reverse transcriptase and reverse splicing activities encoded by the mobile group ii intron cobi1 of...

Reverse Transcriptase and Reverse Splicing ActivitiesEncoded by the Mobile Group II Intron COB I1 ofFission Yeast Mitochondrial DNA

Bernd Schafer1*, Lin Gan1 and Philip S. Perlman2

1Department of Biology IV(Microbiology), AachenTechnical UniversityWorringer Weg, D-52056Aachen, Germany

2Department of MolecularBiology, University of TexasSouthwestern Medical Center5323 Harry Hines Blvd, DallasTX 75390-9148, USA

Mobile group II introns encode multidomain proteins with maturaseactivity involved in splicing and reverse transcriptase (RT) and (often)endonuclease activities involved in intron mobility. These activities arepresent in a ribonucleoprotein complex that contains the excised intronRNA and the intron-encoded protein. Here, we report biochemical studiesof the protein encoded by the group IIA1 intron in the cob gene of fissionyeast Schizosaccharomyces pombe mitochondria (cob I1). RNP particle frac-tions from the wild-type fission yeast strain with cob I1 in its mtDNAhave RT activity even without adding an exogenous primer. Characteri-zation of the cDNA products of such reactions showed a strong preferencefor excised intron RNA as template. Two main regions for initiation ofcDNA synthesis were mapped within the intron, one near the DIVa puta-tive high-affinity binding site for the intron-encoded protein and theother near domain VI. Adding exogenous primers complementary to cobexon 2 sequences near the intron/exon boundary stimulated RT activitybut mainly for pre-mRNA rather than mRNA templates. Further in vitroexperiments demonstrated that cob I1 RNA in RNP particle fractions canreverse splice into double-stranded DNA substrates containing the intronhoming site. Target DNA primed reverse transcription was not detectedunless a DNA target was used that was already nicked in the antisensestrand of exon 2. This study shows that S. pombe cob I1 encodes RNP par-ticles that have most of the biochemical activities needed for it to be aretroelement. Interestingly, it appears to lack an endonuclease activity,suggesting that the active homing exhibited by this intron in crosses maydiffer somewhat from that of the better-characterized introns.

q 2003 Elsevier Science Ltd. All rights reserved

Keywords: fission yeast mitochondria; group II intron; retrohoming;reverse transcription; reverse splicing*Corresponding author

Introduction

Reverse transcriptases (RT) are involved invarious genetic phenomena. Phylogenetic compari-sons of RT sequences reveal strong similarities,with seven highly conserved sequences,1 whichare present in long terminal repeat (LTR) retro-posons, non-LTR retroposons, telomerases, pro-karyotic retrons, mitochondrial plasmids and

group II introns.2 Nearly all group II intron-encoded proteins are closely related and themajority of each protein is encoded within domainIV of the intron RNA.3,4 These proteins usuallycontain amino acid sequences that are closelyrelated to (i) RTs,5 (ii) a family of RNA maturases6

and (iii) HNH endonucleases.7

Studies of the homing mechanisms of two bakersyeast group II introns (aI1 and aI2) and theLactococcus lactis group II intron Ll.LtrB showedthat group II intron mobility can be achieved bydistinguishable pathways that may coexist.8 Theintron-encoded protein (IEP) first binds to theunspliced precursor RNA forming a ribonucleo-protein (RNP) particle. It promotes splicing of theintron RNA and remains bound to the excised

0022-2836/03/$ - see front matter q 2003 Elsevier Science Ltd. All rights reserved

E-mail address of the corresponding author:[email protected]

Abbreviations used: RT, reverse transcriptase; TPRT,target DNA-primed reverse transcription; IEP, intron-encoded protein; RNP, ribonucleoprotein; AMV, avianmyeloblastosis virus.

doi:10.1016/S0022-2836(03)00441-8 J. Mol. Biol. (2003) 329, 191–206

intron RNA lariat. In a homing cross, the DNAtarget is apparently first engaged by the DNA-binding domain of the IEP and sense strand of thetarget site is cleaved by partial or complete reversesplicing of the intron RNA followed by cleavage ofthe antisense strand downstream from the introninsertion site by the endonuclease activity of theIEP.9 In a reaction known as target DNA-primedreverse transcription (TPRT), the 30-end of thecleaved antisense strand serves as the primingsite for first-strand cDNA synthesis.9 – 12 Finally,completion of the intron integration process isaccomplished by one or more of several repair orrecombination mechanisms using partial or full-length cDNA.3,8,13

Four different reverse transcriptase assays havebeen described using RNP fractions enriched fromlysates of bakers yeast (S. cerevisiae) mitochondriaby centrifugation through a sucrose cushion.Similar assays have been used with similarlyenriched RNP particles from Escherichia coli cellsexpressing the Lactococcus intron, but most of thepublished experiments for that system used RNPparticles that were reconstituted from recombinantprotein and self-spliced intron RNA lariat.14 The“endogenous assay” measures cDNA synthesisusing endogenous RNA templates present inthe RNP fraction.10 Although the wild-type aI1-encoded and aI2-encoded proteins are readilyrecovered in RNP particle fractions that haveother relevant activities, aI1 lacks this endogenousRT activity completely13 and aI2 has a very lowlevel of activity;10,15 however, aI2 RNP particlefractions from several mutant strains exhibitsubstantial endogenous RT activity.16 – 18

The P714T mutation of aI2 alters an amino acidat the boundary between the non-conserved Ddomain and the conserved En domain of the aI2open reading frame.15 That mutation does notinhibit splicing but reduces the level of homing tovarious degrees, depending on the recipient alleleused.8,15 Studies with RNP particles from P714Tmutant strains and an optimal DNA substrateshowed that the P714T mutation partially inhibitsthe reverse splicing and antisense strand cleavageactivities.8 By an unknown mechanism, it stronglyactivates the endogenous RT activity; the maintemplate used in that reaction is intron RNA anda minor template is pre-mRNA. Mapped initiationsites are clustered in two main areas; around DVIon intron RNA and within exon 3 on pre-mRNA.10

This observation, together with the finding thatdeletion of domain V from the intron RNA stimu-lates this activity, suggests that altered RNA–protein interactions lead to alternative primingmodes for the RT.18

Three other RT assays are useful with one orboth of the S. cerevisiae introns. In the exogenoussubstrate assay, the endogenous RNAs in RNPparticle fractions are degraded with RNase A andreplaced by an oligo(dT)-primed poly(rA) sub-strate; various aI2 alleles have substantial activitybut there is no activity for any aI1 strain tested.17,19

The TPRT assay involves coupling the reversesplicing and endonuclease activities to the RTactivity so that the cleaved antisense strand of aDNA substrate primes cDNA synthesis; both aI1and aI2 are active in this assay.11,19 Finally, aprimer-dependent RT assay is effective for bothof those introns (our unpublished results).17 Here,added oligonucleotides complementary to intronand flanking exon sequences in endogenous RNAsprime cDNA synthesis, but the most active primersmimic the 30-end of the cleaved antisense strand.

The mitochondrial introns aI1 and aI2 of bakersyeast and the Lactococcus LtrB intron are the mostextensively studied mobile group II introns, butthey represent a small minority of the group IIintrons identified in nature. Although studies ofthe budding yeast group II introns helped to illu-minate details of the homing mechanism, thosetwo introns are related rather closely and havevery similar homing pathways; as noted above,however, their RT activities differ somewhat.Comparing research on homing mechanisms byaI1, aI2 and the Lactococcus intron, it is evidentthat initial steps of retrohoming are highly con-served but downstream steps can vary consider-ably from intron to intron, and even for a givenintron when different target sites or intron allelesare compared.

Here, we introduce fission yeast Schizosaccharomycespombe (S. pombe) as a new system for investigatinghoming mechanisms of mitochondrial group IIintrons. Mitochondria of S. pombe strains containsmall genomes with sizes ranging from 17.4 kb to25 kb.20 Most of that variation is due to differentnumbers of group I and group II introns. A screenfor the distribution of mitochondrial introns in thespecies identified group II introns in alleles of thecox1, cox2 and cob genes. All three group II introns,cox1 I1a, cox2 I1 and cob I1, belong to the A1 sub-group but are otherwise related only distantly.4,21–23

The 2526 bp group IIA1 intron in the cob gene wasfirst identified in strain 50 from the Leupoldcollection24 and it does not self-splice in vitro.21

The intron is mobile in crosses25 and exhibitsectopic homing.26

Here, we report initial biochemical characteri-zation of the protein encoded by the cob intron.Our findings show that this intron encodes RNPparticles that have most of the biochemical activi-ties needed for it to be a retroelement resemblingother mobile group II introns. Interestingly, theRNP particles appear to lack an endonucleaseactivity, suggesting that the very active homingmechanism used by this intron may differ some-what from that of the better-characterized introns.

