! 1!

Resistance of Aerosolized Bacterial Viruses to Relative Humidity and 1!Temperature 2!

3!

Daniel Verreault1, Mélissa Marcoux-Voiselle1, Nathalie Turgeon1, 4!

Sylvain Moineau2,3 and Caroline Duchaine1,3 5!

6!

1 Centre de recherche de l’institut universitaire de cardiologie et de pneumologie de Québec, 7!

2725 chemin Sainte-Foy, Québec, Qc, Canada G1V 4G5. 8!

2 Département de biochimie, de microbiologie et de bio-informatique, 9!

Faculté des sciences et de génie, Université Laval, Québec, Qc, Canada, G1V 0A6 10!

3 3 Félix d’Hérelle Reference Center for Bacterial Viruses and GREB, 11!

Faculté de médecine dentaire, Université Laval, Quebec City, Quebec, Canada, G1V 0A6 12!

13!

* Corresponding author. Mailing address: Caroline Duchaine, Ph.D., Institut universitaire de 14!

cardiologie et de pneumologie de Québec, 2725 Chemin Ste-Foy, Québec, Canada, G1V 4G5. 15!

Phone: (418) 656-8711 ext. 5837. Fax: 418 656-4509. E-mail: Caroline.Duchaine@bcm.ulaval.ca 16!

Running title: Airborne phages resistance to temperature and humidity 17!

Keywords: bioaerosol, phage, virus, aerosolization, resistance 18!

! 2!

ABSTRACT 19!

The use of aerosolized bacteriophages as surrogates to hazardous viruses could simplify 20!

and accelerate the discovery of links between viral components and their persistence in the 21!

airborne state under diverse environmental conditions. In this study, four structurally distinct lytic 22!

phages, MS2 (ssRNA), Φ6 (dsRNA), ΦX174 (ssDNA) and PR772 (dsDNA), were nebulised into 23!

a rotating chamber and exposed to various levels of relative humidity (RH) and temperature as 24!

well as to germicidal ultraviolet radiations. The aerosolized viral particles were allowed to remain 25!

airborne for up to fourteen hours before being sampled for analysis by plaque assays and 26!

quantitative PCR. Phages Φ6 and MS2 were most resistant at low levels of relative humidity 27!

whilst ΦX174 was more resistant at 80% RH. Phage Φ6 lost its infectivity immediately after 28!

exposure to 30°C and 80% RH. The infectivity of all tested phages rapidly declined as a function 29!

of the exposure time to UV-C radiations, phage MS2 being the most resistant. Taken altogether, 30!

our data indicate that these aerosolized phages behave differently under various environmental 31!

conditions and highlight the necessity of carefully selecting viral simulants in bioaerosols studies. 32!

33!

! 3!

INTRODUCTION 34!

Human populations are constantly exposed to viral particles, whether it is through direct 35!

or indirect contacts with an infected individual or through contaminated environments. Despite 36!

precautions, we remain at risk of exposure to infective viral particles, particularly through the 37!

airborne route. This mode of transmission is difficult to control in our everyday lives due to the 38!

ubiquitous nature of airborne particles, which may harbour infectious materials. Although the 39!

airborne route is not the most effective mode of transmission for the majority of known human 40!

pathogens, many viruses may be transmitted through this route (1). For example, measles, 41!

varicella zoster (2) and variola viruses (3) are naturally transmitted by aerosols. Others such as 42!

Newcastle disease virus are particularly resistant to aerosolization and could potentially cause 43!

infections by the aerosol route (4, 5). On the other hand, the importance of aerosol transmission 44!

in the spread of some viruses such as the influenza virus is still a subject of debate (6). 45!

Aerosolized particles may be involved in viral transmission at short range through 46!

contamination of fomites by the rapid deposition of large droplets. However, true aerosol 47!

dissemination implies that sufficiently small infectious particles remain airborne for a prolonged 48!

period (2). Particles smaller than five micrometers in aerodynamic diameter have the potential to 49!

travel long distances as they sediment more slowly. However, these smaller particles also harbour 50!

fewer viruses but also less material that could protect the viruses in the airborne state. Indeed, 51!

viral resistance to aerosolization is partly dependent upon the composition of the droplet or 52!

droplet nuclei (5, 7, 8). Furthermore, the resistance of viruses to aerosolization appears to be 53!

unique to each virus (5, 9, 10). Although, based on a very limited data, some similarities exist 54!

between viruses with similar structural components such as the presence or absence of an 55!

envelope (11). 56!

! 4!

Laboratory work with pathogens requires appropriate bioconfinement procedures 57!

depending on the biosafety classification of each virus. When pathogens are nebulised in high 58!

concentrations, additional safety precautions need to be implemented, adding complexity to the 59!

studies. The use of non-pathogenic surrogate viruses could help facilitate aerosol studies. 60!

