

    sports

    X-Falcons extend reign at Dolphinby Don FennellSports Editor

    As the sun set on the 29th annu-al Dolphin Basketball Classic Sun-day evening, a general consensus among the crowd was thatlike a good winethe tournament keeps getting better with age.

    So, too, apparently do the X-Falcons.

    For the second year in a row, and fourth time in the last fi ve years, the X-Falcons netted the mens ti-tle at the popular Richmond four-on-four playground hoops event at Thompson Community Centre.

    It was tough sledding. We were only 2-2 after the round-robin, but we hung in there, said Navi Sekhon, the architect of the 2014 edition of the X-Falcons.

    Like their coach, the X-Falconswho outscored a talented, but young University of Fraser Valley team 54-43 in the fi naldemon-strated all the qualities of winners.

    And that was the key to victory.Sekhon purposely assembled a

    lineup that, in addition to featur-ing several older players, fea-tured individuals who have con-sistently proven to be winners and know what it takes to rise to the top.

    Their MVP was Josh Whyte, the former University of B.C. star guard who, noted Sekhon, seemed to score a basket every time his team needed one. He was equally eff ective on the defensive side of the ball.

    The X-Falcons tipped off tourna-ment play with a 71-54 win over Blacktop Rainmen Friday and then topped Wolfpack 59-39 Sat-urday morning before dropping two in a row55-50 to the Steve Lee-led Runnin Rebels Saturday night and 68-61 to the University of Fraser Valley Sunday morning.

    Widely regarded as perhaps the best dunker in the world, Kevin Kemp won the slam dunk contest.

    Don Fennell photoMVP Josh Whyte paced the X-Falcons to a solid 54-43 victory over University of Fraser Valley in the mens fi nal of the 29th annual Dol-phin Basketball Classic Sunday at Richmonds Thompson Commu-nity Centre.

    Fourth win in five years for defending four-on-four playground hoop champions

    Morrison at North American Indigenous Games

    Davis drops quarter-fi nal

    Richmond teen Annie Morrison is competing at the North American Indigenous Games, which began this week in Regina.

    Ojibway on her fathers side, Mor-rison, 14, is a pitcher/fi rst base player for B.C.s under-16 girls softball team,

    which was scheduled to play its fi rst tournament game today. Morrison has played softball for seven years and is also active in basketball and volleyball.

    The Games continue through July 27.by Don Fennell

    Don Fennell photoAnnie Morrison is in Regina this week representing B.C. at the North American Indigeous Games.

    Richmond Country Club member Gabe Davis came up shy as a wiidcard entry in the Oldum Brown VanOpen Tennis Tournament July 26 to Aug. 3 in North Vancouver. He lost a quarter-fi nal 6-4, 6-4 to Andrew Slater on Sunday.

  • Page 16 - Richmond Review Wednesday, July 23, 2014

    BALL,Gordon Frederick

    1930 - 2014It is with deep sadness, we announce his passing on June 28th, 2014. A.K.A. Pin Man of Steveston.

    Predeceased by his wife Helen, sister Alice, and brother Alfred. Gordon is lovingly remembered by his daughters Barbara (Ken) and Ann (Nick), sons Robert and Bill, his cherished grandsons Terry (Christina) and Colton, best buds Koda, Loki & Riley, many nieces, nephews, and his best friends Ray & Rene.Dad worked at BC Packers for 44 years, after retirement he spent his time volunteering at The Gulf of Georgia Cannery, The Steveston Community Police and handing out pins at the local McDonalds. The family would like to thank Dr. Howie, the doctors and nurses at Richmond Hospital and his homecare givers for all their care and support.

    A Celebration of Life will be held 1pm-3pm on August 16th at The Buck & Ear Steveston

    Hotel, 12111 3rd Ave,in Steveston

    The Peace Arch News, a twice-weekly award-winning newspaper has an outstanding opportunity for a full-time experienced sales person.

    The successful candidate will have a minimum of two years of sales experience preferably in the advertising or retail industry. The ability to build relationships with clients and offer superior customer service is a must. The winning candidate will be a team player, a strong communicator, well organized and self-motivated. The ability to work in an extremely fast paced environment with a positive attitude is a must. A car and valid driver's license is required.

    We offer a great working environment with a competitive base salary and commission plan coupled with a strong benefi t package.

    Black Press has more than 170 community newspapers across Canada and the United States and for the proven candidate the opportunities are endless.

    Please submit your resume with a cover letter by Friday, July 25, 2014 to:

    Rita Walters, Publisher Peace Arch News, #200 - 2411 - 160th St., Surrey, BC V3S 0C8 or email to publisher@peacearchnews.com

    No phone calls please.

    Advertising Sales Consultant

    www.blackpress.ca

    FAMILY ANNOUNCEMENTS

    6 IN MEMORIAM GIFTS

    7 OBITUARIES

    ALLEY, Margaret W.C. (nee Hall) Winnie

    March 30, 1921 - June 27, 2014

    Beloved Mother, Grandmother and Great Grandmother left us to be with her Nennie and friend Hughie, leaving behind daughter June (Gary), Grand-daughter Amber (Spencer), Grandson Spencer, Great Grandchildren Kendra, Ava, Calia and Hayden. Born in Glasgow, Scotland, she came to Vancouver as a war bride, lived in Richmond for forty years, moved to South Surrey and later to Ladner to live with her daughter and son-in-law. She worked for Montreal Trust in Vancouver for twenty-fi ve years hardly missing a day.Winnie loved her choirs and sang with joy in two church choirs also the Keynotes in Vancouver and the Rainbow Choir in Langley.Special thanks to Kathy Lewis for her tender, loving care over the years and to the caregiv-ers in Eagle Point at Delta View Habitation Centre.In lieu of fl owers donations to Delta View Habitation Centre, 9321 Burns Drive, Delta, BC V4K 3N3 or charity of choice.Memorial to be held at Delta View Habitation Centre, July 30, 2014 @ 11:00 am.