Results

RNP particle fractions fromS. pombe mitochondria

cob I1 of S. pombe mtDNA contains a long open

192 S. pombe RT and Reverse Splicing Activities

reading frame that encodes a protein with aminoacid segments related to reverse transcriptase,maturase and endonuclease domains of othergroup II introns. As indicated in Figure 1, theprotein appears to be translated from the cob pre-mRNA, starting from the AUG start codon of cobexon 1 and terminating at the UAG stop codonnear the end of the intron. Although the proteinsencoded by introns aI1 and aI2 of budding yeastappear to be translated as pre-proteins that areprocessed subsequently to make the active protein,we do not know whether the S. pombe cob I1 proteinis processed.

To learn whether the protein encoded by theS. pombe cob I1 has activities that may relate to thehoming mechanism used by this intron in vivo, weanalyzed extracts of S. pombe mitochondria fromstrain R10, which has cob I1 as the only group IIintron in its mtDNA.21 Extracts from three otherstrains were analyzed as controls: strain P3 has afunctional mtDNA but lacks all mitochondrialintrons; strain 6G6r8 is a respiration-deficientderivative of strain P3 that lacks all mtDNAsequences; and strain R10/5 is blocked for splicingof cob I1 due to a mutation at nucleotide 2734 thatchanges a proline residue near the end of thematurase domain to serine.21,27

Procedures for preparing active RNP particlefractions from flotation-purified mitochondriafrom budding yeast10 (see Materials and Methods)were suitable for obtaining active RNP particlepreparations from glucose cultures of S. pombestrain R10. RNA blot experiments showed thatsedimenting mitochondrial lysates through a1.85 M sucrose cushion containing 0.5 M KCl(and 25 mM CaCl2) yields RNP particle fractionsthat contained essentially all cob gene transcriptsfrom strains R10, P3 and R10/5 (Figure 2(a)); asexpected strain 6G6r8 yielded no signal in theseexperiments (not shown). In addition to cob intronRNP particles, these fractions contained a high

proportion of mitochondrial ribosome subunitsand other mt-mRNAs.

Northern blot experiments estimated the relativeamounts of the various cob transcripts in these frac-tions (Figure 2(a)). Hybridizations with probescomplementary to cob exons 1 and 2 show that themain cob transcript in strain R10 is the splicedmRNA (1164 nt) (Figure 2(a), lanes 4 and 7); thereis about eight times more cob mRNA than pre-mRNA (3690 nt). The intron probe shows that thisfraction contains approximately ten times moreexcised intron RNA (2526 nt) than unspliced cobpre-mRNA (lane 1). The intron signal is often thedoublet seen here; on the basis of similar obser-vations in the budding yeast system, those bandsare probably intact and broken lariat. These dataindicate that mRNA is somewhat more abundantthan is the lariat RNA. Growing strain R10 in raffi-nose medium increases the extent of splicing sothat pre-mRNA is barely detected (not shown).

The mutant strain R10/5 has only pre-mRNAusing all three probes (lanes 2, 5 and 8). RNAblots of several preparations of RNA from strainR10/5 indicate that it has a lower level of cob pre-mRNA relative to other transcripts than does thewild-type strain. The intronless strain P3 hasexclusively cob mRNA, as expected (lanes 6 and9). Primer extension analysis shows that the largercob RNA present in RNA from strain P3 (Figure2(a), lanes 6 and 9, arrow) is cob mRNA with a 50

extension that contains a tRNA (B.S. et al., unpub-lished results).

Reverse transcriptase activity of cob I1RNP particles

These RNP particle fractions were found tohave RT activity using the endogenous templateassay (without added primer). Incorporation of[a-32P]dGTP into cDNA was evident using RNPpreparations from strain R10, but not with RNP

Figure 1. Organization of the cobgene of fission yeast mtDNA.The cob gene of S. pombe mtDNAcontains two exons and one largegroup II intron. The intron containsa long open reading frame that isin-frame with the first exon of thegene. The intron-encoded proteinappears to be translated from thepre-mRNA. Beginning around themiddle of the 1036 amino acid resi-due protein are four domains thatare shared with most other proteinsencoded by group II introns: RT,X, D and En46 are associated withreverse transcriptase, maturase,DNA binding and DNA endo-nuclease activities, respectively.The intron has a recognizable DIVasubstructure near the 50 boundaryof DIV, as indicated.

S. pombe RT and Reverse Splicing Activities 193

particles from the negative control strains 6G6r8and P3 (Table 1, first data column). The value forthe maturase mutant, strain R10/5, is not signifi-cantly higher than the negative controls, but mayreflect a very low level of RT activity. This incorpor-ation was insensitive to actinomycin C (up to150 mg/ml) but was inhibited strongly by pre-treat-

ment of RNP particles with RNase A plus RNaseT1, by adding EDTA and by the absence of dNTPs(not shown). Electrophoresis of the cDNA productsin non-denaturing gels so that the cDNAs remainannealed to their RNA templates yields a broadband migrating more slowly than the 3.6 kb pre-mRNA (Figure 2(b), lane 3). Treatment with

Table 1. RT assays using mtRNP particle fractions from fission yeast strains

Incorporation (cpm ^ SD)RNP sample No primer cob E2(þ10) primer cob E2(þ10) primer þ AMV RT

None 2709 ^ 832 2499 ^ 281 2341 ^ 3426G6r8 3245 ^ 544 3163 ^ 643 3011 ^ 389P3 (no intron) 2993 ^ 721 3106 ^ 471 289,711 ^ 15,423R10 (cob I1) 15,130 ^ 3874 132,016 ^ 19,913 373,589 ^ 12,008R10/5 (maturase mutant) 3876 ^ 299 4207 ^ 1196 65,296 ^ 9908

All assays were carried out with 0.025 A260 unit of mtRNP particles, as described in Materials and Methods. All RT activities are themean ^ standard error for three (lines 1–4) or five (lines 5 and 6) determinations.

Figure 2. Analysis of transcriptsin RNP particle fractions. (a) RNAblot analysis of cob transcripts inRNP particle fractions. Shown areNorthern blots of RNA from RNPparticle preparations from strainsR10 (lanes 1, 4 and 7), R10/5 (lanes2, 5 and 8) and P3 (lanes 3, 6 and 9)using probes complementary tocob I1 (lanes 1–3), cob exon 1 (lanes4–6) and cob exon 2 (lanes 7–9).The locations of the major tran-scripts are indicated: splicedmRNA (1164 nt), excised intronRNA (2526 nt) and pre-mRNA(3690 nt). The arrow alongside lane9 denotes the intronless cob mRNAcontaining a 50 extension. (b) Identi-fication of template* used for endo-genous and primer-stimulated RTreactions. The RT reactions werecarried out with 0.025 A260 units ofRNP particles from strain R10 inthe absence of any primer (lanes3 and 4) or in the presence of25 pmol of the DNA primercob E2(þ10) (lanes 5 and 6). Thetwo lanes on the left show Northernhybridizations of RNA extractedfrom RNP preparations from strainR10, hybridized with probes cobexon 2 (lane 1) and cob I1 (lane 2).Lanes 7 and 8 show products ofreactions in which one unit ofAMV RT (Promega) was addedafter addition of primer cob E2(þ10).The numbers on the right indicatethe locations of RNA molecularmass markers (Roche). Samples inlanes 4, 6 and 8 were treated afterthe reaction with RNase H todegrade the RNA template.


RNase H to remove the RNA template shifts thesignal to lower molecular mass (about 700–1000 ntlong, based on glyoxylated RNAs run as markers)(Figure 2(b), lane 4). These data indicate that theendogenous template is a large mitochondrialRNA and that mostly partial cDNA copies aremade under these in vitro conditions. It willbecome evident below that all of the templatesused for cDNA synthesis are cob gene transcriptsand that the main template in the unprimedreaction is the excised intron RNA.

Next, we determined whether this RT activity isstimulated by added oligonucleotide primers.On the basis of findings with aI2,28 we first used a30 nt long primer complementary to a site begin-ning at position þ10 in cob exon 2 (oligocob E2(þ10)) plus the other constituents needed forthe primer-independent activity. As shown inTable 1 (middle column), adding the primerincreased the level of incorporation by nearly nine-fold for mtRNP particle fractions from strain R10.RNP fractions from the r8 and intronless strainsserved as negative controls for this assay. Thematurase domain mutation inhibited RT activitysubstantially in this assay, though a low level ofactivity may be present.