Although it is clear that no viral surrogate could mimic with perfect accuracy the reactivity of all 61!

airborne viruses to their environment, the characterisation of a panel of surrogates could help 62!

establish some general guidelines to help predict the reactivity of some airborne viruses. 63!

Bacterial viruses, or phages, have been used in a variety of fields as viral models, but their 64!

potential in aerobiology is still poorly exploited. Airborne phages have been studied mostly for 65!

filter testing (12), phage therapy (13) and as surrogates in biodefense research (14). Phage MS2 66!

has been the most used in these virus aerosol studies. Although phages are specific to their 67!

bacterial host, they have some similarities with eukaryotic viruses. Namely, they can be 68!

enveloped or not, possess a single or double stranded RNA or DNA genome, which may be 69!

segmented, linear or circular and the viral capsids exist in a multitude of shapes and sizes (15). 70!

Phages can safely be amplified to high concentrations at low cost. Interestingly, phages are even 71!

accepted by the Parenteral Drug Association (PDA) and the Virus Filter Task Force as published 72!

in the 2008 update of PDA Technical Report 41 : Virus Filtration. 73!

In a previous study, we investigate the resistance to aerosolization and air sampling of 74!

several phages (MS2, PR772, φ6, φX174, and PM2), which were chosen because of some 75!

similarities (virion size, nucleic acid composition, envelope) with pathogenic viruses (5). Here,we 76!

investigated the infectivity of phages following exposure to environmental stress in the airborne 77!

state using a newly designed rotating environmental chamber (17). Four phages were aerosolized 78!

at various temperatures and levels of relative humidity (RH) as well as exposed to UV radiations. 79!

! 5!

MATERIALS AND METHODS 80!

Bacteriophages. The phages used in this study are described in Table 1. Phages Φ6 (HER 102), 81!

ΦX174 (HER 36), PR772 (HER 221) and their respective host bacterial strains, Pseudomonas 82!

syringae (HER 1102), Escherichia coli (HER 1036), and E. coli (HER 1221) were provided by 83!

the Félix d’Hérelle Reference Center for Bacterial Viruses (www.phage.ulaval.ca). Phage MS2 84!

(ATCC 15597-B1) and its host E. coli (ATCC 15597) were obtained through the American Type 85!

Culture Collection (ATCC). 86!

Phages MS2 and ΦX174 were propagated in liquid cultures on their respective hosts as 87!

described previously (9, 10). Phage PR772 was propagated on its host on Tryptic Soy Broth 88!

(TSB) supplemented with agarose (0.75%) as reported elsewhere (16). Phage Φ6 was propagated 89!

on its bacterial host on TSB soft agar (0.75%) as described (10) but with minor modifications. 90!

Briefly, a liquefied preparation of TSB supplemented with 0.75% agar was inoculated with an 91!

overnight culture of P. syringae. A stock suspension of Φ6 was added to the inoculated medium 92!

and poured over Tryptic Soy Agar (TSA) plates. Plates were then incubated overnight at 25°C 93!

and plates with nearly confluent plaque forming units (PFU) were selected for phage extraction. 94!

The soft agar was scrapped from the plates and transferred into tubes containing five ml of phage 95!

buffer (20 mM Tris-HCl, pH 7.4; 100 mM NaCl; 10 mM MgSO4). The tubes were placed under 96!

slow agitation for six hours. Large debris were removed by centrifugation at 2 800 Xg for 10 97!

minutes and the supernatant was filtered (0.45 µm) and kept at 4°C until use. Phage 98!

amplifications produced approximately 1010 PFU per ml, as determined by plaque assay (18). 99!

Aerosol chamber. The specifications and a detailed description of the aerosol chamber used in 100!

this study are available elsewhere (17). Briefly, the aerosol chamber is a 55.5-liter aluminum 101!

! 6!

rotating drum sheltered inside an insulated temperature-controlled enclosure. The temperature 102!

inside the rotating chamber is modulated by controlling the temperature inside the insulated 103!

enclosure with two thermoelectric assemblies (model INB340-24-AA, Watronix Inc., West Hills, 104!

CA) for either cooling or heating. Both ends of the cylindrical chamber are closed with custom-105!

made caps mounted on double sealed ball bearings. The interior sections of the bearings remain 106!

stationary during drum rotation and hold protruding aluminum rods with multiple ports, which 107!

are accessible from the exterior of the insulated enclosure. The left cap holds a 254 nm ultraviolet 108!

C band (UV-C) light (model GCL356T5L/4P, Light Sources, Inc., Orange, CT) at the center of 109!

rotation as well as a UV probe (model UV-Air, sglux SolGel Technologies GmbH, Berlin, 110!

Germany) placed 5 cm from the light source. A temperature and relative humidity (RH) probe 111!

(model RH-USB, Omega) placed inside the rotating chamber through an access port and an 112!

identical probe placed inside the insulated box were used to monitor and record temperature and 113!