    Condolences may be offered at www.victoryfuneralcentre.ca

    Victory Memorial Park Funeral Centre 604-536-6522

    FAMILY ANNOUNCEMENTS

    DAWSON, Janet CatherineJune 14, 1930 - July 14, 2014

    With heavy hearts we announce the sudden passing of Jan Dawson on July 14, 2014. Predeceased by her son Grant in 2007. She is sur-vived by daughters Valerie Friedt (David), Marlene Wos-chee, Joanne Dawson and their father Rennie. She leaves behind grandchildren, great-grandchildren and many special friends. A special ac-knowledgement for the excep-tional care that was provided by Dr. Sherri Caswell and the nursing staff of 2 South Tower, Second Floor, of Richmond General Hospital.A celebration of Jans life will be held on Saturday, July 26, 2014 at the family home, 6080 Drewry Crescent, Richmond at 3:00 pm. Bring your memories and your music.

    MINNS, Margaret

    Margaret Minns, known by her friends as Peggy, passed awaypeacefully on July 15 at the ageof 89. Peggy was pre-deceasedby her loving husband, Harry in 1985, and son, Dennis in 2012.She will be deeply missed and is survived by her son Terry, daughter-in-law Gayle, grand-children Carly (Rob), Meghan (Kyle), and great - grandson Mason. Thank you to the staff at Fraserview for their care and kindness over the last 4 years. No service by request.

    COMMUNITY ANNOUNCEMENTS

    33 INFORMATIONCANADA BENEFIT GROUP - Do you or someone you know suffer from a disability? Get up to $40,000 from the Canadian Government. Toll-free 1-888-511-2250 or www.canadabenefi t.ca.

    041 PERSONALSMeet singles right now! No paid op-erators, just real people like you. Browse greetings, exchange mes-sages and connect live. Try it free. Call now: 1-800-712-9851

    42 LOST AND FOUNDLOST Black Samsung Galaxy 3 Cell Phone - vic of west or central Richmond on Sat. July 12th. Please return to RCMP or Rogers.

    Call today andget noticed!

    www.bcclassi ed.com

    TRAVEL

    74 TIMESHARECANCEL YOUR TIMESHARE. NO Risk Program STOP Mortgage & Maintenance Payments Today. 100% Money Back Guarantee. FREE Consultation. Call Us NOW. We Can Help! 1-888-356-5248

    76 VACATION SPOTSFountain of Youth Spa and RV Re-sort Offers more vacation for less money, hot mineral springs, events, activities, fi tness, entertainment. www.foyspa.com or 888-800-0772.

    CHILDREN

    83 CHILDCARE AVAILABLEDAYCARE SPACES - AGE 3+Home of Joyful Learning is a Li-censed In-Home Daycare w/ skilled & experienced staff. Group size: 8 children max. Variety of activities to promote development. Mon-Fri, 7am to 6pm. Parksville Drive. 778-877-1231 & See Facebook.

    EMPLOYMENT/EDUCATION

    108 BUSINESS OPPORTUNITIES

    A Great JanitorialFranchise Opportunity

    ANNUAL STARTING REVENUE $24,000 - $120,000 Minimum investment

    as low as $6,050 required Guaranteed Cleaning Contracts Professional Training Provided

    Financing Available Ongoing Support

    A Respected Worldwide Leader in Franchised Of ce Cleaning.Coverall of BC 604.434.7744

    info@coverallbc.comwww.coverallbc.com

    GET FREE VENDING MACHINES. Can Earn $100,000.00 + Per Year. All Cash-Retire in Just 3 Years. Protected Territories. Full Details CALL NOW 1-866-668-6629. Web-site WWW.TCVEND.COM.

    114 DRIVERS/COURIER/TRUCKING

    CLASS 1 HIGHWAY LINE HAUL

    COMPANY DRIVERSVan Kams Group of Companies requires Class 1 Drivers for the SURREYarea. Applicants must have a min 2 yrs industry driving experience.

    We Offer AboveAverage Rates!

    To join our team of professional drivers please send off a resume and cur-rent drivers abstract to:

    careers@vankam.comFor more info about Line Haul, call Bev,

    604-968-5488We thank all applicants for

    your interest!Van-Kam is committed toEmployment Equity and

    Environmental Responsibility.

    EMPLOYMENT/EDUCATION

    114 DRIVERS/COURIER/TRUCKING

    HIGHWAYOWNER OPERATORS

    $3500 SIGNING BONUSVan Kams group of compa-nies req. Highway linehaul owner operators based in our Surrey terminal for runs throughout BC and Alberta. Applicants must have winter and mountain driving experi-ence/training.

    We offer above average rates and an excellent

    employee bene ts package.To join our team of profession-al drivers, email a detailed re-sume, current drivers abstract and details of your truck to:

    careers@vankam.com orCall 604-968-5488 or

    Fax: 604-587-9889Only those of interest

    will be contacted.Van Kam is committed toEmployment Equity and

    Environmental Responsibility.

    115 EDUCATION

    APARTMENT/CONDOMANAGER TRAINING

    Certifi ed Home Study

    Course Jobs

    RegisteredAcross Canada Gov. Certifi ed

    www.RMTI.ca / 604.681.5456 or 1.800.665.8339

    Excavator & Backhoe Operator Training. Be employable in 4-6wks. Call 604-546-7600. www.rayway.ca

    INDEX IN BRIEFFAMILY ANNOUNCEMENTS ............... 1-8

    COMMUNITY ANNOUNCEMENTS ... 9-57

    TRAVEL............................................. 61-76

    CHILDREN ........................................ 80-98

    EMPLOYMENT ............................. 102-198

    BUSINESS SERVICES ................... 203-387

    PETS & LIVESTOCK ...................... 453-483

    MERCHANDISE FOR SALE........... 503-587

    REAL ESTATE ............................... 603-696

    RENTALS ...................................... 703-757

    AUTOMOTIVE .............................. 804-862

    MARINE ....................................... 903-920

    AGREEMENTIt is agreed by any Display or Classifi ed Advertiser requesting space that the liability of the paper in the event of failure to publish an advertisement shall be limited to the amount paid by the advertiser for that portion of the advertising space occupied by the incorrect item only, and that there shall be no liability in any event beyond the amount paid for such advertisement. The publisher shall not be liable for slight changes for typographical errors that do not lessen the value of an advertisement.

    bcclassifi ed.com cannot be responsible for errors after the fi rst day of publication of any advertise-ment. Notice of errors on the fi rst day should immediately be called to the attention of the Classifi ed Department to be corrected for the following edition.

    bcclassifi ed.com reserves the right to revise, edit, classify or reject any advertisement and to retain any answers directed to the bcclassifi ed.com Box Reply Service and to repay the customer the sum paid for the advertisement and box rental.