As controls, we found that adding avian myelo-blastosis virus (AMV) RT to primed reactions withRNP particles from strains P3, R10 and R10/5supports robust cDNA synthesis. These resultsshow that each sample contains cob gene tran-scripts that can anneal to the added primer underthese conditions and that the primed template isaccessible to the added AMV RT. The AMV RTreactions with RNP particles from strain R10/5consistently yielded much less incorporation thanwas obtained from the same amount of materialfrom strains P3 and R10. This probably reflects thefinding noted above, that strain R10/5 has areduced level of cob pre-mRNA. This interpretationis supported by the finding that AMV RT reactionsusing a cox2 exon primer yielded comparableincorporation using RNP particle fractions fromall three strains.

On non-denaturing gels, the primed cDNA pro-ducts were mainly a doublet migrating moreslowly than the pre-mRNA; there was a minorband slightly larger than the cob mRNA that wasnot evident in the unprimed reactions (Figure 2(b),lane 5). Treatment of these cDNAs with RNase H(lanes 6 and 8) increased its mobility, showing thatthis activity makes fairly long cDNAs (,1000 nt),but not full-length. Comparing the distributions ofcDNA sizes in lanes 4 and 6, it appears that theprimed activity produces somewhat longercDNAs than does the unprimed activity.

Products of primed AMV RT reactions (lane 7)were rather different from those in lane 5. There isa prominent large band, a broad band around 3 kblong (instead of ,3.5 kb as in lane 5) and a doubletsignal between the 0.58 kb and 1.05 kb markers;some signal slightly larger than the pre-mRNAis present, as in lane 5. Treatment of the AMV RT

products with RNase H (lane 8) shows that AMVRT makes much shorter cDNAs than does theS. pombe enzyme. This observation probablyexplains the different mobilities of the largecDNA/template RNA complexes in lanes 5 and 7.Because the band of high molecular mass materialin lanes 3 and 7 is not shifted by treatment withRNase H, we conclude that it is mtDNA that wascopied by the AMV RT (and, to a lesser extent,by the cob I1 RT). AMV and MMLV RTs are knownto have some DNA-directed DNA polymeraseactivity.29 The small products between the 0.58 and1.05 kb marker bands appear to be cDNAs madefrom a cob E2-containing transcript that wasdetected on the RNA blots (Figure 2(a), lanes 7and 8; Figure 2(b), lane 1). It is curious that cobmRNA is not the main template in the primedAMV RT reactions; in the analogous experimentfor aI2, the mRNA was the main template used byMMLV RT used there.17

Optimization of reaction conditions forassaying the cob I1 reversetranscriptase activity

We optimized both RT assays for Mg2þ and KClconcentration, pH and temperature (not shown).Both assays have optimal activity with 8–14 mMMg2þ, though the endogenous activity remainsoptimal in the presence of Mg2þ at concentrationsas high as 30 mM. The concentration of KCl hadlittle effect on either activity up to 300 mM. Bothactivities were optimal between pH 8.0 and 9.5with much less activity at other values. Finally,both RT activities were high from 28–42 8C, withsignificant activity remaining even at 20 8C and50 8C. Except as noted, we carried out further RTassays at 37 8C in 50 mM Tris–HCl (pH 9.0),100 mM KCl, 8 mM MgCl2.

Effects of primer location on reversetranscriptase activity

In the bakers yeast system, the location of theprimer on exon or intron RNA influences the levelof primer-stimulated cDNA synthesis strongly.17

Here, we measured the stimulation of RT activityin response to primers complementary to differentsites in the S. pombe cob transcripts (Figure 3).Figure 3(a) shows the locations of the primersused here and Figure 3(b) shows the incorporationlevels in the standard solution containing 2 mM,8 mM or 20 mM MgCl2. The results show thatthere is a strong preference for primers comple-mentary to the exon sequence immediately down-stream from the cob I1 insertion site. All primersannealing there stimulate the level of incorporationsubstantially, with some preference for primercob E2(þ10) over cob E2(0) and cob E2(þ15) at2 mM Mg2þ; that preference largely disappears inreactions with 20 mM Mg2þ. RNP particles fromthis strain have some RT activity in reactions withno primer added (first bar in each set). Compared


with that sample, it is evident that the primersannealing to the exon upstream of the intron(cob E1(210)) and the primer annealing fartherdownstream in exon 2 (cob E2(þ70)) do not stimu-late the RT activity. One primer complementary toan intron sequence (cob I(1)) was inactive and theother intron primer (cob I(2)) stimulated activityonly slightly. Reactions with added AMV RTconfirmed that these sites in cob RNA are accessibleto these primers (Figure 3(b), right).

A strong preference for RNA templatescontaining the cob intron

To identify the RNA templates for cDNA synthe-sis in these RT reactions, we prepared 32P-labelled

cDNAs in RT reactions (with or without primercob E2(þ10)) with mtRNP particles from strain R10and used them as probes of S. pombe mtDNA fromstrains P3 and R10 that had been digested withHincII, HindIII or Eco RV (Figure 4(A) and (B)).The blots show that both reactions make cDNAsthat anneal to Eco RV fragments 4a and 4b fromstrain R10 that contain only cob gene intronsequences (Figure 4(B), lanes 6 and 12). Becauseboth cDNAs hybridize with the cob gene exons inmtDNA of the intronless strain (Figure 4(A), lanes5 and 11), it follows that both cDNA probes containsequences complementary to both exon and intronsequences of the cob gene. These data excludetranscripts of all of the other genes shown in thediagram as having been templates for these

Figure 3. Stimulation of RT activity by oligonucleotide primers. (a) Locations of primers in the S. pombe cob gene. Thelocations of seven primers complementary to various sites in cob gene transcripts are indicated. (b) RT activity. The bargraphs summarize the incorporation of (a-32P)-labelled dGTP into cDNA products in the absence of primer and witheach of seven primers added. Each primer is labelled in the first set of bars and the same shading pattern is retainedin the other three data sets. All reactions contained the same amount of RNP particles from strain R10. Three concen-trations of Mg2þ were analyzed, as indicated. The data set at the right summarizes reactions in reaction buffer contain-ing 8 mM Mg2þ in which AMV RT was added; the AMV reactions incorporate about ten times more radioactivity thando the more active reactions in the other sets. All values are given as the arithmetic mean of duplicate assays and therange of the two measurements is indicated.


cDNAs, with the possible exception of cox3, part ofwhich is present in HindIII fragment 4 from strainR10 (and HindIII fragment 3 from strain P3). With-out primer we could not detect cDNA that containsthe cob 30 exon; for example, the signal for theHincII fragment 5 from strain R10 is only evidentusing the primed cDNA probe. This findingsuggests that unprimed reactions initiate mainlywithin the intron while primed reactions areprimed mainly on pre-mRNA or to some extenton mRNA. Considering the data of Figure 4together with the data of Figure 2(a), which definethe cob transcripts in the strain R10 RNP particlefraction, we conclude that the main template inunprimed reactions is the free intron RNA; pre-mRNA is a template to a lesser extent. In the reac-tions with the E2 primer, the main template is thepre-mRNA and a minor template is the splicedmRNA.

Initiation of reverse transcription withoutadded primer

Next, we localized the start site(s) for the cDNAsmade from intron RNA templates in assays lackingadded primers. To do this, the labelled cDNAswere purified as described in Materials andMethods and used as probes of various PCR-amplified DNAs (see Figure 5(A)). After hybridi-zation, the membranes were dried and the signalswere quantified by phosphorimaging. First, we

used PCR fragments A–D covering the entire cobintron (Figure 5(A) and (B)). The amount of targetDNA in each lane was balanced carefully before-hand and it was verified by control hybridizationsthat each DNA could anneal to the cDNA withequal efficiency under these conditions (notshown). The strongest signals were obtained withfragments A and D (Figure 5(B), lanes 1 and 4),which contain the 50 and 30 ends of the intron,respectively. These data suggest that there are twomain regions where cDNAs are initiated withinthe intron.