RH levels in real-time throughout the experiments. The speed of rotation of the chamber was set 114!

at one rotation per minute (rpm) throughout the experiments. 115!

Aerosol generation and sampling protocol. Phage buffer was used for the preparation of the 116!

aerosol generation fluid. Fresh lysates of the four phages were added to the buffer at a final titer 117!

of 108 to 109 PFU/m . Five microliters of concentrated Antifoam A (Sigma-Aldrich, A5633) were 118!

added to the final volume of 50 ml of each suspension prepared for aerosol generation. The 119!

aerosolization was carried out using a 6-jet Collison nebulizer (BGI Inc., Walthman, Mass.) 120!

supplied with medical-grade filtered dry air at a rate of 12 liters per minute and a pressure of 20 121!

pounds per square inch gauge (psig) for ten minutes. 122!

Immediately after nebulisation, an Aerodynamic Particle Sizer (APS; model 3321, TSI 123!

Inc.) equipped with a diluter 1/100 (TSI model 3302A) was used to acquire data at a flow rate of 124!

! 7!

5 liters per minute for 20 seconds. The APS pump was then turned off and the rotating chamber 125!

was sealed. A BioSampler® (SKC Inc., Eighty Four, PA) filled with 20 ml of phage buffer was 126!

used to sample the aerosols from the drum at a rate of 12.5 liters per minute for 20 minutes. 127!

Essentialy, the entire aerosol content of the chamber was concentrated into a single sample, 128!

maximizing the detection of infective viral particles. Each aerosol sample collected corresponded 129!

to a separate nebulization protocol. For each environmental condition described below, aerosol 130!

samples were taken after five minutes, six and 14 hours of suspension time and the air inside the 131!

rotating chamber was flushed after each sample. Time point corresponding to zero hour of 132!

suspension was taken immediately after the APS acquisition. Time points 0, 6, and 14 hours were 133!

always carried out sequentially using the same aerosol generation fluid. Each environmental 134!

condition was assayed in triplicate or more. The aerosol samples were kept at 4°C until analysis 135!

and the infectivity assays were performed within 3 hours following sampling. 136!

Effects of relative humidity and temperature on airborne phages. To evaluate the effects of 137!

temperature and relative humidity on the infectivity of airborne phages, RH levels of 20% (low) 138!

and 50% (medium) were assayed at 18°C whereas RH of 80% was assayed at 18°C and 30°C. 139!

The desired levels of RH were obtained by passing the aerosol through various desiccant-filled 140!

pipes (17). At 18°C, 20% RH was obtained by passing the aerosol through 60 inches of desiccant, 141!

50% RH with 36 inches and 80% RH with 12 inches. In order to attain 80% RH at 30°C, an extra 142!

source of humidified air was used instead of the desiccators. The air was humidified inside the 143!

rotating chamber through a separate inlet port concomitantly virus nebulisation. 144!

Effects of UV-C exposure on airborne phages. The 254 nm UV-C low-pressure mercury lamp 145!

inside the drum was used to assess the effects of ultraviolet radiations on the integrity of airborne 146!

viruses. As indicated above, a UV sensor probe was placed five cm from the source to ensure 147!

! 8!

repeatability between experiments. Phage preparations were nebulised into the drum as described 148!

above. The chamber was sealed and the aerosol was allowed to stabilize inside the rotating 149!

chamber for 15 minutes. The temperature inside the chamber was kept at 18°C with a relative 150!

humidity of 20%. The UV-C light was then turned on for a period of 3, 6 or 10 seconds; controls 151!

without UV-C exposure were also performed. Aerosol samples were taken 1 minute after the UV 152!

exposure with a BioSampler® as described above. 153!

Plaque assays. Plaque assays were performed according to standard protocols using liquefied 154!

TSB (0.75% agar). The BioSampler liquid was assayed undiluted and serially-diluted in phage 155!

buffer. Each aerosol sample was assayed on all four bacterial hosts and incubated overnight at the 156!

optimal temperature of each bacterial strain. The infective titers of viruses were calculated as a 157!

number of plaque forming units (PFU) per milliliter of BioSampler collection liquid. 158!

RNA extraction and cDNA synthesis. RNA extractions from phages MS2 and Φ6 were carried 159!

out using the QIAamp Viral RNA Mini Kit (Qiagen Canada Inc., Mississauga, ON, Canada) 160!

without the carrier RNA, as described elsewhere (10). Prior to the synthesis of the 161!

complementary DNA (cDNA), the extracted RNA samples were heat-treated at 110°C for five 162!

minutes and placed on ice; this step was performed to denature double-stranded RNA segments 163!

(10). Then, cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, 164!

Hercules, CA) according to the manufacturer’s protocol. The reaction mix consisted of 5 µl of the 165!

RNA sample, 4 µl of 5x iScript Reaction Mix (Bio-Rad), 1 µl of iScript Reverse Transcriptase 166!

