rewired signaling network in t cells expressing the ... · 12/19/2019 · a better understanding...

Rewired signaling network in T cells expressing the chimeric antigen

receptor (CAR)

Rui Dong1, Kendra A. Libby2, Franziska Blaeschke3,4,5, Alexander Marson3,4,5,6,7,8,9,10, Ronald D.

Vale1,11, and Xiaolei Su2,12

1. Department of Cellular and Molecular Pharmacology, University of California, San

Francisco, San Francisco, CA, USA, 94158

2. Department of Cell Biology, Yale School of Medicine, New Haven, CT, USA, 06520

3. Department of Microbiology and Immunology, University of California, San Francisco, San

Francisco, CA, USA, 94143

4. Diabetes Center, University of California, San Francisco, San Francisco, CA, USA, 94143

5. Innovative Genomics Institute, University of California, Berkeley, Berkeley, CA, USA, 94720

6. Rosalind Russell/Ephraim P. Engleman Rheumatology Research Center, University of

California, San Francisco, San Francisco, CA, USA, 94143

7. Chan Zuckerberg Biohub, San Francisco, CA, USA, 94158

8. UCSF Helen Diller Family Comprehensive Cancer Center, University of California, San

Francisco, San Francisco, CA, USA, 94158

9. Department of Medicine, University of California, San Francisco, San Francisco, CA, USA,

94143

10. Parker Institute for Cancer Immunotherapy, San Francisco, CA, USA, 94129

11. The Howard Hughes Medical Institute, University of California, San Francisco, San

Francisco, CA, USA, 94158

12. Yale Cancer Center, Yale University, New Haven, CT, USA, 06520

Correspondence: [email protected]; [email protected]

.CC-BY-ND 4.0 International licenseavailable under a(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made

The copyright holder for this preprintthis version posted December 20, 2019. ; https://doi.org/10.1101/2019.12.19.883496doi: bioRxiv preprint

mailto:[email protected]

mailto:[email protected]

https://doi.org/10.1101/2019.12.19.883496

http://creativecommons.org/licenses/by-nd/4.0/

Abstract

The chimeric antigen receptor (CAR) directs T cells to target and kill specific cancer cells. Despite

the success of CAR T therapy in clinics, the intracellular signaling pathways that lead to CAR T

cell activation remain unclear. Using CD19 CAR as a model, we report that, similar to the

endogenous T cell receptor (TCR), antigen-engagement triggers the formation of CAR

microclusters that transduce downstream signaling. However, CAR microclusters do not coalesce

into a stable central supramolecular activation cluster (cSMAC). Moreover, LAT, an essential

scaffold protein for TCR signaling, is not required for microcluster formation, immunological

synapse formation, and actin remodeling following CAR activation. Meanwhile, CAR T cells still

require LAT for the normal production of the cytokine IL-2. Together, these data show that CAR

T cells can bypass LAT for a subset of downstream signaling outputs, thus revealing a rewired

signaling pathway as compared to native T cells.



https://doi.org/10.1101/2019.12.19.883496


Introduction

The development of T cells engineered with chimeric antigen receptors (CARs) has launched a

new era of cell-based therapy for cancer. CAR is a synthetic single-pass transmembrane receptor

that is intended to mimic the signal transducing function of the T cell receptor (TCR). CAR

recognizes a tumor antigen and activates pathways leading to T cell activation. CAR-T cell

therapy, as approved by FDA, has been successfully applied to treat patients with B cell cancers

including acute lymphoblastic leukemia and non-Hodgkin lymphoma1-3. However, many patients

do not respond to CAR T therapy and some suffer from severe neurotoxicity and cytokine release

syndrome4,5. Furthermore, there are unexplained aspects of the CAR T cell response to antigen

stimulation. CARs, for example, trigger faster tyrosine phosphorylation of downstream effectors

and faster cytotoxic granule release in CD8+ T cells6. Perhaps even more surprisingly, CAR-CD4+

T cells can kill target cells as efficiently as CAR-CD8+ T cells, although the basis of this

phenomenon is not known7. A better understanding of the molecular mechanism of CAR signaling

is needed for explaining the unique aspects of CAR T cells and could suggest new strategies for

designing better CAR-T therapies targeting broad types of cancers.

Here, we sought to define the signaling pathways downstream CAR activation in both

immortalized human T cell lines (Jurkat T cells) and primary human T cells. We found that, similar

to TCR, CARs form near micron-sized clusters that serve as signaling platforms to transduce the

activation signal from antigen engagement. However, LAT, an adaptor protein essential for TCR

microcluster formation, is dispensable for the formation of CAR microclusters and CAR-induced

immunological synapses. CAR also can bypass LAT to activate LAT’s downstream signaling

pathways leading to actin reorganization and synapse formation. Together, these data suggest

that CAR T cells display a rewired signaling pathway as compared to the TCR pathway in native

T cells.



https://doi.org/10.1101/2019.12.19.883496


Results and Discussion

CARs form microclusters upon ligand engagement

We used the 3rd generation CD19-CAR as a model, which is activated by the CD19 molecule on

the B cell surface. A transmembrane domain derived from CD8 connects the extracellular single

chain variable fragment (scFv) recognizing CD19 to the intracellular domain composed of the

cytoplasmic part of TCR subunit CD3, co-receptor CD28, and 4-1BB (Figure 1A). A GFP tag

was introduced at the C-terminus to visualize CAR dynamics. GFP-tagged CAR was stably

introduced into Jurkat T cells by lentiviral transduction. To stimulate these CAR-T cells, we used

a supported lipid bilayer-based activation system8, which is compatible with high signal-to-noise

imaging of the T cell plasma membrane by total internal reflection fluorescence (TIRF) microscopy.