Next, we improved the resolution of those twoinitiation sites by hybridizing the cDNA probeswith two sets of smaller PCR fragments, 299–337 bp in length (A1–A5 and D1–D3); in eachgroup, the adjacent fragments overlap by 201–238 bp, as indicated in Figure 5(A). The amount oftarget DNA in each lane was balanced carefullybeforehand, as noted above. As shown in Figure5(C), fragments A2–A5 hybridized about equallybut fragment A1 yielded a 2.2 to 2.8-fold strongersignal. These data show that the strongest primingsite in this region is within the 50 half of fragmentA1. Interestingly, this region contains the DIVa sub-structure that is the putative high-affinity bindingsite for the intron-encoded protein.30 Among tar-gets D1–D3, the signal for D1 was 2.2 to 3.4-foldhigher than for D2 and D3. This fragment containsthe extreme 30-end of the intron, including domainsV and VI. No signal was obtained with a PCR

Figure 4. Identification of template* for cDNA synthesis. cDNAs that were made by cob I1 RNPs either in thepresence of primer cob E(þ10) (lanes 4–6) or in the absence of any exogenous primer (lanes 10–12) were used as probesof Southern blots of mtDNA from the intronless strain P3 (A) or from the cob I1 donor strain R10 (B) digested withHincII (lanes 1, 7), HindIII (lanes 2, 8) and Eco RV (lanes 3 and 9). Below the blots are shown the restriction site mapsfor those three enzymes and the locations of the genes coding for major transcripts.


fragment containing the entire cox2 gene (Figure5(C), lane 6) or with 300 ng of linearized pUC19DNA (lane 10).

Although the intron is 2.5 kb long, we haveshown in Figure 2(b) that most of the cDNAsmade in unprimed reactions are 700–1100 nt long.It follows that initiations near the 30-end of theintron within fragment D1 can explain the cDNAsthat anneal to fragments B and C (Figure 5(B),lanes 2 and 3). However, the downstream end offragment A is separated from fragment D1 by2051 bp so that most of cDNAs hybridizing tofragment A could not have initiated within frag-ment D1. Although there are two main initiationsites, there are probably some weaker initiationsites between fragments D1 and A1; there mayalso be some initiation sites upstream of fragmentA1. Primer extension experiments using thesepurified cDNAs and primers complementary tothem revealed no unique or strongly preferred50-ends of the cDNAs in the A1 and D1 regions(not shown).

cob I1 RNP particle fractions have reversesplicing activity

We next tested whether the cob I1 RNP particlesfrom strain R10 have reverse splicing activity.Aliquots of RNP particle fractions from strain R10were incubated with a 135 bp long internallylabelled double-stranded DNA substrate that con-tains the cob E1–E2 homing site for cob I1 (Figure6(A), substrate 2). The substrate was incubated in areverse splicing reaction using a buffer that issuitable for both RT assays (8 mM Mg2þ and100 mM KCl) and the products were thendenatured by glyoxal treatment as described inMaterials and Methods. The boiled and RNaseA-treated RNP particles yielded no products(Figure 6(B), lanes 2 and 8) while untreated RNPparticles yielded a doublet of products migratingslightly slower than the excised intron lariat(Figure 6(B), lane 5).

Similar experiments in S. cerevisiae yield threeproduct bands. Two lower bands were shown to

Figure 5. Identification of potential start site(s) for cDNAs synthesized in the absence of exogenous primers.(A) Diagram of DNA targets used. The segments of the cob gene shown as black bars (fragments A–D) and grey bars(fragments A1–A5 and D1–D3) were prepared by PCR as described in Materials and Methods. (B) Autoradiogramusing DNA targets A–D. A preparation of labelled cDNA was obtained using RNP particles from strain R10 andpurified as described in Materials and Methods. The cDNA was then hybridized with blots containing PCR-amplifiedDNA fragments A–D (lanes 1–4, respectively). Relevant quantification of results is summarized in the text. (C) Auto-radiogram using DNA targets A1–A5 and D1–D3. To improve the resolution of the two most active initiation sites,the cDNA probe was hybridized with two further sets of PCR fragments (A1–A5 in lanes 1–5 and D1–D3 in lanes7–9). Lane 6 contains a cox2 gene target and lane 10 contains 300 ng of pUC19 DNA.


result from partial reverse-splicing and containdifferent forms of lariat RNA linked to the 30 exonDNA. A third, more slowly migrating, band resultsfrom full reverse-splicing and contains the intronRNA linked to the sense strand of both flankingexons.8,9,19,31 In the original experiments in theS. cerevisiae system, a DNA substrate with shortexons (resembling substrate 2, here) did not permitthe upper product of partial reverse-splicing toresolve clearly from the product of full reverse-splicing.9,31

Later, it was found that using a substrate witha longer upstream exon provided resolution ofall three bands on the same gel system.8 To dis-tinguish the products of partial and full reverse-splicing here, we compared the reverse splicingproducts obtained using analogous alternativesubstrates. If the RNP particle fractions from strainR10 can carry out full reverse-splicing, then sub-strate 3, which has a longer E1 than substrate 2but is the same size as E2 (Figure 6(A)), will yieldan additional slower-moving product. As shownin Figure 6(B), lane 6, substrate 3 yields the samedoublet of products obtained with substrate 2,indicating that those products do not contain E1.Substrate 1 has the same length E1 as does sub-strate 3, but a longer E2 (Figure 6(A)). In reactionsusing substrate 1, both bands of the doublet shifted

(Figure 6(B), lane 4), confirming that they containE2 sequences and establishing that this gel systemcan distinguish reverse splicing products withlonger exons. Because the mobilities of the reversesplicing products respond to the length of E2 butnot to the length of E1, these data show that theseRNP fractions carry out mainly partial reversesplicing. In reactions in the presence of 20 mMMg2þ we observed much less reverse splicingactivity (Figure 6(B), lanes 10–12).

To verify that the intron RNA inserts into theDNA substrate at the E1–E2 junction, we carriedout an RT PCR experiment (Figure 7). To avoidamplifying native cob RNA species present inthese fractions, we constructed a derivative of sub-strate 1 that has the foreign M13 (221) forwardprimer sequence added to the 30-end of the 190 bplong E2 (sequence 3U in Figure 7(A)). After reversesplicing using this double-stranded DNA sub-strate, we used RT PCR to amplify a DNA frag-ment using primers cob I1-13170w and 3U (seeFigure 7(A)) and obtained a product of theexpected length (431 bp) from the reverse splicingreaction (Figure 7(B), lanes 3 and 4) but not fromcontrol samples in which no reverse splicingoccurred (lanes 1 and 2). Sequencing confirmedthat this amplified DNA fragment contains theexpected intron/exon junction. Because the AMV

Figure 6. Reverse splicing of cob I1 RNA into its DNA target site. (A) Three double-stranded DNA substrates used inreverse splicing reactions. The three substrates indicated were prepared by PCR and contained labelled nucleotides atrandom internal positions. Each includes the homing site at the E1–E2 junction (arrow) plus flanking sequences, asindicated. (B) Products of reverse splicing reactions. Boiled RNP particles were used in the reactions of lanes 1–3.Native RNP particles were used in lanes 4–6 and 10–12; RNase A-treated particles were used in lanes 7–9. The sub-strate used and the amount of Mg2þ in the reaction buffer are indicated above each lane. Reverse splicing reactionswere carried out as described in Materials and Methods, glyoxal-treated and analyzed in a 1% agarose gel, whichwas dried and autoradiographed. The locations of the substrate and products of reverse splicing are indicated.


reverse transcriptase has great difficulty readingthrough the branch point that is present in pro-ducts of partial reverse splicing, this RT PCRproduct probably resulted from a minority of thereactions in which the intron RNA carried out fullreverse-splicing.

cob I1 RNP particles lack DNAendonuclease activity

In preliminary TPRT assays we obtained nosignal using a cob E1–E2 fragment cloned inpUC19 as substrate. Because these RNP particleshave both RT and reverse splicing activities, thisnegative result suggested that the cob I1 RNPshave low or no DNA endonuclease activity eventhough the intron open reading frame has a recog-nizable En domain. We next carried out TPRT reac-tions using the short fully duplex DNA substrate 3from Figure 6(A) and another preparation of thatsubstrate assembled from oligonucleotides to havea nick at position þ10 in the antisense strand ofcob E2. As shown in Figure 8, lanes 2 and 3, thenicked substrate supported TPRT activity whilethe fully duplex substrate was inactive. Negativecontrols are standard RT reactions in the absenceof an exogenous primer (lane 1) or in the presenceof the cob E2(þ10) primer (lane 4) and a reactionusing boiled RNPs (lane 6). An aliquot of end-labelled fully duplex substrate and a reversesplicing reaction using it were additional controlsto identify the location of the expected TPRT signal

(lanes 5 and 7, respectively). These data show thatthe cob I1 RNP particles can couple reverse splicingto RT activity, provided that the substrate is alreadynicked in the vicinity of the preferred primer site,and suggest that this intron has a defective Endomain.