(Bio-Rad) and 10 µl of nuclease-free water. 167!

Quantitative PCR analysis. The primers and probes used for quantitative PCR (qPCR) analysis 168!

are described in Table 2. All qPCR reactions were performed with the DNA Engine Opticon 2 169!

! 9!

Real-Time PCR Detection System (Bio-Rad). Samples were analyzed using the Opticon Monitor 170!

Software version 2.02.24 (Bio-Rad). The PCR reaction mix contained 1X final concentration of 171!

iQ Supermix (Bio-Rad) and 1 µM of forward and reverse primers. The probe concentrations were 172!

150 nM, 300 nM, 200 nM and 200 nM for MS2 (10), Φ6 (10), ΦX174 (9) and PR772 (5), 173!

respectively. This master mix solution was distributed in aliquots of 23 µl per well for Φ6 and 174!

MS2 phages and aliquots of 20 µl per well for PR772 and ΦX174, in a 96 well plates. Two µl of 175!

test samples were added for Φ6 and MS2, and 5 µl for PR772 and ΦX174, for a final volume of 176!

25 µl. The qPCR protocol for ΦX174, PR772, and MS2 was 94°C for 3 min (hot start) followed 177!

by 40 cycles of 95°C for 15 sec and 60°C for 60 sec. The protocol for Φ6 was 94°C for 3 min 178!

(hot start) followed by 40 cycles of 95°C for 20 sec and 60°C for 60 sec (Φ6). All qPCR assays 179!

were performed in duplicate. A specific plasmid was prepared for each phage; the targeted gene 180!

segment was cloned into TOPO (Invitrogen, Carlsbad, CA) and purified using the QIAprep Spin 181!

miniprep kit (Qiagen Inc.) (5, 9, 10). Plasmids were quantified by optical density at 260 nm and 182!

serial dilutions of known concentrations were used to prepare the standard curves. 183!

Analysis of infective viruses recovery. The number of PFU found in each sample was divided 184!

by the number of phage genomes found in the same sample volume. The resulting fraction was 185!

multiplied by 100 to obtain the percentage of viral genomes associated to a PFU. 186!

Statistical analysis. Results of quantitative and nominal variables were expressed with mean±sd 187!

and percentage respectively. Two-way ANOVA was performed to carry out analyses for 188!

comparison between groups and temperature or various RH. From residuals of the statistical 189!

model, the normality assumption was verified with the Shapiro-Wilk test and the Brown and 190!

Forsythe's variation of Levene's test statistic was used to verify the homogeneity of variances. For 191!

all variables, the graphical analyses of residuals with predicted values have revealed a 192!

! 10!

relationship between the variances of the observations and the means for these variables. To 193!

estimate the form of the required transformation associated to these variables, a regression 194!

approach was performed between the logarithm of the standard deviations and the logarithm of 195!

the means from different conditions. The logarithm transformation was the appropriate one and 196!

statistical results from these parameters were expressed with the log-transformed values. When 197!

these assumptions were not fulfilled after a log-transformation, an alternative procedure that does 198!

not depend on these assumptions was done. The procedure performed was to replace the 199!

observations by their rank, called rank transformation, and applying the ordinary F test from two-200!

way ANOVA. This technique is an approximate procedure results, but one that has good 201!

statistical properties when compared to exact tests. When both procedures (log-transformed data 202!

and the ranks) gave similar results, results from the standard analysis were retained. When both 203!

procedures differed, the rank transformation was preferred. When necessary, “a posteriori” 204!

comparisons were performed using the Tukey’s technique. 205!

Effect of UV exposure on infectivity of aerosolised bacteriophages was analyzed using a mixed 206!

model on log-transformed data. Three experimental factors, one associated to phages (fixed 207!

factor with four levels), one being samples (random factor) and the other linked to “time” (fixed 208!

factor with three levels) were defined. The latter was analyzed as a repeated-measure factor with 209!

the use of a symmetric covariance structure. Data were analyzed using a linear mixed model with 210!

an interaction term between fixed factors. The statistical model was fitted to compare phages with 211!

heterogeneous variances and was tested whether the model could be reduced to a statistical model 212!

with the same variance across phages. As effect that specifies heterogeneity in the covariance 213!

structure was significant (heteroscedasticity) compare to the same variance among phages, the 214!

statistical analyses was performed using separate residual covariance structure per phage. The 215!

! 11!

residual maximum likelihood was used as the method of estimation and the Kenward–Roger 216!

method to estimate denominator degrees of freedom for the test of fixed effect. Posteriori 217!

comparisons were performed using the Tukey’s method. The normality assumption was verified 218!

with the Shapiro-Wilk tests on the error distribution from the Cholesky factorization of the 219!

statistical model. The results were considered significant if p-values were ≤ 0.05. The data were 220!

analysed using the statistical package program SAS v9.4 (SAS Institute Inc., Cary, NC). 221!

! 12!