    DISCRIMINATORYLEGISLATION

    Advertisers are reminded that Provincial legislation forbids the publication of any advertisement which discriminates against any person because of race, religion, sex, color, nationality, ancestry or place of origin, or age, unless the condition is justifi ed by a bona fi de requirement for the work involved.

    COPYRIGHTCopyright and/or properties subsist in all advertisements and in all other material appearing in this edition of bcclassifi ed.com. Permission to reproduce wholly or in part and in any form whatsoever, particularly by a photographic or offset process in a publication must be obtained in writing from the publisher. Any unauthorized reproduction will be subject to recourse by law._____________

    Advertise across the Lower Mainland

    in the 15 best-readcommunity

    newspapers.ON THE WEB:

    bcclassifi ed.com

    7 OBITUARIES

    109 CAREER OPPORTUNITIES 109 CAREER OPPORTUNITIES

  • Wednesday, July 23, 2014 Richmond Review - Page 17

    BUILDING & RENOVATIONS

    SPECIALIZING IN KITCHENS AND

    BATHS

    CALL FOR ESTIMATE

    www.gen-west.com 604-812-8350

    YOU DREAM IT, WE BUILD IT

    GENERAL CONTRACTING & RENOVATIONS

    PLUMBING & HEATING

    604-868-7062 Licensed, Insured & Bonded Local Plumberswww.1stcallplumbing.ca

    Plumbing Service & Repairs Boilers & Furnaces Gas Work

    Heating System Service SpecialOnly $89 including free hot water tank service!

    HOME SERVICE GUIDE REVIEW the richmond

    ** COMMERCIAL RESIDENTIAL **KITCHEN & BATHROOM SPECIALIST PLUS TIDDLEY THINGS

    604-272-2809 or cell: 604-841-2479

    RENOVATIONS

    BILL GILLESPIECONSTRUCTION RENOVATIONS

    PLUMBING

    5 MINUTE EXPRESS PAGING SYSTEMPLUMBING SERVICES AT REASONABLE RATES

    CALL 604-270-6338

    RJS PLUMBING& HOME SERVICE

    EXCAVATION

    SSL ENTERPRISES INCCOMMERCIAL ~ RESIDENTIAL

    Backhoes Backfi lling/trenchingMini excavator (rubber track) Asphalt/concrete removalBobcats (forks/buckets) DrainageDump trucks Retaining walls Install concrete driveways/sidewalks604-833-2103 604-908-3596

    Residential / Commercial Residential / Commercial

    Rotary / Reel Cutting Rotary / Reel Cutting

    Trimming Trimming

    Edging Edging

    Aeration / Power Raking Aeration / Power Raking

    Complete Complete Fertilizing ProgramsFertilizing Programs

    Hedge Hedge Trimming / PruningTrimming / Pruning

    Pressure Washing Pressure Washing

    666000444--999000888--333555999666666000444-999000888-333555999666

    LAWN SERVICE

    160-8780 Blundell Road160-8780 Blundell Roadat Garden City,at Garden City,Call Now! 604-649-0108 t www.tonyling.com

    NEWS@RICHMONDREVIEW.COM OFFICE: 604-247-3700 DELIVERY: 604-247-3710 CLASSIFIED: 604-575-5555 NEWSROOM: 604-247-3730

    R

    REVIEWthe richmond This years Richmondstreet banners are unveiled 10Is B.C.s new recycling system about to end up in a giant dumpster 5

    Bfoha

    baBl

    frmwm

    C

    604-275604-275-4325-4325604-275604-275-4325-4325604-275-2929604-275-2929

    160 8780 Blundell Road160 8780 Blundell Road

    $$333300 OFFFFFF000 OFFFFFF******WHEN YOU BWHEN YOU BUY ANYUY ANY SPECIAALTLTYY*WHEN YOU B*WHEN YOU BBUY ANY SPEUY ANY SPECUY ANY SPECIALIALTALTYTYY

    LARGELARGELARGELARGELARGE GE 22222 FORFORFORFORFOR 1 PI1 PIZ1 PIZ1 PIZ1 PIZ1 PIZZZZAZAZAZAZAAALimit 1 couponLimit 1 coupon pLimit 1 coupon pt coupo per order With cer order. With ce o e t coupon ooupon only. oupon only. oupon only.

    Expires March 31Expires March 31Expires March 31 202014, 2014.

    Glutt n FrreeeG eeGlGlututteenn Frreeeee Availab eAvavaaiailaababableee!!e EXPERT ADVICE from RICHMONDSFree

    REAL ESTATE PROFESSIONALFREE No Obligation Home EvaluaEvaluationtionFAwardAwardAward Wi iWinninWinning Servg Servg Service anice anice and Resud Resud Resud Resultltsltslts

    Ri hRichmonRichmonRichmond Specid Specid Speci li talistalist

    CaCallall NoNowNow!!! 604604-649649-01080108 t www tonyling com

    GGGGNNNLYY YNNYNYNYTONTONTONTOTOONY GGGNNNIIILLLYYYY LINGNY LINGReal Estate ServicesReal Estate ServicesReal Estate Services

    AWAA

    AWWRAADRR WIWWNNER

    20132013

    RICHMONDRICHMONDf N

    Best ofBest of ICHMOOBBBeBe t ofest ofesBesesteststst ofofoffof f

    OOof

    RICCHHHMMOMONDRREVIEWEVIEWCOMRICCHCHHMHMOMONDRMONDRMONDRNDREVIEWCOMEVIEW.COMEVIEW.COM WEDNESDADA AY MARCH 26 2014 288 PPAAAGG SSWEDNESDAWEDNESDAWEDNESDAY MARY, MARCHY, MARCH 26 201426, 2014 288 PPPAAAGGESSMMM

    But hheeeaalaltth has improved forr seeeizizzzeedd Rottweilers, whohavvee eeeaaacch lost between 10 andd 11555 ppoounds

    by Jaacqquuueeeliinne Langennd Maarrttinnn vvan den Hemellackk PreessssA bbid too hhavve two Rottweilers released

    rom dogggyy ddeeath row was denied by a Rich-mondd proovvvinnciial court judge, who ruled last weekk hee dddiddnntt have jurisdiction to hear thematteer.