In this system, recombinant CD19 proteins, the ligand for CAR, were attached to the supported

lipid bilayers, as a surrogate for antigen-presenting cells. To facilitate cell adhesion, the supported

lipid bilayer also was coated with ICAM-1, an integrin ligand (Figure 1B).

When CAR-T cells were plated onto the CD19- and ICAM-1-coated bilayers, CAR microclusters

rapidly formed as cells spread on the supported lipid bilayer (Figure 1C). These CAR

microclusters were enriched in phosphotyrosines, indicating that they are spots of active signaling

(Figure 1D). In contrast, in the absence of CD19, neither microclusters nor phosphotyrosine

signals were present on the T cell membranes (Figure 1D). These data show the CD19 binding

to CAR triggers the formation of signaling-competent microclusters, which is very similar to what

has been reported for pMHC-triggered TCR microclusters9,10.

We then monitored the behavior of CAR microclusters in a longer term. In about one-quarter of

the CAR-T cells, CAR microclusters translocated to the cell center and formed a stable disk-like

structure (Figure 1E, upper panel and Movie S1), which resembles the central supramolecular

activation cluster (cSMAC)11. However, in another quarter of cells, the CAR cSMAC initially

formed but then quickly disassembled (Movie S2). The average time between cell landing and



https://doi.org/10.1101/2019.12.19.883496


cSMAC disassembly was ~7 min. We also observed moving synapses (kinapse) in about 11% of

cells (Movie S3). Most strikingly, in ~40% of cells, individual microclusters remained separated

and did not form a cSMAC (Figure 1E lower panel, Movie S4). Together, these data (Figure 1F)

suggest that CARs form microclusters, but these generally do not coalesce into a stable cSMAC.

CARs can bypass LAT to form microclusters and induce immunological synapse

formation

Next, we determined the molecular requirements for transducing CAR signaling. LAT, or linker for

activation of T cells, is an essential adaptor for TCR signaling12. Deletion or mutation of LAT

impairs formation of T cell microclusters13,14 as well as signal transduction to downstream

pathways including calcium influx, MAPK activation, IL-2 production, and actin remodeling15,16.

Firstly, we reconfirmed that TCR microclusters did not form in a LAT-deficient Jcam2.5 T cell line

(Figure 2A, left panel). Surprisingly, however, we found that CARs still formed microclusters in

the same LAT-deficient line (Figure 2A and 2B).

Next, we investigated whether CAR microclusters can recruit signaling components downstream

of LAT. Gads is a cytosolic adaptor that is, after TCR activation, recruited to the plasma membrane

by LAT. Gads bridges LAT to SLP76, which further connects the LAT microclusters to the actin

polymerization machinery9. We found that Gads could be recruited to CAR microclusters in both

the presence and absence of LAT. The amount of Gads relative to CAR recruited to membranes

in LAT-deficient cells is comparable to that in the wild-type cells (Figure 3A). This result indicates

Gads can still be recruited to CAR microclusters without LAT.

We then investigated whether LAT is required for the activation of SLP76. SLP76 is a constitutive

binding partner for Gads17 and activated SLP76 recruits Nck, an important regulator of actin

assembly18, to LAT clusters on the membrane. To assess the activation level of membrane-

associated SLP76, we performed immunofluorescence microscopy using a phospho-SLP76

antibody. We found that pSLP76 levels at the membrane were similar between the wild-type and



https://doi.org/10.1101/2019.12.19.883496


LAT-deficient cells following CD19-dependent CAR activation (Figure 3B). In contrast, the level

of pSLP76 was not increased by OKT3, the activating antibody for TCR, in LAT-deficient cells

(Figure 3B). These results suggest that LAT is required for TCR-triggered, but not CAR-triggered

activation of SLP76. In support of the idea that LAT is not required for Gads-SLP76-actin pathway,

in LAT-deficient CAR-T cells, CAR microclusters were still robustly translocated from the

periphery to the cell center (Movie S5). This result indicates that CAR engagement with CD19

induces actin polymerization-dependent retrograde flow in LAT knockout cells.

Actin polymerization also stabilizes immunological synapse formation between a T cell and an

antigen-presenting cell. To test if LAT is required for CAR-T cell synapse formation, we incubated

CAR-T cells with Raji B cells that express CD19. We found LAT-deficient cells can still form

synapses with Raji B cells, though the efficiency is lower than the wild-type cells (Figure 3C). This

result suggests that LAT promotes but is not essential for CAR-induced immunological synapse

formation. Together, these data suggest that LAT is not essential for transducing signaling from

CAR to the actin polymerization pathway.