Discussion

Previous genetic studies showed that S. pombecob I1 is mobile. In crosses between donor strainR10 and recipient strain P3, cob I1 was insertedat the junction between E1 and E2.25 The overallfrequency of homing by this intron is 70–84%,similar to the 80–90% homing obtained with bothbakers yeast introns.8,13 The domain X mutationin mutant strain R10/5 was found to block bothsplicing and homing, and here we show that itinhibits RT activity significantly. AlthoughRT-independent homing has not been demon-strated for this intron, the efficient recombinationin this organelle system makes it likely that thehoming defect of this strain results mainlyfrom the splicing defect. Because studies of theS. cerevisiae introns show that more than onepathway can contribute to homing in wild-typecrosses,8,13 it will be interesting to find out whichbalance of pathways contributes to the efficienthoming of the S. pombe intron.

It had not been possible to decide whetherS. pombe cob I1 homing events involve reverse

Figure 7. The site of insertion ofthe intron RNA into the DNA sub-strate. (A) The RT PCR strategy.Shown is a diagram of the productof full reverse splicing using RNPparticles from strain R10 and a newDNA substrate containing 149 bpof exon 1 sequence, 190 bp of exon2 sequence and 23 bp of the M13(221) forward primer sequence.Following reverse splicing, oligo-nucleotide c30-U, complementary tothe sense strand of the M13sequence, will prime cDNAs thatcontain the 190 nt of exon 2. Addingprimer cob I-13170w, complementaryto nucleotides 13164–13186 of theantisense strand of the intron,permits amplification of a 431 bplong double-stranded DNA fromfull-reverse-spliced product. Thesetwo primers will not yield anyamplified product from substratemolecules that had not reversespliced or from endogenous tem-plates in the RNP particle fraction(such as pre-mRNA or mtDNA).

(B) The RT PCR products. After the reverse splicing reaction, RT PCR reactions were carried out with the two primersshown in (A) and products were fractionated on a 1% agarose gel alongside bacteriophage lambda DNA sizestandards. Lanes 3 and 4 show the product of the expected size from duplicate complete reactions. No product isobtained in parallel samples lacking the DNA substrate (lane 1) or without preincubation for reverse splicing (lane 2).


transcription because usable flanking markers andother mutations of specific domains of the intronreading frame were not available. As known fromthe budding yeast and Lactococcus systems, groupII intron retrohoming depends on reverse splicing,DNA endonuclease and RT activities, all of whichare present in RNP particles that contain theintron-encoded protein and the excised intronlariat. In this study, we present evidence that cob I1RNP particles have both RT and reverse splicingactivities, showing that the S. pombe intron iscapable of retrohoming. Because the RT activity ofthe wild-type aI1 depends completely on a definedprimer and that of aI2 is very low except with anadded primer, it is noteworthy that the S. pombeintron has substantial RT activity without addedprimers. In bakers yeast, RT activity usingendogenous templates and no added primer ismost evident in several aI2 mutant strains. Usingseveral analyses of these cDNA products weshow that the predominant template for cob I1endogenous cDNA synthesis is the excised intronlariat. Pre-mRNA is present in the RNP particlefractions but is used as template only to a smallextent. The cDNAs made in these assays averageabout 1000 nt long, showing that few or no full-length cDNAs are made under these conditions.

We found two main clusters of initiation siteswithin the intron, though there are probably otherless active sites. One of the preferred initiationregions is near the 50-end of domain IV. In thatpart of DIV, we could identify a DIVa substructuresimilar to that found in the Lactococcus intron. Itmay be meaningful that this location contains the

putative high-affinity binding site for the L. lactisintron-encoded protein;30,32 recent studies showthat the DIVa of budding yeast aI2 is importantfor binding its RT protein (H. R. Huang et al.,unpublished results), so that it is likely that DIVais an important factor for binding each group IIintron-encoded protein to its cognate intron. Theother preferred initiation region is within the 30-end of cob I1, where domains V and VI are located.This finding may mean that the IEP is positionedfor efficient initiation of cDNAs in E2 very nearthe 30-end of the intron. The Lactococcus RT makessecondary binding contacts with domain VI30,33,34

and, if such contacts are general, they may explainthis second cluster of preferred sites for cDNAinitiation by the S. pombe protein.

Adding exogenous primers complementary tovarious positions within the endogenous cobRNAs stimulated the S. pombe cob I1 RT activity.The extent of stimulation was influenced substan-tially by the site where the primer base-pairs withthe template RNA. Oligonucleotides that anneal toexon 2 near the intron/exon 2 border (cob E2(0),cob E2(þ10), cob E2(þ15)) were the most effectivein stimulating RT activity, while primers annealingfarther downstream (cob E2(þ70)), or upstream(cob E1(210)) were much less effective or inactive.This activity is not limited to a single site in E2but the position E2 þ 10 is obviously a preferredsite for the cob I1-encoded protein. The down-stream exon position þ10 for introns aI1 and aI2or þ9 for the L. lactis LtrB intron are the siteswhere the endonuclease cleaves the antisensestrand. All three of those introns have high levels

Figure 8. Analysis of TPRTactivity. TPRT reactions were car-ried out using an unlabelled sampleof double-stranded DNA substrate3 (see Figure 6(A)) (lane 3) or anunlabelled substrate in which theantisense strand contains a nickat E2 þ 10 so as to mimic the pre-dicted endonuclease cleavage pro-duct (lane 2). Negative controls area standard RT reaction in theabsence of an exogenous primer(lane 1) or in the presence of thecob E2(þ10) primer (lane 4) and areaction using boiled RNPs (lane6). An aliquot of end-labelled fullyduplex substrate and a reversesplicing reaction using an internallylabelled version of the same sub-strate were additional controls toidentify the location of the expectedTPRT signal (lanes 5 and 7, respec-tively).


of RT activity using primers that anneal in thatvicinity and, thus, mimic a target site followingcleavage by the endonuclease. Although all of theprimers complementary to sites in the buddingyeast aI2 intron stimulated RT activity, primerscomplementary to several locations in the S. pombecob intron were less active. Finally, primerscomplementary to coding sequences in otherS. pombe mRNAs tested here (cox1 and cox2) didnot support detectable reverse transcription ofthose templates, even though they are presentabundantly in the RNP particle fractions used(and yield a strong cDNA signal using AMV RT).

Unlike retroviral RTs, a common feature of thegroup II intron RTs, and even the related telomer-ase enzyme, is that they bind specifically to theirtemplate RNAs and that interaction helps deter-mine the site of initiation of cDNA synthesis.2,35,36

Southern blots using labelled cDNAs as probes ofmtDNA fragments establish that only cob tran-scripts are copied by the cob I1 RT, with or withoutadded primers. The template and template regionpreferences noted here suggest that cob I1 proteinis already bound to cob pre-mRNA and excisedintron RNA in these RNP particle fractions, andthat the mode of binding to intron sequenceslargely limits the RT to initiate cDNA synthesis ata limited number of sites in the intron when noprimer is added and in E2 of pre-mRNA whensuitable primers are added. Both aI2 and theLactococcus intron have similar primer sitepreferences.17,30 Using the optimal E2 primer ofthose tested, the RT can copy primed cob mRNAs,but only inefficiently, even though they are muchmore abundant than pre-mRNA in these fractions.Reverse transcription of primed mRNA may resultfrom transfer of the protein from RNP particlescontaining the intron RNA to the primed mRNAs.Alternatively, this reaction could entail a ternarycomplex, perhaps resembling the immediateproduct of forward splicing.

The pattern described above was obtained with2 mM and 8 mM Mg2þ in the assay buffer. Thepreference for the E2 þ 10 position and the overalllevel of RT activity were somewhat reduced inreaction buffer containing 20 mM Mg2þ. Theprimer-stimulated activity decreased above 15 mMMg2þ, while the primer-independent activity didnot vary with higher levels of Mg2þ up to 30 mM.Of course, magnesium ions play a number of roleswith these introns: they are cofactors for both theribozyme activity of the intron RNA and for theRT activity of the IEP, and they influence the foldingof the intron RNA.11,37 – 39 Like all of the other groupII intron RNPs studied so far, the concentration ofKCl had little effect on RT activity.10,32 The activityof the cob I1-encoded RT is very pH-sensitive andis comparably active over a broad temperaturerange from 28–42 8C.

Experiments with double-stranded DNA sub-strates that contain the cob E1–E2 cDNA sequenceestablish that cob I1 RNP particles have reversesplicing activity. Comparing the products obtained

using two substrates with different length of E1sequences, we found that most of the reaction isjust the first step of reverse splicing (“partialreverse splicing”) in which the intron lariat isjoined to E2 of the sense strand but not to E1.Sequencing of the product of the RT PCR experi-ment illustrated by Figure 7 confirmed that theintron inserts at the expected site in the DNA sub-strate. That experiment provides evidence thatthese RNP particle preparations have some fullreverse splicing activity.