    City lawyer Kevin Westell argued beforeJudge Dennis Schmidt that the court didnthave the power to grant an interim release of the dogs before a scheduled hearing onApril 10 at Richmond provincial court.

    Fearing for the welfare of their pets, afterlearning they hadnt been walked in months and had ballooned in weight, owner NavNijjer and his mother Prabjot Nijjer soughtto have the court intervene and release the dogs prior to the court hearing.

    But it wasnt all bad news for the Nijjer family, who have seen a significant improve-ment in the health of their pets, Axel and Paris.

    They appear to have lost between 10 and15 pounds each in the past couple of weeks, are being walked daily, and are out in the yard

    for a few hours each day, according to lawyer Joe Peschisolido, whose firm has been hired fiby the family after the City of Richmond ap-plied to have the dogs destroyed.

    The Richmond Review revealed two weeks ago that volunteers and staff at the RichmondffAnimal Protection Society were barred from walking the seized dogs, which have been labelled as dangerous by the city. A society policy had prohibited anyone from walkingdangerous dogs, which under normal circum-stances would have been seized for a maxi-mum of 21 days.

    Since they were seized on Oct. 25, followinga minor biting incident involving a construc-tion worker who suff ered a dime-sized contu-ffffsion to his upper thigh, the dogs have gained an estimated 25 pounds each.

    The extra exercise, along with a chaanggee ttootheir diet, has resulted in a notable upptticckk iinntheir health, Peschisolido said.

    The Nijjers are hoping their pets willl bbee rree--turned and have built an enclosure thheeyy ssaayy ensures that the dogs never escape aggainn.

    The enclosure was inspected by animmaal bbbee-haviour specialist Dr. Rebecca Ledgeer, wwwhhonoted there are now three fenceseaacchh aatleast fi ve feet tall, robust and well-conssttruucctt-fiedbetween the Nijjers yard and thee adddjaa-cent Henry Anderson Elementary Schooool.

    These fences prevent school childrenn ffrroommmlooking into your yard to see the dogs,, aannnddalso prevent the dogs from seeing out or ccoommm--ing within 20 feet of the property line, LLeddggeerr wrote.

    See PPaggeee 66

    Richmond hhooosssttssshort-track kselections

    The home of the 200100 Winter Olympic lonng--ttrraacckk speed skating evenntssplayed host to the 2200144 Short Track Nationaal TTeeaaamm Selections last weekkeenndd.. The Richmond Rockkettss Speed Skating Club b hhoosstteeddCanadas top short-ttraacckk k speed skaters.

    Calvin Gehleenn pphhhootoo

    CCoooooouurt denies bid to release seized dogssss

    ADULT SUBSTITUTECARRIERS NEEDED

    Required to deliver theRICHMOND REVIEW

    door to door on Wednesdaysand Fridays. Routes vary

    on a weekly/monthly basis.A reliable vehicle is a must.

    Please leave your name,phone number and address at

    604-247-3700

    EMPLOYMENT/EDUCATION

    115 EDUCATION

    MEDICAL TRANSCRIPTION is an in-demand career in Canada! Em-ployers have work-at-home posi-tions available. Get the online train-ing you need from an employer-trusted program. Visit: Career-Step.ca/MT or 1-888-528-0809 to start training for your work-at-home career today!

    130 HELP WANTED

    An Alberta Oilfi eld Company is hiring experienced dozer and excavator operators, meals and lodging provided. Drug testing required. 1-(780)723-5051.EXPERIENCED PARTS PERSON required for a progressive auto/in-dustrial supplier. Hired applicant will receive top wages, full benefi ts and RRSP bonuses working 5 day work week, plus moving allowanc-es. Our 26,000ft2 store is located 2.5 hours N.E. of Edmonton, Alber-ta. See our community at LacLa-BicheRegion.com. Send resume to: Sapphire Auto, Box 306, Lac La Biche, AB, T0A 2C0. Email: hr@sapphireinc.net.

    FLAGGERS NEEDED. No Certifi cation? Get Certifi ed, 604-575-3944

    LAB TECHNICIANTemporary Lab Technician for Fuchs Lubricants wanted until end of August. To perform Quality Control testing and sampling, data entry, fi ling, maintenance of equipment, calibrations, & customer service work. Perfect for science student enrolled in university in fall. Lab exp. mandatory. Located in Langley, BC. $17.00-$18.00/hr. depending on experience.

    Email resume:jbperez@fuchs.com or

    Fax: 604-888-1145

    Landscaping Sales & Service Opportunities

    Up To $400 CASH DailyF/T & P/T Outdoors. Spring /

    Summer Work. SeekingHonest, Hard Working Staff.

    www.PropertyStarsJobs.com

    130 HELP WANTED

    NOON HOUR SUPERVISORS RICHMOND SCHOOL DISTRICT is seeking noon hour supervisors to work either on-call or fi ve (5) days a week. Duties will involve supervis-ing students in school buildings and grounds during the lunch break plus assisting in the offi ce or school li-brary. The shifts for this part time casual position are 1.5 hours per day on those days that the students are in attendance. $21.53 per hour which includes 4% holiday pay. For further details, please visit www.makeafuture.ca/richmond In-terested qualifi ed applicants should forward resume to RSBsup-port@sd38.bc.ca

    PRODUCTION WORKERSCanadas Largest Independently owned newspaper group, is currently looking for Part-Time Production Workers to work at our Delta - Vantage Way 24/7 production facility.