LAT is required for CAR-triggered PIP2 hydrolysis and IL-2 production

In parallel, we determined if LAT is required for PIP2 signaling following CAR activation. We used

mCherry-labeled C1 domain as a reporter for diacylglycerol (DAG)19, the product of PIP

hydrolysis. In contrast to wild-type cells, in which the C1 domain was robustly recruited to the

plasma membrane upon CAR activation, C1 was not recruited in LAT-deficient cells (Figure S1A).

Consistent with a defect in PIP hydrolysis, CAR also did not induce IL-2 secretion in LAT-deficient

cells (Figure S1B). Together, these data suggest LAT is essential for CAR-triggered PIP2

signaling and IL-2 production in Jurkat T cells.

LAT is not required for CAR signaling in human primary T cells

Next, we sought to determine if a LAT-independent CAR signaling pathway exists in primary T

cells. To do so, we knocked out the LAT gene in human primary T cells by CRISPR-based



https://doi.org/10.1101/2019.12.19.883496


genome targeting. The LAT protein levels were reduced in the overall cell population to 12% as

revealed by immunoblot analysis (Figure 4A). CAR-GFP was then introduced into wild-type or

LAT null T cells by lentiviral transduction. TIRF microscopy revealed that TCR microclusters were

formed in wild-type but not LAT null cells following OKT3 engagement on planar lipid bilayers. In

contrast, CAR microclusters were formed in both wild-type and LAT null cells following CD19

engagement (Figure 4B). Moreover, SLP76, the adaptor linking CAR to actin, was equally

activated in wild-type and LAT null CAR T cells, as determined by a phospho-SLP76 antibody

(Figure 4C). Interestingly, we also found that LAT null CAR T cells produced IL-2, though at a

lower level than wild-type CAR T cells (Figure 4D). This result differs from that obtained with

Jurkat T cells, in which IL-2 production is completely abolished in LAT-deficient cells (Figure S1B).

The mechanism underlying this difference is unclear, potentially due to the different signaling

responses between Jurkat and primary T cells20. Together, these data suggest that LAT is not

required for CAR microcluster formation and SLP76 activation in human primary T cells.

A model for CAR T signaling pathway

Our data reveal that CAR exhibits differences in its signaling mechanism from TCR. LAT plays a

crucial role in signaling after TCR engagement. Tyrosine-phosphorylated LAT recruits several

molecules, including Grb2, PLC1, and Gads, which promote microcluster formation.

Microclusters further transduce signal to downstream pathways that promote synapse formation

and cytokine production (Figure 5A). In contrast, when CAR is engaged, it can induce

microcluster formation even in the absence of LAT. CAR could directly recruit LAT binding partner

Gads, to trigger downstream signaling that leads to actin remodeling and immunological synapse

formation. However, LAT is still partially required for CAR-induced cytokine production (Figure

5B).

The discovery of a LAT-independent signaling pathway may be related to and provide an

explanation for previous reports showing that CAR triggers faster proximal signaling and faster



https://doi.org/10.1101/2019.12.19.883496


killing of target cells than TCR6. CAR could take a shortcut to bypass LAT, and directly recruit

downstream signaling proteins Grb2, Gads, and PLC1 to transduce signaling. The multivalent

interactions between CAR and SH2 domain-containing adaptor proteins might drive the formation

of CAR microclusters, even in the absence of LAT. However, additional work will be needed to

dissect more details on the LAT-independent signaling and how that changes the overall kinetics

of the CAR T cell signaling response.

Acknowledgement

R.D. was supported by a Jane Coffin Childs Postdoctoral Fellowship. K. L. was supported by a

Yale College First-Year Summer Research Fellowship in the Sciences and Engineering. F. B.

was supported by the Care-for-Rare Foundation, the German Research Foundation (DFG), and

an NIH funding for the HIV Accessory & Regulatory Complexes (HARC) Center (P50 GM082250).

A.M. holds a Career Award for Medical Scientists from the Burroughs Wellcome Fund, is an

investigator at the Chan Zuckerberg Biohub and has received funding from the Innovative

Genomics Institute (IGI) and the Parker Institute for Cancer Immunotherapy (PICI). R.D. is an

investigator of the Howard Hughes Medical Institute. X.S. has received support from the American

Cancer Society Institutional Research Grant, the Charles H. Hood Foundation Child Health

Research Awards, the Andrew McDonough B+ Foundation Research Grant, the Gilead Sciences

Research Scholars Program in Hematology/Oncology, and the Rally Foundation a Collaborative

Pediatric Cancer Research Awards Program.

Competing Financial Interests

The authors declare competing financial interests: A.M. is a co-founder of Arsenal Biosciences

and Spotlight Therapeutics. A.M. serves as on the scientific advisory board of PACT Pharma, is

an advisor to Trizell and was a former advisor to Juno Therapeutics. The Marson Laboratory has



https://doi.org/10.1101/2019.12.19.883496


received sponsored research support from Juno Therapeutics, Epinomics, Sanofi and a gift from

Gilead.



https://doi.org/10.1101/2019.12.19.883496


Figure 1. CAR forms microclusters that are signaling-active.