RESULTS 222!

223!

Physical characterisation of aerosols. Particle concentrations following aerosol generation were 224!

between 1.1 x 105 and 1.7 x 105 particles per cubic centimeter as determined by the Aerodynamic 225!

Particle Sizer. The mass median aerodynamic diameter (MMAD) was 1.12 ± 0.05 µm 226!

immediately after nebulisation. The variations in particles concentration and MMAD over time 227!

inside the chamber were described previously (17). 228!

Temperature and relative humidity measurements. The effects of RH (20%, 50%, 80) on 229!

airborne phages were evaluated at 18°C. The recorded temperature was 17.6 ± 0.3°C and the RH 230!

levels varied slightly within and between experiments. The RH levels were kept between 19.6% 231!

and 25.0% for the 20% RH experiments; between 46.6% and 52.7% for 50% RH; and between 232!

75.0 and 80.3% for 80% RH conditions. When an intended temperature of 30°C and RH level of 233!

80% was evaluated, the actual temperature was 29.3 ± 0.6°C and the RH varied between 79.1 and 234!

85.0%. To simplify the text, the relative humidity levels will be referred to as 20% RH, 50% RH 235!

and 80% RH and temperatures will be referred to as 18°C and 30°C. 236!

Effect of relative humidity on the infectivity of airborne phages. Aerosolized particles were 237!

maintained in the rotating aerosol chamber for periods of zero, six and 14 hours at 18˚C and RH 238!

levels of 20%, 50% or 80%. The aerosol samples were analysed by plaque assays and qPCR and 239!

the percentage of viral genomes associated to infective viral particles was calculated. The four 240!

phages were infective at 0 h exposure at all RH. The effects of RH on the infectivity of the four 241!

phages tested are illustrated in Figure 1. 242!

! 13!

Phage ΦX174 displayed a better resistance at 80% RH, at both 6 and 14 hours exposure, 243!

when compared to 20% RH and 50% RH (p< 0.05). Phage PR772 needs high levels of RH to 244!

resist in an airborne state as no infectious PR772 particle was observed after 6h and 14h exposure 245!

at 20% RH and 14h exposure at 50% RH. There was a significant difference for 6h and 14h 246!

exposures when compared to the 0h exposure reference point for all levels of RH. On the other 247!

hand, phage Φ6 resists better at lower HR (20%, p < 0.05) compared to higher RH (50% and 248!

80%). Infectious Φ6 phage were not detected after 6h and 14h exposure to 50% RH and 14h to 249!

80% RH. Finally, phage MS2 was highly stable in all RH conditions tested but was significantly 250!

more resistant in aerosol state at 20% RH (p< 0.05). 251!

Effect of temperature on the infectivity of airborne phages. Phage-containing aerosols were 252!

exposed for 0, 6 or 14 hours at 18°C or 30°C and at a constant RH of 80% (Fig. 2). Plaques were 253!

observed for all phages at time 0 with the exception of Φ6 which did not form any plaque after 254!

aerosolisation at 30°C. Phage ΦX174 was resistant to both temperatures, but resist better at 18°C 255!

(p< 0.05), although, there was a decrease of ΦX174 infectivity after 14h of exposure (p< 0.05). 256!

Phage PR772 was sensitive to both temperature, as its relative infectivity after 6h and 14h 257!

exposure was significantly lower than at the reference time 0h. At 80% HR, phage Φ6 was 258!

remarkably unstable after 0h, 6h or 14h at both temperature. Finally, phage MS2 was stable for 259!

6h exposure at both temperatures but its infectivity decreased after 14h at 30°C (p< 0.05). 260!

Resistance of airborne phage to UV. Phages were aerosolized at 18°C/20% RH and exposed to 261!

UV light for 0, 3, 6 or 10 seconds (Fig. 3). A significant effect was noticeable starting at 3 262!

seconds of UV exposure for all phages (p< 0.0001). Phages displayed various resistance levels to 263!

UV. MS2 was significantly more resistant (p< 0.005) whilst ΦX174 was the most sensitive. 264!

! 14!

DISCUSSION 265!

!266!

The aim of this study was to compare the effects of environmental conditions on the 267!

integrity of four structurally and genetically distinct non-pathogenic phages in aerosols. Four tail-268!

less phages, including MS2, which is frequently used as a surrogate for eukaryotic viruses, were 269!

nebulised into a rotating chamber and exposed to various environmental conditions. Their 270!

infectivity was measured immediately after nebulisation as well as after six hours and 14 hours of 271!

exposure to the controlled conditions of temperature, relative humidity, and ultraviolet radiations. 272!

All four phages were nebulised and sampled simultaneously, thereby limiting the variables to the 273!

nature of the viruses. In order to consider the time or airborne state as a variable factor, the 274!

infectious ratios obtained after six and 14 hours of aerosol suspension was compared to the 275!

infectious ratio obtained at time zero. Sensitivity to environmental conditions varied significantly 276!

from one phage to another and their behaviour is summarized in Table 3. Phage φ6 was highly 277!

sensitive to several tested conditions. Consequently few data points were obtained and results 278!

must be interpreted with caution. 279!