    This is an entry level, general labour position that involves the physical handling of newspaper & related advertising supplements.

    REQUIREMENTS: Prior bindery and/or machine operator experience is preferred Motivated self-starter willing to work in a fast-paced enviro. performing repetitive tasks Must be able to lift 35lbs. & stand for long periods of time Ability to work co-operatively in a diverse, team-based enviro. Must be reliable & dependable Excellent communication skills & detail oriented Completion of high school Must have own transportation

    This P/T position has a variety of afternoon & graveyard shifts (Mon - Fri). The incumbent must be able to work on a weekly schedule with short notice.

    Starting Wage $12.20 +Shift Premiums!

    If you are interested in this position, please e-mail your

    resume, including Production Worker in the subject line to:

    jobs.vantageway@gmail.com

    132 HOME STAY FAMILIES

    HOMESTAY FAMILIESNeeded for international students. Must provide accommodation, food & transporation. Call (778)893-3906

    130 HELP WANTED

    139 MEDICAL/DENTAL

    Full time Certifi ed Dental As-sistant required for team orien-tated family dental practice. Awesome wage and benefi ts package. Apply by resume to: 121 N. 1st Avenue, Williams Lake, BC V2G 1Y7, Fax: (250)398-8633 or by E-mail:vitoratos@shaw.ca Visit our website: www.cariboodentalclinic.com

    160 TRADES, TECHNICAL

    BISON Transport is looking for positive, team oriented Tractor Trailer Technicians for our expand-ing maintenance team in Langley. Great company with leadership op-portunities. Competitive wages and benefi ts dependent on experience and qualifi cations. Red Seal and BC Safety Certifi cation an asset. To apply, visit the Careers page on www.bisontransport.com.

    Commercial Transport& Diesel Engine

    MechanicsRequired for Cullen Diesel Power Ltd. and Western Star and Sterling Trucks of Vancouver Inc. Positions available in Surrey. Cummins, Detroit Diesel and MTU engine exp. considered an asset. Factory training provided.

    Union Shop - Full Bene tsFax Resume: 604-888-4749

    E-mail: ars@cullendiesel.com

    MASTER CRAFTSMENWANTED

    Plumbers Painters Electricians Finish

    Carpenters Tilers Dry Wallers Handymen /

    Jack Of All TradesMust have min. 10 years exp. Serving Metro Vancouver & sur-rounding area. F/T, P/T, Flexible hours & great compensation!

    Apply On-line: www.handymanconnection.com

    /handyman-job-careers-opportunities.aspx

    160 TRADES, TECHNICAL

    HEAVY DUTY TRUCK/ TRAILER MECHANICS

    K-Line Trailers is a custom trans-port trailer manufacturer in Lang-ley, BC. We seek long-term, F/T, qualifi ed Truck-Trailer mechanics to repair, maintain, inspect and certify trucks and trailers. Must have appropriate hand tools, be a solid self-starter but great in a team setting. MVI/CVI required, Class 1 drivers an asset.

    Highly Competitive Wages Health, Dental, RRSP Bene ts

    that grow with long-term employment

    Please email resume:employment@klinetrailers.com

    Join one of North Americas most respected & fastest growing heavy civil infra-structure contractors.

    Flatiron has been named Heavy Civil Contractor of the Year in Alberta & has won numerous employer awards.

    Flatiron Constructors has an immediate need for:

    Formwork Carpenters Apprentice Carpenters Skilled Laborers Grade Checkers Heavy Equipment OperatorsThis is an opportunity to join us in the Edmonton Area. The Northeast Anthony Hen-day Drive project includes the construction of 27 kms of six and eight-lane divided roadway, nine interchanges, two fl yovers, eight rail cross-ing & two bridges across the North Saskatchewan River.

    You can view all skilled trade and construction management positions

    and apply viawww. atironcorp.com

    or forward your resume: canadarecruiter@ atironcorp.com

    Build The Best.Be The Best!

    PERSONAL SERVICES

    182 FINANCIAL SERVICES

    Are You $10K Or More In Debt? DebtGo can help reduce a signifi -cant portion of your debt load. Callnow and see if you qualify. 1-800-351-1783

    IF YOU own a home or real estate, ALPINE CREDITS can lend you money: Its That Simple. Your Cred-it / Age / Income is NOT an issue. 1.800.587.2161.

    182 FINANCIAL SERVICES

    GET BACK ON TRACK! Bad credit? Bills? Unemployed? Need Money? We Lend! If you own your own home - you qualify. Pioneer Acceptance Corp. Member BBB.

    1-877-987-1420 www.pioneerwest.com

    Need CA$H Today? Own a vehicle? Borrow up to $25,000. Snapcarcash.com 604-777-5046

    Unfi led Tax Returns? Unreported Income? Avoid Prosecution and Penalties. Call a Tax Attorney First! 855-668-8089 (Mon-Fri 9-6 ET)

    HOME/BUSINESS SERVICES

    203 ACCOUNTING / TAX /BOOKKEEPING

    Accounting & Tax ServicesBookkeeping for individuals and small business corporations, Clean up historical books, Full Payroll, GST, PST and WCB Re-turns. Tax Returns for Individuals and businesses. Management and systems help.

    Raju Nanduri CGA 778-688-2999

    rajunanduri@yahoo.com

    206 APPLIANCE REPAIRS

    REPAIR Fridges, Stoves, Washers, Dryers, d/ws & garberators. Plumb-ing. 604-916-6542, 604-780-9830

    260 ELECTRICAL

    YOUR ELECTRICIAN $29 Service Call Lic #89402 Same day guarntd We love small jobs! 604-568-1899A+, BBB member-Low rates, Ex-pert trouble shooter. All types of Electrical work 24/7 604-617-1774

    281 GARDENING

    JAPANESE PRO GARDENER Lawns, Power Raking, Hedges & Trees. Free Estimates 604-839-8856

    287 HOME IMPROVEMENTS

    HANDYMAN CONNECTION Home Repairs, Renovations, Installations. Licensed & Bonded. 604-878-5232

    FULL SERVICE Plumbing from Parker Dean. Fast, reliable, 24/7 service. Take $50 off your next job if you present this ad. Vancouver area. 1-800-573-2928

    300 LANDSCAPINGGREENWORKS Redevelopment

    Inc. Hedges, Pavers, Ponds & Walls. Returfi ng, Demos, Drainage, Concrete cutting, Jack hammering,

    old swimming pools fi lled in &decks. 604-782-4322

    778-710-2185

    320 MOVING & STORAGE

    1PRO MOVING & SHIPPINGAcross the street - across the world

    Real Professionals, Reas. Rates. Best in every way! 604-721-4555.