A. Domain structure of CAR. B. Schematic of the assay for imaging CAR dynamics. C. Time

courses of microcluster formation of CAR upon CD19 engagement. D. Enrichment of phosphor-

tyrosine (pY) at CAR microclusters. E. CAR microclusters underwent centripetal movement to

form cSMAC (upper panel) or remained separated (lower panel). Scale bar: 2 m. F.

Quantification of the categories regarding the formation of CAR cSMAC. Shown are the mean +

SD. n=3 independent experiments. 38 to 53 cells were quantified in each experiment.



https://doi.org/10.1101/2019.12.19.883496


Figure 2. LAT is not required for CAR-induced microcluster formation.

A. WT or LAT-deficient Jurkat cells expressing CAR stimulated on planar lipid bilayers coated

with OKT3 (anti-TCR antibody) or CD19 (CAR antigen). TIRF microscopy revealed clustering of

Ax647–labeled streptavidin-Biotin-OKT3 or CD19, which serves as a probe for TCR or CAR

respectively. Scale bar, 2 µm. B. Quantification of clustering as normalized variance13. n = 100

cells. Shown are the mean ± SD. **** p < 0.0001. ** p = 0.0022.



https://doi.org/10.1101/2019.12.19.883496


Figure 3. CAR microclusters can activate Gads-SLP76 pathway in the absence of LAT.

A. Gads is recruited to CAR microclusters in LAT-deficient cells. N=33 or 34 cells. Shown are the

means ± SE. B. Phosphorylated SLP76 is enriched in CAR microclusters in both wild-type and

LAT cells. n = 50 cells. Shown are the means ± SE. C. LAT is dispensable for cell conjugates

formation between Jurkat T cells expressing CAR and Raji B cells expressing CD19. Jurkat cells

are mixed with Raji cells at a 1:1 ratio. K562 cells, which do not express CD19, serve as a negative

control. Three independent experiments were performed and over 100 cells were scored in each

experiment. Shown are the means ± SD. Scale bar: 5 m.



https://doi.org/10.1101/2019.12.19.883496


Figure 4. LAT is not required for CAR microcluster formation and SLP76 activation in

human primary T cells.

A. Western blot showed that LAT is efficiently depleted in human primary T cells using CRISPR.

Shown are the means ± SD. B. WT or LAT-deficient CAR T cells were stimulated on planar lipid

bilayers coated with biotin-OKT3 (left) or biotin-CD19 (right). TIRF microscopy revealed clustering

of Alexa647–labeled streptavidin-Biotin-CD19. C. Phosphorylated SLP76 is enriched in CAR

microclusters in both WT and lat- T cells. As a control, pSLP76 levels are significantly lower on

bilayers without CD19. For Quantification of pSLP76 in B and C, n > 200 cells were scored, and

the cells were isolated from two independent donors. Shown are the means ± SD. Clustering is

quantified as normalized variance. Scale bar, 5 µm. D. T cells were incubated with Raji B cells at

a 4:1 ratio and IL-2 were measured by ELISA at 24hr. Data were pooled from three donors.



https://doi.org/10.1101/2019.12.19.883496


Figure 5. A model comparing TCR- versus CAR-induced signaling.

A. Activated TCR triggers LAT phosphorylation, which promotes microcluster formation.

Microclusters further transduce signal to downstream pathways that induce synapse formation

and cytokine production. No microclusters or synapses are formed in the absence of LAT. B. In

contrast, when CAR is activated, it induces microcluster formation even in the absence of LAT.

CAR could directly recruit LAT binding partners to trigger downstream signaling that leads to

synapse formation and partial cytokine production.



https://doi.org/10.1101/2019.12.19.883496


Supplementary Data

Supplementary Figure

Figure S1. LAT is required for PIP2 hydrolysis and IL-2 production in Jurkat T cells.

A. LAT is required for PIP2 hydrolysis in CAR-induced signaling. PIP2 is hydrolyzed to generate

DAG and IP3, following the receptor activation. The DAG reporter C1 is recruited to plasma

membrane only in wild-type but not LAT deficient cells. Scale bar: 5 m. B. LAT is required for IL-

2 production. CAR-T cells were mixed with Raji B cells expressing CD19 for 24 hrs. IL-2 produced

was measured by ELISA. Shown are means ± SD. n = 3 independent experiments.



https://doi.org/10.1101/2019.12.19.883496


Supplementary Movies

Movie S1. CAR forms a stable cSMAC. TIRF microscopy revealed an example showing CAR-

GFP forming a stable cSMAC as the cell lands on supported lipid bilayers coated with CD19 and

ICAM-1. Shown is a field view of 23 μm x 23 μm.

Movie S2. CAR forms a cSMAC that disassembles early. TIRF microscopy revealed an

example showing CAR-GFP forming an unstable cSMAC that quickly disassembles as the cell

lands on supported lipid bilayers coated with CD19 and ICAM-1. Shown is a field view of 23 μm

x 23 μm.