MS2 is the overall most resistant phage used in this study. This phage was stable at all 280!

levels of relative humidity and temperatures tested. It also demonstrated a higher level of 281!

resistance to germicidal UV radiations. MS2 is widely used because it is non-pathogenic, easy to 282!

use and can reach high titers in little time. The sturdiness of this virus makes it a good choice for 283!

a variety of studies where highly stable viruses are needed. Previous studies have demonstrated 284!

that the infectivity of phage MS2 is not significantly affected by nebulisation or sampling (19, 5, 285!

20). Whilst it may be a good surrogate candidate for some aerosol studies, its resistance to some 286!

stress factors such as UV irradiations also indicates that it may not always be the best 287!

! 15!

representative. For example, adenoviruses have been shown to be more resistant to UV 288!

irradiations than MS2 (21, 22). Therefore, other phage models should be tested to identify 289!

appropriate surrogates. It is noteworthy that the exposure of airborne viruses to germicidal 290!

ultraviolet radiations can help understand how efficient are UV air treatment systems to inactivate 291!

viral particles. However, since these wavelengths are not naturally present on the Earth surface, a 292!

different UV lamp would be required in order to characterise the stability of airborne viruses in 293!

the outdoor environment. 294!

The enveloped phage φ6 was more resistant to lower levels of RH, which is consistent 295!

with some observations suggesting that enveloped viruses, such as influenza virus, are more 296!

resistant to drier and cooler conditions (11). Nevertheless, similar structural components do not 297!

predict viral resistance. Phage MS2, which does not have an envelope, was also stable at lower 298!

RH levels. This highlights the multifactorial nature of viral resistance to environmental stresses. 299!

The nebulisation liquid can also have an impact on the outcome of aerosol resistance 300!

studies. It has been suggested that the presence of proteins in the nebulisation medium could 301!

protect the integrity of airborne viruses, at least for phages MS2 (20), φ6 and PR772 (5). Here, 302!

we used a phage buffer made of a mixture of salts. The protein content was limited to the phage 303!

protein and mostly the residual proteins contained in the filtered phage lysates used to prepare the 304!

nebulisation sample. Thus, we assume this protective effect was limited in our study due to the 305!

low protein content. Since the viruses used were nebulised simultaneously, the airborne particles 306!

were all exposed to the same concentrations of salts and proteins. The data obtained are thus 307!

specific to the phage and conditions tested. 308!

! 16!

Additionally to the nebulisation liquid, other possible factors that could affect viral 309!

infectivity in aerosol studies are the nebulisation and the sampling procedures. Although the 310!

infectivity of phage MS2 was not significantly affected by nebulisation and sampling (5, 19, 20), 311!

this may not be representative of all viruses. Indeed, the differences in structural components 312!

including the presence or absence of an envelope or of protruding structures may have a 313!

significant impact on the vulnerability of airborne viruses to their environment. Differences in 314!

sensitivity have been reported between subtypes of influenza virus (23), suggesting that even 315!

minor structural differences may have an impact on viral infectivity. Our results clearly show that 316!

phages may present different levels of resistance to various environmental conditions. With this 317!

in mind, and considering the availability of phage collections, it is highly possible to find a phage 318!

or a set of phages with an airborne behaviour similar to the virus of interest. 319!

There is an increasing interest in the short- and long-term fate of airborne viruses and 320!

their potential to cause infection after a prolonged exposure to environmental stress factors. One 321!

of the major pitfalls for the generation of a sufficient amount of data to start raising some general 322!

outlines linking viral structures to their airborne stability is the difficulty to study pathogenic 323!

viruses in standard laboratory conditions. In our opinion, the use of phages is a good compromise 324!

to establish some general guidelines without the need for advanced biosecurity precautions. 325!

Furthermore, phages have the additional advantage of being less costly and less labour intensive 326!

to amplify than eukaryotic viruses. As of this day, the panel of airborne viruses studied is limited 327!

and allows only very conservative predictions of viral sensitivity to the conditions encountered in 328!

the aerosol state. A better understanding of the conditions affecting viral infectivity as a function 329!

of their structural components will help in the elaboration of algorithms for the evaluation of the 330!

potential of a given virus to withstand various environmental conditions. It will also certainly 331!

! 17!

lead to the discovery of novel solutions to efficiently eliminating airborne viruses. This will allow 332!

a faster undertaking of the appropriate preventive measures to minimise the risks associated with 333!

the spread of airborne viral particles. Taken altogether, this study provides a framework as well 334!

as robust insights to study the resistance of airborne viruses. 335!

336!

ACKNOWLEDGEMENTS 337!