The intron reading frame of cob I1 clearly con-tains an endonuclease domain and for those otherrelated introns that have been studied, bothRT-dependent and RT-independent homingdepends on the endonuclease activity.8,14,15,40,41 Sofar, we have not detected endonuclease activitywith these cob I1 RNP particle preparations.Although these preparations have reverse splicingactivity, we did not detect TPRT activity in experi-ments with fully duplex DNA substrates (Figure8). However, the cob I1 RNP particle fractions haveTPRT activity when given a double-stranded DNAsubstrate constructed to contain a nick at theE2 þ 10 position of the antisense strand (Figure 8).Thus, it appears that cob I1 lacks the HNH endo-nuclease activity and the high level of homingobserved in vivo may depend on some othernicking activity in mitochondria. It should bementioned that the bacterial group II intronRmInt1 carries out efficient homing even thoughits intron reading frame is deleted for the Endomain sequence.42 One could speculate that theendogenous RT activity of cob I1 could haveevolved to enable cob I1 to be mobile even in theabsence of an efficient endonuclease. It may berelevant that the P714T endonuclease domainmutant of aI2 has a high level of endogenous RTactivity10 and that with several recipient strainsthat mutant intron has substantial retrohomingactivity, even though it has a relatively low levelof endonuclease activity.8

Materials and Methods

Strains

S. pombe strain R10 was constructed by elimination ofall group I introns from the mtDNA of strain anar-14and the intronless strain P3 was constructed by elimi-nation of the cob intron from the mtDNA of strain R10.21

Strain R10/5 is a cob intron mutant of strain R10. Apoint mutation at nucleotide position 2734 changes aproline residue to serine close to the end of domain X ofthe cob intron ORF.21 Finally, strain 6G6 is a r8 derivativeof strain P3.27

Preparation of mtRNP particles

Fission yeast strains were grown in complete mediumwith 2% (w/v) yeast extract, 1% (w/v) peptone, 5%(w/v) glucose or 3% (w/v) raffinose. Cells from station-ary phase cultures were harvested and refreshed for one


hour in complete medium containing 5% glucose. Cellswere then collected and washed sequentially in 50 mMEDTA (pH 7.5), sterile distilled water, and then citrate/phosphate buffer (pH 7.0). The cell wall was digested inSPC buffer (100 mM citrate-phosphate buffer, 750 mMsorbitol, 1 mM EDTA, final pH 5.8) containing 5 mg/gof cells of Lysing Enzyme (Sigma L-2265). Protoplastswere collected, washed twice in SPC buffer and brokenin 100 mM citrate phosphate buffer (pH 7.0), 300 mMsorbitol, 50 mM EDTA. In some experiments, sterileglass beads were used to improve cell breakage. Mito-chondria were pelleted and washed twice in ice-coldsucrose buffer I (15% (w/v) sucrose, 10 mM Tricine,175 mM EDTA, pH 7.5). The pellet was then suspendedin 15 ml of ice-cold sucrose buffer IV (65% (w/v) sucrose,10 mM Tricine, 100 mM EDTA, pH 7.5) and the suspen-sion was then overlaid with ice-cold buffers containing53% sucrose and then 44% sucrose (both w/v) andpurified by centrifugation for two hours at 27,000g in aBeckman SW 28 rotor. Subsequent steps for enrichingRNP particles from these flotation-purified mitochondriawere adapted from the methods described.10,17

Northern blot experiments

RNA was isolated from mitochondrial RNP prepa-rations by extraction with phenol/chloroform. ForNorthern blot experiments, 10 mg of RNA (0.25 A260

unit) was run on urea/agarose gels43 and blotted ontoa nylon membrane. The blots were hybridized withvarious 50-end labelled 50-mer oligonucleotides, asindicated. The inputs were balanced by subsequenthybridization with 40-mer oligonucleotides complemen-tary to sequences at the 50-end of the cox2 (nucleotides1–40) and rns (nucleotides 1–40) genes. Hybridizationsignals were measured using a Fuji LAS-1000 imager.

Assays of RT activity

RT was assayed in 10 ml reactions containing RNase-free RT reaction buffer (50 mM Tris–HCl (pH 8.5),30 mM KCl, 8 mM MgCl2, 5 mM DTT), except as notedin the text) plus 200 mM dATP, dTTP, and dCTP and10 mCi of [a-32P]dGTP (3000 Ci/mmol; Dupont NEN).Reactions were initiated by adding 0.025 A260 unit ofRNP particles and incubated for ten minutes at 37 8C.Synthesis of cDNA was measured by spotting 9 mlaliquots of each reaction onto DE81 paper (Whatman,Fairfield, NJ) and washing them four times with RNase-free 2£SSC (150 mM NaCl, 15 mM sodium citrate). Thefilters were then dried and quantified by Cerenkovcounting in a Beckman LS1801 scintillation counter. Forprimer-stimulated RT assays, 25 pmol of each primerwas added prior to addition of the RNP particles. Thecob primers used are 30-mers, defined using sequencecoordinates in the mosaic form of the cob gene countingfrom the first nucleotide of the start codon in exon 1:cob E1(210), from 646–675; cob E2(0), from 3211–3240;cob E2(þ10), from 3220–3249; cob E2(þ15), from 3225–3254; cob E2(þ70), from 3270–3399; cob I1(1), from 828–857; cob I1(2), from 1802–1831. The 30-mer oligo usedfor cox2 is complementary to nucleotides 2813–2844counting from the first nucleotide of the start codon ofthe mosaic form of the cox2 gene.23 All values reportedare means of at least three assays.

Analysis of cDNAs by Southern blot experiments

mtDNA was purified from the intronless strain (P3)and the intron donor strain (R10) as described,44 digestedwith HincII, HindIII and Eco RV, resolved in a 1% (w/v)agarose gel and blotted onto a positively charged nylonmembrane (Roche). To produce cDNA probes, RT assayswere carried out with 0.025 A260 unit of RNP particlesin 10 ml RT reactions (as above). The reactions wereextracted with the same volume of phenol/chloroform/isoamyl alcohol (25:24:1, by vol.), and then purifiedthrough Sephadex G-50 spin columns (Roche). cDNA:template heteroduplexes were denatured in 0.1 MNaOH, 1 mM EDTA at 50 8C for one hour. The denaturedcDNAs were precipitated by addition of 2.5 volumesof ethanol and 0.1 volume of 3 M sodium acetate andresuspended in 10 ml of distilled water. The subsequentSouthern hybridizations were carried out as described45

and dried membranes were quantified using a phosphor-imager (Fuji).

Native gel electrophoresis of RNAtemplate:cDNA complexes

The RNA:cDNA complexes were synthesized in RTassays as above. The reactions were terminated byplacing the reaction tubes on ice and adding 40 ml ofTricine–EDTA buffer, 0.5 ml of tRNA solution (10 mg/ml) and 45 ml of phenol/chloroform. The aqueous phasewas mixed with 5 ml of 3 M sodium acetate (pH 7.9) andpurified on a Sephadex G-50 spin column. The RNA/cDNA duplexes were precipitated with 250 ml of ice-cold ethanol and resuspended in 10 ml of Tricine–EDTAbuffer with 2 ml of loading dye (bromphenol and xylenecyanol in 50% (v/v) glycerol; RNase-free). For treatmentof RT products with RNase H, a reaction was incubatedfor 20 minutes at 37 8C with two units of RNase H(Roche) prior to extraction with phenol/chloroform/isoamyl alcohol (25:24:1, by vol.), and purification bySephadex G-50 spin column. These samples were ana-lyzed by non-denaturing gel electrophoresis on agarosegels with 1% (w/v) SeaKem LE agarose in diethyl pyro-carbonate-treated 0.5£TBE buffer (45 mM Tris–borate(pH 8.3), 1 mM EDTA) at 4 8C. The gels were dried in aslab dryer for two hours at 80 8C and exposed on a phos-phorimager cassette (Molecular Dynamics) or on X-rayfilm. Standard RNA molecular mass marker II (Roche)was used.

Determination of RT initiation sites in endogenousRT reactions

The following DNA fragments containing differentsegments of the S. pombe cob gene sequence were ampli-fied from mtDNA by PCR (defined from the first nucleo-tide of the start codon of exon 1): A, 693 bp, containingnucleotides 535–1228; B, 1240 bp, nucleotides 1203–2443; C, 1070 bp, nucleotides 1781–2851; D, 863 bp,nucleotides 2416–3279; A1, 302 bp, nucleotides 1103–1405; A2, 299 bp, nucleotides 1204–1503; A3, 315 bp,nucleotides 1295–1610; A4, 336 bp, nucleotides 1385–1721; A5, 337 bp, nucleotides 1483–1820; D1, 300 bp,nucleotides 2911–3211; D2, 328 bp, nucleotides 2992–3320; D3, 280 bp, nucleotides 3120–3400; and cox2,747 bp covering the entire cox2 gene sequence. ThesePCR products were separated on preparative 1.5%agarose gels, recovered from the gel and extracted withphenol/chloroform/isoamyl alcohol (25:24:1, by vol.).