Movie S3. CAR forms a moving cSMAC. TIRF microscopy revealed an example showing CAR-

GFP forming a moving cSMAC (kinapse) as the cell lands on supported lipid bilayers coated with

CD19 and ICAM-1. Shown is a field view of 23 μm x 23 μm.

Movie S4. CAR forms a scattered pattern. TIRF microscopy revealed an example showing

CAR-GFP remaining scattered and not coalescing into a cSMAC as the cell lands on supported

lipid bilayers coated with CD19 and ICAM-1. Shown is a field view of 23 μm x 23 μm.

Movie S5. CAR forms a moving cSMAC. TIRF microscopy revealed an example showing CAR-

GFP microclusters undergoing centripetal movements as the LAT-deficient cell lands on

supported lipid bilayers coated with CD19 and ICAM-1. Shown is a field view of 25 μm x 25 μm.



https://doi.org/10.1101/2019.12.19.883496


Methods

Key Resources Table

Reagent type

Designation Source or reference

Additional information

Cell line Jurkat T cell E6.1

UCSF Cell Culture Facility

Cell line Jurkat T cell Jcam2.5 LAT deficient

UCSF Cell Culture Facility

Cell line Raji B cells UCSF Cell Culture Facility

Plasmid CAR (1st)-sfGFP

This study Signal peptide: CD8a (Gene Bank AAH25715 aa 1-21), extracellular antibody: anti-CD19 CAR (Gene Bank AMZ04819, aa 23-130-linker (3xGGGGS)- aa 148-267), Stalk and Transmembrane: CD8a (Gene Bank AAH25715 aa 138-206), Cytosolic: CD3z (Gene Bank AAH25703 aa 52-164), linker (2xGGS), sfGFP (Gene Bank AVR55105)

Plasmid CAR (3rd)-sfGFP

This study Signal peptide: CD8a (Gene Bank AAH25715 aa 1-21), extracellular antibody: anti-CD19 CAR (Gene Bank AMZ04819, aa 23-130-linker (3xGGGGS)- aa 148-267), Stalk and Transmembrane: CD8a (Gene Bank AAH25715 aa 138-206), Cytosolic: CD28 (Gene Bank AAA51944 aa 180-220) -4-1BB (Gene Bank AAA53133 aa 214-255)-CD3z (Gene Bank AAH25703 aa 52-164), linker (2xGGS), sfGFP (Gene Bank AVR55105)

Plasmid Gads-mCherry

This study FKBP (Gene Bank AAP36774 aa 1-109), linker (3xGS-G4S2), Gads (AAH26002 aa 1-330), linker (2xGGS), mCherry (AMO27233 aa 1-236)

Protein CD19 (Ex), biotinylated

Sino biological A DNA sequence encoding CD19 (UniProt P15391) aa 1-291 was expressed with a C-terminal polyhistidine tag in HEK293 cells. The purified protein was biotinylated in vitro.

Protein ICAM-1(Ex)-His

Sino biological A DNA sequence encoding ICAM1 (NP_000192.2) aa 1-480 was fused with the a polyhistidine tag at the C-terminus. The gene product was expressed and purified from HEK293 cells.

Antibody Anti-LAT antibody

Cell Signaling Host: Rabbit. Cat #9166s.

Antibody Anti-p150 (glued) antibody

BD Biosciences

Host: Mouse. Cat #612709.



https://doi.org/10.1101/2019.12.19.883496


Antibody IRDye 800 CW goat anti-rabbit

Li-Cor Biosciences

Cat #926-32211.

Antibody IRDye 800CWGoat anti-mouse

Li-Cor Biosciences

Cat #924-32210.

Antibody Anti-pSLP76 antibody

Abcam Rabbit monoclonal [EP2853Y] to SLP76 (phospho Y145). Cat #ab75829.

Antibody Goat anti-Rabbit A647

Molecular Probes

Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647. Cat # A-21244

Antibody Biotin-OKT3 BioLegend Biotin anti-human CD3 Antibody, Cat # 317319

Cell Culture

Jurkat T cell lines were grown in RPMI (Invitrogen) supplemented with 10% FBS (Invitrogen), 1%

PenStrep-Glutamine, and 10 mM HEPES pH 7.4. HEK293T cells (purchased from the ATCC

collection) were grown in DMEM (Invitrogen) supplemented with 10% FBS and 1% PenStrep-

Glutamine.

Lentiviral Product and Generation of Stable Expressing Jurkat Cell Lines

HEK293T cells were co-transfected with the pHR transfer plasmids with second generation

packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) using

Lipofectamine LTX Reagent (ThermoFisher). 48 hr after plasmid transfection, cell culture media

containing virus particles were harvested, centrifuged and filtered through 0.45 µm pore size filter,

and mixed with Jurkat cells for infection in RPMI media for 72 hr. Jurkat cells expressing

fluorescent proteins were FACS sorted to generate a stable and homogenous expression

population.