    AFFORDABLE MOVINGwww.affordablemoversbc.com

    From $45/Hr1, 3, 5, 7 & 10 Ton Trucks

    Licensed ~ Reliable ~ 1 to 3 MenFree Estimate/Senior DiscountResidential~Commercial~PianosLOCAL & LONG DISTANCE

    604-537-4140

    329 PAINTING & DECORATING

    ABOVE THE REST Interior & Exterior Unbeatable

    Prices & Professional Crew. Free Est. Written Guarantee

    No Hassle Quick Work Insured WCB

    778-997-9582

    www.paintspecial.com 604.339.1989 Lower Mainland

    604.996.8128 Fraser ValleyRunning this ad for 10yrsPAINT SPECIAL

    3 rooms for $299,2 coats any colour

    (Ceiling & Trim extra) Price inclsCloverdale Premium quality paint.

    NO PAYMENT until Job iscompleted. Ask us about our

    Laminate Flooring & Maid Services.

    332 PAVING/SEAL COATING

    ASPHALT PAVING Brick Driveways Retaining Walls Foundation Repairs Sealcoating 604-618-2304

    338 PLUMBING

    Plumbing Services - Hvac Gas Fitting & Electrical. C & C Electrical Mechanical 604-475-7077

    MIN. EXPRESS PAGING SYSTEM

    Reasonable Rates 604-270-6338

    10% OFF if you Mention this AD! *Plumbing *Heating *Renos *More Lic.gas fi tter. Aman: 778-895-2005

    BRO MARV PLUMBING 24/7Plumbing, heating, plugged drains BBB. (604)582-1598, bromarv.com

    341 PRESSURE WASHING

    Power Washing, Gutters, Windows, Maintenance, Res/Comm. Lic/Insd. Free Est. Call Dean 604-839-8856

    POWER WASHINGGUTTER CLEANING

    SAME DAY SERVICE AVAILABLE Call Ian 604-724-6373

    353 ROOFING & SKYLIGHTS

    10% DISCOUNT. MG Roofi ng & Siding. WCB

    Re-roofi ng, New Roof Gutters & Replace Fascia 604-812-9721

    EXCEL ROOFING LTD. All kinds of roofi ng work. Reroof, New, Repairs. Free est. (778)878-2617

    .A East West Roofi ng & Siding Co. Repairs, new roofs, torching, gutter services. 10% off. 604-783-6437

    Call 604-575-5555bcclassied.com

    EMPLOYMENT/EDUCATION EMPLOYMENT/EDUCATION EMPLOYMENT/EDUCATION PERSONAL SERVICES HOME/BUSINESS SERVICES

    287 HOME IMPROVEMENTS

    HOME/BUSINESS SERVICES

  • Page 18 - Richmond Review Wednesday, July 23, 2014

    CHRIST-CENTERED CHRISTIAN CHURCHwww.cccc-richmondbc.com

    COME AND JOIN USIN OUR CELEBRATION OF REDEMPTION!

    Worship Service 12:20 p.m.Sunday School 2:00 p.m.

    8151 Bennett Road, Richmond tel: 604-271-6491

    INTERNATIONAL CHRISTIAN CHURCH

    TO ADVERTISE IN THE COMMUNITY WORSHIP PAGECALL GEETU AT 604-575-5304

    Community WorshipREFORMED CHURCH (RCA)

    Fujian Evangelical Churchwelcomes you to

    Sunday Worship Services English Services: 9:00 & 10:45 a.m. Mandarin Service: 9:00 a.m. Minnanese Service: 10:45 a.m.

    12200 Blundell Road, Richmond, B.C., V6W 1B3Phone 604-273-2757 www.fujianevangelical.org

    ANGLICAN CHURCH OF CANADASt. Alban

    an Anglican parish in the heart of RichmondServices at 8:30 and 10:00 am

    Sunday School 10:00 amThe Reverend Margaret Cornish

    7260 St. Albans Road, Richmond 604-278-2770 www.stalbansrichmond.org

    St. Annes - Steveston Anglican Church4071 Francis Road, Richmond, BC

    The Rev. Brian Vickers, Rector 604-277-9626Sunday 8:30 a.m. - Contemplative Eucharist

    10:00 a.m. Family Eucharist with Church SchoolWednesday 10:00am. Eucharist, 11:00am Bible Study, 7pm Eucharist

    www.stannessteveston.ca

    UNITEDSTEVESTON UNITED CHURCH

    3720 Broadway Street (at 2nd Ave.) Please join us at 10am Sunday, July 27, 2014

    for Worship Service and Sunday School604-277-0508 www.stevestonunitedchurch.ca

    A caring and friendly village church

    Richmond United Church8711 Cambie Rd. (near Garden City Rd.) 604-278-5622

    Come for 10am Sunday Worship and ChildrensSunday School and after-service coffee and fellowship.

    Rev. Dr. Warren McKinnonFounded 1888. Richmonds Oldest Church

    GILMORE PARK UNITED CHURCH8060 No. 1 Road (corner of No. 1 & Blundell)

    604.277.5377 www.gilmoreparkunited.caRev. Maggie Watts-Hammond, Min. of Word, Sacrament & Pastoral Care

    Rev. Yoko Kihara Min. of Christian Development & OutreachWorship and Childrens Program Sundays 10:30 am

    For more information, please check our website or call the offi ceEveryone is welcome!

    BRIGHOUSE UNITED CHURCHan evangelical congregation

    8151 Bennett Road, Richmond, 604-278-7188www.brighouseunitedchurch.org

    Sunday, 10 am Worship & Sunday SchoolMinister: Rev. Stuart W. Appenheimer, B.A., M.Div.