The amounts of these DNA samples were determinedby measuring A260: Equimolar amounts of each DNAfragment were run on a 1% agarose gel and blotted ontoNylon membranes (Roche) for subsequent Southern blotanalysis as described.45 The balancing was verified bySouthern hybridization of a parallel gel using anequimolar mixture of end-labelled oligonucleotidescomplementary to the 50-end of each PCR fragmentas probe. All the signals were quantified byphosphorimaging.

The radiolabelled cDNA probes were synthesizedwith 0.025 A260 unit of RNP, PCI extracted with phenol/chloroform/isoamyl alcohol (25:24:1, by vol.), and thenpurified through Sephadex G-50 spin columns (Roche).cDNA:template heteroduplexes were denatured in0.1 M NaOH, 1 mM EDTA at 50 8C for one hour. Thedenatured cDNAs were precipitated by addition of 2.5volumes of ethanol, 0.1 volume of 3 M sodium acetate,and resuspended in 10 ml of distilled water. Theincorporation was quantified by Cerenkov counting in aBeckman LS1801 scintillation counter with 1 ml of eachreaction spotted onto DE81 paper (Whatman). In thesubsequent Southern hybridization we used about50,000 cpm of labelled cDNA as probe. After hybridi-zation the membranes were dried and analyzed usingthe Fuji LAS-1000 imager.

Reverse splicing and RT-PCR analysis of the introninsertion site

Reverse splicing assays were carried out in 10 ml reac-tion mixtures including 150,000 cpm of labelled DNAsubstrate and 0.025 A260 unit of RNP particles in a reac-tion buffer containing 50 mM Tris–HCl (pH 7.5), 50 mMKCl, 10 mM MgCl2 and 1 mM DTT. Assays were initiatedby adding the RNP particles, then incubated at 37 8C for20 minutes. After being terminated on ice, the reactionmixture was extracted with phenol/chloroform/isoamylalcohol (25:24:1, by vol.) in the presence of 5 mg of yeasttRNA carrier (Sigma) and then precipitated by ethanol,as above. Pellets were resuspended in TE (10 mM Tris,1 mM EDTA, pH 7.5) and denatured by glyoxal treat-ment for 45 minutes at 50 8C. The final products wereanalyzed in a 1% agarose gel containing 10 mM sodiumphosphate (pH 7.0)45 and visualized by autoradiographyof the dried gel. The DNA substrates were all generatedby PCR in the presence of 2 mCi/ml of [a-32P]dATP(3000 mCi/mmol; Amersham Pharmacia). PCR productswere gel-purified, further purified through G-50 columnsand then precipitated in ethanol.

An RT PCR experiment determined the site of reversesplicing. Primers c30-U (TACAACGTCGTGACTGGGAAAAC; complementary to the M13(221) forward sequen-cing primer) and cob I-13170w (nucleotides 13164–13186of the cob intron) were added to incubated reversesplicing reactions and RT PCR was carried out usingTitan One Tube RT PCR Kit (Roche). The samples wereincubated in a Gene Amp PCR cycler 9700 (PerkinElmer) that was programmed as follows: initial 30 min-utes at 50 8C (first strand cDNA synthesis), then ninecycles with 30 seconds at 94 8C, 30 seconds at 50 8C and30 seconds at 68 8C and then 24 cycles with 30 secondsat 94 8C, 30 seconds at 50 8C and 30 seconds with anincrement of five seconds at each cycle at 68 8C andfinally one cycle with five minutes at 68 8C. The productswere analyzed on a 1% agarose gel in TBE buffer.45 Theresulting 431 bp DNA was purified from the gel (HighPure PCR Product Purification Kit, Roche) and

sequenced using 50 Cy5-labelled primers on an A.L.F.Sequencer (Pharmacia Biotech).

TPRT assays

TPRT activity was assayed as described11 usingunlabelled DNA substrate 3 in which both strands wereintact and another DNA target in which the antisensestrand contains a nick at E2 þ 10 so as to mimic thepredicted endonuclease cleavage site on that strand.Each reaction contained 0.025 A260 unit of RNP particlesfrom strain R10 in reaction buffer (50 mM Tris–HCl (pH8.5), 30 mM KCl, 8 mM MgCl2, 1 mM DTT), 1 mg ofDNA substrate, 0.2 mM each dATP, dCTP and dTTP,and 10 mCi of labelled dGTP (as above) in a total volumeof 10 ml. The reactions were initiated by addition of RNPparticles, incubated for ten minutes at 37 8C, chased with0.2 mM dGTP for ten minutes and terminated by extrac-tion with phenol/chloroform/isoamyl alcohol (25:24:1,by vol.) with 0.3 M sodium acetate (pH 7.8) and 5 mg ofyeast tRNA carrier (Sigma). The products were precipi-tated twice in ethanol, fractionated on 1% agarose gelsin TBE buffer45 and analyzed by autoradiography.Unlabelled and labelled double-stranded DNA substrate3 were prepared by PCR as above. The nicked substratewas prepared by annealing a sense strand oligonucleo-tide from position 2149 in E1 to þ69 in E2 with twoantisense strand oligonucleotides from nucleotides 265to þ10 and þ11 to þ69. Both substrates were recoveredas double-stranded DNA from a preparative polyacryl-amide gel, extracted with phenol/chloroform/isoamylalcohol (25:24:1, by vol.) and precipitated in ethanol.

Acknowledgements

The skilled technical assistance of Mrs AnnetteSchreer is acknowledged. This research was sup-ported by NIH grant GM31480 and by grantI-1211 from the Robert A. Welch Foundation,both to P.S.P., and by a grant from the DeutscheForschungsgemeinschaft (DFG) to K.W. and B.S.

References

1. Xiong, Y. & Eickbush, T. H. (1990). Origin and evolu-tion of retroelements based upon their reversetranscriptase sequences. EMBO J. 9, 3353–3362.

2. Eickbush, T. H. (1997). Telomerase and retrotranspo-sons: which came first? Science, 277, 911–912.

3. Lambowitz, A. M., Caprara, M. G., Zimmerly, S. &Perlman, P. S. (1999). Group I and group II ribozymesas RNPs: clues to the past and guides to the future.In The RNA World (Gesteland, R. F., Cech, T. R. &Atkins, J. F., eds), pp. 451–485, Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

4. Zimmerly, S., Hausner, G. & Wu, X. (2001). Phylo-genetic relationships among group II intron ORFs.Nucl. Acids Res. 29, 1238–1250.

5. Michel, F. & Lang, B. (1985). Mitochondrial class IIintrons encode proteins related to the reversetranscriptases of retroviruses. Nature, 316, 641–643.

6. Mohr, G., Perlman, P. S. & Lambowitz, A. M. (1993).Evolutionary relationships among group II intron-encoded proteins and identification of a conserved


domain that may be related to maturase function.Nucl. Acids Res. 21, 4991–4997.

7. Shub, D. A., Goodrich-Blair, H. & Eddy, S. R. (1994).Amino acid sequence motif of group I intron endo-nucleases is conserved in open reading frames ofgroup II introns. Trends Biochem. Sci. 19, 402–404.

8. Eskes, R., Liu, L., Ma, H., Chao, M. Y., Dickson, L.,Lambowitz, A. M. & Perlman, P. S. (2000). Multiplehoming pathways used by yeast mitochondrialgroup II introns. Mol. Cell Biol. 20, 8432–8446.

9. Zimmerly, S., Guo, H., Eskes, R., Yang, J., Perlman,P. S. & Lambowitz, A. M. (1995). A group II intronRNA is a catalytic component of a DNA endo-nuclease involved in intron mobility. Cell, 83,529–538.

10. Kennell, J. C., Moran, J. V., Perlman, P. S., Butow,R. A. & Lambowitz, A. M. (1993). Reverse transcrip-tase activity associated with maturase-encodinggroup II introns in yeast mitochondria. Cell, 73,133–146.

11. Zimmerly, S., Guo, H., Perlman, P. S. & Lambowitz,A. M. (1995). Group II intron mobility occurs bytarget DNA-primed reverse transcription. Cell, 82,545–554.

12. Cousineau, B., Smith, D., Lawrence-Cavanagh, S.,Mueller, J. E., Yang, J., Mills, D. et al. (1998). Retro-homing of bacterial group II intron: mobility via com-plete reverse splicing, independent of homologousDNA recombination. Cell, 94, 451–462.