Primary T Cell Gene Editing

T cell editing was performed according to published protocols21,22. Briefly, peripheral blood

mononuclear cells (PBMCs) were isolated from healthy donors (Trima Apheresis, Blood Centers

of the Pacific) by Ficoll centrifugation with SepMate tubes (STEMCELL Technologies). Bulk T

cells were isolated from PBMCs using Easysep Human T Cell Isolation Kit (STEMCELL



https://doi.org/10.1101/2019.12.19.883496


Technologies) and activated with Dynabeads Human T-Activator CD3/CD28 (Thermo Fisher

Scientific) at a 1:1 (bead:cell) ratio. Cells were cultured in X-VIVO 15 medium (Lonza Bioscience)

supplemented with 10% fetal bovine serum (FBS), 50 μM 2-mercaptoethanol (Thermo Fisher

Scientific), 10 mM N-acetyl L-cystine (Sigma), 500 U/ml Interleukin-2 (IL-2, Aldesleukin Proleukin,

Novartis), 5 ng/ml IL-7 and 5 ng/ml IL-15 (R&D Systems).

24 hr after activation, 10 μL of concentrated lentivirus was added per ml of T cells. Lentivirus was

produced as previously described22. Briefly, 293T cells were transfected with transfer plasmid,

pMD2.G and psPAX2 (Addgene) using FugeneHD transfection reagent (Promega Corporation).

24 hr later, Viral Boost reagent #VB100 (Alstem) was added according to the manufacturer’s

protocol. Viral supernatant was collected 48 hr after transfection and concentrated 100x using

lentivirus precipitation solution #VC100 (Alstem).

48 hr after transduction, culture was washed, Dynabeads were removed and T cells were counted.

Ribonucleoproteins (RNPs) were produced as previously described (Roth et al., Nature 2018).

Briefly, crRNA and tracrRNA (Dharmacon) were resuspended at a concentration of 160 μM in

nuclease-free duplex buffer (IDT), mixed 1:1 by volume and incubated for 30 min at 37° C to form

the gRNA. Poly-L-glutamic acid (PGA) sodium salt (Sigma, stock 100 mg/ml) and recombinant

Cas9 (Macrolab UC, stock 40 μM) were added as previously described (0.72:1 by volume for PGA

vs gRNA and 2:1 by volume for Cas9 vs gRNA)23 and incubated at 37° C for 15 min to form RNP

complex.

Prior to electroporation, T cells were centrifuged for 10 min at 90x g and resuspended in

electroporation buffer P3 (Lonza) at a concentration of 750,000 cells/ 20 μL. 750,000 cells per

well were mixed with 6 μL of RNP per well and electroporated in a 96-well electroporation plate

(Lonza) using electroporation code EH115 on a 4D Nucleofector system with 96-well shuttle

(Lonza). Immediately after electroporation, 80 μL of pre-warmed media without cytokines were

added per well and cells were incubated in the electroporation plate at 37° C. After 15 min, cells



https://doi.org/10.1101/2019.12.19.883496


were moved to final culture vessels. Following electroporation, T cells were cultured in media

without IL-7 and -15 (only IL-2) and split every two days.

LAT gRNA sequence: TTTACCAGTTTGTATCCAAG (from Brunello sgRNA library, Doench et al.,

Nature Biotechnology 2016).

psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260 ;

RRID:Addgene_12260). pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ;

http://n2t.net/addgene:12259 ; RRID:Addgene_12259).

Preparation of Supported Lipid Bilayer

Lipid mixture were prepared with 97.5% POPC, 2.0% DGS-NGA-Ni, 0.5% PEG5000-PE, and less

than 0.1% Biotin-Cap-PE. Lipids were dissolved in chloroform in glass tubes, and dried under a

stream of argon gas followed by further drying in the vacuum for 2 hr. The dried lipid films were

then hydrated with PBS pH 7.4 (invitrogen). The small unilamellar vesicles (SUVs) were produced

by twenty freeze-thaw cycles (-80ºC and 37ºC) and collected as the supernatant after centrifuge

at 53,000x g for 45 min at 4ºC. SUVs were stored at 4ºC and used within 2 weeks.

Glass coverslip (Ibidi Cat#10812) were RCA-cleaned followed by extensive washing with pure

water, and dried with nitrogen. PDMS (Dow Corning) wells were made by preparing PDMS

substrate mixtures according to the manufacturer's instructions and casting the PDMS mixtures

into laser-cut acrylic mold. To build supported lipid bilayer, PDMS wells and glass coverslips were

cleaned with plasma in a Harrick Plasma cleaner before assembling them into glass-bottomed

PDMS chambers. SUV suspensions were then deposited in each chamber and allows to form for

1 hr. After 1 hr, wells were washed extensively with PBS, and functionalized by incubation for 1

hr with proteins as designated.