    Brighouse Pre-school:604-272-2480 Brighouse UC Day Care: 604-278-8469

    BAPTIST

    8140 Saunders Road, Richmond, BC604-277-8012 www.bbchurch.caDr. Tim Colborne - Lead Pastor.

    Worship Service - 10:30 a.m. Sonshine Adventures for Kids

    Broadmoor Baptist ChurchA safe place to connect with God and fellow

    travellers on your spiritual journey

    CATHOLICEastern Catholic Church :

    Everyone Welcome!Sunday Service: 11:00 am

    : : 9:00amSe habla espaol; Bine ai venit,

    8700 Railway Ave. (just north Francis)www.easternchurch.wordpress.com Tel: 604 447 1731

    PeninsulaProperty Management#304 - 1959 152nd Street,White Rock, B.C. V4A 9E3

    RESIDENTIAL RENTALS IN B.C.604.536.0220

    PHONE:

    www.rentinfo.ca

    Rental Homes for Qualifi ed Tenants.

    Rentinfo.ca

    URGENTLY NEEDED!PROUD TO SUPPORT THE LOCAL SPCA

    PET WEEK OF THE

    TO ADOPT CALL 604-277-3100SPCA Thriftmart

    5400 MINORU BLVD 604.276.2477

    PATTI AND SELMA NEED A GOOD HOME WITH YOU!

    PATTI AND SELMA,ID# 333980 AND 333981, CHINCHILLA, FEMALE, 3 YEARS 2 MONTHSPatti and Selma are two adorable sisters who came to the centre together. Chinchillas make a unique pet and are a ton of fun to watch. Come visit these cutie-pies soon!

    REVIEW the richmond

    5431 NO. 3 RD 604.276.2254 &10151 NO. 3 RD Richlea Square

    604.241.7586

    HOME/BUSINESS SERVICES

    356 RUBBISH REMOVAL

    #1 AAA RubbishRemoval

    25 Years Serving Rmd.Residential & Commercial Clean Courteous Service

    FREE ESTIMATESJoe 604-250-5481

    FLEETWOOD WASTEBin Rentals 10-30 Yards.Call Ken at 604-294-1393

    JUNK REMOVAL By RECYCLE-IT!604.587.5865www.recycleitcanada.ca

    477 PETS

    356 RUBBISH REMOVAL

    Brads Junk Removal.com. Same Day Service. Affordable Rates! 604.220.JUNK (5865)

    PETS

    477 PETSCATS GALORE, TLC has for adoption spayed & neutered adult cats. 604-309-5388 / 604-856-4866GERMAN Shepherd pups. Working line. Black & black/tan. 6 weeks old. $700. 604-820-4230, 604-302-7602Male Stud Services. Looking for a Maltese. Will consider Pomeranian. Reasonable fee. 604-302-6647Pure bread CAIRN TERRIER Pups Shots, dewormed. $650. House pets. 778-588-1051,604-859-1724

    MERCHANDISE FOR SALE

    542 FRUIT & VEGETABLESCHERRY JUBILEE Sour Cherries

    2014 HARVEST SEASONJuly 16 - July 27 (Closed July 20th)

    8:00a.m. - 3:00p.m.2017 - 272nd Street, AldergrovePlace Your Order: 604-856-5844

    477 PETS

    Find a friendwww.bcclassi ed.com

    MERCHANDISE FOR SALE

    560 MISC. FOR SALEKILL BED BUGS & THEIR EGGS! Buy Harris Bed Bug Killer Complete Treatment Program or Kit. Available: Hardware Stores, Buy Online: homedepot.comKILL ROACHES! Buy Harris Roach Tablets. Eliminate Bugs - Guaran-teed. No Mess, Odorless, Long Lasting. Available online only @ Ace Hardware & The Home DepotSTEEL BUILDINGS/METAL BUILDINGS 60% OFF! 20x28, 30x40, 40x62, 45x90, 50x120, 60x150, 80x100 sell for balance owed! Call 1-800-457-2206 www.crownsteelbuildings.ca.STEEL BUILDINGS...SUMMER MELTDOWN SALE! 20X20 $5,419. 25X26 $6,485. 30X30 $8,297. 32X34 $9,860. 40X48 $15,359. 47X68 $20,558. Front & Back Wall Included. Pioneer Steel 1-800-668-5422 www.pioneersteel.ca

    563 MISC. WANTED

    FIREARMS. All types wanted, es-tates, collections, single items, mili-tary. We handle all paperwork and transportation. Licensed Deal-er.1.866.960.0045.www.dollars4guns.com.

    REAL ESTATE

    612 BUSINESSES FOR SALEFor Lease $1500 pm or for sale $699,000 Gas Bar/Gro-cery Store, Fruit Stand, Restaurant, lots parking,7500 sq.ft. bldg on Trans Canada Hwy, Sicamous. 1 (250)309-0975

    627 HOMES WANTEDWE BUY HOMES BC

    All Prices All Situations All Conditions

    www.webuyhomesbc.com604-657-9422

    PRIMELAKEVIEW LOTS

    FROM $140,000Also; Spectacular 3 Acre

    Parcel at $390,0001-250-558-7888

    www.orlandoprojects.com~ FINANCING AVAILABLE ~

    REAL ESTATE

    630 LOTS

    2.5 ACRE LOTS, LUMBY, BCMabel Estates 5 mins from town, pristine lush views. De-signed and ready to build. Wells & power at lot. Starting, $139,000, $50,000 below as-sessed value. 250-317-2807.