13. Eskes, R., Yang, J., Lambowitz, A. M. & Perlman, P. S.(1997). Mobility of yeast mitochondrial group IIintrons: engineering a new site specificity and retro-homing via full reverse splicing. Cell, 88, 865–874.

14. Matsuura, M., Saldanha, R. J., Ma, H., Wank, H.,Yang, J., Mohr, G. et al. (1997). A bacterial group IIintron encoding reverse transcriptase, maturase, andDNA endonuclease activities: biochemical demon-stration of maturase activity and insertion of newgenetic information within the intron. Genes Dev. 11,2910–2924.

15. Moran, J. V., Zimmerly, S., Eskes, R., Kennell, J. C.,Lambowitz, A. M., Butow, R. A. & Perlman, P. S.(1995). Mobile group II introns of yeast mitochon-drial DNA are novel site-specific retroelements. Mol.Cell Biol. 15, 2828–2838.

16. Kennell, J. C., Saville, B. J., Mohr, S., Kuiper, M. T.,Sabourin, J. R., Collins, R. A. & Lambowitz, A. M.(1995). The VS replicates by reverse transcription asa satellite of a retroplasmid. Genes Dev. 9, 294–303.

17. Zimmerly, S., Moran, J. V., Perlman, P. S. & Lambowitz,A. M. (1999). Group II intron reverse transcriptase inyeast mitochondria. Stabilization and regulation ofreverse transcriptase activity by the intron RNA.J. Mol. Biol. 289, 473–490.

18. Morozova, T., Seo, W. & Zimmerly, S. (2002). Non-cognate template usage and alternative priming bya group II intron-encoded reverse transcriptase.J. Mol. Biol. 315, 951–963.

19. Yang, J., Zimmerly, S., Perlman, P. S. & Lambowitz,A. M. (1996). Efficient integration of an intron RNAinto double-stranded DNA by reverse splicing.Nature, 381, 332–335.

20. Zimmer, M., Welser, F., Oraler, G. & Wolf, K. (1987).Distribution of mitochondrial introns in the speciesSchizosaccharomyces pombe and the origin of thegroup II intron in the gene encoding apocytochromeb. Curr. Genet. 12, 329–336.

21. Schafer, B., Merlos-Lange, A. M., Anderl, C., Welser,F., Zimmer, M. & Wolf, K. (1991). The mitochondrial

genome of Schizosaccharomyces pombe: inability of allintrons to splice autocatalytically, and constructionof an intronless genome. Mol. Gen. Genet. 225,158–167.

22. Schafer, B. & Wolf, K. (1999). A novel group IIintron in the cox1 gene of the fission yeastSchizosaccharomyces pombe is inserted in the samecodon as the mobile group II intron aI2 in theSaccharomyces cerevisiae cox1 homologue. Curr. Genet.35, 602–608.

23. Schafer, B., Kaulich, K. & Wolf, K. (1998). Mosaicstructure of the cox2 gene in the petite negativeyeast Schizosaccharomyces pombe: a group II intronis inserted at the same location as the otherwiseunrelated group II introns in the mitochondria ofhigher plants. Gene, 214, 101–112.

24. Lang, B. F., Ahne, F. & Bonen, L. (1985). Themitochondrial genome of the fission yeastSchizosaccharomyces pombe. The cytochrome b genehas an intron closely related to the first two intronsin the Saccharomyces cerevisiae cox1 gene. J. Mol. Biol.184, 353–366.

25. Paschke, T., Meurer, P., Schafer, B. & Wolf, K. (1994).Homing of mitochondrial introns in the fission yeastSchizosaccharomyces pombe. Endocytobiosis Cell Res. 10,205–213.

26. Schmidt, W. M., Schweyen, R. J., Wolf, K. & Mueller,M. W. (1994). Transposable group II introns in fissionand budding yeast. Site-specific genomic instabilitiesand formation of group II IVS plDNAs. J. Mol. Biol.243, 157–166.

27. Massardo, D. R., Manna, F., Schafer, B., Wolf, K. &Del Giudice, L. (1994). Complete absence ofmitochondrial DNA in the petite-negative yeastSchizosaccharomyces pombe leads to resistance towardslycorine. Curr. Genet. 25, 80–83.

28. Yang, J., Mohr, G., Perlman, P. S. & Lambowitz, A. M.(1998). Group II intron mobility in yeast mito-chondria: target DNA-primed reverse transcriptionactivity of aI1 and reverse splicing into DNA trans-position sites in vitro. J. Mol. Biol. 282, 505–523.

29. Tabor, S. & Richardson, C. C. (1987). DNA sequenceanalysis with a modified bacteriophage T7 DNApolymerase. Proc. Natl Acad. Sci. USA, 84, 4767–4771.

30. Wank, H., SanFilippo, J., Singh, R. N., Matsuura, M.& Lambowitz, A. M. (1999). A reverse transcrip-tase/maturase promotes splicing by binding at itsown coding segment in a group II intron RNA. Mol.Cell, 4, 239–250.

31. Guo, H., Zimmerly, S., Perlman, P. S. & Lambowitz,A. M. (1997). Group II intron endonucleases useboth RNA and protein subunits for recognition ofspecific sequences in double-stranded DNA. EMBOJ. 16, 6835–6848.

32. Saldanha, R. J., Chen, B., Wank, H., Matsuura, M.,Edwards, J. & Lambowitz, A. M. (1999). RNA andprotein catalysis in group II intron splicing andmobility reactions using purified components. Bio-chemistry, 38, 9069–9083.

33. Matsuura, M., Noah, J. W. & Lambowitz, A. M.(2001). Mechanism of maturase-promoted group IIintron splicing. EMBO J. 20, 7259–7270.

34. Singh, R. N., Saldanha, R. J., D’Souza, L. M. &Lambowitz, A. M. (2002). Binding of a group IIintron-encoded reverse transcriptase/maturase to itshigh affinity intron RNA binding site involvessequence-specific recognition and autoregulatestranslation. J. Mol. Biol. 318, 287–303.

35. Eickbush, T. H. (1994). Origin and evolutionary


relation-ships of retroelements. In The EvolutionaryBiology of Viruses (Morse, S. S., ed.), pp. 121–157,Raven Press, New York.

36. Nakamura, T. M. & Cech, T. R. (1998). Reversingtime: origin of telomerase. Cell, 92, 587–590.

37. Michel, F. & Ferat, J. L. (1995). Structure and activi-ties of group II introns. Annu. Rev. Biochem. 64,435–461.

38. Jacquier, A. (1996). Group II introns: elaborate ribo-zymes. Biochimie, 78, 474–487.

39. Swisher, J. F., Su, L. J., Brenowitz, M., Anderson, V. E.& Pyle, A. M. (2002). Productive folding to the nativestate by a group II intron ribozyme. J. Mol. Biol. 315,297–310.

40. Dickson, L., Huang, H. R., Liu, L., Matsuura, M.,Lambowitz, A. M. & Perlman, P. S. (2001). Retro-transposition of a yeast group II intron occurs byreverse splicing directly into ectopic DNA sites.Proc. Natl Acad. Sci. USA, 98, 13207–13212.

41. Singh, N. N. & Lambowitz, A. M. (2001). Interactionof a group II intron ribonucleoprotein endonucleasewith its DNA target site investigated by DNA foot-

printing and modification interference. J. Mol. Biol.309, 361–386.

42. Martinez-Abarca, F., Garcia-Rodriguez, F. M. & Toro,N. (2000). Homing of a bacterial group II intron withan intron-encoded protein lacking a recognizableendonuclease domain. Mol. Microbiol. 35, 1405–1412.

43. Locker, J. (1979). Analytical and preparative electro-phoresis of RNA in agarose–urea. Anal. Biochem. 98,358–367.

44. Lang, B. F. & Wolf, K. (1984). The mitochondrialgenome of the fission yeast Schizosaccharomycespombe 2. Localization of genes by interspecifichybridization in strain ade 7-50h- and cloning of thegenome in small fragments. Mol. Gen. Genet. 196,465–472.

45. Sambrook, J., Frisch, E. F. & Maniatis, T. (1989).Molecular Cloning: A Laboratory Manual, Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY.

46. SanFilippo, J. & Lambowitz, A. M. (2002). Characteri-zation of the C-terminal DNA-binding/DNAendonuclease region of a group II intron-encodedprotein. J. Mol. Biol. 324, 933–951.

Edited by D. E. Draper

(Received 15 October 2002; received in revised form 20 March 2003; accepted 27 March 2003)


reverse transcriptase and reverse splicing activities encoded by the mobile group ii intron cobi1 of...

Documents