All the following lipids were purchased from Avanti Polar Lipids: 16:0-18:1 POPC 1-palmitoyl-2-

oleoyl-sn-glycero-3-phosphocholine (POPC; Cat #850457), 18:0 PEG5000 PE 1,2-distearoyl-sn-



https://doi.org/10.1101/2019.12.19.883496


glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-5000] (ammonium salt) (PE-

PEG5000; Cat #880220), 18:1 DGS-NTA (Ni+2) 1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-

carboxypentyl)iminodiacetic acid)succinyl] (nickel salt) (Ni2+-NTA-DOGS; Cat#790404), 1,2-

dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(cap biotinyl) (sodium salt) (Biotin-Cap-PE; Cat

#870277).

IL-2 Production

Raji B cells were co-cultured at a 1:1 ratio with Jurkat CAR T cells in RPMI medium supplemented

with 20 mM HEPES-Na+, pH7.4 for 24 hours at 37ºC. Supernatant was collected for IL-2

measurement using an ELISA kit (BioLegend #431801).

Cell Conjugation Assay

Raji B or K562 cells expressing a membrane marker mCherry-CAAX were co-cultured at a 1:1

ratio with Jurkat CAR T cells in RPMI medium supplemented with 20 mM HEPES-Na+, pH7.4 for

1 hr at 37ºC. Cells were fixed in 1.6% paraformaldehyde for 15 min at RT, washed, and

resuspended in RPMI medium supplemented with 20 mM HEPES and imaged by confocal

microscopy.

Imaging Setup

Imaging was performed on a Nikon TI-E microscope equipped with a Nikon 100× Plan Apo 1.49

NA oil immersion objective, four laser lines (405, 488, 561, and 640 nm), a Hamamatsu Flash 4.0,

and μManager software. A polarizing filter was placed in the excitation laser path to polarize the

light perpendicular to the plane of incidence. The angle of illumination was controlled with either

a standard Nikon TIRF motorized positioner or a mirror moved by a motorized actuator (CMA-

25CCCL; Newport). Data collection was performed at 37ºC for the experiments involving live cells,

and at room temperature for the rest non-cell experiments. Before imaging, cells were pelleted,



https://doi.org/10.1101/2019.12.19.883496


washed, and resuspended in the imaging buffer containing 20 mM HEPES pH 7.4, 1 mM CaCl2,

135 mM NaCl, 0.5 mM MgCl2, 4 mM KCl, and 10 mM glucose.

Image Analysis

Images were analyzed using Fiji. The same brightness and contrast were applied to images within

the same panels. To quantify the clustering levels (as shown in Figure 2B and 3B), a uniform cell-

sized circular region of interest (ROI) that is of 10 µm in diameter was manually placed over the

region of cell fluorescence. The average and the standard deviation of fluorescence intensity

inside the ROI was measured respectively, and the normalized variance, i.e. the ratio of the

standard deviation fluorescence intensity divided by the average fluorescence intensity, was used

to indicate the dispersive distribution of fluorescence intensity for each cell. To quantify pSLP76

levels by immunofluorescence (Figure 3B and 4C) or Gads recruitment (Figure 3A), a uniform

cell-sized circular ROI that is of 10 µm in diameter was manually placed over the region of cell

fluorescence, and the fluorescence intensity of the channel of interest inside that ROI was

measured.

Immunoblotting

Cells were washed twice in cold PBS and lysed on ice for 15 min in lysis buffer containing 50 mM

Tris, 150 mM NaCl, 0.1% (w/v) SDS, 0.5% (w/v) sodium deoxycholate, 1% (v/v) TritonX-100, pH

7.5 supplemented with protease inhibitor cocktail (Roche) and benzonase (Novagen). Cell lysates

were then centrifuged at 21,000 xg for 20 min at 4°C. The supernatants were processed for SDS-

PAGE and immunoblotting with standard procedure. Immunoblots were visualized using Odyssey

Fc Imager (LI- COR Biosciences) at 800 nm channel, and quantified using the gel analysis

function in Fiji.

Immunofluorescence

Cells were activated on supported lipid bilayers in the imaging buffer (see section “Imaging Setup”

for formula) for 30 min at 37ºC, and fixed by adding PFA to a final concentration of 3.2% (v/v) and



https://doi.org/10.1101/2019.12.19.883496


incubating at room temperature for 15 min. Cells were then washed twice with PBS, permeabilized

with methanol at 4ºC for 10 min. Then cells were blocked with PBS containing 0.1% (v/v) tween20,

1% (w/v) BSA, and 22.5 mg/mL glycine for one hour, and incubated with the primary antibody in

the same buffer overnight. The next day, cells were washed three times with PBS, incubated with

buffer containing Alexa-647 conjugated secondary antibody for 1 hour. Excess antibodies were

washed away before proceeding to image acquisition.



https://doi.org/10.1101/2019.12.19.883496


References

1 Ghobadi, A. Chimeric antigen receptor T cell therapy for non-Hodgkin lymphoma. Curr Res Transl Med 66, 43-49, doi:10.1016/j.retram.2018.03.005 (2018).

2 Lee, D. W. et al. T cells expressing CD19 chimeric antigen receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 dose-escalation trial. Lancet 385, 517-528, doi:10.1016/S0140-6736(14)61403-3 (2015).