This work was funded by the NSERC/CIHR collaborative health research project 338!

program. We acknowledge the Félix d’Hérelle Reference Center for Bacterial Viruses 339!

(www.phage.ulaval.ca) who kindly provided the bacteriophages. We are grateful to Serge Simard 340!

for statistical analysis. M.M.V. is recipient of studentships from NSERC. C.D. is a FRQ-S senior 341!

scholar and a member of the FRQ-S Respiratory Health Network. S.M. holds a Tier 1 Canada 342!

Research Chair in Bacteriophages. 343!

! 18!

344!

REFERENCES 345!

1. Roy CJ, Milton DK. 2004. Airborne transmission of communicable infection--the 346!

elusive pathway. N Engl J Med 350:1710-1712. 347!

2. Tang JW, Li Y, Eames I, Chan PK, Ridgway GL. 2006. Factors involved in the aerosol 348!

transmission of infection and control of ventilation in healthcare premises. J Hosp Infect 349!

64:100-114. 350!

3. Milton DK. 2012. What was the primary mode of smallpox transmission? Implications 351!

for biodefense. Front Cell Infect Microbiol 2:150. 352!

4. Turgeon N, McNicoll F, Toulouse M-J, Liav A, Barbeau J, Ho J, Grund C, Duchaine 353!

C. 2011. Neuraminidase activity as a potential enzymatic marker for rapid detection of 354!

airborne viruses. Aerosol Sci Tech 45:183-195. 355!

5. Turgeon N, Toulouse MJ, Martel B, Moineau S, Duchaine C. 2014. Comparison of 356!

five bacteriophages as models for viral aerosol studies. Appl Environ Microbiol 80:4242-357!

4250. 358!

6. La Rosa G, Fratini M, Della Libera S, Iaconelli M, Muscillo M. 2013. Viral infections 359!

acquired indoors through airborne, droplet or contact transmission. Ann Ist Super Sanita 360!

49:124-132. 361!

7. Phillpotts RJ, Thomas RJ, Beedham RJ, Platt SD, Vale CA. 2010. The Cystovirus 362!

phi6 as a simulant for Venezuelan equine encephalitis virus. Aerobiologia 26:301-309. 363!

8. Trouwborst T, Kuyper S. 1974. Inactivation of bacteriophage T3 in aerosols: effect of 364!

prehumidification on survival after spraying from solutions of salt, peptone, and saliva. 365!

Appl Microbiol 27:834-837. 366!

! 19!

9. Verreault D, Rousseau GM, Gendron L, Masse D, Moineau S, Duchaine C. 2010. 367!

Comparison of polycarbonate and polytetrafluoroethylene filters for sampling of airborne 368!

bacteriophages. Aerosol Sci Tech 44:197-201. 369!

10. Gendron L, Verreault D, Veillette M, Moineau S, Duchaine C. 2010. Evaluation of 370!

filters for the sampling and quantification of RNA phage aerosols. Aerosol Sci Tech 371!

44:893-901. 372!

11. Verreault D, Moineau S, Duchaine C. 2008. Methods for sampling of airborne viruses. 373!

Microbiol Mol Biol Rev 72:413-444. 374!

12. Gardner PD, Eshbaugh JP, Harpest SD, Richardson AW, Hofacre KC. 2013. Viable 375!

viral efficiency of N95 and P100 respirator filters at constant and cyclic flow. J Occup 376!

Environ Hyg 10:564-572. 377!

13. Hoe S, Semler DD, Goudie AD, Lynch KH, Matinkhoo S, Finlay WH, Dennis JJ, 378!

Vehring R. 2013. Respirable bacteriophages for the treatment of bacterial lung infections. 379!

J Aerosol Med Pulm Drug Deliv 26:317-335. 380!

14. O'Connell KP, Bucher JR, Anderson PE, Cao CJ, Khan AS, Gostomski MV, Valdes 381!

JJ. 2006. Real-time fluorogenic reverse transcription-PCR assays for detection of 382!

bacteriophage MS2. Appl Environ Microbiol 72:478-483. 383!

15. Ackermann HW, Prangishvili D. 2012. Prokaryote viruses studied by electron 384!

microscopy. Arch Virol 157:1843-1849. 385!

16. Lute S, Aranha H, Tremblay D, Liang D, Ackermann HW, Chu B, Moineau S, 386!

Brorson K. 2004. Characterization of coliphage PR772 and evaluation of its use for virus 387!

filter performance testing. Appl Environ Microbiol 70:4864-4871. 388!

! 20!

17. Verreault D, Duchaine C, Marcoux-Voiselle M, Turgeon N, Roy CJ. 2014. Design of 389!

an environmentally controlled rotating chamber for bioaerosol aging studies. Inhal 390!

Toxicol 26:554-558. 391!

18. Panec M, Katz SD. 2010. Plaque assay protocol. In Protocols. American Society for 392!

Microbiology, Washington, DC. http://www.microbelibrary.org Accessed 7 October 2011 393!