    RENTALS

    750 SUITES, LOWER

    2RD/Steveston. Gr. fl r. 2-bdrm, w/d, quiet garden house. Avail. Sept. 1. N/s, n/p. $1000. 604-716-1261

    751 SUITES, UPPER

    RICHMOND #1/Blundell. 3 BDRM upper, appls & lndry. NP/NS. $1300 incl utils. Avail now. 604-889-5220

    RICHMOND nr Cambie & Shell, 4 bdrm 1.5 baths, new h/w fl rs, f/p, incl ldry deck fncd yd, sm pet OK $2195 incl util Aug 1. 778-389-5225

    TRANSPORTATION

    810 AUTO FINANCING

    Auto Financing Dream Team - www.iDreamAuto.com or call 1.800.961.7022

    Auto Loans Guaranteed or We Pay You! 1-888-375-8451 or apply at: www. greatcanadianautocredit.com

    TRANSPORTATION

    845 SCRAP CAR REMOVAL

    #1 FREE SCRAP VEHICLE REMOVAL

    ASK ABOUT $500 CREDIT $$$ PAID FOR SOME

    604.683.2200

    AAA SCRAP CAR REMOVALMinimum $150 cash for full size

    vehicles, any cond. 604-518-3673The Scrapper

    736 HOMES FOR RENT

    845 SCRAP CAR REMOVAL

    847 SPORT UTILITY VEHICLES

    2009 TOYOTA RAV4 LIMITEDV6, 3.5L, 4/dr, 4WD, 5spd, 83K. Pyrite colour, leather int, satellite radio, Bluetooth, a/c, pwr sunroof, heated front seats, rear fold-down seat, push button/smart key.

    One owner, non-smoker. LOADED! Exc Cond! $19,950

    604-338-4114

    HOME/BUSINESS SERVICES

    551 GARAGE SALES

    FINAL MOVING SALE! Prices re-duced from previous sales, a lot of items marked as free. 8791 No 4 Road (near Francis). Sunday, July 20 from 10am to 4pm. Email mo-vingsale8791@gmail.com for info and photos.

    GARAGE Sale Sat July 19, 10-4, 10591 Agassiz Crt. Something for everyone. All proceeds are dona-tions for animal rescue.

    TRANSPORTATION

    736 HOMES FOR RENT

  • Wednesday, July 23, 2014 Richmond Review Page 19

    LOOK FOR OUR FLYER IN TODAYS PAPER!

    Happy togetherr

    COPPERSMITH PLAZA(across from Canadian Tire)

    11380 Steveston Hwy, Richmond

    (604) 204-0511

    FRANCIS RD @ GILBERT#120 - 7020 Francis Rd.Richmond, BC V6Y 1A2(604) 204-0707

    13 99

    Midsummer Arts Dream at Thompson Community Centre

    Wonderful works of 2D art were on display for the opening night of the third annual Mid-summer Arts Dream exhibition, put on by the Community Arts Council of Richmond at Thompson Com-munity Centre last Friday.

    The level of art seems to be even higher than last year, said Natasha Lozovsky-Burns, the presi-dent of the Community Arts Council of Richmond.

    Over 100 guests walked around and enjoyed 70

    pieces of 2D artwork from approximately 50 different artists on open-ing night of the three-day exhibit.

    Everyone [was] very happy, Lozovsky-Burns said. We have received very positive feedback.

    Opening night featured beverages, cake, live music by a string trio and door prizes.

    This will definitely (con-tinue to) be an annual thing, Lozovsky-Burns said. I can see this get-ting bigger and bigger.

    Throughout the three days the exhibit was open to the public, every-

    one had the opportunity to vote for their favourite painting and their favou-rite photograph.

    By Sunday, artist William Watt received the most votes in the painting category, while Joci Sirak received the most votes in the photography cat-egory.

    Each won $350. Much of the artwork

    on display was available to be purchased directly from the artists.

    Amanda Oye cov-ers the social scene for The Richmond Review. amanda.oye@telus.net

    Around TownAmanda Oye

    In Performance Entertainment Solutions provided musical entertainment at the opening.

    Man-Kay Koon and Sui-Fan Ho.

    Margaret Stephens, treasurer and primary admin-istrator of the Community Arts Council of Richmond and Coun. Bill McNulty.

    Sylvia Gurstein and Annie Lee. Sharon MacKenzie, Joan Hauff and Arlene Jessen.

    Natalie, Richard, Julie and Kyla Kish enjoyed the art on display at Thompson.

    Marni Zimmermen, Restie Bengco, Mumtaz Khokhar, Jackelyn Lal and Marjorie Young.

    Exhibition featured 50 artists

  • Page 20 Richmond Review Wednesday, July 23, 2014

    Langley Farm MarketLangley Farm Market

    MEATMEAT

    Freybe Honey Ham......................................... .............$1.09/100g

    Freybe Summer Sausage........................................................ ....99 /100g

    German Edam Cheese....................................................... .$1.29 /100g

    Chicken Winglet Frozen (8.33kg) ........................... ...................$3.79/lb.

    Pork Back Ribs Frozen(10.97 kg) ......................... ...................$4.99/lb.

    Pork Side Ribs Whole(6.57 kg)..............................................$2.99 /lb.

    DELIDELI

    BAKERYBAKERY

    GROCERYGROCERY

    Opera Cake (4"x8") .......................................................$11.00 ea.Zucchini Loaf (450g) ............................................. ...$2.80 ea.

    Butter Roll (350g) ..................................................... ...$1.80 ea.Peanut Butter Cookies (250g) ..................... ...$2.50 ea.

    Asian Family Oyster Sauce (210ml) ...................2/$3.00FarkayNoodles, (Assorted 397 g) ............................................. ...$2.49 ea.

    Mediterranean Gourmet Sunflower Oil, (1L).. ................................................ .$2.99 ea.Pacific Foods Broths, Asst. (946ml).. ............. $3.25 ea.

    Prices in effect Wed. July 23 - Sun. July 27, 2014. While Quantities Last.

    Langley Farm MarketLangley Farm Market

    LOCAL MINI CUKEproduct of BC (3.28 kg)

    OKANAGANAPRICOT

    product of BC (2.18 kg)

    lb.$149

    LOCAL BLUEBERRY

    product of BC 1 lb clamshell

    LOCAL BOK CHOY MUE

    product of BC ($2.18 kg)

    99

    99lb.

    lb.

    lb. $169OKANAGANCHERRY

    product of BC ($3.82 kg)

    LOCAL

    2 for$500

    LOCAL

    2 for$400BC

    GRAPE TOMATOESproduct of BC