3 Porter, D. L., Levine, B. L., Kalos, M., Bagg, A. & June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. N Engl J Med 365, 725-733, doi:10.1056/NEJMoa1103849 (2011).

4 June, C. H. & Sadelain, M. Chimeric Antigen Receptor Therapy. N Engl J Med 379, 64-73, doi:10.1056/NEJMra1706169 (2018).

5 Lim, W. A. & June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell 168, 724-740, doi:10.1016/j.cell.2017.01.016 (2017).

6 Davenport, A. J. et al. Chimeric antigen receptor T cells form nonclassical and potent immune synapses driving rapid cytotoxicity. Proceedings of the National Academy of Sciences of the United States of America 115, E2068-E2076, doi:10.1073/pnas.1716266115 (2018).

7 Xhangolli, I. et al. Single-cell Analysis of CAR-T Cell Activation Reveals A Mixed TH1/TH2 Response Independent of Differentiation. Genomics Proteomics Bioinformatics 17, 129-139, doi:10.1016/j.gpb.2019.03.002 (2019).

8 Valvo, S. et al. Comprehensive Analysis of Immunological Synapse Phenotypes Using Supported Lipid Bilayers. Methods in molecular biology 1584, 423-441, doi:10.1007/978-1-4939-6881-7_26 (2017).

9 Bunnell, S. C. et al. T cell receptor ligation induces the formation of dynamically regulated signaling assemblies. J Cell Biol 158, 1263-1275, doi:10.1083/jcb.200203043 (2002).

10 Varma, R., Campi, G., Yokosuka, T., Saito, T. & Dustin, M. L. T cell receptor-proximal signals are sustained in peripheral microclusters and terminated in the central supramolecular activation cluster. Immunity 25, 117-127, doi:10.1016/j.immuni.2006.04.010 (2006).

11 Grakoui, A. et al. The immunological synapse: a molecular machine controlling T cell activation. Science 285, 221-227 (1999).

12 Zhang, W., Sloan-Lancaster, J., Kitchen, J., Trible, R. P. & Samelson, L. E. LAT: the ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation. Cell 92, 83-92, doi:10.1016/s0092-8674(00)80901-0 (1998).

13 Su, X. et al. Phase separation of signaling molecules promotes T cell receptor signal transduction. Science 352, 595-599, doi:10.1126/science.aad9964 (2016).

14 Barda-Saad, M. et al. Dynamic molecular interactions linking the T cell antigen receptor to the actin cytoskeleton. Nat Immunol 6, 80-89, doi:10.1038/ni1143 (2005).

15 Finco, T. S., Kadlecek, T., Zhang, W., Samelson, L. E. & Weiss, A. LAT is required for TCR-mediated activation of PLCgamma1 and the Ras pathway. Immunity 9, 617-626, doi:10.1016/s1074-7613(00)80659-7 (1998).



https://doi.org/10.1101/2019.12.19.883496


16 Bunnell, S. C., Kapoor, V., Trible, R. P., Zhang, W. & Samelson, L. E. Dynamic actin polymerization drives T cell receptor-induced spreading: a role for the signal transduction adaptor LAT. Immunity 14, 315-329, doi:10.1016/s1074-7613(01)00112-1 (2001).

17 Liu, S. K., Fang, N., Koretzky, G. A. & McGlade, C. J. The hematopoietic-specific adaptor protein gads functions in T-cell signaling via interactions with the SLP-76 and LAT adaptors. Curr Biol 9, 67-75, doi:10.1016/s0960-9822(99)80017-7 (1999).

18 Wunderlich, L., Farago, A., Downward, J. & Buday, L. Association of Nck with tyrosine-phosphorylated SLP-76 in activated T lymphocytes. Eur J Immunol 29, 1068-1075, doi:10.1002/(SICI)1521-4141(199904)29:04<1068::AID-IMMU1068>3.0.CO;2-P (1999).

19 Oancea, E. & Meyer, T. Protein kinase C as a molecular machine for decoding calcium and diacylglycerol signals. Cell 95, 307-318 (1998).

20 Bartelt, R. R., Cruz-Orcutt, N., Collins, M. & Houtman, J. C. Comparison of T cell receptor-induced proximal signaling and downstream functions in immortalized and primary T cells. PLoS One 4, e5430, doi:10.1371/journal.pone.0005430 (2009).

21 Schumann, K. et al. Generation of knock-in primary human T cells using Cas9 ribonucleoproteins. Proc Natl Acad Sci U S A 112, 10437-10442, doi:10.1073/pnas.1512503112 (2015).

22 Shifrut, E. et al. Genome-wide CRISPR Screens in Primary Human T Cells Reveal Key Regulators of Immune Function. Cell 175, 1958-1971 e1915, doi:10.1016/j.cell.2018.10.024 (2018).

23 Nguyen, D. N. et al. Polymer-stabilized Cas9 nanoparticles and modified repair templates increase genome editing efficiency. Nat Biotechnol, doi:10.1038/s41587-019-0325-6 (2019).



https://doi.org/10.1101/2019.12.19.883496


rewired signaling network in t cells expressing the ... · 12/19/2019 · a better understanding...

Documents