19. Zuo ZL, Kuehn TH, Verma H, Kumar S, Goyal SM, Appert J, Raynor PC, Ge S, Pui 394!

DYH. 2013. Association of airborne virus infectivity and survivability with its carrier 395!

particle size. Aerosol Sci Tech 47:373-382. 396!

20. Zuo Z, Kuehn TH, Bekele AZ, Mor SK, Verma H, Goyal SM, Raynor PC, Pui DY. 397!

2014. Survival of airborne MS2 bacteriophage generated from human saliva, artificial 398!

saliva, and cell culture medium. Appl Environ Microbiol 80:2796-2803. 399!

21. Hijnen WAM, Beerendonk EF, Medema GJ. 2006. Inactivation credit of UV radiation 400!

for viruses, bacteria and protozoan (oo)cysts in water: A review. Water Res 40:3-22. 401!

22. Ko G, Cromeans TL, Sobsey MD. 2005. UV inactivation of adenovirus type 41 402!

measured by cell culture mRNA RT-PCR. Water Res 39:3643-3649. 403!

23. Pyankov OV, Pyankova OG, Agranovski IE. 2012. Inactivation of airborne influenza 404!

virus in the ambient air. J Aerosol Sci 53:21-28. 405!

406!

407!

! 21!

TABLE 1 Description of the tail-less phages used in this study. 408!

Phage MS2 Φ6 PR772 ΦX174 Phage family Leviviridae Cystoviridae Tectiviridae Microviridae

Enveloped No Yes No No

Genome ssRNA Linear 3569 nt

dsRNA Linear,

segmented 13385 bp

dsDNA Linear

14492 bp

ssDNA Circular 5386 nt

Bacterial host E. coli P. syringae E. coli E. coli Incubation temperature 37°C 25°C 37°C 37°C

!409!

! !410!

! 22!

TABLE 2 Primers and probes used for qPCR and qRT-PCR. 411!Phage Sequence Reference

MS2 For: 5’- GTCCATACCTTAGATGCGTTAGC -3’ (10) Rev: 5’- CCGTTAGCGAAGTTGCTTGG -3’ Probe: 5’- /FAM/ACGTCGCCAGTTCCGCCATTGTCG/BHQ_1 -3’

Φ6 For : 5’- TGGCGGCGGTCAAGAGC -3’ (10) Rev: 5’- GGATGATTCTCCAGAAGCTGCTG -3’ Probe: 5’- /HEX/CGGTCGTCGCAGGTCTGACACTCGC/BHQ -3’

PR772 For: 5’- CCTGAATCCGCCTATTATGTTGC -3’ (5) Rev: 5’- TTTTAACGCATCGCCAATTTCAC -3’ Probe: 5’-/FAM/CGCATACCAGCCAGCACCATTACGCA/IABlk_FQ -3’

ΦX174 For: 5’- ACAAAGTTTGGATTGCTACTGACC-3’ (9) Rev: 5’- CGGCAGCAATAAACTCAACAGG -3’ Probe: 5’- /FAM/CTCTCGTGCTCGTCGCTGCGTTGA/BHQ_1 -3’

For, forward; Rev, reverse. 412!

! !413!

! 23!

TABLE 3 Behaviour of the aerosolized phages under the various 414!environmental conditions used. 415!Phage 18°C 30°C 20% RH 50% RH 80% RH UV MS2 + - + + + +++

Φ6 - ND + ND - ++

PR772 - - ND - - ++

ΦX174 + - - - +

+

+: resistant; -: sensitive; ND: not detected.!416! 417!

418!

! 24!

419!

FIG 1 Effects of relative humidity and time of aerosol suspension on phage infectivity. 420!Experiments were conducted at 18°C with various RH (! 20%, " 50%, ! 80%). The infectious 421!ratios after 6h and 14h exposure were compared to the infectious ratio at 0h to calculate the 422!relative infectious ratio. The dotted line indicates the reference value at time 0. * indicates a 423!significant difference with the reference value (p

! 25!

430!

FIG 2 Effects of temperature and time of aerosol suspension on phage infectivity. Experiments 431!were conducted at 80% RH under two temperatures (! 18°C and " 30°C). The infectious ratios 432!after 6h and 14h exposure were compared to the infectious ratio at 0h exposure to calculate the 433!relative infectious ratio. The dotted line indicates the reference value at time 0. * indicates 434!significant difference with the reference value at time 0 (p

! 26!

442!

FIG 3 Effect of UV exposure on infectivity of aerosolized phages. Experiments were conducted 443!at 18 °C and 20% RH. The infectious ratios at 3 sec, 6 sec and 10 sec exposure were compared to 444!the infectious ratio at 0 sec exposure to calculate the relative infectious ratio. The dotted line 445!indicates the reference value at time 0. a, b, and c indicate significant differences between phage 446!resistance to UV (p